microrna126 GATA mg /kg 800 November 2013 Vol. 35 No. 11 Chinese Traditional Patent Medicine 10% 5% GATA-3 40 BALB /c GATA-3 TH2 NA126

Transcript

1 Psychopharmacology Porsoh R Le pichon M Jalfre M mg /kg Bunney W Davis J. 5-8 J. 1 Steru L Chemlat R Thicrry B et al. The tail suspension test A new method for screening antidepressants in mice J. Depression a new method animal model sensitive to antidepressant treatments J. Nature Khalifa A E. Hypericum perforatum as a nootropic drug enhancement of retrieval memory of a passive avoidance conditioning paradigm in mice J. J Ethnopharmacol Pawlowski L & Mazela Psychopharmacology M Nowak G Szewczyk B Wieronska J et al. Antidepressant-like effects of acute and chronic treatment with zinc in forced swim test and olfactory bulbectomy model in rats J. Brain Res Bull Norepinephrine in depressive reactions J. Arch Gen Psychiatry Janne G Eldbjorg F Robert M et al. Extracellular levels of serotonin and GABA in the hippocampus after chronic mild stress in rats A microdialysis study in an animal model of depression J. Behav Brain Res microrna126 GATA-3 * microrna126 GATA-3 10% 5% BALB /c 40 BALB /c 10 4 microrna126 GATA-3 mrna microrna126 GATA-3 micror- NA126 GATA-3 TH2 microrna126 GATA-3 R doi /j. issn A ZYSNXD-CC-HPGC-JD *

2 Role of Pingchuan Recipe on microrna126 and GATA-3 expression in lung tissue of mice with asthma LIU Fei YU Jian-er * BAI Li Shanghai Municipal Hospital of Traditional Chinese Medicine Affiliated to Shanghai University of TCM Shanghai China ABSTRACT AIM To study the intervention role of Pingchuan Recipe Ephedrae Herba Armeniacae Semen amarum Perillae Fructus Persicae Semen Raphani Semen Scutellariae Radix etc. on microrna126 and GATA3 expression in mice s lung tissue of asthma model and the improvement in airway inflammation. METHODS Injection of 10% ovalbumin and inhalation of 5% ovalbumin were used to establish the BALB / c mouse bronchial asthma model. Forty male BALB /c mice were randomly divided into control group model group dexamethasone group and Pingchuan Recipe group each with ten mice. For four weeks of treatment the pathological changes of the lung tissue of mice were observed with an optical microscope. MicroRNA126 GATA3 mrna expression levels in lung tissue were determined by polymerase chain reaction. RESULTS Pingchuan Recipe group could effectively reduce the level of microrna126 reach the negative regulation of GATA-3 expression and lessen the symptoms of mice with bronchial asthma equivalent to dexamethasone. CONCLUSION MicroRNA126 may be an access to reduction in GATA-3 and inhibition in the over-expression of TH2 to improve airway inflammation. KEY WORDS bronchial asthma Pingchuan Recipe microrna126 GATA-3 GATA3 1 Th1 Th2 Th2 T BALB /c 40 4 ~ 6 18 ~ 22 g - SCXK IL-4 IFN-γ 5 Th2 GATA DEPC 3 6 DEPC microrna126 microrna 22 RNA 7 RNA AR c DNA 8 Fermentas Trizol Invitrogen Real-tiome PCR Mix ABI USA microrna T Mus musculus Th1 Th2 Joerg Mattes 9 microrna 126 Mir126 microrna GACAG- microrna126 8 CACATTATTACTTTTGG CGCATTATTACT- 1 GATA3 Th2 CACGGTAC TACGCGCTGTGACACT- 2325

3 TCAAACTC GATA-3 GATA bp 5' GTTCCTCCGACCCCTTC- TAC3' 5' TTCAGTGGTTGGAATGCAGA3' FAM CGCAGGAGCAGTATCATGAA-TAMA- RA β-actin 180 bp 5' GTCGTAC- CACTGGCATTGTG3' 5' TCTCAGCTGTGGTG- GTGAAG3' FAM CCACACTGTGC- CCATCTATG-TAMARA LSD Peasern XW 80A 3 K10CD FLUKO 3. 1 F6 /10 Sigma 3K15 Real-time ABI ABI BALB /c % ~ 70% g 1g 100 ml 10% 50 ml /kg h 5% 20 min 1 /d GATA-3 microrna126 1 /d min min 95% V 60 / h g /ml db = da KB /KA 20 ml / kg d 30kg mg /ml % Fig. 1 Polymerase Chain Reaction microrna126 Ga- Ta3mRNA 2 SPSS x ± s LSD HE by HE staining light microscopy HE 400 Pathological changes in lung tissue observed

4 GATA-3 microrna126 4 P < Danit Ariel 11 microrna GATA-3 microrna126 P < GATA- 3 microrna126 P > * P < # P < 0. Δ P < microrna126 2 GATA-3 m RNA PCR PU. 1 GATA-3 Fig. 2 Kinetic curves of GATA-3 mrna Gene PCR amplification Th2 9 GA- TA-3 microrna < n 40 ** microrna 1 GATA-3 microrna126 micror- x ± s NA Tab. 1 Comparison of GATA-3 and microrna126 in lung tissue x ± s 9q Adam Collison 13 / GATA-3 microrna126 microrna126 HDM ± ± ± * ± * ± # ± # ± * # ± # microrna microrna126 GATA-3 RT-PCR PCR T- bet GATA-3 T-bet GATA-3 TH1 /TH2 15 GATA-3 GATA-3 microrna mirna-126 PCR Fig. 3 Kinetic curves of mirna-126 Gene PCR amplification 3. 4 GATA-3 microrna126 GATA-3 microrna GATA-3 microrna126 Tab. 2 Correlation analysis of GATA-3 and microrna126 GATA-3 Pearson microrna ** 4. 4 microrna

5 7 Wang Jiawang Li Kunyu Hellermann G et al. Regulating the regulators microrna and asthma J. World Allergy Or- gan J GATA-3 micror- NA126 GATA-3 microrna M J Adam Collison Cristan Herbert Jessica S Siegle et al. Altered expression of microrna in the airway wall in chronic asth- 30 J ma mir-126 as a potential therapeutic target J. BMC Pulmonary Med J γ 4 J TH1 /TH2 J. T-bet /GATA J Thomas X Joseph D Ting Wen et al. MicroRNA signature in patients with eosinophilic esophagitis reversibility with glucocorticoids and assessment as disease biomarkers J. J Allergy Clin Immunol Mattesa J Collisona A Planka M et al. Antagonism of microrna-126 suppresses the effector function of TH2 cells and the development of allergic airways disease J. Proc Natl Acad Sci USA M Danit Ariel Daya Upadhyay. The role and regulation of micrornas in asthma J. Curr Opin Allergy Clin Immunol 12 Ishizaki T Tamiya T Taniguchi K et al. mir126 positively regulates mast cell proliferation and cytokine production through suppressing spred1 J. Genes Cells T-bet / GATA3 Th1 /Th2 J. 16. M