Research Paper. sirna. RNA small interfering RNA sirna hepatitis B virus HBV pmc. BESPX-MCS2. sirna. pmc-h1-sihbs-u6. E. coli ZYCY10P3S2T HBV

Transcript

1 Research Paper Acta Microbiologica Sinica February 2012 ISSN CN /Q http / /journals. im. ac. cn /actamicrocn sirna 1 2 1* RNA small interfering RNA sirna hepatitis B virus HBV HBV S sirna pmc. BESPX-MCS2 pmc-h1-sihbs-u6 E. coli ZYCY10P3S2T L- RNA pmc-h1-sihbs-u6 RNA HBV phbv1. 3 Huh ELISA Huh-7 HBsAg HBeAg Real-time RT-PCR RNA HBV DNA mrna HBV S sirna pmc-h1-sihbs-u6 Huh-7 HBsAg HBeAg 2-3 Real-time PCR HBV DNA mrna 71% 80% sirna HBV RNA HBV HBV RNA hepatitis B virus HBV RNA Huh-7 Q933 A hepatitis B virus HBV RNA HBV RNAi HBV RNA pregenomic RNA pgrna α- sirna HBV RNA RNA mrna interference RNAi post-transcriptiona1 gene silencing RNA 1 - PTGS 2 HBV RNA HBV * Tel fengtao9_9@ yahoo. com lxm1926@ hotmail. com

2 192 Xiaoman Liu et al. /Acta Microbiologica Sinica RNA Escherichia coli DH5α Huh-7 RNA Huh-7 DMEM 10% FBS 100 μg /ml U /ml 37 5% CO 2 TRIzol Lipofectamine Invitrogen Opti-MEM GIBCO Thermo PCR T DNA DNA Marker TaKaRa DNA Qiagen 11 Vigorous Real-time PCR 12 Promega L- HBV Qiagen DNA Tanon1600 Bio-RAD Real-time PCR ABI 7300 PCR RNA HBV 1. 2 HBV S sirna pmc. RNAi 1 BESPX-MCS2 pmc sirna sihbs ZYCY10P3S2T E. coli SBI H HBS sirna HBV1. 3 sirna HBV S BLAST HBV HBV S Invitrogen HBV EGFP siegfp 20 - U6 psuper-u sirna 1 Table 1 sirna Restriction site Sequences 5 3 sihbs siegfp The Sequences of sihbs and siegfp sihbs BglⅡ Forward sequence GATCAAAAACTCAGTTTACTAGTGCCATTTG TTCTTCAAGAGAG AACAAATGGCACTAGTAAACTGAGTTTTT SalⅠ Reverse sequence TCGAAAAAACTCAGTTTACTAGTGCCATTTG TTCTCTCTTGAAGAACAAATGGCACTAGTAAACTGAGTTTTT siegfp BglⅡ Forward sequence GATCAAAAAAAGAACGGCATCAAGGTGAA CTTCAAGAGAGTTCACCTTGATGCCGTTCTTTTTTT SalⅠ Reverse sequence TCGAAAAAAAAGAACGGCATCAAGGTGAA CTCTCTTGAAGTTCACCTTGATGCCGTTCTTTTTTT sirna psuper-u6 psuper-u6 5' BglⅡ SalI psuper-sihbs-u6 psuper-siegfp-u6 T4 DNA DH5a Spe Ⅰ

3 sirna. / NaOH 10 ml 20% L- 3 ± SD 1% rpm /min 5 h P < RNA pmc-h1-sihbs-u6 pmc-h1-siegfp- U6 pmc-h1-u RNA Huh-7 Huh sirna psuper-sihbs / siegfp-u6 37 5% CO 2 70% - 90% opti-mem pmc-h1-sihbs-u6 sirna 1 psuper-u ng 1 ng 2 ng phbv ng SpeⅠ EcoRI bp Huh % CO bp 6 h 10% DMEM % CO 2 psuper-u6 EcoRI 600 bp sirna pmc-h1-520 bp sihbs siegfp-u6 pmc-h1-u6 3 siegfp DNA psuper-u h 7 d pmc SpeⅠ - 80 EcoRI H1-siHBS-U6 H1-siEGFP-U6 ELISA H1-U6 psuper-u6 RNA pmc 1. 6 HBV DNA pmc-h1-sihbs-u6 pmc-h1-siegfp-u6 pmc-h1-u sirna RNA 24 h 48 h 72 h HBV DNA copies /ml RNA 1. 7 HBV mrna DNA Trizol Invitrogen 72h RNA cdna cdna 100 μl 5 ml ABI7300 PCR 50 μg /ml LB rpm / HBS β-actin. PCR min min 6-8 h s s 40 CT 100 ml 50 μg /ml TB rpm /min hod ml LB 4 ml 1N 1. 5 HBsAg HBeAg HBsAg HBeAg QIAGEN HBV ABI7300 PCR 2 - CT 100% 1. 8 SPSS sihbs Fig. 1 The oligonucleotides sihbs1 top and sihbs2 below annealed to generate double-stranded sihbs.

4 194 Xiaoman Liu et al. /Acta Microbiologica Sinica DNA HBV S sirna 2 psuper -sihbs /EGFP-U6 SpeI EcoRI Fig. 2 psuper-sihbs /siegfp /-U6 was digested by SpeI and EcoRI. lane M. TaKaRa DL DNA marker lane 1. psuper -sihbs-u6 lane 2. psuper-siegfp-u6 lane 3. psuper-u6 as the empty vector control RNA H1-siHBS-U6 H1-siEGFP-U6 3 H1-U6 pmc RNA RNA pmc-h1-sihbs-u6 3-A 600 bp 2. 3 HBsAg HBeAg pmc-h1-sihbs-u6 phbv Huh-7 ELISA RNA Fig. 3 The construction generation and identification of Minicircle RNAi vector A. Diagram of production process of a minicircle DNA vector. B. pmc-h1-sihbs-u6 was digested by Bgl Ⅱ and EcoNI restriction enzymes before electrophoresis. lane M. TaKaRa DL DNA maker. lane +. pmc-h1-sihbs-u6 with Bgl Ⅱ and DNA EcoNI restriction enzymes. lane. pmc-h1-sihbs-u6 without BglII and EcoNI restriction enzymes. 4 sirna BglⅡ DNA EcoNI 2. 4 sirna HBV-DNA 3-B pmc-h1-sihbs-u6 QIAGEN HBV HBV-DNA ABI7300 PCR 24 h 48 h HBsAg HBeAg 72 h HBV DNA HBsAg HBeAg pmc-h1-sihbs-u6 HBV- pmc-h1-sihbs-u6 4 1 DNA 24 h 48 h 72 h 72 h 64% 67% 71% HBsAg HBeAg P < % 89% 168 h pmc-h1-siegfp-u6 pmc- H1-U6 2 sirna HBV- P < DNA pmc-h1-siegfp-u6 pmc-h1-u6

5 sirna. / CT 2 - CT pmc-h1-sihbs-u6 Huh-7 HBV mrna 72 h 80% 5 P < pmc- H1-siEGFP-U6 pmc-h1-u6 5 sirna HBV mrna 5 Real-time RT-PCR sirna 4 ELISA HBV S mrna sirna HBsAg A HBeAg B Fig. 5 Inhibition of HBV S gene mrna by RNAi based on Minicircle DNA vector delivery in Huh-7 cell pools. The amount of HBV S gene Fig. 4 Inhibition of HBsAg A and HBeAg B by RNAi mrna was measured by Real-time RT-PCR. The data shown represent based on Minicircle DNA vector delivery in Huh-7 cell the mean values ± S. D. based on three independent experiments. pools. The amount of HBsAg and HBeAg in the culture Compared with control groups *** P < medium was measured in 1-7 days by ELISA. The data shown represent the mean values ± S. D. based on three 3 independent experiments. Compared with control groups * P < ** P < *** P < DNA minicircle DNA Real-time PCR sirna Huh-7 HBV DNA DNA Table 2 Inhibition of HBV DNA by RNAi based on Minicircle DNA vector delivery in Huh-7 cell pools. The amount of HBV DNA was measured by Real-time PCR. The data shown represent CpG the mean values ± S. D. based on three independent DNA experiments copies /ml ± SD Species Number 24h 48h 72h pmc-h1-siegfp-u ± 0. 8 * ± ± 1. 2 pmc-h1u ± ± ± 1. 3 pmc-h1-sihbs-u ± 1. 1 ** ± 0. 9 ** ± 0. 4 *** Chen * 10 6 copies /ml ± SD Compared with control groups ** P < P < Kay sirna Huh-7 HBV mrna ΦC31 pmc-h1-sihbs-u6 72h I-SceI ΦC31 RNA cdna HBS I-SceI β-actin ABI7300 PCR

6 196 Xiaoman Liu et al. /Acta Microbiologica Sinica DNA 3 Chen Y Cheng G Mahato RI. RNAi for treating hepatitis DNA B viral infection J. Pharmaceutical Research % Gardlik R Palffy R Hodosy J Lukacs J Turna J Celec P. Vectors and delivery systems in gene therapy. Medical Science Monitor RA110-RA Kootstra NA Verma IM. Gene therapy with viral vectors. sirna Annual Reviews of Pharmacol and Toxicol sirna 6 Verma IM Weitzman MD. Gene therapy twenty-first RNA pmc-h1-sihbs-u6 century medicine. Annual Reviews of Biochem HBV phbv Huh-7 phbv1. 3 5' 7 Marshall E. Gene therapy death prompts review of Enh I Enh II DR1 adenovirus vector. Science DR2 X C X 8 Marshall E. Volunteer s death prompts review. Science 3. 5 kb 2. 4 kb 2. 1 kb kb HBV 9 Marshall E. Gene therapy a suspect in leukemia-like HBV disease. Science Marshall E. Second child in French trial is found to have HBV sirna leukemia. Science pmc-h1-sihbs- 11 Pang AS. Production of antibodies against Bacillus U6 72 h HBsAg HBeAg 75% 91% thuringiensis delta-endotoxin by injecting its plasmids. Biochemical and Biophysical Research Communications 168 h DNA PCR pmc-h1-sihbs-u6 HBV DNA 72 h 71% RNA PCR pmc-h1-siegfp-u6 pmc-h1-u6 sirna 14 Chen ZY He CY Ehrhardt A Kay MA. Minicircle DNA vectors devoid of bacterial DNA result in persistent and high-level transgene expression in vivo. Molecular Therapy Darquet AM Cameron B Wils P Scherman D Crouzet J. RNA A new DNA vehicle for nonviral gene delivery supercoiled minicircle. Gene Therapy HBV Darquet AM Rangara R Kreiss P Schwartz B Naimi S 1 Hannon GJ. RNA interference. Nature Gitlin L Andino R. Nucleic acid-based immune system the antiviral potential of mammalian RNA silencing. Journal of Virology Chen ZY He CY Meuse L Kay MA. Silencing of episomal transgene expression by plasmid bacterial DNA elements in vivo. Gene Therapy pmc-h1-sihbs-u6 13 Bigger BW Tolmachov O Collombet JM Fragkos M HBV mrna 72 h 80% Palaszewski I Coutelle C. An arac-controlled bacterial cre expression system to produce DNA minicircle vectors for nuclear and mitochondrial gene therapy. Journal of Biological Chemistry Delaère P Crouzet J Scherm an D. M inicircle an improved DNA molecule for in vitro and in vivo gene transfer. Gene Therapy Suzuki M Kasai K Saeki Y. Plasmid DNA sequences present in conventional herpes simplex virus amplicon vectors cause rapid transgene silencing by forming inactive chromatin. Journal of Virology

7 sirna. / Vaysse L Gregory LG Harbottle RP Perouzel E Tolmachov O Coutelle C. Nuclear-targeted minicircle to enhance gene transfer with non-viral vectors in vitro and in vivo. Journal of Gene Medical Wu J Xiao X Zhao P Xue G Zhu X Zheng L Zeng Y Huang W. Minicircle-IFNgamma induces antiproliferative and antitumoral effects in human nasopharyngeal carcinoma. Clinical Cancer Research Mitaqishi M Taira K. U6-promoter-driven sirnas with four uridine 3 overhangs efficiently suppress targeted gene expression in mammalian cells J. Nature Biotechnology Brummelkamp TR Bernards R Aqami R. A System for Stable Expression of Short Interfering RNAs in Mammalian Cells. Science Chen ZY He CY Kay MA. Improved production and purification of minicircle DNA vector free of plasmid bacterial sequences and capable of persistent transgene expression in vivo. Human Gene Therapy Kay MA He CY Chen ZY. A robust system for production of minicircle DNA vectors. Nature Biotechnology Tang H Mclachan A. Transcriptional regulation of hepatitis B virus by nuclear hormone receptors is critical determinant of viral tropism. Proceedings of the National Academy of Sciences of the United States of America A minicircle DNA vector-mediated sirna to stably suppress hepatitis B virus replication and expression Xiaoman Liu 1 Zhuo Yang 2 Tao Feng 1* 1 Department of Biochemistry and Molecular Biology College of Basic Medicine Chongqing Medical University Chongqing China 2 School of Life Sciences Tsinghua University Beijing China Abstract Objective We used a minicircle DNA vector system to express small interfering RNA sirna and studied the inhibition of hepatitis B virus HBV replication and gene expression in vitro. Methods sirna targeting HBV S gene sihbs was designed synthesized and cloned into a minicircle DNA vector pmc. BESPX-MCS2. After sequencing we transformed the recombinant pmc-h1-sihbs-u6 into E. coli ZYCY10P3S2T and induced the degradation of its bacterial backbone by adding L-arabinose into the bacterial growth medium. As expected a minicircle RNA interference RNAi vector pmc-h1-sihbs-u6 was generated only consisting of gene expression cassette. Then pmc- H1-siHBS-U6 was co-transfected into Huh-7 cells with HBV expression vector phbv1. 3. ELISA and Real-time PCR were performed to evaluate the inhibition effect of the secretion of HBsAg and HBeAg and the levels of HBV DNA and mrna in Huh-7 cells. Results We Successfully established the minicircle-based RNAi vector pmc-h1-sihbs-u6 which can significantly inhibit the secretion of HBsAg and HBeAg in Huh-7 cells for two to three weeks. Real-time PCR results show that HBV DNA and mrna levels were also down-regulated about 71% and 80%. Conclusion The minicircle DNAbased RNAi vector pmc-h1-sihbs-u6 can suppress HBV replication and gene expression specifically efficiently and steadily. Thus this study provided us a new sirna delivery system and a new gene therapy strategy of HBV infection. Keywords minicircle DNA vector hepatitis B virus HBV sirna Huh-7 cell Supported by the National Science Foundation of China * Corresponding author. Tel fengtao9_9@ yahoo. com Received 5 September 2011 /Revised 14 December 2011