http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology RT- PCR fat-1 3T3

Transcript

1 ISSN CN / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology ~ 760 ω-3 fat * ω-6pufas / ω-3pufas ω- 3PUFAs ω-6pufas ω-3pufas ω-3 Caenorhabditis elegans ω-3 fat-l cdna pegfpc1-fat-1 RT- PCR pegfpc1-fat-1 ω-6pufas / ω-3pufas MTT P < 0 05 fat-1 ω-6pufas ω-6pufas ω-3pufas 3T3 ω-3 Q812 Overexpression of ω-3 Fatty Acid Dehydrogenase Gene Protects Mouse Embryonic Fibrocytes from ω-6 PUFAs-induced Apoptosis 1 LI Fang-Fang 2 GE Yin-Lin 1 * XUE Mei-Lan 1 ZHANG Jin-Yu 1 LI Quan 1 SHAN Hu 2 1 Department of Biochemistry and Molecular Biology Medical School of Qingdao University Qingdao 2 School of Animal Science and Veterinary Medicine Qingdao Agricultural University Qingdao China China Abstract ω-3 polyunsaturated fatty acids ω-3pufas are important for the normal function of mammals However it is difficult to gain ω-3pufas in human body and there is no ω-3pufas dehydrogenase in vivo to catalyze ω-6pufas into ω-3pufas But the expressed product of fat-1 gene from Caenorhabditis elegan is ω-3 PUFAs dehydrogenase Hence to express fat-1 gene in mouse embryonic fibrocyte is the aim of this study First the eukaryotic expression vector pegfpc1-fat-1 containing fat-1 gene cdna was constructed and transfected into mouse embryonic fibrocyte Then the expression level was detected by RT-PCR and Laser Scanning Confocal Microscope the change of cellular ω-6pufas / ω-3pufas ratio was examined by gas chromatography the inhibiting rate of cells proliferation was observed by MTT method and cell apoptosis was evaluated by flow cytometry Results showed that the cells proliferation rate was higher and cells apoptosis magnitude was lower than those in the control cells In conclusion fat-1 gene could significantly decrease the ratio of cellular ω-6pufas / ω-3pufas and inhibit apoptosis of the 3T3 cell It shows strong cell-protective effects on mouse embryonic fibrocyte No No * Tel geyinlin@ 126 com Received March Accepted June Supported by National Natural Science Foundation of China No and Foundation from Ministry of Education No * Corresponding author Tel geyinlin@ 126 com

2 Key words apoptosis ω-3 polyunsaturated fatty acids dehydrogenase gene expression embryo fibroblast cell PUFAs 6PUFAs 20 4ω-6PUFAs Sigma 1 2 pegfpc1-fat-1 fat-1 cdna WBGene PUFAs ω-6pufas ω-3pufas 1 2 ω-6pufas 5'-GGGGTACCGCCACCATGGTCGCTCAT TCCT-3' KpnⅠ 5'-CGCGGATCCTCCCTTGGCCTTTGCCTT- 3 4 ω-3pufas 3' BamHⅠ pcaggs-fat-1 PCR fat cdna PCR ω-6pufas ω-3pufas 4 1 ~ 6 KpnⅠ / BamHⅠ ~ 30 1 ω- pegfpc1 3PUFAs TOP10 Kanamycin 7 8 ω-6pufas ω-3pufas TaKaRa - 70 ω-3 ω-3pufas DMEM Caenorhabditis elegans ω-3 24 h 70% 96 fat-1 ω ng pegfpc1-fat μl Xfect ω-6pufas Polymer μg pegfpc1-fat-1 ω-3pufas fat μl Xfect Polymer 6 6 μg ω- pegfpc1-fat μl Xfect Polymer 6PUFAs ω-3pufas pegfpc1 Xfect Polymer 10 s fat-1 10 min DNA-Polymer pegfpc1-fat % CO 2 4 h RT-PCR 48 h fat-l ω-6pufas ω-3pufas MTT 1 4 pegfpc1 EGFP 488 nm RT- 1 PCR RNAiso Plus RNA 1 1 fat-1 cdna pcaggs-fat Kit min cdna PrimeScript RT-PCR Kit β-actin 5'-CCAAGGCCAACCGCGAGA AGATGAC-3' 5'-AGGGTACATGGTGGTG CCGCCAGAC-3' 490 bp Fat-1 cdna ATG 630 bp TaKaRa Alexa Fluor 488 annexin V and PI for Flow Cytometry kit Invitrogen Xfect Polymer Clontech 75% RNase-free RNA PrimeScript RT-PCR Gibco 5'-GGTTCCCAGTGTACACTCTGTTCGGTTTCTGTGAT DNA Omega 18 2ω- G-3' fat bp 5'-

3 8 ω-3 fat CGCGGATCCTCCCTTGGCCTTTGC CTT-3' 579 bp 94 3 min s s 72 1 min h 0 01% BHT 0 5 mol / L KOH 1 ml 80 2 h 14% BF3 1 ml 80 1 h Fig 1 The KpnⅠ / BamHⅠ digestion of pegfpc1-fat ml The Kpn Ⅰ / BamH Ⅰ digested plasmid pegfpc1 and fat-1 PUFAs gene were ligated by T4 DNA ligase at 4 for 16 hours Then 1 6 MTT ligation mixture was transformed into TOP10 competent cells 1 3 A The recombinant plasmid pegfpc1-fat-1 extracted from the 60 μmol / L 18 2 ω-6pufas Linoleic acid positive clone was identified by KpnⅠ / BamHⅠ digestion M 1 kb DNA ladder 1 2 Kpn I / BamHI digestion of pegfpc ω-6pufas arachidonic acid B fat-1 C pegfpc1 60 μmol / L ω-6PUFAs D pegfpc1-fat-1 60 μmol / L ω-6PUFAs 24 ~ h MTT 5 mg / ml 20 μl 4 h 150 μl fat-1 DMSO 10 min 490 nm SPSS h PBS 1 1 AnnexinV Fig / ml 100 μl Alexa FluorR 488 annexinv 5 μl 100 μg / ml PI 1 μl 15 min 400 μl 1 annexin pegfpc1-fat-1 PCR KpnⅠ / BamHⅠ Fig 1 Fig 2 RT-PCR identification of fat-1 transcript levels DNAMAN GenBank After transfection 24 hours the total cellular RNA was fat-1 cdna extracted by RNAiso Plus and chloroform then the total TaKaRa RNA was reverse transcript into cdna and the following SJQ1031 RT-PCR was carried out at 94 3 min s 2 2 Fat s 72 1 min 30 cycles M 100 bp plus 48 h RT-PCR DNA ladder 1 RT-PCR products using pegfpc1 as pegfpc1-fat-1 fat-1 pegfpc1 fat nm pegfpc1-fat-1 pegfpc1 pegfp-fat-1 template 2 3 RT-PCR products using pegfpc1-fat-1 as template

4 ω-6pufas / ω-3pufas 24 h 48 h 72 h ω-6pufas / ω-3pufas h 48 h 72 h fat-1 ω- 6PUFAs ω-3pufas 48 h ω-6 PUFAs / ω-3 PUFAs h ω-6 PUFAs / ω-3 PUFAs Fig 4 Cell proliferation assessment by MTT method P < h Mouse embryonic fibroblasts were transfected by pegfpc1 Table 1 fat-1 or pegfpc1-fat-1 with 60 μmol / L 18 2 ω-6 PUFAs ω-6pufas linoleic acid and 60 μmol / L 20 4 ω-6 PUFAs ω-3pufas ω-6pufas / arachidonic acid in the culture medium After ω-3pufas transfection 48 hours MTT method was used to test the 2 4 cell viability Ctrl cells without any treatment LA MTT 60 Linoleic acid AA arachidonic acid V empty vector μmol / L 18 2 ω-6 PUFAs linoleic acid 20 transfection Fat-1 pegfpc1-fat1 transfection 4 ω-6 PUFAs arachidonic acid 48 h pegfpc1-fat nm ± 0 10 ω-6 PUFAs pegfpc1 490 nm ± ω-3 PUFAs 3T OD = x 珋 ± s fat-1 P < fat-1 ω-6pufas Table h AnnexinV -Alex Fluor4 8 8 / PI Gas chromatography analysis of cellular PUFAs after transfection 72 hours x 珔 ± s n = 3 Number Peak retention time min Long chain fatty acids pegfpc1 pegfpc1-fat ± ± ± ± ± ± ω ± ± ω ± ± ω ± ± ± ± ± ± ω ± ± ω ± ± ω ± ± ω ± ± ω ± ± ω ± ± ω ± ± ω ± ± ω ± ± ω3EPA 0 39 ± ± ω3DHA 1 77 ± ± 0 53 Total ω-6 PUFAs / ω-3 PUFAs Mouse embryonic fibroblasts were transfected by pegfpc1 and pegfpc1-fat-1 with 10 μmol / L Linoleic acid and 10 μmol / L Arachidonic acid After transfection hours total cellular fatty acids were extracted and gas chromatography was used to examine the PUFAs composition

5 8 ω-3 fat Fig 3 Fluorescence photos of mouse embryonic fibroblasts after transfection 48 hours 200 After transfection 48 hours the expressed protein level was detected by Laser Scanning Confocal Microscope at the 488 nm exciting light A Normal mouse embryonic fibroblasts without transfection B and D Mouse embryonic fibroblastss transfected by pegfpc1 C and E Mouse embryonic fibroblasts transfected by pegfpc1-fat-1 Fig 5 Representative of flow cytometry analysis of cell apoptosis After transfection 48 hours the mouse embryonic fibroblastsce were harvested and stained by the dyestuff PI and annexinv then the stained cells were analyzed by flow cytometry to measure fluorescence intensity of live cells apoptosis cells and the dead cells A Normal cells B Cells transfected by pegfpc1 C Cells transfected by pegfpc1-fat-1 Alexa FluorR 488-/ PI- Alexa FluorR / PI + Alexa FluorR / PI- Fig 5 DNA pegfpc ± 4 6% pegfpc1-fat ± ω-3pufas 1 8% OD = xs P 珋 < PUFAs 15 Fat-1 ω- 6PUFAs ω-3pufas ω-3pufas

6 EPA DHA ω-3pufas ω- studies J 3PUFAs 20 9 Patil S Nag A fat-1 fat-1 ω-3pufas ω-6pufas ω-3pufas ω-6pufas / ω-3pufas ω PUFAs fat-1 USA Ge Y L Chen Z H Kang Z B fat-1 ES 13 J fat-1 fat-1 vitro J Chin J Biochem Mol Biol 14 Ge Y L Wang X Y Chen Z H ω-3pufas ω- 6PUFAs ω-3pufas References 1 Minihane A M Khan S Leigh-Firbank E C et al ApoE polymorphism and fish oil supplementation in subjects with an atherogenic lipoprotein phenotype J Arterioscler Thromb Vasc Biol Manfred Schwab N3 fatty acids Encyclopedia of Cancer M Springer-Verlag Berlin Heidelberg New York Bourre J M E Dumont O L Piciotti M J et al Comparison of vegetable and fish oil in the provision of n-3 polyunsaturated fatty acids for nervous tissue and selected organs J J Nutr Biochem Williams C M Moore F Morgan L et al Effects of n-3 fatty acids on postprandial triglyceride and hormone concentrations in normal subjects J Br J Nutr Sahena F Zaidul I S M Jinap S et al PUFAs in fish extraction fractionation importance in health J Comprehensive Rev Food Sci Simopoulos A P Essential fatty acids in health and chronic disease J Am J Clin Nutr suppl 560S-569S 7 Minihane A M Brady L M Lovegrove S S et al Lack of effect of dietary n-6 n-3 PUFA ratio on plasma lipids and markers of insulin responses in Indian Asians living in the UK J Eur J Nutr Harris W S N-3 fatty acids and serum lipoproteins human Am J Clin Nutr suppl 1645S-1654S Production of PUFA concentrates from poultry and fish processing waste J J Am Oil Chem Soc Guil-Guerrero J L Belarbi E H Purification process for cod liver oil polyunsaturated fatty acids J J Am Oil Chem Soc Kang Z B Ge Y L Chen Z H et al Adenoviral gene transfer of Caenorhabditis elegans n-3 fatty acid desatuarse optimize fattty acid composition in mammalian cells J Proc Natl Acad Sci et al Effects of adenoviral gene transfer of C elegans n-3 fatty acid desaturase on the lipid profile and growth of human breast cancer cells J Anticancer Res A ω6 Ge Y L Geng F S Zhang J Y et al Expression of ω6 fatty acid desaturase has an inhibition effects on breast cancer cells in et al Gene transfer of the Caenorhabditis elegans n-3 fatty acid desaturase inhibits neuronal apoptosis J J Neurochem Sawyer M B Field C J Possible mechanisms of ω-3 PUFA antitumour action J Diet Cancer Terry P D Rohan T E Wolk A In takes of fish and marine fatty acids and the risks of cancers of the breast and prostate and of other hormone-related cancers a review of the epidemiologic evidence J Am J Clin Nutr Yam D Peled A Shinitzky M Supperssion of tumor growth and metastasis by dietary fish oil combined with vitamins E and C and cisplatin J Cancer Chemother Pharmacol SanGiovanni J P Chew E Y et al The role of omega-3 long chain polyunsaturated fatty acids in health and disease of the retina J Prog Retin Eye Res Carlson S E Cooke R J Werkman S H et al First year growth of preterm infants fed standard compared to marine oil n-3 supplemented formula J Lipids Griffin B A Zampelas A Influence of dietary fatty acids on the atherogenic lipoprotein phenotype J Nutr Res Rev Pohlmeier W E Hovey R C Van Eenennaam A L Reproductive abnormalities in mice expressing omega-3 fatty acid desaturase in their mammary glands J Transgenic Res