http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology T7Select10-3b MCS cdna 3' 6 cdna.

Transcript

1 ISSN CN / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology ~ 481 T7 cdna * Western University of Health Sciences California USA C cdna ORF PCR T7Select10-3b MCS cdna 3' 6 cdna cdna ORF 6 % 70 % cdna T7 Q78 Construction of Lung Cancer cdna T7 Phage Library Using Modified Polyhistidine Tagged Expression Vector DONG Xiao-Min 1 1 ZHONG Li 2 * FAN Jiang-Ping 1 ZHANG Xu-Fei 1 1 Laboratory of Biochip School of Life Sciences Hebei University Baoding 2 Western University of Health Sciences California USA China Abstract The commercially available cdna T7 phage library is constructed using C-terminal display mechanism which contains inadequate open reading frame ORF expressed protein epitopes To improve the selection of ORF proteins we modified the existing phage vector T7Select10-3b by inserting 6 His-tag genes into the multiple cloning sites MCS at the 3' terminus by PCR The obtained phage clone expressing His-tag was used for construction of a display library The cdna was extracted from the human lung cancer tissues and inserted into the His-tag modified vector The packaged phages with ORF inserts were enriched by Ni-chelating affinity chromatography and then screened by chemiluminescence immunoassay The result showed that the 6 His-tag allowed the enrichment of expressed peptides with an increased from 6 % to 70 % as compared to unselected the library Our His-taged phage library provided a convenient and practical method to improve the ORF selection Key words His-tag T7 phage library open reading frame ORF cdna T7 cdna No No * Tel lee_z@ yahoo com Received February Accepted April Supported by National Natural Science Foundation of China No No * Corresponding author lee_z@ yahoo com Tel

2 cdna 5 DNA PCR Xho I Sac I C cdna 6 T7 cdna % open T7 E coli BLT5615 reading frame ORF PCR 7 8 T His T7Select10-3b His ORF DNA cdna ORF Sal I Xho I 3' His T7 ORF 1 1 T7Select10-3b μl 990 μl LB μl 900 E coli BLT5615 T7Select μl LB b Novagen 12 RNeasy Mini 5% TBST Kit Oligotex Direct mrna Mini Kit QIAGEN TBST 10 4 HRP Orient Express Random Primer cdna Synthesis Kit EcoR I / Hind III End Modification Kit DNA Ligation Kit T7Select10-3b Cloning Kit Novagen Taq DNA β-agarase IPTG TaKaRa MiniBEST Agarose Gel DNA RNA mrna Extraction Kit TaKaRa DNA QIAGEN RNeasy Mini HRP His Kit RNA RNA 6 His-Tagged Protein Purification Kit Oligotex Direct mrna Mini Kit mrna 10 μl RNase-free Water cdna Orient His T7Select10-3b Express Random Primer cdna Synthesis Kit His 10 cdna T7Select10-3b DNA Directional EcoR Ⅰ / Hind Ⅲ Linkers P1 5'-CCCGAGCTC AAGCTTCATCATCATCATCATCATGTCGACGAGATT CTACAAGC-3' P2 5'- CCGCTCGAGTACCGAAGG Hind Ⅲ EcoR Ⅰ Mini Column Fractionation Kit cdna AGTCGTGAATCAGT-3' PCR PCR 94 5 min 94 1 min 66 1 min 72 1 min min His ECL 1 3 T7 cdna RNA RNA 500 μg DNA EcoRⅠ / HindⅢ 1% EcoRⅠ End Modification Kit HindⅢ

3 5 T7 cdna 477 cdna ORF ORF His P1 P2 T7Select10-3b DNA PCR 0 75 kb 6 10 mmol / L His DNA T7Select10-3b DNA Sac I Xho I mmol / L kb kb DNA Fig 1 PCR cdna Novagen T7Select PCR 6 ORF His T7Select10-3b Fig 1 Electrophoresis analysis of the modified T7 vector A M1 DL2000 DNA marker 1 Inserts of His-tag synthesized by PCR appeared at the size of 0 75 kb B M2 DNA ladder 2 Liner T7Select10-3b DNA that was digested by Sac I and Xho I appeared at kb and kb μg mrna A 260 / A His % mrna T7Select10-3b cdna T7Select10-3b Fig 3B 2 4 cdna HRP pfu / ml PCR 1% Fig 2 85% 90% 2 3 RNA mrna 300 bp Fig 4 RNeasy Mini 2 5 cdna ORF RNA A 260 / A RNA 1% ORF 28S 18S rrna Fig 3A 6% ORF 70% Fig 5

4 Fig 2 Expression identification of His-tag by immunoblotting A The modified phage vector with Histag right and the negative control without insert left side were plated on BLT5615 bacterial plates at a similar density B Plaques in two plates were lifted onto nitrocellulose membranes respectively The expression of the His-tag in individual phage clones was analyzed by immunoblotting using HRP-conjugated anti His-tag monoclonal antibody and chemiluminescence detection Positive signals indicated that the phage expressed His-tag Fig 3 Electrophoresis analysis of total RNA and mrna A 1 Total RNA was isolated from lung cancer tissue and the 28S and 18S ribosomal RNA appeared clearly B 2 mrna was purified from total RNA and appeared as a smear M DL2000 DNA marker Fig 4 PCR analysis of cdna inserts in lung cancer T7 phage library The library was plated in limiting dilution on LB-Agar / agarose plates A total of 100 plaques were randomly picked followed by PCR amplification using T7SelectUp and T7SelectDown primers The sizes of PCR products were analyzed on agarose gel More than 85% of the clones had cdna inserts approximately 90% of inserts were longer than 300 bp M DL2000 DNA marker 1 ~ 11 PCR products of randomly selected clones

5 5 T7 cdna Fig 5 Analysis of ORF library by immunoblotting The packaged phage cdna library was selected by Nichelating affinity chromatography to generate ORF enriched cdna library The library showed here before A and after B the enrichment was plated on BLT5615 bacterial plates respectively The expression of the His-tag was analyzed by immunoblotting and chemiluminescence detection as before Positive signals indicated that the clones expressed the His-tag with ORF cdna inserts Approximately 70% of phage clones in the ORF library had ORF inserts whereas only < 6% of the clones had ORF inserts in the non-his-tagged library 3 1 ORF T Smith ORF 13 cdna ORF 90% T7Select10-3b 14 λ MSC 3' T7 cdna ORF 15 T7 C ORF ORF T7Select10-3b DNA 36 kb DNA DNA PCR EDTA PCR PCR 450 bp DNA 750 bp PCR bp 470 bp PCR 6 His PCR PCR 3 2 cdna ORF cdna ORF 2004 Faix 8 pg3orf cdna ORF ORF pucmg4-198 ORF 6% 87% 2010 Caberoy 6 T7DNA ORF T7 cdna 10B C cdna cdna ORF ORF 18 ORF cdna ORF ORF 19

6 GenBank 200 bp ORF 96% cdna bp ORF 99 2% bp cdna ORF cdna frame selection J PCR cdna 90% 300 bp 21 ORF ORF ORF C HRP ECL HRP 70% use as markers of non-small cell lung cancer J cdna ORF 12 Zhong L Ge K Zu J C et al biomarkers for breast cancer J 3 R40 13 Smith G P that display cloned antigens on the virion surface J ORF Fukunaga K Taki M ORF available phage display cloning systems J References 1 Ferlay J Shin H R Bray F et al Estimates of worldwide burden of cancer in 2008 GLOBOCAN 2008 J Int J Cancer Grunnet M Sorensen J B Carcinoembryonic antigen CEA as tumor marker in lung cancer J Lung Cancer Takakusagi Y Takakusagi K Sugawara F et al Use of phage display technology for the determination of the targets for smallmolecule therapeutics J Expert Opin Drug Discov J Liu Shu-Qing Zong 19 Li W Caberoy N B New perspective for phage display as an Jun-Wei Guo Chun-Mei et al Lymphatic metastasis-associated biomarkers for cancers J Chin J Biochem Mol Biol 2012 efficient and versatile technology of functional proteomics J Appl Microbiol Biotechnol Paschke M Phage display systems and their applications J Appl Microbiol Biotechnol Caberoy N B Zhou Y Jiang X et al Efficient identification of tubby-binding proteins by an improved system of T7 phage display J J Mol Recognit Kalnina Z Silina K Meistere I et al Evaluation of T7 and lambda phage display systems for survey of autoantibody profiles in cancer patients J J Immunol Methods Faix P H Burg M A Gonzales M et al Phage display of cdna libraries enrichment of cdna expression using open reading Biotechniques Holz C Lueking A Bovekamp L et al A human cdna expression library in yeast enriched for open reading frames J Genome Res T7 J Ge Kun Zhong Li Zhao Long-Hua et al Vector preparation and optimization of ligation condition in the construction of T7 phage library J Sci Technol Inf Zhong L Peng X Hidalgo G E et al Identification of circulating antibodies to tumor-associated proteins for combined Proteomics Autoantibodies as potential Breast Cancer Res Filamentous fusion phage novel expression vectors Science Practical tips for construction of custom peptide libraries and affinity selection by using commercially J Nucleic Acids 15 Van Dorst B Mehta J Rouah-Martin E et al The identification of cellular targets of 17β estradiol using a lytic T7 cdna phage display approach J Toxicol In Vitro Dunn J J Studier F W Complete nucleotide sequence of bacteriophage T7 DNA and the locations of T7 genetic elements J J Mol Biol Dai M Temirov J Pesavento E et al Using T7 phage display to select GFP-based binders J Protein Eng Des Sel Danner S Belasco J G T7 phage display a novel genetic selection system for cloning RNA-binding proteins from cdna libraries J Proc Natl Acad Sci U S A Garufi G Minenkova O Lo Passo C et al Display libraries on bacteriophage lambda capsid J Biotechnol Annu Rev cdna Arpc51 cdna J

7 5 T7 cdna 481 Wang Li-Xin Zheng Yao Ai Min et al Construction of cdna library of Andrias davidianus skin tissue with analyzing the cdna sequence and expression of Arpc51 gene J Chin J Biochem Mol Biol Caberoy N B Zhou Y Alvarado G et al Efficient identi cation of phosphatidylserine-binding proteins by ORF phage display J Biochem Biophys Res Commun