http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology H 2 O 2 AKT2 TUNEL DNA ladder AKT2 sirna PI3K / AKT
|
|
- Ναχώρ Χριστόπουλος
- 6 χρόνια πριν
- Προβολές:
Transcript
1 ISSN CN / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology ~ 1050 AKT2 * AKT2 H 2 RT-PCR AKT2 cdna pcdna3 1 / myc-his - A AKT2 AKT2 DN-AKT2 MCF-7 AKT2 2 sirna TUNEL DNA ladder AKT2 AKT2 sirna WT-AKT2 DN-AKT2 Western WT-AKT2 DN-AKT2 MCF-7 AKT2 sirna AKT2 TUNEL DNA ladder WT-AKT2 MCF-7 DN-AKT2 P < 0 05 P > 0 05 AKT2 AKT2 sirna PI3K / AKT wortmannin WT-AKT2 QuikChange AKT2 DN-AKT2 WT- AKT2 AKT2 MCF- 7 Bβ RNA Q78 Overexpression of AKT2 Suppresses -induced Breast Cancer Cells Apoptosis LING Cai-Hong LAN Feng-Hua HAN Jun-Yong DONG Li-Hong HUANG Qiao-Jia * Research Center for Molecular Medicine Fuzhou General Hospital of Nanjing Command PLA Fuzhou China Abstract To study the effect of AKT2 gene on the apoptosis induced by in breast cancer cells the full length AKT2 cdna was amplified by RT-PCR and then inserted into pcdna3 1 / myc-his - A vector to construct pcdna3 1 / myc-his - A-AKT2 wild type WT-AKT2 Dominant negative mutant of AKT2 DN-AKT2 were generated by QuikChange site-directed mutagenesis and confirmed by sequencing The eukaryotic expression vector of WT-AKT2 or DN-AKT2 were transfected into MCF-7 breast cancer cells Clones stably expressing AKT2 or DN-AKT2 were obtained by neomycin selections Two sirnas targeted AKT2 were designed and synthesized then transfected into the same cell line No 08MA100 No 2009J01181 * Tel huangqj100@ 126 com Accepted August Received October Supported by Medical Scientific Research Foundation of Nanjing Command No 08MA100 and Natural Science Foundation of Fujian Province No 2009J01181 * Corresponding author Tel huangqj100@ 126 com
2 11 AKT Apoptosis with or without treatments was determined by TUNEL and DNA Ladder assays The expression of WT-AKT2 and DN-AKT2 as well as sirna inhibition in MCF-7 cells was demonstrated by Western blotting WT-AKT2 over-expression significantly increased the resistance of -induced apoptosis in MCF-7 cells but not DN-AKT2 The number of apoptotic cells following treatment was significantly lower in WT-AKT2 stably transfected cells than those in empty vector control or nontransfected cells P < 0 05 The inhibition of apoptosis was abolished in AKT2 sirna or PI3K / AKT2 inhibitor wortmannin treated cells Our study suggested that AKT2 inhibit -induced apoptosis in cancer cells and interference of AKT2 might be used as a therapeutic approach for breast cancers Key words protein kinase B beta Akt2 gene cloning RNA interference gene transfection cell apoptosis -3 PI3K / B protein kinase B PKB AKT AKT2 β-actin Western AKT2 β Cell 1 ~ 3 Signal Sigma PI3K / AKT SantaCruz TUNEL DNA Ladder AKT pcdna3 1 / myc-his - A Invitrogen AKT 3 AKT1 / PKBα AKT2 / PKBβ AKT3 / PKBγ AKT DMEM Invitrogen 4 ~ 6 AKT1 PCR DH5α AKT2 G418 Invitrogen 4 ~ 6 5 cm 7 cm AKT1 AKT2 X AKT2 1 2 RT-PCR Akt2 cdna Trizol NIH OVCAR- AKT2 3 RNA RNA M-MLV AKT2 sirna oligo T 25 μl AKT h min 90 3 min AKT2 GenBank NM _ F 5'- CTAGCTAGCGATGAATGAGGT GTCTGTCATC -3' R 5'-GG RIPA BCA PCR 94 4 min s s DNA DNA s min PCR OMEGA Nhe Ⅰ Kpn Ⅰ ECL Invitrogen NIH OVCAR-3 MCF-7 Mycco s 5A GGTACCCTCGCGGATGC TGGCCGA-3' NheⅠ KpnⅠ Platinum Taq DNA PCR 1 2% DpnⅠ T4-DNA New England Bio 1 3 AKT2 Lab M-MLV Platinum Taq WT- AKT2 DNA Kpn Ⅰ + NheⅠ RT-PCR Lipofectamine TM 2000 Lipofectamine LTX PVDF 7
3 PA28β LB UAGUCGAAGUCATT-3' sirna + AMP DNA KpnⅠ + Nhe Ⅰ CGUTT-3' 5'-ACGUGACACGUUCGG F 5'-TAATACGACTCAC TATAGGG-3' T7 promoter R 5'-TAGAA GGCACAGTCGAGG-3' BGH 1 4 AKT2 100 nmol / L sirna DN-AKT2 AKT2 181 Lys PCR AKT2 Met DN- 1 7 Western AKT2 4 Stratagene Quikchange WT-AKT2 1 5'-CTA CTACGCCATGATGATCCTGCGGAAGG-3' 5'- CCTTCCGCAGGATCATCATGGCGTAGTAG-3' ECL AAG X ATG MCF-7 Quikchange 1 5 WT-AKT2 DN-AKT2 MCF-7 24 h MCF-7 3 mmol / L 8 h h TUNEL DNA Ladder 2 ml Lipofectamine TM 2000 Lipofectamine LTX TUNEL WT-AKT2 DN-AKT2 DNA 3 μg / DNA Ladder MCF-7 DNA Ladder AKT2 DN-AKT2 MCF-7 T 7 Western RT-PCR AKT2 4 ~ 5 AKT2 MCF-7 / β GAPDH 1 6 AKT2 sirna AKT2 sirna 2 Genescript sirna AKT2 sirna 2 1 Akt2 AKT2 90 ~ ~ 468 GAGCGACGGCT 5' UUCUCCGAACGUGUCA AGAATT-3' Lipofectamine TM nmol / L AKT2 2 sirna MCF-7 AKT2 / MCF-7 RT- 9 Western 1 AKT2 β HRP IgG 2 MCF-7 0 1% DMEM 16 h TUNEL DNA Ladder SPSS13 0 T P < 0 05 AKT2 T 1 2% RT-PCR bp CCTTCATT TGACTTCGACTATCTCAAA Fig 1A sirna 1 2% KpnⅠ + Nhe MCF-7 WT- 5'- GAGCGACGGCUCCUUCAUUTT- 3' 5' UGA Ⅰ AKT2 RT- CUUCGACUAUCUCAAATT-3' 5'- PCR AAUGAAGGAGCCGUCGCUCTT-3' 5'-UUUGAGA Fig 1B
4 11 AKT AKT2 2 2 AKT2 L181 M181 DN- Quikchange WT- Lys AAG Met ATG AKT2 181 Lys 4 pcdna3 1-myc-HisA Fig 2 Fig 1 RT-PCR amplification of AKT2 cdna and recombinant plasmid identified by Kpn Ⅰ + NheⅠ AKT2 cdna was amplified by RT-PCR and then inserted into pcdna3 1-myc-HisA - vector by KpnⅠ and Nhe Ⅰ sites to construct pcdna3 1 / myc-his - A-AKT2 A M DL2000 DNA marker 1 AKT2 cdna was obtained by RT-PCR B M DL2000 DNA marker 1 Recombinant plasmid digested by KpnⅠ + NheⅠ 2 Empty plasmid digested by KpnⅠ + NheⅠ 3 AKT2 cdna obtained by RT-PCR Fig 2 Part inserted sequences of DN-AKT2 before and after QuikChange site-directed mutagenesis DN-AKT2 compared with WT-AKT2 DN-AKT2 was obtained by changing the lysine residue at position 181 of AKT2 to a methionine residue using QuikChange site-directed mutagenesis A WT-AKT2 B DN-AKT2 2 3 AKT2 sirna MCF-7 AKT2 AKT2 AKT2 DN-AKT2 PVDF P < WT-AKT2 DN-AKT2 MCF-7 1 M r 60 kd AKT2 Fig 3 pcdna3 1 / myc-his - A MCF-7 AKT2 WT-AKT2 DN-AKT AKT2 P > 0 05 AKT2 Western AKT2 sirna MCF-7 MCF-7 AKT2
5 Fig 3 AKT2 expression in MCF-7 cells analyzed by Western blotting A Over-expressed AKT2 and DN- AKT2 protein in MCF-7 cells were achieved by transfected WT-AKT2 and DN-AKT2 expression vector with Lipofectamine whereas control group was transfected with empty vector 1 Transfected with WT-AKT2 expression vector 2 Transfected with DN-AKT2 expression vector 3 Transfected with empty vector 4 Untransfected cells B sirna Total of 100 nmol / L of sirna1 plus sirna2 against AKT2 gene were transfected into MCF-7 cells by Lipofectamine to silence AKT2 expression 1 Untransfected cells 2 Transfected with sirna negative control 3 Transfected with AKT2 sirna sirna AKT2 sirna AKT2 2 4 AKT2 sirna MCF-7 AKT2 mrna P < 0 05 t AKT2 / MCF-7 DN-AKT2 / MCF-7 AKT2 mrna AKT2 sirna wortmannin P > 0 05 MCF-7 AKT2 / MCF-7 AKT2 sirna AKT2 mrna sirna P < 0 05 Fig AKT2 AKT2 DNA MCF-7 TUNEL MCF-7 3 / MCF- 7 3 mmol / L 8 h reactive oxygen AKT2 ROS ROS AKT2 / MCF-7 / MCF-7 ± SD 17% ± 2 83% 18 5% ± 3 53% Fig 5A AKT2 / MCF-7 6% ± 2 56% Fig 5A P c < 0 05 t nmol / L PI3K / Akt wortmannin 3 h 13 AKT2 sirna wortmannin 3 h 44% ± 4 24% 40 5% ± 2 12% P < 0 05 AKT2 / MCF nmol / L AKT2 sirna MCF-7 AKT2 / MCF- 7 Akt2 sirna RT-PCR WT-AKT2 DN-AKT2 33% ± 4 24% AKT2 / MCF-7 DN- P < 0 05 AKT2 / MCF-7 AKT2 mrna P > 0 05 AKT2 DN- empty / MCF-7 AKT2 / MCF-7 H 2 31% ± 2 83% / MCF-7 P < 0 05 DNA Ladder 3 h AKT2 / MCF-7 AKT2 sirna DN-AKT2 / MCF-7 H 2 DNA Ladder Fig 5B AKT2 / MCF-7 Ladder species NADPH 10 ~ 11 ROS
6 11 AKT Fig 4 Detection of AKT2 mrna expression by RT- PCR The expression of AKT2 mrna in AKT2 / MCF- 7 DN-AKT2 / MCF-7 and empty vector / MCF-7 stable transfectants and untransfected MCF-7 MCF-7 cells transfected with sirna negative control or AKT2 sirna and AKT2 / MCF-7 transfected with AKT2 sirna were detected by RT-PCR The results confirmed that these transfections resulted in elevated exogenous WT AKT2 and DN-AKT2 in AKT2 / MCF-7 and DN-AKT2 / MCF-7 stable transfectants groups and decreased AKT2 levels in AKT2 sirna transfected groups respectively A Electrophoretic analysis of AKT2 mrna expression M DL2000 DNA marker 1 Empty / MCF-7 stable transfectant 2 AKT2 / MCF-7 stable transfectant 3 untransfected MCF-7 4 MCF-7 cells transfected with sirna negative control fragment 5 MCF-7 cells transfected with AKT2 sirna 6 AKT2 / MCF-7 stable transfectant transfected with Akt2 sirna 7 DN-AKT2 / MCF-7 stable transfectant B The relative amount of the AKT2 mrna expression in different cell groups were showed in bar graph P < 0 05 vs empty vector / MCF-7 stable transfentant and untransfected cells P < 0 05 vs cells tranfected with control sirna and untransfected cells Fig 5 AKT2 decreased MCF-7 cells apoptosis in response to treatment MCF-7 cell apoptosis as revealed by TUNEL and DNA ladder were increased by Pre-treatment of cells with wortmannin before further increased cell apoptosis whereas over-expression of AKT2 decreased cell apoptosis and knocking down of AKT2 with sirna caused an increase in cell apoptosis too Similarly DN-AKT2 increased induced cell apoptosis A The average percentages of apoptotic cells detected by TUNEL method P < 0 05 vs cells transfected with empty vector or untransfected cells and treated with P < 0 05 vs cells tranfected with control sirna and treated with P < 0 05 vs untransfected cells treated with B -induced MCF-7 cell apoptosis was determined by DNA Ladder assay 1 Empty vector 2 Empty vector 3 AKT2 WT 4 Untransfected cells 5 Untransfected cells 6 Control sirna 7 Control sirna 8 AKT2 sirna 9 AKT2 WT + AKT2 sirna 10 Wortmannin 100 nmmol / L 11 DN-AKT2 O 2 AKT1 AKT AKT2 PI3K / AKT2 NIH OVCAR-3 AKT2 4 mrna BCL-2 NF-кB DNA 14 AKT1 RT-PCR AKT2 cdna AKT2 4 ~ 5 AKT pcdna3 1 / myc-his - A
7 MCF-7 AKT2 mrna growth J AKT2 DN-AKT2 AKT2 sirna MCF-7 AKT2 / MCF-7 AKT2 mrna TUNEL DNA Ladder AKT2 WT-AKT2 DN-AKT2 sirna WT-AKT2 WT-AKT2 MCF-7 AKT2 sirna AKT2 AKT2 AKT2 / MCF-7 AKT2 8 sirna AKT2 PI3K / Akt wortmannin DN-AKT2 sirna AKT2 AKT2 J AKT2 AKT2 ROS AKT2 J AKT2 sirna References 1 Woodard J Sassano A Hay N et al Statin-dependent suppression of the Akt / mammalian target of rapamycin signaling cascade and programmed cell death 4 Up- regulation in renal cell carcinoma J Clin Cancer Res Zhang H Chen D Ringler J et al Disulfiram treatment facilitates phosphoinositide 3-kinase inhibition in human breast cancer cells in vitro and in vivo J Cancer Res Grimshaw K M Hunter L J Yap T A et al AT7867 is a potent and oral inhibitor of AKT and p70 S6 kinase that induces pharmacodynamic changes and inhibits human tumor xenograft Mol Cancer Ther Arboleda M J Lyons J F Kabbinavar F F et al Overexpression of AKT2 / protein kinase Bβ leads to up-regulation of β1 integrins increased invasion and metastasis of human breast and ovarian cancer cells J Cancer Res Vandermoere F El Yazidi-Belkoura I Demont Y et al Proteomics exploration reveals that actin is a signaling target of the kinase Akt J Mol Cell Proteomics Andrabi S Gjoerup O V Kean J A et al Protein phosphatase 2A regulates life and death decisions via Akt in a contextdependent manner J Proc Natl Acad Sci U S A Huang Q Huang Q Lin W et al Potential roles for PA28b in gastric adenocarcinoma development and diagnosis J J Cancer Res Clin Oncol TLR SRP54 SRP RNA J Huang Qiao-Jia Lan Feng-Hua Dong Li-Hong et al Role of TLR sequence in binding of SRP54 with SRP RNA and signal peptide J Chin J Biochem Mol Biol Huang Q Yang J Lin Y et al Differential regulation of interleukin-1 receptor and Toll-like receptor signaling by MEKK3 Nat Immunol Mackey A M Sanvicens N Groeger G et al Redox survival signalling in retina- derived 661 W cells J Cell Death Differ Yoon S O Kim M M Park S J et al Selenite suppresses hydrogen peroxide-induced cell apoptosis through inhibition of ASK1 / JNK and activation of PI3-K / Akt pathways J FASEB 12 Dossumbekova A Berdyshev EV Gorshkova I et al Akt activates NOS3 and separately restores barrier integrity in - stressed human cardiac microvascular endothelium J Am J Physiol Heart Circ Physiol H2417-H Hirpara J L Cleomentú M V Pervaiz S Intracellular acidification triggered by mitochondrial-derived hydrogen peroxide is an effector mechanism for drug-induced apoptosis in tumor cells J J Biol Chem Qin S Chock P B Implication of phosphatidylinositol 3-kinase membrane recruitment in hydrogen peroxide-induced activation of PI3K and Akt J Biochemistry Cheng G Z Chan J Wang Q et al Twist transcriptionally upregulates AKT2 in breast cancer cells leading to increased migration invasion and resistance to paclitaxel J Cancer Res
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology HBx HBxΔ127
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2011 5 27 5 426 ~ 430 X HBxΔ127 ERK 1 * * 300071 hepatitis B virus HBV X HBx HBx HBxΔ127 1
Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού
Σχολή Θετικών Επιστημών Τμήμα Βιολογίας Πρόγραμμα Μεταπτυχιακών Σπουδών Κατεύθυνση: Εφαρμοσμένη γενετική και βιοτεχνολογία ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου
CPT. Tsuchiya. beta. quantitative RT PCR QIAGEN IGFBP. Fect Transfection Reagent sirna. RT PCR RNA Affymetrix GeneChip Expression Array
7 PTEN p Tsuchiya DNA Hepatocyte nuclear factor beta HNF beta HNFbeta IGFBP GLUT G Pase MODY maturity onset diabetes of the young Tsuchiya HNFbeta HNFbeta HNFbeta sirna CPT HNFbeta HNFbeta TOVG KOC ESMCAS
Journal of Ningxia Medical University. Annexin P19 mrna P < AnnexinA2 P19 mrna. AnnexinA2 P19 mrna. PCR 1.
33 6 2011 6 Journal of Ningxia Medical University 511 1674-6309 2011 06-0511 - 04 AnnexinA2 P19 1 2 3 3 3 1. 415700 2. 750004 3. 750004 AnnexinA2 P19 62 IHC RT - PCR Western blot AnnexinA2P19 mrna AnnexinA2
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN
BIOTECHNOLOGY BULLETIN 2011 3 α 1 2-300457 PCR Helicobacter pylori HP DNA α 1 2- α 1 2-fucosyltransferase α 1 2-fuct 906 bp pet-22b + pet-fuct BL21 DE3 25 0. 1 mmol /L IPTG 4 h SDS-PAGE 33 kd α 1 2- BL21
Chinese Journal of Biochemistry and Molecular Biology. p38mapk
ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2008 6 24 (6) :537 542 Grx1 HEK293T H 2 O 2 p38mapk 1), 2), 1), 1), 3), 1), 1) 3 ( 1), 150081 ; 2), 150081 ; 3), 161042)
, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells
2011 9 1 77 SLC26A4 HEK 293 1 2 1 1 1 1 (100853) 2 ( 050051) SLC26A4 (pegfp enhanced green fluorescent protein) SLC26A4 pegfp-slc26a4 HEK293 pegfp-slc26a4 HEK293 - (RT-PCR) SLC26A4 mrna Western Blot (
ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ
- - ό ό : Ω ί ό ί ώ.. ά ή ί ός ή ς ύ ί ί ή έ ώ ό. ή ς ά ς ής ό ός ά ς ή έ ός ή ς ί ής ί ς. ό έ ώ - ώ ή ής ή ς- ί ά ά ς ί ς. ά ί ί έ έ ά ύ ή, ό ί ά, ό ό ά έ ά ής ί ύ George Wald ή ί έ ς ί ύ ό ς ί ς ά έ
IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2
344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.
Basic & Clinical Medicine PLGA MUC1 MUC1 IC 50 MUC1 +
2011 7 31 7 1001-6325 2011 07-0751 -05 July 2011 Vol. 31 No. 7 MUC1 1 1 1 2 1 1* 1. 100005 2. 100190 MUC1 PLGA MUC1 MUC1 MUC1 MCF-7 HepG2 MTS IC 50 MUC1 225. 3 ± 9. 2 nm 83. 6% ± 1. 7% MUC1 + MCF-7 P
Shiraia sp. Slf14 III
39 4 Vol 39 No 4 2015 7 Journal of Jiangxi Normal University Natural Science Jul 2015 1000-5862 2015 04-0430-05 Shiraia sp Slf14 III 1 1 2 1 1 1 2* 1 330022 2 330013 Polyketide synthase PKS Shiraia sp
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to facilitate intracellular survival Hongwei Gu 1,2*, Chihao Zhao 1,2*, Tianfu Zhang 1,2*, Hongwei Liang 1,2, Xiao-Ming Wang 1,
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity Jian-Long Li 1,a, Wei Zhao 1,a, Chen Zhou 1,a, Ya-Xuan
Mouse Gene 2.0 ST Array Shn3. Runx2 Shn3. Runx2 Shn3 Runx2. adult. (Schnurri, Shn)3/Hivep3. Runx2 Shn/Hivep. ST2 BMP-2 Shn3
adult (Schnurri, Shn)3/Hivep3 Runx2 Shn/Hivep Shn3 Shn3 Shn3 Shn3 Shn1 Shn2 Shn3 gain-of-function loss-of-function Shn3 in vivo mimic MC3T3-E1 ST-2 ATDC5 C3H10T1/2 ALP RT-PCR alcian blue RT-PCR Affymetrix
BGP TRACP-5b BGP TRACP-5b P 0.05
()2014 10 8 20 Chin J Clinicians(Electronic Edition),October 15,2014,Vol.8,No.20 3615 OP 2011 1 2013 6 120 OP 3 40 37 40 38 40 38 BMD BGP-5b TRACP-5b OP 1 4 L1 4NFTH BMD BGP TRACP-5b P 0.05 OP L1 4 NF
Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer
Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer Naomi Morota Newman M Key Words woman diagnosed with breast cancer, rehabilitation nursing care program, the
Science of Sericulture
Science of Sericulture 2012 38 1 0065-0069 ISSN 0257-4799 CN 32-1115 /S E-mail CYKE@ chinajournal. net. cn 215123 25 0 ~ 24 h GSH GSSG GSH + 2GSSG GSH /GSSG S- GST TPX 23% GR 57% GSH TPX GST GSSG 61% GSH
Chinese Journal of Biochemistry and Molecular Biology RNA.
ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2009 8 25 (8) :759 763 RNA 1), 2), 1) 3, 1) 1),2), ( 1), 400014 ; 2), 400014) RNA, (CTGF) RNA. EcoR Hind, ptm12 CTGF PCR
Gateway cdna. cdna. pdest TM ~ cfu/ ml ~ cfu bp
2010 32 4 0791-0796 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com Gateway cdna * * 350002 cdna cdna Gateway RNA mrna 3 cdna BP LR cdna pdest TM
Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin
2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,
Supporting Information
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Supporting Information Crotonols A and B, Two Rare Tigliane Diterpenoid
Chinese Journal of Biochemistry and Molecular Biology. psilencer 2. 0-FucT Ⅶ 2
ISSN 1007-7626 CN 11-3870 / Q 2010 3 Chinese Journal of Biochemistry and Molecular Biology 26 3 290 ~ 294 RNA FucT VII HT-29 HUVECs 1 2 1 1 1 * 1 161006 2 150040 RNA RNAi Ⅶ FucT Ⅶ HT-29 HUVEC 3 FucT Ⅶ
ACTA CHINESE MEDICINE. diabetic nephropathies DN 24. urine protein quantitation in 24 hours 24hUTP serum creatinine Scr
* TGF-β1 215600 diabetic nephropathies DN 24 urine protein quantitation in 24 hours 24hUTP serum creatinine Scr -β1 transforming growth factor-β1 TGFβ1 STZ DN SD 10 10 10 8 24hUTP Scr HE ELISA TGF-β1 24hUTP
Survivin sirna. Inhibitory effect of small interference RNA targeting survivin nanospheres on human pancreatic carcinoma BXPC-3 cell growth
Experimental Research Chin J Curr Adv Gen Surg Survivin sirna 253 1 2 1 3 1 1 1 1 266003 266003 : survivin sirna survivin sirna BXPC- 3 : BXPC- 3 BXPC- 3 4 survivin sirna survivin sirna RT- PCR survivin
Construction and Identification of Transforming Growth Factor-β1 shrna Expressing Vector
2010 30 5 975 -β1shrna 215123 TGF -β1 RNA shrna TGF-β1 mrna Ambion Target Finder TGF-β1shRNA BglⅡ HindⅢ psuper gfp-neo shrna psuper gfp-neo DH5a ELISA TGF-β1shRNA ELISA shrna-a shrna-b shrna-c TGF-β1 shrna-b
TGFp FSH INH INH
(210095) E-mail ( genlinwang@hotmail.com) - -(Strept Avidin-Biotin-Peroxidase Complex SABC), 1 32,, 1 inhibin INH α 32 000 TGFp FSH FSH [1] INHα Sertoli Noguchi 1997 [2] Meunier et al.1988 [3] INH INH
Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology
2012 34 2 382-387 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com 212018 105 W 42 2 min 0. 631 TS202. 3 A 1000-2286 2012 02-0382 - 06 Optimizing
Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone
ISSN 100727626 CN 1123870ΠQ 2002 12 Chinese Journal of Biochemistry and Molecular Biology 18 (6) :693 697 cdna, 3, (, 150030) RNA, cdna cdna PCR, 380 bp cdna pmd2182t2verctor 3,,, 96 %, 95 %,, 74 %, 95
0. 35g kg ~ 2. 0cm 10min. Nar- 15μL 6mm
22 Journal of Ningxia Medical University 34 1 2012 1 1674-6309 2012 01-0022 - 03 1 2 1 3 1. 750004 2. 750004 3. 750004 60 SD 300 ± 20 g 5 S ICH M 2 M 4 M 8 12 Deinsberger S M 2 4 8 - ICH 10min 2 4 8 mg
High mobility group 1 HMG1
Vol. 29, pp.705 ~ 711, 2001 High mobility group 1 HMG1 13 12 20 anti-neutrophil cytoplasmic antibodies, ANCA ANCA 1982 Davies 1980 1 high mobility group HMG1 HMG2 30 kd high mobility group HMGHMG HMG1
Cellular Physiology and Biochemistry
Original Paper 2016 The Author(s). 2016 Published The Author(s) by S. Karger AG, Basel Published online: November 25, 2016 www.karger.com/cpb Published by S. Karger AG, Basel 486 www.karger.com/cpb Accepted:
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology RT- PCR fat-1 3T3
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2011 8 27 8 755 ~ 760 ω-3 fat-1 1 2 1 * 1 1 1 2 1 266021 2 266109 ω-6pufas / ω-3pufas ω- 3PUFAs
Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...
III Contents I II III Abstract... I Zusammenfassung... II Contents... III 1 Aim of the work... 1 2 Introduction... 2 2.1 Short overview of Chinese hamster ovary cell lines... 2 2.2 Unspecific mutations:
[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,
in vitro αα In Vitro α-glucosidase and α-amylase Inhibitory Effects of Herbal Tea Leaves from Yacon (Smallanthus sonchifolius) 1, 1, 1, 2, 1, 2, 3, 1, 2, 1, 2, 1, 2, 1, 2 1, 2, *, 1 2, 3 Yuto Ueda 1, Shintaro
Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk
32 3 2011 3 ENVIRONMENTAL SCIENCE Vol 32 No 3 Mar 2011 1 1 1 2 1 100101 2 663000 Panax notoginseng Burk F H Chen 6 9 ~ 242 0 mg kg - 1 48% 2 mg kg - 1 24% 81% 14% 57% 44% 100 mg kg - 1 ADI > > > > FAO
Evaluation of the Efficacy of Olopatadine Hydrochloride in the Treating Allergic Rhinitis A Multicenter Randomized Double-blind Double-dummy Study
CHINESE JOURNAL OF ALLERGY & CLINICAL IMMUNOLOGY 1 1 2 3 4 5 6 7 1# 100730 91 5 mg 2 d 89 10 mg 1 d 14 d 2 0. 597 ± 0. 266 0. 596 ± 0. 282 P = 0. 984 79. 3% 81. 4% P = 0. 730 31. 1% 27. 3% P = 0. 573 23.
Differential Expression of DNMTs Between Gastric Tissues with and without H. Pylori Infection
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2011 11 27 11 1032 ~ 1038 DNMT 1 2 3 1 1 4 1 * 1 400016 2 400016 3 400016 4 400016 DNA DNA
http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology 1 retinoblastoma gene 1 RB1 NMD
ISSN 1007-7626 CN 11-3870 / Q http / /cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2015 2 31 2 168 ~ 174 DOI 10 13865 /j cnki cjbmb 2015 02 09 PTC NMD * 030006 mrna nonsense-mediated
2 0 1 2 2 Journal of Shanghai Normal University Natural Sciences Feb. 2 0 1 2 SNAT2. HEK293T Western blot SNAT2 - HA Q 31 A 1000-5137 2012 01-0083-06
4 1 1 Vol 41 No 1 2 0 1 2 2 Journal of Shanghai Normal University Natural Sciences Feb 2 0 1 2 SNAT2 - HA * 200234 SNAT2 - SNAT2 PCR HA SNAT2 C pbk - CMVΔ 1098-1300 - SNAT2 - HA HEK293T Western blot SNAT2
Antimicrobial Ability of Limonene, a Natural and Active Monoterpene
2010,32 (1) :24 28 http :/ / xuebao. jlau. edu. cn Journal of Jilin Agricultural University E2mail : jlndxb @vip. sina. com Ξ,,,, ΞΞ, 200062 : : 320 mg/ L,; ph 4 9, ; 80, 100,121 : : ; ; : TS20213 : A
Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang
13 4 2015 7 Chinese Journal of Bioprocess Engineering Vol. 13 No. 4 Jul. 2015 doi 10. 3969 /j. issn. 1672-3678. 2015. 04. 012 1 2 2 2 2 1. 830054 2. 361005 L- 50% IC 50 0. 27 mg /ml K I - K IS 0. 218 0.
Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application
31 5 2011 5 Acta Scientiae Circumstantiae Vol 31 No 5 May 2011 2011 - J 31 5 935-940 Huang Y M Yuan D X Peng Y Z et al 2011 Rapid determination of soluble reactive silicate in seawater by flow injection
Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica
35 1 2 0 1 7 1 DOI 10. 13193 /j. issn. 1673-7717. 2017. 01. 035 1 1 1 1 2 1. 150036 2. 150040 D101 DEAE Cellulose 52 Sephacryl S - 300 - - PJP - 1a PJP - 3a 1. 34 10 3 Da 1. 70 10 7 Da - PJP - 3a 4. 56
Hepatic Stellate Cells: Multifunctional mesenchymal cells of the Liver
Nagoya Med. J., 137 Hepatic Stellate Cells: Multifunctional mesenchymal cells of the Liver KAZUO IKEDA Department of Anatomy and Cell Biology, Graduate School of Medical Sciences, Nagoya City University
PCR. Site-directed Mutagenesis of Sumf 1 Gene of Mouse Based on Overlap Extension PCR and Construction of Eukaryotic Expression Vector
13 5 Vol13 No5 9 10 Life Science Research Oct 9 9 PCR Sumf1 *,,,,, 481 : (chromatin immunoprecipitation assay, ChIP) activator protein-2 alpha (AP-2 α) Sumf 1 PCR, AP-2 α Sumf 1, DNA, Sumf 1 103 ~111,
A Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn
56 [ ] 167-3619(009)03-056-05 Journal of Tropical Medicine Vol.9 No.3 Mar.009 * ( 510515) (PCT) CNKI VIP PCT QUADAS Metadisc1.4 DOR (SROC) SROC (AUC) Review Manager5 Meta 8 ; 7 8 (χ =3.8P=0.858I =0.0%)
P450 CYP4G19. Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody , 518060; 2.
2009 6 9 6 [ ] 1672-3619(2009)06-0591-06 591 P450 CYP4G19 1,2 1,2*,, 2, 2, 2, 2 1, (1., 518060; 2., 518020) P450 CYP4G19, CYP4G19 RT-PCR CYP4G19, T-A, pet-28a, BL21 (DE3),,,, ELISA Western-blot cdna 771bp,
ΑΜΦΙΚΟΙΛΙΑΚΗ ΒΗΜΑΤΟΔΟΤΗΣΗ
ΠΑΝΕΛΛΗΝΙΑ ΣΕΜΙΝΑΡΙΑ ΟΜΑΔΩΝ ΕΡΓΑΣΙΑΣ 2015 ΟΜΑΔΑ ΕΡΓΑΣΙΑΣ ΚΑΡΔΙΑΚΗΣ ΑΝΕΠΑΡΚΕΙΑΣ Από τη βασική έρευνα στην κλινική πράξη ΑΜΦΙΚΟΙΛΙΑΚΗ ΒΗΜΑΤΟΔΟΤΗΣΗ Ξυδώνας Σωτήριος, MD, FESC Καρδιολογικό Τµήµα, Γ.Ν.Α. «Ο
ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΙΣ «ΚΛΙΝΙΚΕΣ ΚΑΙ ΚΛΙΝΙΚΟΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΤΡΙΚΕΣ ΕΙΔΙΚΟΤΗΤΕΣ»
ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΙΣ «ΚΛΙΝΙΚΕΣ ΚΑΙ ΚΛΙΝΙΚΟΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΤΡΙΚΕΣ ΕΙΔΙΚΟΤΗΤΕΣ» ΑΡΝΗΤΙΚΗ ΡΥΘΜΙΣΗ ΤΗΣ ΜΕΤΑΒΙΒΑΣΗΣ ΤΟΥ ΣΗΜΑΤΟΣ ΤΗΣ
4T1 BALB /c Western GFP. Establishment of a mouse mammary cancer model stably expressing human HER2 / neu gene and luciferase gene
2012 2 36 2 Mil Med Sci Vol 36 No 2 Feb 2012 133 neu 1 2 2 2 2 2 neu neu 4T1 G418 Western neu 4T1 BALB /c 1. 5 10 6 G418 4T1 Western neu GFP 4T1 neu neu R737. 9 1674-9960 2012 02-0133-05 A Establishment
Ινσουλίνη και καρδιά. Ηλιάδης Φώτης Λέκτορας Α.Π.Θ.
Ινσουλίνη και καρδιά Ηλιάδης Φώτης Λέκτορας Α.Π.Θ. Επίδραση ινσουλίνης στο ήπαρ, στους μυς και στον λιπώδη ιστό : Διατήρηση ευγλυκαιμίας Nature 2001;414:799 806 Ινσουλίνη? Λειτουργικότητα Μορφολογία Βιωσιμότητα
DNA. SPF 20 d 9. 09% % % % % % Testis Injection of Exogenous DNA Results in Expression in Mouse Sperm
Chinese Journal of Zoology 2010 45 2 151 ~ 157 DNA * 400716 DNA Mus musculus DNA DNA pegfp-n 1 DNA- DNA 0. 08 μg / μl 0. 12 μg / μl 0. 24 μg / μl 3 SPF 2 5 d 3 20 d GFP PCR 3 9. 09% 47. 06% 27. 78% 3 GFP
JEV C RNA 11kb 3. Japanese encephalitis virus JEV JEV C 7. C E prm C 1 RNA. Gold pgbkt7 pgadt7- T pgbkt7-53 pgbkt7- JEV C PCR JEV C cdna
2012 12 4 CHINA TROPICAL MEDICINE Vol.12 No.4 April 2012 427 * JEV C PCR JEV C cdna pgbkt7 EcoRI/BamHI PEG/LiAc pgbkt7- JC pgbkt7 Gold Western- blotting BD- JC pgbkt7- JC Genebank JEV SA14-14- 2 JEV C
HepG hotmail. com. HepG2 Bid Bcl-2. HepG2 G0 /G1 Bid Bcl-2. HepG2. HepG2
588 HepG2 2 2 53002 E-mail huan_chaos@ hotmail. com 2 3602 HepG2 MTT PI HepG2 Western Blot HepG2 Bid Bcl-2 HepG2 HepG2 G0 /G Bid Bcl-2 Bax Bid Bcl-2 Bax HepG2 HepG2 R 735. 7 A 0253-4304 204-588-05 DOI
8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,
31 2003 8 (FENXI HUAXUE) 8 Chinese Journal of Analytical Chemistry 976 980 22( 82 252 272 )21,82 23,62 3 (, 510631) 22(82 252 272 )21,82 23,62 (BSA), 8Q5SAC BSA 298K, 35 40 6. 1 10 5 LΠmol 8Q5SAC, ph =
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2011 7 27 7 671 ~ 678 PUMA sirna / 1 2 1 1 * 1 330006 2 330006 p53 p53 up-regulated modulator
Supporting Information
Supporting Information Mitochondria-Targeting Polydopamine Nanocomposites as Chemophotothermal Therapeutics for Cancer Zhuo Wang *,, Yuzhi Chen, Hui Zhang, Yawen Li, Yufan Ma, Jia Huang, Xiaolei Liu, Fang
Η ΥΠΕΡΕΚΦΡΑΣΗ ΤΟΥ SMAD7 ΠΡΟΣΤΑΤΕΥΕΙ ΤΟ ΗΠΑΡ ΑΠΟ ΤΗΝ TGF-Β/SMAD ΜΕΣΟΛΑΒΟΥΜΕΝΗ ΙΝΟΓΕΝΕΣΗ
Η ΥΠΕΡΕΚΦΡΑΣΗ ΤΟΥ SMAD7 ΠΡΟΣΤΑΤΕΥΕΙ ΤΟ ΗΠΑΡ ΑΠΟ ΤΗΝ TGF-Β/SMAD ΜΕΣΟΛΑΒΟΥΜΕΝΗ ΙΝΟΓΕΝΕΣΗ OVEREXPRESSION OF SMAD7 PROTECTS LIVER FROM TGF-B/SMAD-MEDIATED FIBROGENESIS Γ. Γερμανίδης(1), Ν. Αργέντου(2), Ε.
sirna ECM hepatic stellate cells HSC HSC ECM HSC HSCs β-arrestins G coupled receptor GPCR β-arrestin GPCR RNA small interfering RNA sirna
612 612 ~ 6 2012-5 - 4 9 14 http / /www. cnki. net /kcms /detail /34. 1086. R. 20120504. 0914. 006. html sirna β-arrestin2 230032 doi 10. 3969 /j. issn. 1001-1978. 2012. 05. 006 A 1001-1978 2012 05-0612
1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.
2 0 1 5 7 Journal of Chinese Institute of Food Science and Technology Vol. 15 No. 7 Jul. 2 0 1 5 1,2 1 1 1 1* ( 1 315211 2 315502) : ( ) : (E-Nose), - : GC-MS, 20.98% 2.5%, 53.15% 11.2%, 0. 51% 71.86%
The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea
2011 48 4 909 914 * 1 2** 2 2 2 2 2*** 1. 110161 2. 100081 026000 3 Calliptamus italicus L. 3 LC 50 LC 90 1. 34 14. 17 mg / L LC 50 LC 90 2. 09 45. 22 mg / L 50 mg / L 14 d 87% 100% 50 mg / L 50% The toxicity
,,, (, 100875) 1989 12 25 1990 2 23, - 2-4 ;,,, ; -
25 3 2003 5 RESOURCES SCIENCE Vol. 25 No. 3 May 2003 ( 100875) : 500L - 2-4 - 6-8 - 10 114h - 120h 6h 1989 12 25 1990 2 23-2 - 4 : ; ; - 4 1186cm d - 1 10cm 514d ; : 714 13 317 714 119 317 : ; ; ; :P731
Τα ηπατικά επίπεδα του FOXP3 mrna στη χρόνια ηπατίτιδα Β εξαρτώνται από την έκφραση των οδών Fas/FasL και PD-1/PD-L1
Τα ηπατικά επίπεδα του FOXP3 mrna στη χρόνια ηπατίτιδα Β εξαρτώνται από την έκφραση των οδών Fas/FasL και PD-1/PD-L1 Γ. Γερμανίδης, Ν. Αργέντου, Θ. Βασιλειάδης, Κ. Πατσιαούρα, Κ. Μαντζούκης, A. Θεοχαρίδου,
KLT SMMC Anti - tumor effect in vitro of coix seed oil injection on the human liver cancer cell SMMC and the mechanism study
2012 4 20 4 MODERN ONCOLOGY Apr. 2012 VOI. 20 NO. 04 693 SMMC - 7721 珮 Anti - tumor effect in vitro of coix seed oil injection on the human liver cancer cell SMMC - 7721 and the mechanism study YIN Beipei
Construction and Evaluation of Lentiviral Vector pita-hbp1
ISSN 1007-7626 CN 11-3870 / Q 2010 11 Chinese Journal of Biochemistry and Molecular Biology 26 11 1044 ~ 1049 pita-hbp1 1 2 3 4 4 * 1 100191 2 100086 3 050031 4 100191 1 HBP1 pita-hbp1 Western HBP1 Q78
Effects of soothing liver and invigorating spleen recipes of TCM on hepatic inflammatory cytokines of rats with nonalcoholic steatosishepatitis
33 2 Vol. 33 No. 2 2012 4 Journal of Jinan University Medicine Edition Apr. 2012 TNF-α IL-6 IL-1 1 2 1 3 2 2 2 1. 510630 2. 510632 3. 510630 NASH TNF-α 6 IL-6 1 IL-1 NASH NASH 16 HE O ELISA TNF-α IL-6
LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing
2003 61 3, 435 439 ACTA CHIMICA SINICA Vol 61, 2003 No 3, 435 439 2 ΞΞ ( 400715), 2, 2, 2, 3/ 2 2,, 2,, Ne w Methods for the Determination of the Inclusion Constant between Procaine Hydrochloride and 2Cyclodextrin
A X All-trans retinoic acid ATRA LS174T
318 2014 30 doi10. 3969 /j. issn. 1000-484X. 2014. 03. 006 1 ERK1 /2 23 2 4 361100 R363 A 1000-484X201403-0318-05 All-trans retinoic acidatra ERK1 /2 MTT ATRA RT-PCR Western blot ATRA LS174T MEK1 /2 /ERK1
A strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines
1 2 Supplementary information 3 4 A strategy for the identification of combinatorial bioactive compounds contributing to the holistic effect of herbal medicines 5 6 Fang Long 1, Hua Yang 1, Yanmin Xu,
Effect of Trx1 Overexpression on Expression Level of MMP9 under High Glucose Condition in HBZY21
ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2009 5 25 (5) :465 472 Trx1 HBZY21 MMP9 1),2), 1), 1), 1), 1), 1) 1),3) 3, ( 1), 150081 ; 2), 150086 ; 3), 150081) 1 (thioredoxin1,trx1)
,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78
ISSN 100727626 CN 1123870ΠQ 2002 4 Chinese Journal of Biochemistry and Molecular Biology 18 (2) :245 249 HLA2B2704 3 2) ( 2) 100044) HLA2B2704 286 HLA2B2704 DNA ( HLA2B2704 DNA) PCR F0 F1 RT2PCR HLA2B2704
Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene
2001, 24 (1) : 2529 Journal of Nanjing Agricultural University rolc (, 210095) :, rolc ( Nicotiana tabacum ), GUS, PCR Southern rolc,, rolc : ; ; rolc ; : S572103513 : A : 1000Ο2030 (2001) 01Ο0025Ο05 Study
rp, ribosomal protein 60S rp mrna rpl30 rps14 RT-PCR mrna nonsense-mediated mrna decay smg-2 smg-2 mrna rp rpl-1 rpl-1
rp, ribosomal protein 60S 47 rpl 40S 32 rps rp mrna rpl30 rps14 rpl12 rpl3 rps13 rp mrna nonsense-mediated mrna decay (NMD) C. elegans smg-2 smg-2 mrna 50 rp 7 rp 4 rpl 4 rp NMD mrna 6 rp mrna rp mrna
Journal of Jiangsu University Medicine Edition. sublytic C5b-9 glomerular mesangial cell GMC. sir- NA small hair RNA shrna. TSP-1 shrna shtsp-1 GMC
21 5 2011 9 Journal of Jiangsu University Medicine Edition Vol. 21 No. 5 Sept. 2011 TSP-1 C5b-9 210029-1 thrombospondin-1 TSP-1 sublytic C5b-9 glomerular mesangial cell GMC TSP-1 sir- NA small hair RNA
1., Specificity and Epitope Mapping of Four Monoclonal Antibodies. against SARS-CoV Nucleocapsid Protein
21 3 21 3 207-212 2006 5 VIROLOGICA SINICA May 2006 SARS-CoV N * 1** 1 1 1 1 1 2** 1 1 1., 100052 2., 361005 Specificity and Epitope Mapping of Four Monoclonal Antibodies against SARS-CoV Nucleocapsid
Chinese Journal of Biochemistry and Molecular Biology. CHO., 3 hfgl2p ( ) LUC hfgl2p ( - 997) LUC hfgl2p ( - 816) LUC ; hfgl2p (2468)LUC
ISSN 100727626 CN 1123870ΠQ 2007 2 Chinese Journal of Biochemistry and Molecular Biology 23 (2) :130 135 hfgl2 SARS,,,,, (,, 430030) 3 SARS hfgl2, PCR Western hfgl2 mrna SARS, hfgl2 5, hfgl2, SARS CHO,
MSM Men who have Sex with Men HIV -
,**, The Japanese Society for AIDS Research The Journal of AIDS Research HIV,0 + + + + +,,, +, : HIV : +322,*** HIV,0,, :., n,0,,. + 2 2, CD. +3-ml n,, AIDS 3 ARC 3 +* 1. A, MSM Men who have Sex with Men
PE CVVH PE+HP HP+CVVH HP+CVVH+PE CVVH. ENLAV of HCO - 3 ENLAV-HCO ± μmol /L HP+PE HP+CVVH HP+CVVH+PE
2624 54 plasma exchange PE hemoperfusion HP continuous venovenous hemofiltration CVVH 54 PE CVVH PE+HP HP+CVVH HP+CVVH+PE 183 exceed normal limit absolute value ENLAV prothrombin time PT PE total bilirubin
PNS mg kg - 1. Rb 1
94 2 3 3. 53002 2. 53000 3. 543000 86. 2 mg kg -. 8 mg kg - R Rg Rb 3P97 AUC 0 - R Rg Rb R 0. 8 ± 0. 09 vs 0. 6 ± 0. 06 h Rg 2. 03 ± 0. 76 vs. 74 ± 0. 27 h Rb 0. 76 ± 0. 39 vs 0. 74 ± 0. 7 h R 0. 96 ±
Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo
Bull. Earthq. Res. Inst. Univ. Tokyo Vol. 2.,**3 pp.,,3,.* * +, -. +, -. Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Kunihiko Shimazaki *, Tsuyoshi Haraguchi, Takeo Ishibe +, -.
Octretide joint proton pump inhibitors in treating non-variceal gastrointestinal bleeding a Metaanalysis
528 2012 6 21 6 Chin J Gastroenterol Hepatol Jun 2012 Vol. 21 No. 6 doi 10. 3969 /j. issn. 1006-5709. 2012. 06. 011 Meta 430060 Cochrane Library Pubmed 2 Revman 5. 0 6 484 Meta Meta R573. 2 A 1006-5709
Research Papers. TNF-α. L929 LPS Carswell [1] BCG. pet-41d TNF).TNF. NEB TNF-α cdna Invitrogen DNA. 75 ku TNF TransTaq High %
Research Papers Progress in Biochemistry and Biophysics 2009, 36(4): 424~430 wwwpibbaccn * TNF-α 1, 2) 1) 1)** ( 1) 100101 2) 100039) TNF-α TNF-α TNF-α TNF-α TNF-α TNF-α 9C6 TNF-α 29~40 TNF-α 9C6 TNF-α
GDNF 220YL) 2,52. (glial cell line2de2. 015d 15d rived neurotrophic factor GDNF) 1993 Lin B49 (L15) (FBS) (poly2l2lysin, pll) (laminin, LN) GDNF GDNF
2003123 (6) Basic Medical Sciences and Clinics 625 : 100126325 ( 2003) 0620625205 GDNF 3,,,,, (, 050000) : ( GDNF) (DRGn), MTT 1 g/ L 10 g/ L 50 g/ L 100 g/ L GDNF : GDNF GDNF : ; ; :R32912 :A (glial cell
Congruence Classes of Invertible Matrices of Order 3 over F 2
International Journal of Algebra, Vol. 8, 24, no. 5, 239-246 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/.2988/ija.24.422 Congruence Classes of Invertible Matrices of Order 3 over F 2 Ligong An and
Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements
5 5 2012 10 Chinese Optics Vol. 5 No. 5 Oct. 2012 1674-2915 2012 05-0525-06 - * 100190-14 - - 14. 51 μm 81. 4 μm - 1. 64 μm / O436. 1 TH703 A doi 10. 3788 /CO. 20120505. 0525 Correction of chromatic aberration
Aronia. melanocarpa. Επιβλεπονηερ καθηγηηερ:
Αλεξάνδπειο Τεσνολογικό Εκπαιδεςηικό Ίδπςμα Θεζζαλονίκηρ Σσολή Τεσνολογίαρ Γεωπονίαρ Και Τεσνολογίαρ Τποθίμων Διαηποθήρ Aronia melanocarpa Αξιολόγηζη ηηρ επίδπαζηρ Ελληνικών απομονώζεων ηος γένοςρ Trichoderma
HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332
,**1 The Japanese Society for AIDS Research The Journal of AIDS Research +,, +,, +,, + -. / 0 1 +, -. / 0 1 : :,**- +,**. 1..+ - : +** 22 HIV AIDS HIV HIV AIDS : HIV AIDS HIV :HIV AIDS 3 :.1 /-,**1 HIV
Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil
J. Jpn. Soc. Soil Phys. No. +*0, p.- +*,**1 Eh * ** Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil Daisuke MURAKAMI* and Tatsuaki KASUBUCHI** * The United Graduate
# Effect of PPAR-α agonist on adipokines expression in rats fed with high-fat diet LI yan#, HUANG bin, CHENG hua, LIANG zhen, LIU shan-ying
PPAR-α # 510120 PPAR-α SD SD 6 4 RT-PCR?? mrna FFA TG HOME-IR FFA 2.37±0.60 1.59±0.30 1.33±0.34 mmol/l p
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology human telomerase reverse transcriptase htert
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2013 4 29 4 383 ~ 388 PCR htert mrna 1 2 2 3 1 1 2 2 1 1 530021 2 530021 3 * 3 530021 human
Electrolyzed-Reduced Water as Artificial Hot Spring Water
/-,**- + +/ 0 +, - + + +, - + +. ++,3 +/. +. Electrolyzed-Reduced Water as Artificial Hot Spring Water Shoichi OKOUCHI +, Daisuke TAKEZAKI +, Hideyuki OHNAMI +, Yuhkoh AGISHI,, Yasuo KANROJI -, and Shigeo
B16F10 SDS-PAGE. Annexin V-FITC /PI
NRP1 B16F10 * 361005 1 neuropilin1 NRP1 NRP1 mab B16F10 SDS-PAGE 1 1 B16F10 1 Annexin V-FITC /PI 1 1 1 B16F10 1 1 B16F10 P < 0. 05 1 B16F10 P < 0. 05 B16F10 Akt ERK1 /2 Bcl-2 Caspase 3 Bax 1 B16F10 1 PI3K
Characterization of the molecular networks that control pathogenic T-cell driven responses in Multiple Sclerosis using RNA-seq analysis software
NATIONAL AND KAPODISTRIAN UNIVERSITY OF ATHENS SCHOOL OF SCIENCE DEPARTMENT OF INFORMATICS & TELECOMMUNICATIONS POSTGRADUATE PROGRAM "INFORMATION TECHNOLOGIES IN MEDICINE & BIOLOGY" MASTER S THESIS Characterization
Mitomycin C application for the prevention of postoperative synechiae formation at the anterior commissure.
Otorhinolaryngologia - Head and Neck Surgery Issue 50, October - November - December 2012, pages 18-22 ORIGINAL REVIEW ARITCLE Mitomycin C application for the prevention of postoperative synechiae formation
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology Aβ42 Alzheimer's disease AD insulin degrading enzyme IDE.
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2013 1 29 1 70 ~ 75 PPARγ IDE TNF-α Aβ42 430030 metformin MET MET β- β-amyloid Aβ Alzheimer's
30s 56 60s 72 60s dntp cm s s s 23
31 3 Vol 31 No 3 2012 8 JOURNAL OF OCEANOGRAPHY IN TAIWAN STRAIT Aug 2012 AFLP 1 1 2 1 1 361005 2 361005 dntp Taq Mg 2 + 300 ng DNA 5U PstI 5U MseI 4 h 16 10 50 AFLP AFLP 64 12 AFLP DOI 10 3969 /J ISSN
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology breast cancer resistance protein BCRP ATP p53 p53
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2012 2 28 2 152 ~ 157 p53 * 414000 breast cancer resistance protein BCRP ATP p53 wild type
Το Βιολογικό Ρολόι: Θεµελιώδης Ρυθµιστής της Φυσιολογίας των Οργανισµών
Ιούλιος 2005 Το Βιολογικό Ρολόι: Θεµελιώδης Ρυθµιστής της Φυσιολογίας των Οργανισµών ρ. Α. Προµπονά Εργαστήριο Ρύθµισης της Μεταγραφής από το Βιολογικό Ρολόι Κιρκαδικό Ρολόι Ρυθµοί µε περίοδο ~ 24 ωρών
College of Life Science, Dalian Nationalities University, Dalian , PR China.
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2018 Postsynthetic modification
ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ
1 ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΑΝΑΡΤΗΤΕΑ ΣΤΟ ΔΙΑΔΙΚΤΥΟ ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ Ηράκλειο, 04.02.2014 Αρ. πρωτ. 1054 Ο Ειδικός Λογαριασμός του Πανεπιστημίου Κρήτης