Chinese Journal of Biochemistry and Molecular Biology. sirna. PCR, 3 Corresponding author Tel : , E2mail

Transcript

1 ISSN CN ΠQ Chinese Journal of Biochemistry and Molecular Biology 21 (3) : sirna SARS,,,,,,, 3,,,, ( ) sirna SARS, BJ01 SARS ( Pol) ( S), 4 sirna, sirna PCR, sirna SARS, Pol sirna (psoe) Vero BJ01 SARS RNA SARS SARS SARS, RNAi, sirna Q78,R373 Interference of SARS2CoV Replication by Small Interfering RNAs ZHAO Hui, CHEN Shui2Ping, DUAN Hong2Yuan, DENG Yong2Qiang, J IANG Tao, ZHAO Zhuo, YU Man, KANG Xiao2Ping, YANG Bao2An, LI Xiao2Yu, QIN Cheng2Feng, QIN E2De 3 ( State Key Laboratory of Pathogen and Biosecurity, Institute of Microbiology and Epidemiology,Academy of Military Medical Sciences, Beijing , China) Abstract To investigate interference of SARS2CoV replication in mammalian cells by small interfering RNAs (sirnas), sirna expression plasmids targeting the polymerase gene and the S gene of SARS2CoV were constructed Vero cells were stably transfected with these plasmids Clonal cell lines,psoa,psoe,pssk and psne were selected by growth in hygromycin B2containing media and characterized further by PCR analysis to determine the organization of plasmid DNA in the clonal cell lines Cell lines in which the plasmid DNA was correctly integrated into the genome were challenged with SARS2CoV BJ01 strain at a multiplicity of infection (MOI) of 0105 Cytopathic effect (CPE) of cells infected by SARS2CoV was observed every day At 3rd day, postchallenged cells which was no CPE were fixed in the slides and immunofluorescence assays ( IFA) were performed One of the clonal cell lines,psoe were resistant to SARS2CoV infection In addition, SARS2CoV RNA failed to accumulate in psoe by real2time quantitive PCR analysis Observations have showed that sirna (psoe) targeting polymerase gene could inhibit SARS2CoV RNA replication and protein expression in Vero cells These results suggested a feasibility of using RNAi to elucidate pathogenesis of SARS2CoV and that RNAi might represent a new approach for the treatment of SARS infection Key words SARS coronavirus, RNA interference, small interfering RNAs SARS (SARS coronavirus,sars2cov) ( severe acute respiratory syndrome,sars) RNA : : , 5 3 (No 2003CB514119) 3 :Tel : ,E2mail com :5 2 2S 2E 2M 2N 2 3 [1 ] SARS RNA, RNA RNA, RNA Received :August 25, 2004 ;Accepted :September 28, 2004 Supported by National High Technology 973 Project of China 2003CB514119) 3 Corresponding author Tel : , E2mail com ( NO China Academic Journal Electronic Publishing House All rights reserved

2 mrna RNA ; RNA ( RNeasy Mini Kit ) [2 ] QIAGEN ; (PCR) SARS, ; (Lipofectamine SARS RNA ( RNA interference,rnai) Invitrogen ; SARS RNAi SARS, ; FITC RNA(double2stranded RNA,dsRNA) IgG, sirna RNA 1 4 dsrna, RNA (RNA2inducing silencing complex,risc) sirna2 ( sirna2protein complex, sirnp) ATP sirna, AGTTGGGTA23 SARS Pol sirnp mrna PCR mrna [3,4 ],sirna (PCR) [5 8 ] 1 5 sirna,, SARS, RNAi, Pol S 5 UTR sirna 3 UTR ( RNA [9 ], ), sirna SARS sirna Ambion sirna, sirna sirna SARS BJ01 ( Pol) ( http :ΠΠwww ambion comπtechlibπmiscπsirna - design ( S) sirna html) sirna sirna, sirna BJ01 SARS 1 1 2, 24 h, 018 g sirna DNA sirna (psilencer TM hygro) 2 l Lipofectamine 2000, 24 h, Ambion Lipofectamine 2000 (psne) E coli DH5 1 7 LB (10 gπl 5 gπl 10 gπl NaCl,pH gπml) ) (Opti2MEM ) B sirna PCR 5 2 TAATACGACTCACTATAGGG23 5 2AGGCGATTA, 3 : sirna TTCAAGAGA sirna 65 BamH Hind 1 1 SARS 2 DNA SARS BJ01 ( GenBank : psilencer sirna Fig 1 AY278488) SARS sirna Vero ( ) 10 % ( GIBCO ) UΠml 100 UΠml DMEM Vero 24 (ph 712), Π 37,5 % CO 2 24 h Vero 10, 37, 5 % CO 2 24 h B ( 300 gπml), Vero Ex Taq DNA dntp TaKaRa, 150 gπml ; E coli DH5 B ; DNA, China Academic Journal Electronic Publishing House All rights reserved

3 3 :sirna SARS 399 DNA( 215 U 36 l 94 2 min, 35 : ) PCR PCR : s,55 45 s,72 1 min 72 7 Ex 5 l,215 mmolπl dntp 4 l,20 molπl min 1 l DNA 2 l, Ex Taq Fig 1 sirna target sites and its expression plasmid construction (A) Oa,Oe targeting polymerase gene and Sk targeting S gene were selected as sirna target sites ; (B) Map of psoe plasmid construction Complementary sequence are underlined 1 8 SARS BJ01 Vero PFUΠml [10 ] 0105 MOI, 3, 37,5 % CO 2 95 % 1 h, 2 % 150 gπml B DMEM 1 1 ml 1 10 RNA PCR,, 24 h, 24 h (cytopathic effect,cpe) BSL2 RNA( ( IFA) IgG, 3, [12 ] ) 9 d RNA 10 l [ 11 ] RNA PCR SARS FITC China Academic Journal Electronic Publishing House All rights reserved

4 (PCR) BJ01 SARS Pol S psoa psoe pssk sirna, DNA, sirna Vero B, 4 sirna :psoa psoe pssk psne,psne DNA PCR 526 bp Fig 2 PCR products of sirna expression plasmid integrated into the cellular genome M:100 bp DNA ladder ;C:Vero cell ; 1,2,3 and 4 represent four clonal cell lines (psne,psoa,psoe and pssk) respectively Vero ( Fig 2) sirna SARS ( Fig 4) 4, SARS Pol sirna (psoe) 2 2 sirna BJ01 SARS, psoa psoe pssk sirna (psoa) SARS SARS, psne S sirna(pssk) BJ01 psoa psoe pssk Pol psoe sirna, SARS 2 3 sirna BJ01 SARS 3 d sirna psoe,psoa pssk psne SARS,, 4 +, PCR SARS Pol psoe ( Fig SARS Pol 3) psoe,psoe Fig 3 CPE of cells infected by SARS2CoV at 3rd day (A) Normal Vero cells ; (B) infected Vero cells ; (C), (D), ( E) and (F) represent infected psne,psoe,psoa and pssk clonal cells, respectively China Academic Journal Electronic Publishing House All rights reserved

5 3 :sirna SARS 401 Fig 4 IFA of inhibition of SARS2CoV antigen in clonal cells by sirna at 3rd day (A) Negative control ; (B) Positive control ; (C) and (D) represent infected psne clonal cells and psoe clonal cells, respectively 5 7 d ( Fig 5), psoe psne 10-3 psne sirna SARS RNA 24 h,, Fig 5 Real time quantitive RT2PCR of inhibition of SARS2CoV replication by sirna psne ; psoe 3 psilencer RNA sirna SARS, U6 RNAi SARS S [14 ] RNA(shRNA) sirna S sirna sirna, sirna,, Pol SARS, pol [15 ] shrna RNA, SARS shrna sirna RNA, sirna, RNA, sirna, sirna Pol sirna (psoe) Vero BJ01 sirna, SARS RNA, RNA SARS sirna [9,13 ] sirna SARS, sirna SARS RNA, SARS Vero SARS,,siRNA [15 ] Vero SARS,,SARS, China Academic Journal Electronic Publishing House All rights reserved

6 RNAi,siRNA, sirna, sirna RNAi sirna SARS Pol (psoe) SARS RNA, sirna, sirna, [5,7 ] sirna sirna SARS sirna SARS ( References) 5 Park W S,Miyano2Kurosaki N,Hayafune M,Nakajima E,Matsuzaki T, Shimada F, Takaku H Prevention of HIV21 infection in human peripheral blood mononuclear cells by specific RNA interference Nucleic Acids Res,2002,30(22) : McCaffrey A P, Nakai H, Pandey K, Huang Z, Salazar F H, Xu H, Wieland S F,Marion P L, Kay M A Inhibition of hepatitis B virus in mice by RNA interference Nat Biotechnol,2003,21(6) : Kapadia S B,Brideau2Andersen A,Chisari F V Interference of hepatitis C virus RNA replication by short interfering RNAs Proc Natl Acad Sci USA,2003,100(4) : McCaffrey A P,Meuse L,Pham T T,Conklin D S,Hannon GJ, Kay M A RNA interference in adult mice Nature,2002,418(6893) : Gitlin L, Karelsky S, Andino R Short interfering RNA confers intracellular antiviral immunity in human cells Nature, 2002, 418 (6896) : SARS BJ01 ( Yu Man, Peng Wen2Ming, Duan Hong2Yuan, Chang Guo2 Hui,Fan Bao2Chang,Deng Yong2Qiang,Liu Hong,Wei Yun2Ling, Zhu Qing2Yu,Qin E2de Development of plaque assay for SARS coronavirus BJ01 strain Med J Chin PLA),2003,28 (8) : , SARS 1 Rota P A,Oberste M S,Monroe S S,Nix W A,Campagnoli R,Icenogle J (Si Bing2Yin, Yang Bao2An, Yu Man,Liu Hong, P,Penaranda S,Bankamp B,Maher K,Chen M H, Tong S, Tamin A, Lu Fu2Shuang, Han Wei2Guo, Zhang Yu,Shi Yu2Ling,Li lin2hai,qin Lowe L,Frace M,DeRisi J L,Chen Q,Wang D, Erdman D D,Peret T E2De,Zhu Qing2Yu Development of IFA method for detecting antibodies C,Burns C,Ksiazek T G,Rollin P E,Sanchez A,Liffick S,Holloway B, of SARS coronavirus Med J Chin PLA),2003,28(8) : Limor J,McCaustland K,Olsen2Rasmussen M, Fouchier R, Gunther S, 12 Adelman Z N,Sanchez2Vargas I,Travanty E A,Carlson J O,Beaty B J, Osterhaus A D,Drosten C,Pallansch M A,Anderson L J,Bellini W J Blair C D,Olson K E RNA silencing of dengue virus type 2 replication Characterization of a novel coronavirus associated with severe acute in transformed C6Π36 mosquito cells transcribing an inverted2repeat RNA respiratory syndrome Science,2003,300(5624) : derived from the virus genome J Virol,2002,76 (24) : ,, SARS 13 Brummelkamp T R,Bernards R,Agami R A system for stable expression RNA ( ) (Rui Wei,Zhang of short interfering RNAs in mammalian cells Science, 2002, 296 Qi2Peng, Shi Lei, Lu Ming, Jing Xia, Guo Qiang2Hua, Shang Tong (5567) : Analysis of coding region in RNA polymerase of SARS2CoV J Peking 14 Zhang Y,Li T, Fu L, Yu C,Li Y, Xu X,Wang Y,Ning H, Zhang S, Univ ( Heal Sci) ),2003,35( supplement) : Chen W, Babiuk L A, Chang Z Silencing SARS2CoV Spike protein 3 RNA ( RNAi) expression in cultured cells by RNA interference FEBS Lett,2004,560 ( Chen Zhong2Bin, Yu Yue2Cheng,Wang (123) : Sheng2Qi Recent Advances on the RNA Interference Chin J Biochem 15 SARS Mol Biol),2002,18 (5) : ( Wang Cheng2Zhong, QI Zheng2Wu The 4 Dykxhoorn D M,Novina C D,Sharp P A Killing the messenger : short biological characteristics of SARS virus and its related coronaviruses RNAs that silence gene expression Nat Rev Mol Cell Biol,2003,4 (6) : Acta Biochim Biophys Sin),2003,35(6) : China Academic Journal Electronic Publishing House All rights reserved