(MACF1) Association of Microtubule Actin Crosslinking Factor 1 with Cytoskeleton in Osteoblast

HTML
DOWNLOAD

Μέγεθος: px

Εμφάνιση ξεκινά από τη σελίδα:

Download "(MACF1) Association of Microtubule Actin Crosslinking Factor 1 with Cytoskeleton in Osteoblast"

Νίκη Βουγιουκλάκης
6 χρόνια πριν
Προβολές:

1 13 5 Vol13 No Life Science Research Oct MACF1,,,,, * : (MACF1) (MG-63 MC3T3) /, MACF1,, MACF1 ; B MACF1,, MACF1 sirna-macf1 MG-63 MACF1, ; MACF1 : 1; ; ; ; : Q291 : A : (2009) Association of Microtubule Actin Crosslinking Factor 1 with Cytoskeleton in Osteoblast QIAN Ai-rong HU Li-fang DI Sheng-meng ZHANG Wei GAO Xiang SHANG Peng * Institute of Special Environment Biophysics Key Laboratory for Space Biosciences & Biotechnology Faculty of Life Sciences : : Northwestern Polytechnical University Xi an Shaanxi China Abstract The association of microtubule actin crosslinking factor1 MACF1 with actin filaments AFs microtubule MT and focal adhesion were examined using laser scanning confocal microscopy LSCM Results showed that MACF1 aligned along MT filaments and partly co-localized with the AFs and MT in the Cytoplasm In many osteoblast anti-macf1 labeling could be found in regions of focal adhesions cytochalasin B caused translocation of MACF1 to the perinuclear region or nucleus in contrast colchicines had no obvious effects on the association of MACF1 with cytoskeleton AFs were discrete and disrupted and MTs were disorganized in MG-63 cells tranfected with sirna-macf1 compared with that in control cells These results indicate that MACF1 plays an important role not only in linking cytoskeleton proteins but in stabilizing the cytoskeleton structure The association of MACF1 with cytoskeleton primarily depends on the integrity of the actin network Key words microtubule actin crosslinking factor 1 actin filaments microtubule focal adhesion osteoblast : Life Science Research ~387 : Tel qianair@nwpueducn * Tel shangpeng@nwpueducn

2 5 :MACF MACF1 Abnova ACF7 Liem RH α-tubulin FITC-IgG rhodamine- IgG KPL α-tubulin Plakin vinculin B MACF1 Calbiochem phalloidin- rhodamine ACF7 Actin cross-linking family kda actin-binding protein GFP-siRNA-MACF1 Macrophin-1 OFC4 Trabeculin-α [1~4] Plakin GFP-siRNA Eppendorf [5~8] 12 MACF1 / ACF7 MG-63 MC3T3 MACF1 / ACF [9~11] MACF1 MEM 10% 37 5% CO 2 18 h 24 h [10] ACF7 kakapo - 24 h [12] kakapo / ACF7 13 αβ1 [15] MACF1 [13] Kodama [13] ACF7 / MACF1 - ACF7 / MACF1 1 MACF1 MACF1-siRNA - 5 -AATTCAAAAAGCTGTGGTCAGAGTCGCT ACF7 ACF7 GATTCTCTTGAAATCAGCGACTCTGACCACAGC GGG GATCCCCGCTGTGGTCAGAGTCGCTGAT MACF1 TTCAAGAGAATCAGCGACTCTGACCACAGCTTT TTG- 3 MACF1 2 Scramble sirna 5 -AATTCAAAAAAAAGGTCGTGGCAATCTG MACF1 TACTTCTCTTGAAAGTACAGATTGCCACGACCTT MACF1 GGG [14] MACF1 5 - GATCCCCAAGGTCGTGGCAATCTGTACT TTCAAGAGAAGTACAGATTGCCACGACCTTTTTT TTG-3 MACF1 TaKaRa Invitrogen Lecia MEM DNA Ligation Kit Solution I psiren-retroq-zsgreen BamH / EcoR

3 Ecoli DH5α PBS 2 4% 37 05% 8 PCR phalloidin- rhodamine α-tubulin MG-63 PBS GFP-siRNA μg 543 nm sirna- MACF1 2 mm scramble sirna MG μl 4 10 min Eppendorf 200 V min 35 mm 72 h 21 MACF1 15 MG-63 MC3T3 5 1 MG-63 MACF / ml MEM 1A C E MC3T3 10% 37 5% CO 2 24 h 4% 20 min 05% 1B D F MG-63 MC3T3 15 min TBS 3 2% BSA 01% Triton X % Azide MACF1 actin 1A B MACF1 tubulin ACF7 vinculin TBS α- MACF C D MACF1 FITC-IgG B MACF1 FITC-IgG phalloidin- rhodamine rhodamine- IgG FITC-IgG 1 h TBS 3 Leica TCS SP5 B 30 min actin FITC 60 min Anti- 488 nm rhodamine MACF1 543 nm 16 B MACF1 MG-63 MC3T3 min 60 min MACF1 24 h 1 μmol / L B 1 μmol / L 30 min 60 min 4% 05% 23 MACF1 B MACF1 MG-63 MC3T3 1 μmol / L rhodamine - IgG nm MACF1 MACF1 actin 1E F MG-63 MC3T3 1 μmol / L B MACF1 actin 2 2 B MG-63 B 30 C D MC3T3 MACF1 30 min 60 min 17 sirna-macf1 MG-63 MACF1 3 3 A B MG-63 sirna-macf1 scramble 30 min 60 min MACF1 sirna MG h C D MC3T3

4 5 :MACF1 385 MACF1 E F 1 MG-63 MC3T3 MACF1, 25 μm Fig1 The association of MACF1 with actin vinculin and tubulin in MG-63 and MC3T3-E1 cells Insets are higher magnification of regions within dotted white boxes Bar 25 μm 2 B MG-63 MC3T3 MACF1 25 μm Fig2 The association of MACF1 with actin filaments in MG-63 and MC3T3-E1 cells treated with cytochalasin B Bar 25 μm

sirna-macf1 MACF1 MG-63 scramble sirna 4D

filaments C D in MG-63 and MC3T3 cells by

MC3T3 cell transfected with scramble sirna

5 sirna-macf1 MG-63 4B sirna-macf1 MG-63 scramble sirna sirna- sirna-macf1 MACF1 MG-63 scramble sirna 4D 3 MG-63 MC3T3 MACF1 25 μm Fig3 The association of MACF1 with microtubule filaments in MG-63 and MC3T3-E1 cells treated with colchicines Bar 25 μm 4 si-macf1 MG-63 (A B) (C D) A, C: ; B, D: ; 25 μm Fig4 The effects of si-macf1 on actin filaments A B and microtubule filaments C D in MG-63 and MC3T3 cells by laser confocal microscopy A C MG-63 and MC3T3 cell transfected with scramble sirna D MG-63 and MC3T3 cell transfected with si-macf1 Bar 25 μm 3 MACF1 MCF-7 [16] MACF1 MACF1 MACF1 MACF1 MACF1 MACF1 kakapo / ACF7 Lin [15] MACF1 MACF1b [12,17] MACF1 MACF1b

6 5 :MACF1 387 [17] B MACF1 [J] MACF1 of MACF1[J] MACF1 Kodama [13] ACF7 / MACF1 - ACF7 ACF7 disease[j] Exp Cell Res versatile cytolinker proteins[j] Karakesisoglou [16] ACF-7 ACF-7 Cell Biol ACF-7 ACF-7 MACF1 sirna-macf1 MG-63 sirna-macf1 MG-63 MACF1 MACF1 MACF1 MACF1 MACF1 ATPase [18] MACF1 MACF (References): [1] LEUNG C L SUN D ZHENG M et al Microtubule actin cross-linking factor MACF a hybrid of dystonin and dystrophin that can interact with the actin and microtubule cytoskeletons [J] J Cell Biol [2] BERNIER G MATHIEU M DE REPENTIGNY Y et al [4] 1 QIAN Ai-rong HU Li-fang SHANG Peng Recent advances on the structure and functions Chinese Journal of Cell Biology [5] CHEN H J LIN C M LIN C S et al The role of microtubule actin cross-linking factor 1 MACF1 in the Wnt signaling pathway [J] Genes Dev [6] SONNENERG A LIEM R K Plakins in development and [7] LEUNG C L GREEN K J LIEM R K Plakins a family of Trends Cell Biol [8] JEFFERSON J J LEUNG C L LIEM R K Plakins goliaths that link cell junctions and the cytoskeleton[j] Nat Rev Mol [9] BERNIER G POOL M KLLCUP M et al Acf7 MACF is an actin and microtubule linker protein whose expression predominates in neural muscle and lung development [J] Dev Dyn [10] SUN D LEUNG C L LIEM R K Characterization of the microtubule binding domain of microtubule actin crosslinking factor MACF identification of a novel group of microtubule associated proteins[j] J Cell Sci Pt [11] SUN Y ZHANG J KRAEFT S K et al Molecular cloning and characterization of human trabeculin-alpha a giant protein defining a new family of actin-binding proteins[j] J Biol Chem [12] STRUMPF D VOLK T Kakapo a novel cytoskeletalassociated protein is essential for the restricted localization of the neuregulin-like factor vein at the muscle-tendon junction site[j] J Cell Biol [13] KODAMA A KARAKESISOGLOU I WONG E et al ACF7 an essential integrator of microtubule dynamics [J] Cell [14] QIAN A R HU L F GAO X et al Large gradient high magnetic field affects the association of MACF1 with Actin and microtubule cytoskeleton[j] Bioelectromagnetics 2009 [15] LIN C M CHEN H J LEUNG C L et al Microtubule actin crosslinking factor 1b a novel plakin that localizes to the Golgi complex[j] J Cell Sci Pt [16] MACF1 [J] QIAN Ai-rong ZHANG Bo SHANG Peng et al Bioinformatics analysis and cellular localization of Microtubule Actin Cross-Linking Factor 1[J] Journal of the Fourth Military Medical University [17] KARAKESISOGLOU I YANG Y FUCHS E An epidermal Cloning and characterization of mouse ACF7 a novel member of the dystonin subfamily of actin binding proteins[j] Genomics plakin that integrates actin and microtubule networks at cellular junctions [J] J Cell Biol [18] WU X Y KODAMA A FUCHS E ACF7 regulates [3] BYERS T J BEGGS A H MCNALLY E M et al Novel cytoskeletal-focal adhesion dynamics and migration and has actin crosslinker superfamily member identified by a two step ATPase activity [J] Cell degenerate PCR procedure[j] FEBS Lett

Σχετικά έγγραφα

Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements

$Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements$ 5 5 2012 10 Chinese Optics Vol. 5 No. 5 Oct. 2012 1674-2915 2012 05-0525-06 - * 100190-14 - - 14. 51 μm 81. 4 μm - 1. 64 μm / O436. 1 TH703 A doi 10. 3788 /CO. 20120505. 0525 Correction of chromatic aberration