BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ"

Transcript

1 BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ

2 ΜΕΡΟΣ ΠΡΩΤΟ - ΠΕΡΙΓΡΑΜΜΑ 5.1 ΈΝΑ ΝΟΥΚΛΕΙΝΙΚΟ ΟΞΥ ΑΠΟΤΕΛΕΙΤΑΙ ΑΠΌ ΤΕΣΣΕΡΑ ΕΙΔΗ ΒΑΣΕΩΝ, ΠΟΥ ΠΡΟΣΔΕΝΟΝΤΑΙ ΣΕ ΈΝΑ ΚΟΡΜΟ ΣΑΚΧΑΡΩΝ ΦΩΣΦΟΡΙΚΩΝ 5.2 ΈΝΑ ΖΕΥΓΟΣ ΑΛΥΣΙΔΩΝ ΝΟΥΚΛΕΙΝΙΚΟΥ ΟΞΕΩΣ ΜΕ ΣΥΜΠΛΗΡΩΜΑΤΙΚΕΣ ΑΛΛΗΛΟΥΧΙΕΣ ΜΠΟΡΕΙ ΝΑ ΣΧΗΜΑΤΙΣΕΙ ΔΟΜΗ ΔΙΠΛΗ ΕΛΙΚΑΣ 5.3 ΤΟ DNA ΑΝΤΙΓΡΑΦΕΤΑΙ ΑΠΌ ΠΟΛΥΜΕΡΑΣΕΣ ΠΟΥ ΚΑΘΟΔΗΓΟΥΝΤΑΙ ΑΠΌ ΕΚΜΑΓΕΙΑ

3 BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ 5.1 ΈΝΑ ΝΟΥΚΛΕΙΝΙΚΟ ΟΞΥ ΑΠΟΤΕΛΕΙΤΑΙ ΑΠΌ ΤΕΣΣΕΡΑ ΕΙΔΗ ΒΑΣΕΩΝ, ΠΟΥ ΠΡΟΣΔΕΝΟΝΤΑΙ ΣΕ ΈΝΑ ΚΟΡΜΟ ΣΑΚΧΑΡΩΝ ΦΩΣΦΟΡΙΚΩΝ ΤΑ ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ ΕΊΝΑΙ ΓΡΑΜΜΙΚΑ ΠΟΛΥΜΕΡΗ

4 ΔΟΜΗ ΚΑΙ ΟΝΟΜΑΤΟΛΟΓΙΑ ΣΑΚΧΑΡΩΝ

5 BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ

6 BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΔΟΜΗ ΚΑΙ ΟΝΟΜΑΤΟΛΟΓΙΑ ΒΑΣΕΩΝ

7 BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΝΟΥΚΛΕΟΖΙΤΗΣ= ΜΙΑ ΒΑΣΗ ΔΕΣΜΕΥΜΕΝΗ ΣΕ ΈΝΑ ΣΑΚΧΑΡΟ ΔΟΜΗ ΤΗΣ ΑΔΕΝΟΣΙΝΗΣ

8 BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΝΟΥΚΛΕΟΤΙΔΙΟ = ΦΩΣΦΟΡΙΚΟΣ ΕΣΤΕΡΑΣ ΤΟΥ ΝΟΥΚΛΕΟΖΙΤΗ Πχ ΑΤΡ = 5 ΤΡΙΦΩΣΦΟΡΙΚΗ ΑΔΕΝΟΣΙΝΗ

9 Ο ΚΟΡΜΟΣ ΤΟΥ ΓΡΑΜΜΙΚΟΥ ΠΟΛΥΜΕΡΟΥΣ ΤΩΝ ΝΟΥΚΛΕΙΝΙΚΩΝ ΟΞΕΩΝ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ

10 BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ Η ΑΛΥΣΙΔΑ ΤΟΥ DNA ΕΧΕΙ ΠΟΛΙΚΟΤΗΤΑ

11 ΣΥΜΒΑΣΗ ΓΡΑΦΗΣ ΑΛΛΗΛΟΥΧΙΩΝ DNA: ΚΑΤΕΥΘΥΝΣΗ ΑΠΌ ΤΟ 5 ΑΚΡΟ ΣΤΟ 3 ΑΚΡΟ, πχ. ACG

12 BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ TO DNA ΕΝΌΣ ΑΠΛΟΥ ΙΟΥ ΕΧΕΙ ΜΗΚΟΣ 5100 ΝΟΥΚΛΕΟΤΙΔΙΑ ΤΟ ΑΝΘΡΩΠΙΝΟ: 3 ΔΙΣΕΚΑΤΟΜΜΥΡΙΑ

13 ΗΔΟΜΗΤΟΥDΝΑ 5.2 ΈΝΑ ΖΕΥΓΟΣ ΑΛΥΣΙΔΩΝ ΝΟΥΚΛΕΙΝΙΚΟΥ ΟΞΕΩΣ ΜΕ ΣΥΜΠΛΗΡΩΜΑΤΙΚΕΣ ΑΛΛΗΛΟΥΧΙΕΣ ΜΠΟΡΕΙ ΝΑ ΣΧΗΜΑΤΙΣΕΙ ΔΟΜΗ ΔΙΠΛΗ ΕΛΙΚΑΣ

14 BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΗΔΟΜΗΤΟΥDΝΑ

15 ΠΕΡΙΘΛΑΣΗ ΑΚΤΙΝΩΝ Χ ΣΕ ΚΡΥΣΤΑΛΛΟΥΣ

16 TO DΝΑ EINAI ΙΝΩΔΕΣ ΜΟΡΙΟ DNA fibre drawn between two glass rods

17 ΠΑΡΑΔΕΙΓΜΑΤΑ ΙΝΩΔΩΝ ΜΟΡΙΩΝ TMV Amyloid fibres DNA Pf1 DNA-protein complex

18 ΠΕΡΙΘΛΑΣΗ ΑΚΤΙΝΩΝ Χ ΣΕ ΙΝΕΣ

19 ΠΕΡΙΘΛΑΣΗ ΑΚΤΙΝΩΝ Χ ΣΕ ΙΝΩΔΗ ΜΟΡΙΑ Fibres contains polymer molecules with their long axes mostly parallel to the axis of the fibre. Fibre axis Crystalline fibre -the polymer molecules form small crystallites that have one axis aligned along the fibre axis. These crystallites have no preferred orientation about the fibre axis and the diffraction pattern is rather like that from a single crystal that has been rotated by 360º about one of its principal axes during the exposure. Crystalline data are therefore averaged in a way that depends on the crystal symmetry. The diffraction pattern has sharp spots throughout. Non crystalline fibre - the polymer molecules are not packed into crystallites. They are still largely parallel to each other, although they have random orientation. There is therefore no crystalline sampling. The diffraction pattern exhibits continuous diffraction instead of the sharp reflections seen in the crystalline case Crystalline fibre

20 ΠΕΡΙΘΛΑΣΗ ΑΚΤΙΝΩΝ Χ ΣΕ ΙΝΩΔΗ ΜΟΡΙΑ

21 Crystalline and non-crystalline fibre diffraction patterns Non crystalline B-DNA Crystalline B-DNA

22 A simple representation of a double helix

23 A simple representation of a double helix

24 A simple representation of a double helix

25 The DNA Double Helix

26

27 BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ

28 BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ

29 BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ

30

31 ΤΑ ΚΥΡΙΑ ΣΤΟΙΧΕΙΑ ΤΗΣ ΔΟΜΗΣ ΤΟΥ DΝΑ ΔΥΟ ΕΛΙΚΟΕΙΔΕΙΣ ΠΟΛΥΝΟΥΚΛΕΟΤΙΔΙΚΕΣ ΑΛΥΣΙΔΕΣ ΜΕ ΑΝΤΙΘΕΤΕΣ ΚΑΤΕΥΘΥΝΣΕΙΣ ΠΕΡΙΣΤΡΕΦΟΝΤΑΙ ΓΥΡΩ ΑΠΌ ΈΝΑΝ ΚΟΙΝΟ ΑΞΟΝΑ ΚΟΡΜΟΣ: ΦΩΣΦΟΡΙΚΑ ΔΕΟΧΥΡΙΒΟΖΕΣ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΗΣ ΕΛΙΚΑΣ. ΒΑΣΕΙΣ ΠΟΥΡΙΝΗΣ-ΠΥΡΙΜΙΔΙΝΗΣ ΣΤΟ ΕΣΩΤΕΡΙΚΟ ΒΑΣΕΙΣ ΣΧΕΔΟΝ ΚΑΘΕΤΕΣ ΣΤΟΝ ΑΞΟΝΑ ΤΗΣ ΕΛΙΚΑΣ ΑΠΕΧΟΥΝ ΜΕΤΑΞΥ ΤΟΥΣ 3,4 Å. ΒΗΜΑ ΤΗΣ ΕΛΙΚΑΣ: 34 Å (10 ΒΑΣΕΙΣ /360 ΜΟΙΡΕΣ) ΣΤΡΟΦΗ 36 ΜΟΙΡΕΣ / ΒΑΣΗ. ΔΙΑΜΕΤΡΟΣ ΤΗΣ ΕΛΙΚΑΣ: 20 Å

32 ΜΗΧΑΝΙΣΜΟΣ ΜΕΤΑΦΟΡΑΣ ΤΗΣ ΠΛΗΡΟΦΟΡΙΑΣ ΑΠΌ ΤΗΝ ΔΙΠΛΗ ΕΛΙΚΑ ΠΕΙΡΑΜΑ MESELSON-STAHL

33 BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ

34 BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ

35 BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ H ΜΕΤΑΦΟΡΑ ΤΗΣ ΠΛΗΡΟΦΟΡΙΑΣ ΑΠΌ ΤΗΝ ΔΙΠΛΗ ΕΛΙΚΑ EINAI HMIΣYNTHΡHTIKH

36 BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ Η ΔΙΠΛΗ ΕΛΙΚΑ ΤΟΥ DNA ΜΠΟΡΕΙ ΝΑ ΤΗΧΘΕΙ ΑΝΤΙΣΤΡΕΠΤΑ: ΣΗΜΑΝΤΙΚΩΤΑΤΟ ΣΤΟΙΧΕΙΟ ΤΗΣ ΒΙΟΛΟΓΙΚΗΣ ΛΕΙΤΟΥΡΓΙΑΣ ΤΟΥ

37 ΜΕΡΙΚΑ ΜΟΡΙΑ DNA ΕΙΝΑΙ ΚΥΚΛΙΚΑ ΚΑΙ ΥΠΕΡΕΛΙΚΩΜΕΝΑ

38 ΜΟΝΟΚΛΩΝΑ ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ ΜΠΟΡΟΥΝ ΝΑ ΠΑΡΟΥΝ ΠΟΛΥΠΛΟΚΕΣ ΤΡΙΣΔΙΑΣΤΑΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΔΟΜΕΣ ΣΤΕΛΕΧΟΥΣ-ΘΗΛΙΑΣ

39 ΜΟΝΟΚΛΩΝΑ ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ ΜΠΟΡΟΥΝ ΝΑ ΠΑΡΟΥΝ ΠΟΛΥΠΛΟΚΕΣ ΤΡΙΣΔΙΑΣΤΑΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ

40 ΜΟΝΟΚΛΩΝΑ ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ ΜΠΟΡΟΥΝ ΝΑ ΠΑΡΟΥΝ ΠΟΛΥΠΛΟΚΕΣ ΤΡΙΣΔΙΑΣΤΑΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ

41 ΤΟ DNA ΑΝΤΙΓΡΑΦΕΤΑΙ ΑΠΌ ΠΟΛΥΜΕΡΑΣΕΣ ΠΟΥ ΚΑΘΟΔΗΓΟΥΝΤΑΙ ΑΠΌ ΕΚΜΑΓΕΙΑ ΑΠΑΡΑΙΤΗΤΑ ΣΥΣΤΑΤΙΚΑ / ΠΡΟΥΠΟΘΕΣΕΙΣ: 1) ΕΚΜΑΓΕΙΟ

42 ΤΟ DNA ΑΝΤΙΓΡΑΦΕΤΑΙ ΑΠΌ ΠΟΛΥΜΕΡΑΣΕΣ ΠΟΥ ΚΑΘΟΔΗΓΟΥΝΤΑΙ ΑΠΌ ΕΚΜΑΓΕΙΑ ΑΠΑΡΑΙΤΗΤΑ ΣΥΣΤΑΤΙΚΑ / ΠΡΟΥΠΟΘΕΣΕΙΣ: 2) ΕΚΚΙΝΗΤΗΣ ΜΕ ΕΛΕΥΘΕΡΟ 3 ΑΚΡΟ

43 ΤΟ DNA ΑΝΤΙΓΡΑΦΕΤΑΙ ΑΠΌ ΠΟΛΥΜΕΡΑΣΕΣ ΠΟΥ ΚΑΘΟΔΗΓΟΥΝΤΑΙ ΑΠΌ ΕΚΜΑΓΕΙΑ ΑΠΑΡΑΙΤΗΤΑ ΣΥΣΤΑΤΙΚΑ / ΠΡΟΥΠΟΘΕΣΕΙΣ: 3) ΠΟΛΥΜΕΡΑΣΗ

44 ΤΟ DNA ΑΝΤΙΓΡΑΦΕΤΑΙ ΑΠΌ ΠΟΛΥΜΕΡΑΣΕΣ ΠΟΥ ΚΑΘΟΔΗΓΟΥΝΤΑΙ ΑΠΌ ΕΚΜΑΓΕΙΑ ΑΠΑΡΑΙΤΗΤΑ ΣΥΣΤΑΤΙΚΑ / ΠΡΟΥΠΟΘΕΣΕΙΣ: 3) ΠΡΟΔΡΟΜΑ ΜΟΡΙΑ (datp, dgtp, dttp, dctp) και ιοντα μαγνησίου

45 ΑΝΤΙΓΡΑΦΗ ΤΟΥ DNA

46 ΤΑ ΓΟΝΙΔIA ΜΕΡΙΚΩΝ ΙΩΝ ΑΠΟΤΕΛΟΥΝΤΑΙ ΑΠΌ RNA: ΔΡΑΣΗ ΤΗΣ ΑΝΤΙΣΤΡΟΦΗΣ ΜΕΤΑΓΡΑΦΑΣΗΣ

47 ΦΑΡΜΑΚΟ ΚΑΤΆ ΤΟΥ ΙΟΥ ΤΟΥ ΕΡΠΗΤΑ (Gertrude Ellion, Nobel Prize in Medicine 1988) ΠΟΙΟΣ ΕΊΝΑΙ Ο ΜΗΧΑΝΙΣΜΟΣ ΔΡΑΣΗΣ ΤΟΥ? ΔΕΟΞΥΓΟΥΑΝΟΣΙΝΗ (ΔΕΟΞΥΡΙΒΟΖΗ + ΓΟΥΑΝΙΝΗ) ACYCLOVIR (ZOVIRAX)

48 ΦΑΡΜΑΚΟ ΚΑΤΆ ΤΟΥ ΙΟΥ ΤΟΥ ΕΡΠΗΤΑ (Gertrude Ellion, Nobel Prize in Medicine 1988) ΠΟΙΟΣ ΕΊΝΑΙ Ο ΜΗΧΑΝΙΣΜΟΣ ΔΡΑΣΗΣ ΤΟΥ?

49 ΦΑΡΜΑΚΟ ΚΑΤΆ ΤΟΥ ΙΟΥ ΤΟΥ ΕΡΠΗΤΑ (Gertrude Ellion, Nobel Prize in Medicine 1988) ΔΕΟΞΥΓΟΥΑΝΟΣΙΝΗ (ΔΕΟΞΥΡΙΒΟΖΗ + ΓΟΥΑΝΙΝΗ) ACYCLOVIR (ZOVIRAX)

1.Μαθησιακοί στόχοι του μαθήματος

1.Μαθησιακοί στόχοι του μαθήματος BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ 1.Μαθησιακοί στόχοι του μαθήματος της ΒΙΟΧΗΜΕΙΑΣ (ΕΤΥ-232) 1)εξοικείωση των φοιτητών με τον μοριακό σχεδιασμό της ζωής 2)εμπέδωση της δομής και λειτουργίας

Διαβάστε περισσότερα

Οργανική Χηµεία. Κεφάλαιο 29: Βιοµόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα

Οργανική Χηµεία. Κεφάλαιο 29: Βιοµόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα Οργανική Χηµεία Κεφάλαιο 29: Βιοµόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα 1. Γενικά-ιδιότητες Κυκλικές οργανικές ενώσεις: καρβοκυκλικές (δακτύλιος περιέχει µόνο άτοµα C) και ετεροκυκλικές (δακτύλιος

Διαβάστε περισσότερα

Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι:

Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι: 1 ΑΣΚΗΣΕΙΣ ΝΟΥΚΛΕΙΚΩΝ ΟΞΕΩΝ ΑΣΚΗΣΗ 1 Ποια είναι η δομή των νουκλεοτιδίων; Τα νουκλεοτίδια προέρχονται από τη σύνδεση με ομοιοπολικό δεσμό, τριών διαφορετικών μορίων. Μιας πεντόζης (σάκχαρο με πέντε άτομα

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα

Οργανική Χημεία. Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα Οργανική Χημεία Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα 1. Γενικά-ιδιότητες Κυκλικές οργανικές ενώσεις: καρβοκυκλικές (δακτύλιος περιέχει μόνο άτομα C) και ετεροκυκλικές (δακτύλιος

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής ΚΕΑΛΑΙΟ 5 ιατήρηση και συνέχεια της ζωής 5.2 H ροή της γενετικής πληροφορίας 3 Πώς βρέθηκε η δομή του DNA στο χώρο; Η ανακάλυψη της δομής του DNA πραγματοποιήθηκε το 1953 από τους Watson και Crick. Από

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα

Το κεντρικό δόγμα (The central dogma)

Το κεντρικό δόγμα (The central dogma) Οι βασικές μοριακές γενετικές διαδικασίες Αντιγραφή Μεταγραφή Μετάφραση ΠΡΩΤΕΪΝΗ Το κεντρικό δόγμα (The central dogma) Σύσταση νουκλεοτιδίων του DNA και του RNA Α 5 -άκρο Θυμίνη (Θ) Β 5 άκρο Αδενίνη (Α)

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΚΕΦΑΛΑΙΟ 8: ΕΝΖΥΜΑ: ΒΑΣΙΚΕΣ ΑΡΧΕΣ ΚΑΙ ΚΙΝΗΤΙΚΗ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΚΕΦΑΛΑΙΟ 8: ΕΝΖΥΜΑ: ΒΑΣΙΚΕΣ ΑΡΧΕΣ ΚΑΙ ΚΙΝΗΤΙΚΗ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΚΕΦΑΛΑΙΟ 8: ΕΝΖΥΜΑ: ΒΑΣΙΚΕΣ ΑΡΧΕΣ ΚΑΙ ΚΙΝΗΤΙΚΗ Η ΕΝΝΟΙΑ ΤΗΣ ΚΑΤΑΛΥΣΗΣ ΣΤΗΝ ΧΗΜΕΙΑ ΚΑΙ ΤΗΝ ΒΙΟΛΟΓΙΑ Παράδειγμα: η αναγωγή του αζώτου σε αμμωνία Ν 2 + 3Η

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 2. Δομή νουκλεϊκών οξέων ΝΟΥΚΛΕΪΚΑ ΟΞΕΑ ΣΥΣΤΑΣΗ ΟΡΓΑΝΙΣΜΩΝ ΣΕ ΟΡΓΑΝΙΚΕΣ ΕΝΩΣΕΙΣ ΜΙΚΡΟΜΟΡΙΑ ΜΑΚΡΟΜΟΡΙΑ 1. Αμινοξέα πρωτεϊνες

Διαβάστε περισσότερα

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Chain Reaction (pcr)- Αλυσιδωτή αντίδραση πολυμεράσης.η

Διαβάστε περισσότερα

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ Τα προβλήματα αυτού του κεφαλαίου αναφέρονται στον υπολογισμό : 1. νουκλεοτιδίων ή αζωτούχων βάσεων ή πεντοζών ή φωσφορικών ομάδων 2. φωσφοδιεστερικών δεσμών ή μορίων

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Θέματα 1. Ποια είναι η δομή και τα βασικά χαρακτηριστικά των λιπαρών οξέων 2. Πώς απομακρύνονται

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ

ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Γιώργος Τσιάµης Επίκουρος Καθηγητής Περιβαλλοντικής Μικροβιολογίας Η Περιβαλλοντική Μικροβιολογία επηρεάζει σε µεγάλο βαθµό τις περιβαλλοντικές επιστήµες γιατί συµβάλλει στην!

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

ΚΥΠΡΙΑΚΗ ΕΤΑΙΡΕΙΑ ΠΛΗΡΟΦΟΡΙΚΗΣ CYPRUS COMPUTER SOCIETY ΠΑΓΚΥΠΡΙΟΣ ΜΑΘΗΤΙΚΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ 19/5/2007

ΚΥΠΡΙΑΚΗ ΕΤΑΙΡΕΙΑ ΠΛΗΡΟΦΟΡΙΚΗΣ CYPRUS COMPUTER SOCIETY ΠΑΓΚΥΠΡΙΟΣ ΜΑΘΗΤΙΚΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ 19/5/2007 Οδηγίες: Να απαντηθούν όλες οι ερωτήσεις. Αν κάπου κάνετε κάποιες υποθέσεις να αναφερθούν στη σχετική ερώτηση. Όλα τα αρχεία που αναφέρονται στα προβλήματα βρίσκονται στον ίδιο φάκελο με το εκτελέσιμο

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ

Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΝΟΥΚΛΕΪΝΙΚΑ ΟΞΕΑ Είναι τα βιοπολυμερή που η δομική τους μονάδα είναι τα νουκλεοτίδια Διακρίνονται στο DNA (δεσοξυριβονουκλεϊκό οξύ), στο RNA (ριβονουκλεϊκό

Διαβάστε περισσότερα

Κεφάλαιο 28 ΣΥΝΘΕΣΗ ΚΑΙ ΜΑΤΙΣΜΑ ΤΟΥ RNA

Κεφάλαιο 28 ΣΥΝΘΕΣΗ ΚΑΙ ΜΑΤΙΣΜΑ ΤΟΥ RNA Κεφάλαιο 28 ΣΥΝΘΕΣΗ ΚΑΙ ΜΑΤΙΣΜΑ ΤΟΥ RNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ) Η διαδικασία της μεταγραφής απαιτεί τη δράση του

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ... 8 ΠΡΟΒΛΗΜΑΤΑ...

ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ... 8 ΠΡΟΒΛΗΜΑΤΑ... ΚΕΦΑΛΑΙΟ 1 ο ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ.... 8 ΠΡΟΒΛΗΜΑΤΑ... 9 ΙΑΓΩΝΙΣΜΑ...12 ΚΕΦΑΛΑΙΟ 1 ο I. Το γενετικό

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημικά στοιχεία που συνθέτουν τους οργανισμούς Ο C, το H 2, το O 2 και το N 2 είναι τα επικρατέστερα στους οργανισμούς σε ποσοστό 96% κ.β. Γιατί; Συμμετέχουν σε σημαντικό βαθμό στη σύνθεση

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i..

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i.. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ «XHMIKH ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ» ΕΙΣΑΓΩΓΗ ΚΑΙ Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Όταν αναφερόμαστε στον όρο «Χημική Σύσταση του Κυττάρου», τί νομίζετε ότι

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΕ ANIMATIONS ΚΑΙ ΣΧΕΔΙΑΓΡΑΜΜΑΤΑ Παν. Πάλλα - ΕΚΦΕ Ν. ΣΜΥΡΝΗΣ 1 ΜΙΑ ΕΙΚΟΝΑ ΧΙΛΙΕΣ ΛΕΞΕΙΣ Η παρουσίαση ακολουθεί τη σειρά των περιεχομένων του βιβλίου Βιολογίας

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΣΥΓΓΡΑΦΗ): ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (Θα περιέχει ερωτήσεις θεωρίας µε απαντήσεις, ασκήσεις ανοικτούκλειστού τύπου µε

Διαβάστε περισσότερα

Δημοσιεύτηκε στο Science in School (http://www.scienceinschool.org)

Δημοσιεύτηκε στο Science in School (http://www.scienceinschool.org) Δημοσιεύτηκε στο Science in School (http://www.scienceinschool.org) Αναπαριστώντας τον διπλό έλικα του DNA με τη χρήση ανακυκλωμένων υλικών Ο Διονύσιος Καρούνιας, η Ευανθία Παπανικολάου και ο Αθανάσιος

Διαβάστε περισσότερα

ΔΟΜΗ ΚΑΙ ΑΝΑΛΥΣΗ ΒΙΟΜΟΡΙΩΝ

ΔΟΜΗ ΚΑΙ ΑΝΑΛΥΣΗ ΒΙΟΜΟΡΙΩΝ ΔΟΜΗ ΚΑΙ ΑΝΑΛΥΣΗ ΒΙΟΜΟΡΙΩΝ Διδάσκοντες: Δ.Δ. Λεωνίδας, Α.-Μ. Ψαρρά Κωδικός e-class: SEYC194 28/9/2015 Δ.Δ. Λεωνίδας 28/9/2015 Δ.Δ. Λεωνίδας Βιοχημεία είναι η Χημεία που εμφανίζεται μέσα στους ζώντες οργανισμούς

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

Γενική Μικροβιολογία. Ενότητα 12 η ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΙΟΛΟΓΙΑ

Γενική Μικροβιολογία. Ενότητα 12 η ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΙΟΛΟΓΙΑ Γενική Μικροβιολογία Ενότητα 12 η ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΙΟΛΟΓΙΑ Όνομα καθηγητή: Δ. ΓΕΩΡΓΑΚΟΠΟΥΛΟΣ Όνομα καθηγητή: Γ. ΖΕΡΒΑΚΗΣ Όνομα καθηγητή: ΑΝ. ΤΑΜΠΑΚΑΚΗ Τμήμα: ΕΠΙΣΤΗΜΗΣ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΣΤΟΧΟΙ ΤΟΥ ΜΑΘΗΜΑΤΟΣ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα

Μεταβολισμός μικροοργανισμών

Μεταβολισμός μικροοργανισμών Μεταβολισμός μικροοργανισμών Ο μεταβολισμός είναι το σύνολο των βιοχημικών αντιδράσεων που πραγματοποιούνται στα κύτταρα των ζωντανών οργανισμών. Συνεπώς ο μεταβολισμός περιλαμβάνει όλες εκείνες τις βιοχημικές

Διαβάστε περισσότερα

Μεταγωγή σήματος και βιολογικές μεμβράνες

Μεταγωγή σήματος και βιολογικές μεμβράνες Μεταγωγή σήματος και βιολογικές μεμβράνες ΜΕΜΒΡΑΝΙΚΕΣ ΠΡΩΤΕΪΝΕΣ ΠΡΩΤΕΪΝΕΣ ΒΙΟΛΟΓΙΚΩΝ ΜΕΜΒΡΑΝΩΝ Ορισμός / Μονάδες Δομές (πρωτοταγής κλπ) Ταξινόμηση με βάση τις λειτουργίες Απεικόνιση - Μοντέλα (συρμάτων

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση:

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου Ενότητα 1.1: Χημεία της ζωής Ενότητα 2.1: Μακρομόρια Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: 1. Για ποιο λόγο θεωρείται αναγκαία η σταθερότητα

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 04/09/2016 ΘΕΜΑ Α Α.1. β. Α.2. β. Α.3. γ. Α.4. δ. ΑΠΑΝΤΗΣΕΙΣ Α.5. β. Μονάδες 25 ΘΕΜΑ Β Β. 1. Ιχνηθέτηση. είναι η σήμανση χημικών

Διαβάστε περισσότερα

M. Λέκκα 2011 ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ

M. Λέκκα 2011 ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ M. Λέκκα 2011 Οι βιολογικές μεμβράνες είναι φυσικά φράγματα που οριοθετούν την αρτιότητα των κυττάρων ως προς το περιβάλλον τους, (πλασματική μεμβράνη στους προκαρυωτικούς οργανισμούς),

Διαβάστε περισσότερα

Βιολογικές Μεμβράνες και Μεταγωγή Σήματος

Βιολογικές Μεμβράνες και Μεταγωγή Σήματος ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Βιολογικές Μεμβράνες και Μεταγωγή Σήματος Λιπίδια Διδάσκουσα: Καθ. Μαρία - Ελένη Ε. Λέκκα Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες

Διαβάστε περισσότερα

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή.

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή. 5ο ΓΕΛ ΧΑΛΑΝΔΡΙΟΥ Μ. ΚΡΥΣΤΑΛΛΙΑ 2/4/2014 Β 2 ΚΕΦΑΛΑΙΟ 3 ΒΙΟΛΟΓΙΑΣ 3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική

Διαβάστε περισσότερα

Νέα Οπτικά Μικροσκόπια

Νέα Οπτικά Μικροσκόπια Νέα Οπτικά Μικροσκόπια Αντίθεση εικόνας (contrast) Αντίθεση πλάτους Αντίθεση φάσης Αντίθεση εικόνας =100 x (Ι υποβ -Ι δειγμα )/ Ι υποβ Μικροσκοπία φθορισμού (Χρησιμοποιεί φθορίζουσες χρωστικές για το

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

ΒΙΟΤΕΧΝΟΛΟΓΙΑ 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΒΟΛΟΥ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ

ΒΙΟΤΕΧΝΟΛΟΓΙΑ 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΒΟΛΟΥ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 1ο ΒΙΟΤΕΧΝΟΛΟΓΙΑ 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΒΟΛΟΥ 2010-11 ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 1 ο : ΟΡΓΑΝΙΚΗ ΧΗΜΕΙΑ ΚΑΙ ΒΙΟΧΗΜΕΙΑ 1. Τι είναι η Βιοχημεία και με ποιες ενώσεις ασχολείται. 2. Πόσα και ποια στοιχεία

Διαβάστε περισσότερα

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων.

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Αθήνα, 27/05/2016 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

ΑΝΤΙΓΡΑΦΗ ΤΟΥ DNA ΣΤΟΥΣ ΕΥΚAΡΥΩΤΙΚΟΥΣ ΚΑΙ ΠΡΟΚΑΡΥΩΤΙ- ΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ

ΑΝΤΙΓΡΑΦΗ ΤΟΥ DNA ΣΤΟΥΣ ΕΥΚAΡΥΩΤΙΚΟΥΣ ΚΑΙ ΠΡΟΚΑΡΥΩΤΙ- ΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ Β ΤΡΙΜΗΝΟ ΚΟΝΤΟΓΙΑΝΝΗΣ ΔΗΜΗΤΡΗΣ ΑΝΤΙΓΡΑΦΗ ΤΟΥ DNA ΣΤΟΥΣ ΕΥΚAΡΥΩΤΙΚΟΥΣ ΚΑΙ ΠΡΟΚΑΡΥΩΤΙ- ΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ Γ2 Ιανουάριος 2015 ΕΙΣΑΓΩΓΗ Ο ι Watson και Crick, το 1953, διατύπωσαν το μοντέλο της διπλής έλικας

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

Η αλληλεπίδραση ανάμεσα στην καθημερινή γλώσσα και την επιστημονική ορολογία: παράδειγμα από το πεδίο της Κοσμολογίας

Η αλληλεπίδραση ανάμεσα στην καθημερινή γλώσσα και την επιστημονική ορολογία: παράδειγμα από το πεδίο της Κοσμολογίας Η αλληλεπίδραση ανάμεσα στην καθημερινή γλώσσα και την επιστημονική ορολογία: παράδειγμα από το πεδίο της Κοσμολογίας ΠΕΡΙΛΗΨΗ Αριστείδης Κοσιονίδης Η κατανόηση των εννοιών ενός επιστημονικού πεδίου απαιτεί

Διαβάστε περισσότερα

BΑΣΙΚΕΣ ΑΡΧΕΣ ΒΙΟΧΗΜΕΙΑΣ ΕΝΕΡΓΕΙΑ ΚΑΙ ΜΕΤΑΒΟΛΙΣΜΟΣ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ

BΑΣΙΚΕΣ ΑΡΧΕΣ ΒΙΟΧΗΜΕΙΑΣ ΕΝΕΡΓΕΙΑ ΚΑΙ ΜΕΤΑΒΟΛΙΣΜΟΣ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ BΑΣΙΚΕΣ ΑΡΧΕΣ ΒΙΟΧΗΜΕΙΑΣ ΕΝΕΡΓΕΙΑ ΚΑΙ ΜΕΤΑΒΟΛΙΣΜΟΣ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ 1. ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ 2. BΑΣΙΚΕΣ ΑΡΧΕΣ ΒΙΟΧΗΜΕΙΑΣ Ι. ΑΤΟΜΑ ΚΑΙ ΜΟΡΙΑ ΙΙ. ΧΗΜΙΚΟΙ ΔΕΣΜΟΙ ΙΙΙ. ΜΑΚΡΟΜΟΡΙΑ ΣΤΑ ΚΥΤΤΑΡΑ

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 Α1. 1. δ 2. α 3. δ 4. γ 5. γ Βιολογία ΘΕΜΑ A κατεύθυνσης Α2. Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 ΘΕΜΑ Β 1.

Διαβάστε περισσότερα

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA 1. Γιατί οι περιοριστικές ενδονουκλεάσες και οι φορείς κλωνοποίησης είναι απαραίτητα εργαλεία για τη Γενετική Μηχανική; Οι περιοριστικές ενδονουκλεάσες είναι

Διαβάστε περισσότερα

BIO111 Μικροβιολογια ιαλεξη 8 Κυτταρικη ιαιρεση

BIO111 Μικροβιολογια ιαλεξη 8 Κυτταρικη ιαιρεση BIO111 Μικροβιολογια ιαλεξη 8 Κυτταρικη ιαιρεση Τα χαρακτηριστικα της Ζωης Τα χαρακτηριστικα της Ζωης Περιεχοµενα 1. Πως κληρονοµείται η πληροφορία-aναδιπλασιασµός χρωµοσωµικού και πλασµιδιακού DNA. 2.

Διαβάστε περισσότερα

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΑΠΑΝΤΗΣΕΙΣ

Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΑΠΑΝΤΗΣΕΙΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 16/04/2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΟΚΤΩ (8) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Για τις ερωτήσεις

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ ΔIAΛEΞΗ 2 (22/2/2016) Χημικοί δεσμοί - Το νερό & ο ρόλος του. Τα μόρια του κυττάρου.

Kυτταρική Bιολογία ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ ΔIAΛEΞΗ 2 (22/2/2016) Χημικοί δεσμοί - Το νερό & ο ρόλος του. Τα μόρια του κυττάρου. Kυτταρική Bιολογία ΔIAΛEΞΗ 2 (22/2/2016) ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ Χημικοί δεσμοί - Το νερό & ο ρόλος του Τα μόρια του κυττάρου. Ενεργοποιημένα μόρια-φορείς ενέργειας AΣ ΘYMHΘOYME Tι είπαμε στην προηγούμενη

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα

Βιολογικές Μεμβράνες και Μεταγωγή Σήματος

Βιολογικές Μεμβράνες και Μεταγωγή Σήματος ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Βιολογικές Μεμβράνες και Μεταγωγή Σήματος Πρωτεΐνες Διδάσκουσα: Καθ. Μαρία - Ελένη Ε. Λέκκα Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΟΡΓΑΝΩΣΗ ΛΙΠΙΔΙΩΝ ΣΕ ΥΔΑΤΙΚΟ ΠΕΡΙΒΑΛΛΟΝ

ΟΡΓΑΝΩΣΗ ΛΙΠΙΔΙΩΝ ΣΕ ΥΔΑΤΙΚΟ ΠΕΡΙΒΑΛΛΟΝ ΟΡΓΑΝΩΣΗ ΛΙΠΙΔΙΩΝ ΣΕ ΥΔΑΤΙΚΟ ΠΕΡΙΒΑΛΛΟΝ ΜΟΝΤΕΛΑ ΜΕΜΒΡΑΝΙΚΩΝ ΣΥΣΤΗΜΑΤΩΝ 1. Μονοστιβάδες 2. Διπλοστιβάδες 3. Λιποσώματα 1.1 ΜΟΝΟΣΤΙΒΑΔΕΣ Σχηματίζονται από μη-πολικά μόρια στη μεσόφαση αέρα/νερού Συσκευή

Διαβάστε περισσότερα

09/04/ Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

09/04/ Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Η µελέτη της δοµής του DNA είναι άκρως απαραίτητη στην διαλεύκανση της λειτουργίας του (αντιγραφή- µεταγραφή) και του τρόπου της αλληλεπίδραση τους µε άλλα βιοµόρια, όπως πρωτείνες. 09/04/2014 1 Το DNA

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ 1. Τοποθετείστε στο διάγραμμα που ακολουθεί, τους όρους: σύνθεση, υδρόλυση, μακρομόριο, μονομερή. Ερμηνεύστε το διάγραμμα. Η -Q-

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ Η ΔΙΑΣΠΑΣΗ ΤΟΥ ΠΕΠΤΙΔΙΚΟΥ ΔΕΣΜΟΥ ΚΑΙ ΚΑΤΑΛΥΤΙΚΟΙ ΜΗΧΑΝΙΣΜΟΙ ΠΡΩΤΕΑΣΩΝ Η ΔΙΑΣΠΑΣΗ ΕΥΝΟΕΙΤΑΙ ΘΕΡΜΟΔΥΝΑΜΙΚΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

ΑΚΑ ΗΜΙΑ ΕΜΠΟΡΙΚΟΥ ΝΑΥΤΙΚΟΥ ΜΑΚΕ ΟΝΙΑΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ

ΑΚΑ ΗΜΙΑ ΕΜΠΟΡΙΚΟΥ ΝΑΥΤΙΚΟΥ ΜΑΚΕ ΟΝΙΑΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΑΚΑ ΗΜΙΑ ΕΜΠΟΡΙΚΟΥ ΝΑΥΤΙΚΟΥ ΜΑΚΕ ΟΝΙΑΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΘΕΜΑ :ΤΥΠΟΙ ΑΕΡΟΣΥΜΠΙΕΣΤΩΝ ΚΑΙ ΤΡΟΠΟΙ ΛΕΙΤΟΥΡΓΙΑΣ ΣΠΟΥ ΑΣΤΡΙΑ: ΕΥΘΥΜΙΑ ΟΥ ΣΩΣΑΝΝΑ ΕΠΙΒΛΕΠΩΝ ΚΑΘΗΓΗΤΗΣ : ΓΟΥΛΟΠΟΥΛΟΣ ΑΘΑΝΑΣΙΟΣ 1 ΑΚΑ

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

Κεφάλαιο 7 ΑΛΚΑΛΟΕΙΔΗ Τα αλκαλοειδή δεν αποτελούν μια ομογενή ομάδα ενώσεων, αποτέλεσμα να είναι ιδιαίτερα δύσκολος ο προσδιορισμός τους. με Ένας γενικότερος ορισμός των αλκαλοειδών αναφέρει ότι αυτά είναι

Διαβάστε περισσότερα

Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ

Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Τεχνικές Μοριακής Ενδοκρινολογίας. Ενότητα 3: Παιδιατρική Ενδοκρινολογία Βασιλική Ε. Γκρέκα-Σπηλιώτη Σχολή Επιστημών Υγείας Τμήμα Ιατρικής

Τεχνικές Μοριακής Ενδοκρινολογίας. Ενότητα 3: Παιδιατρική Ενδοκρινολογία Βασιλική Ε. Γκρέκα-Σπηλιώτη Σχολή Επιστημών Υγείας Τμήμα Ιατρικής Τεχνικές Μοριακής Ενδοκρινολογίας Ενότητα 3: Παιδιατρική Ενδοκρινολογία Βασιλική Ε. Γκρέκα-Σπηλιώτη Σχολή Επιστημών Υγείας Τμήμα Ιατρικής Σκοποί ενότητας Εισαγωγή σε μεταβολικά νοσήματα της Παιδιατρικής

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ ΔIAΛEΞΗ 2 (10/3/2014) Χημικοί δεσμοί - Το νερό & ο ρόλος του. Τα μόρια του κυττάρου.

Kυτταρική Bιολογία ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ ΔIAΛEΞΗ 2 (10/3/2014) Χημικοί δεσμοί - Το νερό & ο ρόλος του. Τα μόρια του κυττάρου. Kυτταρική Bιολογία ΔIAΛEΞΗ 2 (10/3/2014) ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ Χημικοί δεσμοί - Το νερό & ο ρόλος του Τα μόρια του κυττάρου. Ενεργοποιημένα μόρια- Φορείς ενέργειας AΣ ΘYMHΘOYME Tι είπαμε στην προηγούμενη

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια ΚΕΦΑΛΑΙΟ 4ο: Η τεχνολογία του ανασυνδυασµένου DNA έδωσε στον άνθρωπο την ικανότητα όχι µόνο να ερευνά αλλά και να τροποποιεί το γενετικό υλικό των οργανισµών ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA Η τεχνολογία

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1

ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΚΕΦΑΛΑΙΟ 1 Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΑΣΚΗΣΕΙΣ 1. Σε ένα δίκλωνο µόριο DNA ο λόγος Α / C είναι 1/ 4. Το μήκος του είναι 20.000 ζεύγη βάσεων. Ποια η εκατοστιαία σύσταση και ποιος ο αριθµός των νουκλεοτιδίων που

Διαβάστε περισσότερα

ΠΕΡΙΕΧΟΜΕΝΑ. Μάρκετινγκ Αθλητικών Τουριστικών Προορισμών 1

ΠΕΡΙΕΧΟΜΕΝΑ. Μάρκετινγκ Αθλητικών Τουριστικών Προορισμών 1 ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΙΓΑΙΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΤΗΣ ΔΙΟΙΚΗΣΗΣ ΤΜΗΜΑ ΔΙΟΙΚΗΣΗΣ ΕΠΙΧΕΙΡΗΣΕΩΝ ΔΙΑΤΜΗΜΑΤΙΚΟ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ «Σχεδιασμός, Διοίκηση και Πολιτική του Τουρισμού» ΜΑΡΚΕΤΙΝΓΚ ΑΘΛΗΤΙΚΩΝ ΤΟΥΡΙΣΤΙΚΩΝ

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 11 ΣΕΠΤΕΜΒΡΙΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ 19-21 -10681 210 3824614 210 3847670 www.irakleitos.gr ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 1 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

EE512: Error Control Coding

EE512: Error Control Coding EE512: Error Control Coding Solution for Assignment on Finite Fields February 16, 2007 1. (a) Addition and Multiplication tables for GF (5) and GF (7) are shown in Tables 1 and 2. + 0 1 2 3 4 0 0 1 2 3

Διαβάστε περισσότερα

Second Order Partial Differential Equations

Second Order Partial Differential Equations Chapter 7 Second Order Partial Differential Equations 7.1 Introduction A second order linear PDE in two independent variables (x, y Ω can be written as A(x, y u x + B(x, y u xy + C(x, y u u u + D(x, y

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΕΙΡΑΙΑ ΤΜΗΜΑ ΝΑΥΤΙΛΙΑΚΩΝ ΣΠΟΥΔΩΝ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΗΝ ΝΑΥΤΙΛΙΑ

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΕΙΡΑΙΑ ΤΜΗΜΑ ΝΑΥΤΙΛΙΑΚΩΝ ΣΠΟΥΔΩΝ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΗΝ ΝΑΥΤΙΛΙΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΕΙΡΑΙΑ ΤΜΗΜΑ ΝΑΥΤΙΛΙΑΚΩΝ ΣΠΟΥΔΩΝ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΗΝ ΝΑΥΤΙΛΙΑ ΝΟΜΙΚΟ ΚΑΙ ΘΕΣΜΙΚΟ ΦΟΡΟΛΟΓΙΚΟ ΠΛΑΙΣΙΟ ΚΤΗΣΗΣ ΚΑΙ ΕΚΜΕΤΑΛΛΕΥΣΗΣ ΠΛΟΙΟΥ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ που υποβλήθηκε στο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ.

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. ΒΙΟΛΟΓΙΑ Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. Ηλιούπολης Κεφάλαιο 1ο ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Η ΙΕΡΑΡΧΙΑ ΤΩΝ ΒΙΟΜΟΡΙΩΝ ΠΡΟΔΡΟΜΕΣ

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα