http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology T7Select10-3b MCS cdna 3' 6 cdna.
|
|
- Διόσκουροι Πυλαρινός
- 9 χρόνια πριν
- Προβολές:
Transcript
1 ISSN CN / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology ~ 481 T7 cdna * Western University of Health Sciences California USA C cdna ORF PCR T7Select10-3b MCS cdna 3' 6 cdna cdna ORF 6 % 70 % cdna T7 Q78 Construction of Lung Cancer cdna T7 Phage Library Using Modified Polyhistidine Tagged Expression Vector DONG Xiao-Min 1 1 ZHONG Li 2 * FAN Jiang-Ping 1 ZHANG Xu-Fei 1 1 Laboratory of Biochip School of Life Sciences Hebei University Baoding 2 Western University of Health Sciences California USA China Abstract The commercially available cdna T7 phage library is constructed using C-terminal display mechanism which contains inadequate open reading frame ORF expressed protein epitopes To improve the selection of ORF proteins we modified the existing phage vector T7Select10-3b by inserting 6 His-tag genes into the multiple cloning sites MCS at the 3' terminus by PCR The obtained phage clone expressing His-tag was used for construction of a display library The cdna was extracted from the human lung cancer tissues and inserted into the His-tag modified vector The packaged phages with ORF inserts were enriched by Ni-chelating affinity chromatography and then screened by chemiluminescence immunoassay The result showed that the 6 His-tag allowed the enrichment of expressed peptides with an increased from 6 % to 70 % as compared to unselected the library Our His-taged phage library provided a convenient and practical method to improve the ORF selection Key words His-tag T7 phage library open reading frame ORF cdna T7 cdna No No * Tel lee_z@ yahoo com Received February Accepted April Supported by National Natural Science Foundation of China No No * Corresponding author lee_z@ yahoo com Tel
2 cdna 5 DNA PCR Xho I Sac I C cdna 6 T7 cdna % open T7 E coli BLT5615 reading frame ORF PCR 7 8 T His T7Select10-3b His ORF DNA cdna ORF Sal I Xho I 3' His T7 ORF 1 1 T7Select10-3b μl 990 μl LB μl 900 E coli BLT5615 T7Select μl LB b Novagen 12 RNeasy Mini 5% TBST Kit Oligotex Direct mrna Mini Kit QIAGEN TBST 10 4 HRP Orient Express Random Primer cdna Synthesis Kit EcoR I / Hind III End Modification Kit DNA Ligation Kit T7Select10-3b Cloning Kit Novagen Taq DNA β-agarase IPTG TaKaRa MiniBEST Agarose Gel DNA RNA mrna Extraction Kit TaKaRa DNA QIAGEN RNeasy Mini HRP His Kit RNA RNA 6 His-Tagged Protein Purification Kit Oligotex Direct mrna Mini Kit mrna 10 μl RNase-free Water cdna Orient His T7Select10-3b Express Random Primer cdna Synthesis Kit His 10 cdna T7Select10-3b DNA Directional EcoR Ⅰ / Hind Ⅲ Linkers P1 5'-CCCGAGCTC AAGCTTCATCATCATCATCATCATGTCGACGAGATT CTACAAGC-3' P2 5'- CCGCTCGAGTACCGAAGG Hind Ⅲ EcoR Ⅰ Mini Column Fractionation Kit cdna AGTCGTGAATCAGT-3' PCR PCR 94 5 min 94 1 min 66 1 min 72 1 min min His ECL 1 3 T7 cdna RNA RNA 500 μg DNA EcoRⅠ / HindⅢ 1% EcoRⅠ End Modification Kit HindⅢ
3 5 T7 cdna 477 cdna ORF ORF His P1 P2 T7Select10-3b DNA PCR 0 75 kb 6 10 mmol / L His DNA T7Select10-3b DNA Sac I Xho I mmol / L kb kb DNA Fig 1 PCR cdna Novagen T7Select PCR 6 ORF His T7Select10-3b Fig 1 Electrophoresis analysis of the modified T7 vector A M1 DL2000 DNA marker 1 Inserts of His-tag synthesized by PCR appeared at the size of 0 75 kb B M2 DNA ladder 2 Liner T7Select10-3b DNA that was digested by Sac I and Xho I appeared at kb and kb μg mrna A 260 / A His % mrna T7Select10-3b cdna T7Select10-3b Fig 3B 2 4 cdna HRP pfu / ml PCR 1% Fig 2 85% 90% 2 3 RNA mrna 300 bp Fig 4 RNeasy Mini 2 5 cdna ORF RNA A 260 / A RNA 1% ORF 28S 18S rrna Fig 3A 6% ORF 70% Fig 5
4 Fig 2 Expression identification of His-tag by immunoblotting A The modified phage vector with Histag right and the negative control without insert left side were plated on BLT5615 bacterial plates at a similar density B Plaques in two plates were lifted onto nitrocellulose membranes respectively The expression of the His-tag in individual phage clones was analyzed by immunoblotting using HRP-conjugated anti His-tag monoclonal antibody and chemiluminescence detection Positive signals indicated that the phage expressed His-tag Fig 3 Electrophoresis analysis of total RNA and mrna A 1 Total RNA was isolated from lung cancer tissue and the 28S and 18S ribosomal RNA appeared clearly B 2 mrna was purified from total RNA and appeared as a smear M DL2000 DNA marker Fig 4 PCR analysis of cdna inserts in lung cancer T7 phage library The library was plated in limiting dilution on LB-Agar / agarose plates A total of 100 plaques were randomly picked followed by PCR amplification using T7SelectUp and T7SelectDown primers The sizes of PCR products were analyzed on agarose gel More than 85% of the clones had cdna inserts approximately 90% of inserts were longer than 300 bp M DL2000 DNA marker 1 ~ 11 PCR products of randomly selected clones
5 5 T7 cdna Fig 5 Analysis of ORF library by immunoblotting The packaged phage cdna library was selected by Nichelating affinity chromatography to generate ORF enriched cdna library The library showed here before A and after B the enrichment was plated on BLT5615 bacterial plates respectively The expression of the His-tag was analyzed by immunoblotting and chemiluminescence detection as before Positive signals indicated that the clones expressed the His-tag with ORF cdna inserts Approximately 70% of phage clones in the ORF library had ORF inserts whereas only < 6% of the clones had ORF inserts in the non-his-tagged library 3 1 ORF T Smith ORF 13 cdna ORF 90% T7Select10-3b 14 λ MSC 3' T7 cdna ORF 15 T7 C ORF ORF T7Select10-3b DNA 36 kb DNA DNA PCR EDTA PCR PCR 450 bp DNA 750 bp PCR bp 470 bp PCR 6 His PCR PCR 3 2 cdna ORF cdna ORF 2004 Faix 8 pg3orf cdna ORF ORF pucmg4-198 ORF 6% 87% 2010 Caberoy 6 T7DNA ORF T7 cdna 10B C cdna cdna ORF ORF 18 ORF cdna ORF ORF 19
6 GenBank 200 bp ORF 96% cdna bp ORF 99 2% bp cdna ORF cdna frame selection J PCR cdna 90% 300 bp 21 ORF ORF ORF C HRP ECL HRP 70% use as markers of non-small cell lung cancer J cdna ORF 12 Zhong L Ge K Zu J C et al biomarkers for breast cancer J 3 R40 13 Smith G P that display cloned antigens on the virion surface J ORF Fukunaga K Taki M ORF available phage display cloning systems J References 1 Ferlay J Shin H R Bray F et al Estimates of worldwide burden of cancer in 2008 GLOBOCAN 2008 J Int J Cancer Grunnet M Sorensen J B Carcinoembryonic antigen CEA as tumor marker in lung cancer J Lung Cancer Takakusagi Y Takakusagi K Sugawara F et al Use of phage display technology for the determination of the targets for smallmolecule therapeutics J Expert Opin Drug Discov J Liu Shu-Qing Zong 19 Li W Caberoy N B New perspective for phage display as an Jun-Wei Guo Chun-Mei et al Lymphatic metastasis-associated biomarkers for cancers J Chin J Biochem Mol Biol 2012 efficient and versatile technology of functional proteomics J Appl Microbiol Biotechnol Paschke M Phage display systems and their applications J Appl Microbiol Biotechnol Caberoy N B Zhou Y Jiang X et al Efficient identification of tubby-binding proteins by an improved system of T7 phage display J J Mol Recognit Kalnina Z Silina K Meistere I et al Evaluation of T7 and lambda phage display systems for survey of autoantibody profiles in cancer patients J J Immunol Methods Faix P H Burg M A Gonzales M et al Phage display of cdna libraries enrichment of cdna expression using open reading Biotechniques Holz C Lueking A Bovekamp L et al A human cdna expression library in yeast enriched for open reading frames J Genome Res T7 J Ge Kun Zhong Li Zhao Long-Hua et al Vector preparation and optimization of ligation condition in the construction of T7 phage library J Sci Technol Inf Zhong L Peng X Hidalgo G E et al Identification of circulating antibodies to tumor-associated proteins for combined Proteomics Autoantibodies as potential Breast Cancer Res Filamentous fusion phage novel expression vectors Science Practical tips for construction of custom peptide libraries and affinity selection by using commercially J Nucleic Acids 15 Van Dorst B Mehta J Rouah-Martin E et al The identification of cellular targets of 17β estradiol using a lytic T7 cdna phage display approach J Toxicol In Vitro Dunn J J Studier F W Complete nucleotide sequence of bacteriophage T7 DNA and the locations of T7 genetic elements J J Mol Biol Dai M Temirov J Pesavento E et al Using T7 phage display to select GFP-based binders J Protein Eng Des Sel Danner S Belasco J G T7 phage display a novel genetic selection system for cloning RNA-binding proteins from cdna libraries J Proc Natl Acad Sci U S A Garufi G Minenkova O Lo Passo C et al Display libraries on bacteriophage lambda capsid J Biotechnol Annu Rev cdna Arpc51 cdna J
7 5 T7 cdna 481 Wang Li-Xin Zheng Yao Ai Min et al Construction of cdna library of Andrias davidianus skin tissue with analyzing the cdna sequence and expression of Arpc51 gene J Chin J Biochem Mol Biol Caberoy N B Zhou Y Alvarado G et al Efficient identi cation of phosphatidylserine-binding proteins by ORF phage display J Biochem Biophys Res Commun
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN
BIOTECHNOLOGY BULLETIN 2011 3 α 1 2-300457 PCR Helicobacter pylori HP DNA α 1 2- α 1 2-fucosyltransferase α 1 2-fuct 906 bp pet-22b + pet-fuct BL21 DE3 25 0. 1 mmol /L IPTG 4 h SDS-PAGE 33 kd α 1 2- BL21
Shiraia sp. Slf14 III
39 4 Vol 39 No 4 2015 7 Journal of Jiangxi Normal University Natural Science Jul 2015 1000-5862 2015 04-0430-05 Shiraia sp Slf14 III 1 1 2 1 1 1 2* 1 330022 2 330013 Polyketide synthase PKS Shiraia sp
JOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3. PCR bp BCCP. pet-28a Escherichia coli BL21 DE3 Ni-NTA
6 2011 5 31 3 JOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3 A ACC CT * 430070 PCR A ACC 2 42 ~ 147 bp 315 ~ 677 bp 6 801 bp A 3 BC BCCP CT CT pet-28a Escherichia coli BL21 DE3 Ni-NTA CT 1. 8 mg /ml ACC
30s 56 60s 72 60s dntp cm s s s 23
31 3 Vol 31 No 3 2012 8 JOURNAL OF OCEANOGRAPHY IN TAIWAN STRAIT Aug 2012 AFLP 1 1 2 1 1 361005 2 361005 dntp Taq Mg 2 + 300 ng DNA 5U PstI 5U MseI 4 h 16 10 50 AFLP AFLP 64 12 AFLP DOI 10 3969 /J ISSN
,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78
ISSN 100727626 CN 1123870ΠQ 2002 4 Chinese Journal of Biochemistry and Molecular Biology 18 (2) :245 249 HLA2B2704 3 2) ( 2) 100044) HLA2B2704 286 HLA2B2704 DNA ( HLA2B2704 DNA) PCR F0 F1 RT2PCR HLA2B2704
Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone
ISSN 100727626 CN 1123870ΠQ 2002 12 Chinese Journal of Biochemistry and Molecular Biology 18 (6) :693 697 cdna, 3, (, 150030) RNA, cdna cdna PCR, 380 bp cdna pmd2182t2verctor 3,,, 96 %, 95 %,, 74 %, 95
Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic
Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene
2001, 24 (1) : 2529 Journal of Nanjing Agricultural University rolc (, 210095) :, rolc ( Nicotiana tabacum ), GUS, PCR Southern rolc,, rolc : ; ; rolc ; : S572103513 : A : 1000Ο2030 (2001) 01Ο0025Ο05 Study
ER-Tree (Extended R*-Tree)
1-9825/22/13(4)768-6 22 Journal of Software Vol13, No4 1, 1, 2, 1 1, 1 (, 2327) 2 (, 3127) E-mail xhzhou@ustceducn,,,,,,, 1, TP311 A,,,, Elias s Rivest,Cleary Arya Mount [1] O(2 d ) Arya Mount [1] Friedman,Bentley
Gateway cdna. cdna. pdest TM ~ cfu/ ml ~ cfu bp
2010 32 4 0791-0796 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com Gateway cdna * * 350002 cdna cdna Gateway RNA mrna 3 cdna BP LR cdna pdest TM
2 0 1 2 2 Journal of Shanghai Normal University Natural Sciences Feb. 2 0 1 2 SNAT2. HEK293T Western blot SNAT2 - HA Q 31 A 1000-5137 2012 01-0083-06
4 1 1 Vol 41 No 1 2 0 1 2 2 Journal of Shanghai Normal University Natural Sciences Feb 2 0 1 2 SNAT2 - HA * 200234 SNAT2 - SNAT2 PCR HA SNAT2 C pbk - CMVΔ 1098-1300 - SNAT2 - HA HEK293T Western blot SNAT2
Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica
35 1 2 0 1 7 1 DOI 10. 13193 /j. issn. 1673-7717. 2017. 01. 035 1 1 1 1 2 1. 150036 2. 150040 D101 DEAE Cellulose 52 Sephacryl S - 300 - - PJP - 1a PJP - 3a 1. 34 10 3 Da 1. 70 10 7 Da - PJP - 3a 4. 56
Digesting Plasmid DNA with Restriction Endonuclease s under the Condition of Microwave-heating
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2012 4 28 4 380 ~ 384-1 2 1 1 1 * 1 310021 2 210095 2 min DNA 2 min Q78 Digesting Plasmid
P450 CYP4G19. Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody , 518060; 2.
2009 6 9 6 [ ] 1672-3619(2009)06-0591-06 591 P450 CYP4G19 1,2 1,2*,, 2, 2, 2, 2 1, (1., 518060; 2., 518020) P450 CYP4G19, CYP4G19 RT-PCR CYP4G19, T-A, pet-28a, BL21 (DE3),,,, ELISA Western-blot cdna 771bp,
Identification of Fish Species using DNA Method
5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,
Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...
III Contents I II III Abstract... I Zusammenfassung... II Contents... III 1 Aim of the work... 1 2 Introduction... 2 2.1 Short overview of Chinese hamster ovary cell lines... 2 2.2 Unspecific mutations:
Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer
Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer Naomi Morota Newman M Key Words woman diagnosed with breast cancer, rehabilitation nursing care program, the
High mobility group 1 HMG1
Vol. 29, pp.705 ~ 711, 2001 High mobility group 1 HMG1 13 12 20 anti-neutrophil cytoplasmic antibodies, ANCA ANCA 1982 Davies 1980 1 high mobility group HMG1 HMG2 30 kd high mobility group HMGHMG HMG1
Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology
2012 34 2 382-387 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com 212018 105 W 42 2 min 0. 631 TS202. 3 A 1000-2286 2012 02-0382 - 06 Optimizing
College of Life Science, Dalian Nationalities University, Dalian , PR China.
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2018 Postsynthetic modification
1., Specificity and Epitope Mapping of Four Monoclonal Antibodies. against SARS-CoV Nucleocapsid Protein
21 3 21 3 207-212 2006 5 VIROLOGICA SINICA May 2006 SARS-CoV N * 1** 1 1 1 1 1 2** 1 1 1., 100052 2., 361005 Specificity and Epitope Mapping of Four Monoclonal Antibodies against SARS-CoV Nucleocapsid
Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin
2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,
SCIENTIA SILVAE SINICAE. a/ b. oldhamii). The length of cab2bo1 ( GenBank accession
43 3 2 0 0 7 3 SCIENTIA SILVAE SINICAE Vol143, No13 Mar., 2 0 0 7 a/ b 3 1 1 2 1 (1. 100102 ; 2. 100091) : RT2PCR RACE a/ b cdna, cab2 BO1 ( GenBank : EF061137) 1 102 bp, 64 861 bp 1, 265 cab2bo1 64 232
HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332
,**1 The Japanese Society for AIDS Research The Journal of AIDS Research +,, +,, +,, + -. / 0 1 +, -. / 0 1 : :,**- +,**. 1..+ - : +** 22 HIV AIDS HIV HIV AIDS : HIV AIDS HIV :HIV AIDS 3 :.1 /-,**1 HIV
Ara h 2. pet - 32a + Origami. Western blotting ELISA SDS - PAGE Ara h 2 F - Ara h 2. IgE
2011 33 5 0993-0998 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com Ara h 2 1 2 3 4 5 6 2 4* 2 4* 1. 518060 2. 518060 3. 830000 4. 518060 5. 518045
IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2
344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.
Supporting Information
Supporting Information Lewis acid catalyzed ring-opening reactions of methylenecyclopropanes with diphenylphosphine oxide in the presence of sulfur or selenium Min Shi,* Min Jiang and Le-Ping Liu State
Supporting Information
Supporting Information for AgOTf-catalyzed one-pot reactions of 2-alkynylbenzaldoximes with α,β-unsaturated carbonyl compounds Qiuping Ding 1, Dan Wang 1, Puying Luo* 2, Meiling Liu 1, Shouzhi Pu* 3 and
Quick algorithm f or computing core attribute
24 5 Vol. 24 No. 5 Cont rol an d Decision 2009 5 May 2009 : 100120920 (2009) 0520738205 1a, 2, 1b (1. a., b., 239012 ; 2., 230039) :,,.,.,. : ; ; ; : TP181 : A Quick algorithm f or computing core attribute
Identification of Salmonella,Campylobacter jejuni and Enterohemorrhagic E.coli by Denaturing High-performance Liquid Chromatography
BIOTECHNOLOGY BULLETIN 2009 3 116015 PCR multiplex PCR mpcr denaturing high-performance liquid chromatography DHPLC O157 H7 fimy gyra O157 H7 rfbe 3 O157 H7 PCR 284 159 499 bp PCR O157 H7 1.5 CFU/ ml 15
Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo
Bull. Earthq. Res. Inst. Univ. Tokyo Vol. 2.,**3 pp.,,3,.* * +, -. +, -. Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Kunihiko Shimazaki *, Tsuyoshi Haraguchi, Takeo Ishibe +, -.
Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements
5 5 2012 10 Chinese Optics Vol. 5 No. 5 Oct. 2012 1674-2915 2012 05-0525-06 - * 100190-14 - - 14. 51 μm 81. 4 μm - 1. 64 μm / O436. 1 TH703 A doi 10. 3788 /CO. 20120505. 0525 Correction of chromatic aberration
Construction and Evaluation of Lentiviral Vector pita-hbp1
ISSN 1007-7626 CN 11-3870 / Q 2010 11 Chinese Journal of Biochemistry and Molecular Biology 26 11 1044 ~ 1049 pita-hbp1 1 2 3 4 4 * 1 100191 2 100086 3 050031 4 100191 1 HBP1 pita-hbp1 Western HBP1 Q78
«ΠΡΟΜΗΘΕΙΑ ΕΞΟΠΛΙΣΜΟΥ ΕΡΓΑΣΤΗΡΙΟΥ»
ΦΟΡΕΑΣ ΔΙΑΧΕΙΡΙΣΗΣ ΕΘΝΙΚΟΥ ΘΑΛΑΣΣΙΟΥ ΠΑΡΚΟΥ ΖΑΚΥΝΘΟΥ ΤΕΥΧΟΣ ΠΡΟΚΗΡΥΞΗΣ ΑΝΟΙΚΤΟΥ ΙΑΓΩΝΙΣΜΟΥ ΓΙΑ ΤΟ ΕΡΓΟ «ΠΡΟΜΗΘΕΙΑ ΕΞΟΠΛΙΣΜΟΥ ΕΡΓΑΣΤΗΡΙΟΥ» Για τις ανάγκες της Πράξης ΟΡΓΑΝΩΣΗ ΤΗΣ ΠΡΟΣΤΑΣΙΑΣ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ
c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No
2008 245 2 1) 1) 2) 3) 4) 1) 1) 1) 1) 1), 2) 1) 2) 3) / 4) 20 3 24 20 8 18 2001 2 2 2004 2 59.0 2002 1 2004 12 3 2 22.1 1 14.0 (CNS), Bacillus c 2 p 0.01 2 1 31.3 41.9 21.4 1 2 80 CNS 2 1 74.3 2 Key words:
SOD SNP % Cu /Zn-SOD. DAM- BE DNAStar % Mn /Fe-SOD. 6 1SNP /17. 9 bp
2011 33 6 1206-1211 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com SOD SNP 1 2 3 2 2* 1. 330004 2. 330004 3. 510006 GenBank Cu /Zn-SOD Mn /Fe-SOD
TABLE OF CONTENTS Page
TABLE OF CONTENTS Page Acknowledgements... VI Declaration... VII List of abbreviations... VIII 1. INTRODUCTION... 1 2. BASIC PRINCIPLES... 3 2.1. Hereditary Colorectal Cancer... 3 2.1.1. Differential diagnosis...
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to facilitate intracellular survival Hongwei Gu 1,2*, Chihao Zhao 1,2*, Tianfu Zhang 1,2*, Hongwei Liang 1,2, Xiao-Ming Wang 1,
ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ
- - ό ό : Ω ί ό ί ώ.. ά ή ί ός ή ς ύ ί ί ή έ ώ ό. ή ς ά ς ής ό ός ά ς ή έ ός ή ς ί ής ί ς. ό έ ώ - ώ ή ής ή ς- ί ά ά ς ί ς. ά ί ί έ έ ά ύ ή, ό ί ά, ό ό ά έ ά ής ί ύ George Wald ή ί έ ς ί ύ ό ς ί ς ά έ
Electrolyzed-Reduced Water as Artificial Hot Spring Water
/-,**- + +/ 0 +, - + + +, - + +. ++,3 +/. +. Electrolyzed-Reduced Water as Artificial Hot Spring Water Shoichi OKOUCHI +, Daisuke TAKEZAKI +, Hideyuki OHNAMI +, Yuhkoh AGISHI,, Yasuo KANROJI -, and Shigeo
Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application
31 5 2011 5 Acta Scientiae Circumstantiae Vol 31 No 5 May 2011 2011 - J 31 5 935-940 Huang Y M Yuan D X Peng Y Z et al 2011 Rapid determination of soluble reactive silicate in seawater by flow injection
Μαρία Κατσιφοδήμου. Ο ρόλος της έκκρισης HLA-G από τα ανθρώπινα έμβρυα στην επιτυχία της εξωσωματικής γονιμοποίησης. Μεταπτυχιακή Διπλωματική Εργασία
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΚΑΤΕΥΘΥΝΣΗ: ΕΦΑΡΜΟΣΜΕΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΒΙΟΤΕΧΝΟΛΟΓΙΑ Ο ρόλος της έκκρισης HLA-G από τα ανθρώπινα
Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού
Σχολή Θετικών Επιστημών Τμήμα Βιολογίας Πρόγραμμα Μεταπτυχιακών Σπουδών Κατεύθυνση: Εφαρμοσμένη γενετική και βιοτεχνολογία ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου
A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ Πτυχιακή εργασία ΜΕΛΕΤΗ ΠΟΛΥΦΑΙΝΟΛΩΝ ΚΑΙ ΑΝΤΙΟΞΕΙΔΩΤΙΚΗΣ ΙΚΑΝΟΤΗΤΑΣ ΣΟΚΟΛΑΤΑΣ Αναστασία Σιάντωνα Λεμεσός
Science of Sericulture
Science of Sericulture 2012 38 1 0065-0069 ISSN 0257-4799 CN 32-1115 /S E-mail CYKE@ chinajournal. net. cn 215123 25 0 ~ 24 h GSH GSSG GSH + 2GSSG GSH /GSSG S- GST TPX 23% GR 57% GSH TPX GST GSSG 61% GSH
Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil
354 Nippon Shokuhin Kagaku Kogaku Kaishi Vol. /-, No.0, -/.-0* (,**0) 38 * * Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil Tomoko Kawakami, Kyoko Ohashi* and Atsuko Shimada Graduate
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity Jian-Long Li 1,a, Wei Zhao 1,a, Chen Zhou 1,a, Ya-Xuan
Angioarrestin( harp1) C FD
ISSN 100727626 CN 1123870ΠQ 2007 2 Chinese Journal of Biochemistry and Molecular Biology 23 (2) :136 140 Angioarrestin( harp1) C FD,,,,, ( 200433) 3 Angioarrestin DNA angioarrestin C hfd cdna (MBP) pmal2c
CHAPTER INTRODUCTION... 1 CHAPTER REVIEW OF LITERATURE...
Table of Content CHAPTER-1... 1 1 INTRODUCTION... 1 CHAPTER-2... 4 2 REVIEW OF LITERATURE... 4 2.1 History of Filariasis... 4 2.1.1 Discovery of Symptoms (1588-1592)... 4 2.1.2 Discovery of Microfilariae
Octretide joint proton pump inhibitors in treating non-variceal gastrointestinal bleeding a Metaanalysis
528 2012 6 21 6 Chin J Gastroenterol Hepatol Jun 2012 Vol. 21 No. 6 doi 10. 3969 /j. issn. 1006-5709. 2012. 06. 011 Meta 430060 Cochrane Library Pubmed 2 Revman 5. 0 6 484 Meta Meta R573. 2 A 1006-5709
Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic
Supporting Information Asymmetric Binary-acid Catalysis with Chiral Phosphoric Acid and MgF 2 : Catalytic Enantioselective Friedel-Crafts Reactions of β,γ- Unsaturated-α-Ketoesters Jian Lv, Xin Li, Long
Research Papers. TNF-α. L929 LPS Carswell [1] BCG. pet-41d TNF).TNF. NEB TNF-α cdna Invitrogen DNA. 75 ku TNF TransTaq High %
Research Papers Progress in Biochemistry and Biophysics 2009, 36(4): 424~430 wwwpibbaccn * TNF-α 1, 2) 1) 1)** ( 1) 100101 2) 100039) TNF-α TNF-α TNF-α TNF-α TNF-α TNF-α 9C6 TNF-α 29~40 TNF-α 9C6 TNF-α
Tan Xiaofeng Chen Hongpeng Zhang Dangquan Zeng Yanling Li Wei Jiang Yao Xie Lushan Hu Xiaoyi Hu Fangming. and Technology Changsha 410004)
44 3 2 0 0 8 3 SCIENTIA SILVAE SINICAE Vol144,No13 Mar.,2 0 0 8 FAD2 cdna ( 410004) : FAD2, EST, 5 RACE PCR FAD2 cdna 1 682 bp, 1 149 bp, 382, FAD2, FAD2 FAD2 : ; EST ; FAD2 ; RACE; PCR ; :S718146 ;Q94312
Congruence Classes of Invertible Matrices of Order 3 over F 2
International Journal of Algebra, Vol. 8, 24, no. 5, 239-246 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/.2988/ija.24.422 Congruence Classes of Invertible Matrices of Order 3 over F 2 Ligong An and
TGFp FSH INH INH
(210095) E-mail ( genlinwang@hotmail.com) - -(Strept Avidin-Biotin-Peroxidase Complex SABC), 1 32,, 1 inhibin INH α 32 000 TGFp FSH FSH [1] INHα Sertoli Noguchi 1997 [2] Meunier et al.1988 [3] INH INH
CPT. Tsuchiya. beta. quantitative RT PCR QIAGEN IGFBP. Fect Transfection Reagent sirna. RT PCR RNA Affymetrix GeneChip Expression Array
7 PTEN p Tsuchiya DNA Hepatocyte nuclear factor beta HNF beta HNFbeta IGFBP GLUT G Pase MODY maturity onset diabetes of the young Tsuchiya HNFbeta HNFbeta HNFbeta sirna CPT HNFbeta HNFbeta TOVG KOC ESMCAS
Πρόσκληση υποβολής προσφοράς
Αθήνα, 5 Μαρτίου 2014 Πρόσκληση υποβολής προσφοράς από φυσικά ή νομικά πρόσωπα για την προμήθεια υλικών στην Πράξη «ΘΑΛΗΣ Εθνικό Ίδρυμα Ερευνών Βιοσύνθεση και Γενετική Επιλογή Κυκλικών Πεπτιδίων με Εν
Antimicrobial Ability of Limonene, a Natural and Active Monoterpene
2010,32 (1) :24 28 http :/ / xuebao. jlau. edu. cn Journal of Jilin Agricultural University E2mail : jlndxb @vip. sina. com Ξ,,,, ΞΞ, 200062 : : 320 mg/ L,; ph 4 9, ; 80, 100,121 : : ; ; : TS20213 : A
JEV C RNA 11kb 3. Japanese encephalitis virus JEV JEV C 7. C E prm C 1 RNA. Gold pgbkt7 pgadt7- T pgbkt7-53 pgbkt7- JEV C PCR JEV C cdna
2012 12 4 CHINA TROPICAL MEDICINE Vol.12 No.4 April 2012 427 * JEV C PCR JEV C cdna pgbkt7 EcoRI/BamHI PEG/LiAc pgbkt7- JC pgbkt7 Gold Western- blotting BD- JC pgbkt7- JC Genebank JEV SA14-14- 2 JEV C
Distribution of Mercury and Selenium in the Proteins of Porcine Liver and Kidney Under Different Mercury Exposure Level
ISSN 100727626 CN 1123870ΠQ 2003 6 Chinese Journal of Biochemistry and Molecular Biology 19 (3) :377 382, 3,, (, 918 100039), (, 550002) (Sephadex G2100),, ;, ;, 11 kd (MT),,,,,,,,, Q51,X132 Distribution
Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
33 2 2011 4 Vol. 33 No. 2 Apr. 2011 1002-8412 2011 02-0096-08 1 1 1 2 3 1. 361005 3. 361004 361005 2. 30 TU746. 3 A Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
, Litrrow. Maxwell. Helmholtz Fredholm, . 40 Maystre [4 ], Goray [5 ], Kleemann [6 ] PACC: 4210, 4110H
57 6 2008 6 100023290Π2008Π57 (06) Π3486208 ACTA PHYSICA SINICA Vol. 57,No. 6,June,2008 ν 2008 Chin. Phys. Soc. 3 1) 2) 1) g 1) (, 130033) 2) (, 100049) (2007 9 11 ;2007 11 14 ),Littrow,,.,., Litrrow.
svari Real-time RT-PCR RSV
19 39-43 12 Real-time RS svarireal-time RSV subgroup HMPV RSV N Real-time 100 100 Real-time RSV subgroup RSV HMPV F Real-time 55.8 95.5 genotype A2 B1 TaqMan svari InfV RS RSV HMPV HRV PIV RSV HMPV RSV
Supporting Information
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Supporting Information Silver or Cerium-Promoted Free Radical Cascade Difunctionalization
Affinity chromatography for the purification of glutathione S-transferase from Oxya chinensis
20 48 4 826 830 * S - 2 **. 030006 2. 03080 GSH-agarose Oxya chinensis Thunberg 5 S - glutathione S-transferases GSTs 60% ~ 80% GSTs 90% 0. 3046 μmol / min / mg protein. 82 GSH-agarose 8. 585 μmol / min
Copper-Catalyzed Oxidative Dehydrogenative N-N Bond. Formation for the Synthesis of N,N -Diarylindazol-3-ones
Electronic Supplementary Material (ESI) for Organic Chemistry Frontiers. This journal is the Partner Organisations 2016 Supporting information Copper-Catalyzed Oxidative Dehydrogenative - Bond Formation
Acknowledgements... 3 Contents... I Figures... VII Tables... IX Abbreviations... X
I Acknowledgements... 3... I Figures... VII Tables... IX Abbreviations... X Amino acids... XII Nucleobases... XII 1 Introduction... 1 1.1 Polyketides and non-ribosomal peptides... 1 1.2 Polyketide synthases...
LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing
2003 61 3, 435 439 ACTA CHIMICA SINICA Vol 61, 2003 No 3, 435 439 2 ΞΞ ( 400715), 2, 2, 2, 3/ 2 2,, 2,, Ne w Methods for the Determination of the Inclusion Constant between Procaine Hydrochloride and 2Cyclodextrin
Introduction to Bioinformatics
Introduction to Bioinformatics 260.602.01 September 2, 2005 Jonathan Pevsner, Ph.D. pevsner@jhmi.edu bioinformatics medical informatics Tool-users public health informatics databases algorithms Tool-makers
The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea
2011 48 4 909 914 * 1 2** 2 2 2 2 2*** 1. 110161 2. 100081 026000 3 Calliptamus italicus L. 3 LC 50 LC 90 1. 34 14. 17 mg / L LC 50 LC 90 2. 09 45. 22 mg / L 50 mg / L 14 d 87% 100% 50 mg / L 50% The toxicity
Journal of Ningxia Medical University. Annexin P19 mrna P < AnnexinA2 P19 mrna. AnnexinA2 P19 mrna. PCR 1.
33 6 2011 6 Journal of Ningxia Medical University 511 1674-6309 2011 06-0511 - 04 AnnexinA2 P19 1 2 3 3 3 1. 415700 2. 750004 3. 750004 AnnexinA2 P19 62 IHC RT - PCR Western blot AnnexinA2P19 mrna AnnexinA2
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology Z58 Taxus x media Z min M + Na +
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2012 12 28 12 1141 ~ 1146 1 2 3 * 2 2 2 2 * 1 044099 2 430074 3 430064 Taxus x media Z58 10
Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang
13 4 2015 7 Chinese Journal of Bioprocess Engineering Vol. 13 No. 4 Jul. 2015 doi 10. 3969 /j. issn. 1672-3678. 2015. 04. 012 1 2 2 2 2 1. 830054 2. 361005 L- 50% IC 50 0. 27 mg /ml K I - K IS 0. 218 0.
Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis
HPLC * 271016 HPLC - DAD DiamonsilC 18 250 mm 4. 6 mm 5 μm - -1% 370 nm 1. 0 ml /min 40 R282. 7 A 1001-1528 2011 01-0001-05 Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus
* ** *** *** Jun S HIMADA*, Kyoko O HSUMI**, Kazuhiko O HBA*** and Atsushi M ARUYAMA***
J. Jpn. Soc. Soil Phys. No. +*2, p. +3,2,**2 * ** *** *** Influence Area of Stem Flow on a Soil of Deciduous Forest Floor by Electric Resistivity Survey and the Evaluation of Groundwater Recharge through
Basic & Clinical Medicine PLGA MUC1 MUC1 IC 50 MUC1 +
2011 7 31 7 1001-6325 2011 07-0751 -05 July 2011 Vol. 31 No. 7 MUC1 1 1 1 2 1 1* 1. 100005 2. 100190 MUC1 PLGA MUC1 MUC1 MUC1 MCF-7 HepG2 MTS IC 50 MUC1 225. 3 ± 9. 2 nm 83. 6% ± 1. 7% MUC1 + MCF-7 P
2011 33 3 0578-0583 http / /xuebao. jxau. edu. cn. orfh79 orfh79 pet - 28a - orfh79 pgex5x - 2 - orfh79
2011 33 3 0578-0583 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com orfh79 1 2 1 1 2 1 2 2 1. / 330031 2. / 430072 orfh79 orfh79 pet - 28a - orfh79
1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.
2 0 1 5 7 Journal of Chinese Institute of Food Science and Technology Vol. 15 No. 7 Jul. 2 0 1 5 1,2 1 1 1 1* ( 1 315211 2 315502) : ( ) : (E-Nose), - : GC-MS, 20.98% 2.5%, 53.15% 11.2%, 0. 51% 71.86%
CorV CVAC. CorV TU317. 1
30 8 JOURNAL OF VIBRATION AND SHOCK Vol. 30 No. 8 2011 1 2 1 2 2 1. 100044 2. 361005 TU317. 1 A Structural damage detection method based on correlation function analysis of vibration measurement data LEI
Direct Transformation of Ethylarenes into Primary Aromatic Amides with N-Bromosuccinimide and I 2 -aq NH 3
Supporting Information Direct Transformation of Ethylarenes into Primary Aromatic Amides with N-Bromosuccinimide and I 2 -aq NH 3 Shohei Shimokawa, Yuhsuke Kawagoe, Katsuhiko Moriyama, Hideo Togo* Graduate
PCR. Site-directed Mutagenesis of Sumf 1 Gene of Mouse Based on Overlap Extension PCR and Construction of Eukaryotic Expression Vector
13 5 Vol13 No5 9 10 Life Science Research Oct 9 9 PCR Sumf1 *,,,,, 481 : (chromatin immunoprecipitation assay, ChIP) activator protein-2 alpha (AP-2 α) Sumf 1 PCR, AP-2 α Sumf 1, DNA, Sumf 1 103 ~111,
Molecular Cloning of MUC1ΠY and Soluble Expression of Its
ISSN 100727626 CN 1123870ΠQ 2001 10 Chinese Journal of Biochemistry and Molecular Biology 17 (5) :579 584 MUC1ΠY, 3, ( 100039) MUC1ΠY cdna, RT2PCR HeLa MUC1ΠY cdna ;PCR, p GEX22T DH5a ; ; GST N ; MUC1ΠY
* /+* *,3- +**+ + ** , +1 - ect of a Dietary Education Program for Kindergarten Children and their Mothers
, * ** * ** ** * /+* *,3- +**+ + **.0. 200, +1- The E# ect of a Dietary Education Program for Kindergarten Children and their Mothers, Chizuko Hotta* **, Haruko Takada*, Tomoko Kimura** and Michitaka Naito**
Nguyen Hien Trang* **
152 Nippon Shokuhin Kagaku Kogaku Kaishi Vol.., No.., +,+3 (,**1) 10 Nguyen Hien Trang* ** * Department of Food Science and Technology, Hue University of Agriculture and Forestry ** Properties of "Shishibishio
Reading Order Detection for Text Layout Excluded by Image
19 5 JOURNAL OF CHINESE INFORMATION PROCESSING Vol119 No15 :1003-0077 - (2005) 05-0067 - 09 1, 1, 2 (11, 100871 ; 21IBM, 100027) :,,, PMRegion,, : ; ; ; ; :TP391112 :A Reading Order Detection for Text
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology human telomerase reverse transcriptase htert
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2013 4 29 4 383 ~ 388 PCR htert mrna 1 2 2 3 1 1 2 2 1 1 530021 2 530021 3 * 3 530021 human
Advance in Nanorealgar Studies
21 5 2009 5 PROGRESS IN CHEMISTRY Vol. 21 No. 5 May, 2009 1 1 2 3 (1. 430074 ; 2. 430074),,, ;,, : O61316 ; R284 : A : 10052281X(2009) 0520934206 Advance in Nanorealgar Studies Ye Xiaochuan 1 Yang Xiangliang
Enantioselective Organocatalytic Michael Addition of Isorhodanines. to α, β-unsaturated Aldehydes
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2016 Enantioselective Organocatalytic Michael Addition of Isorhodanines to α,
Chinese Journal of Biochemistry and Molecular Biology RNA.
ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2009 8 25 (8) :759 763 RNA 1), 2), 1) 3, 1) 1),2), ( 1), 400014 ; 2), 400014) RNA, (CTGF) RNA. EcoR Hind, ptm12 CTGF PCR
CHAPTER 25 SOLVING EQUATIONS BY ITERATIVE METHODS
CHAPTER 5 SOLVING EQUATIONS BY ITERATIVE METHODS EXERCISE 104 Page 8 1. Find the positive root of the equation x + 3x 5 = 0, correct to 3 significant figures, using the method of bisection. Let f(x) =
Study on Purification Technology and Antioxidant Activity of Total Flavonoid from Eriobotryae Folium
Interleukin-1beta causes pulmonary inflammation, emphysema, and airway remodeling in the adult murine lung [J]. Am J Respir Cell Mol Biol, 2005, 32(4): 311-318. [10] FAN C H, LI S Y, LI M, et al. The clinical
Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water
31 1 2010 1 ENVIRONMENTAL SCIENCE Vol. 31,No. 1 Jan.,2010, 3, (,, 100084) :,.,, ( Microcystis aeruginosa),3 (A 2 O ) 10 6 ml - 1,> 0139 d - 1. A 2 O222,. TP ( K max ) ( R max ), Monod. :; ; ; ; :X173 :A
Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2
Free Radical Initiated Coupling Reaction of Alcohols and Alkynes: not C-O but C-C Bond Formation Zhongquan Liu,* Liang Sun, Jianguo Wang, Jie Han, Yankai Zhao, Bo Zhou Institute of Organic Chemistry, Gannan
Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent
Supplementary information for the paper Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent Yang Xue, Ling-Po Li, Yan-Hong He * & Zhi Guan * School of Chemistry and Chemical Engineering,
PrP C. PrP SC PrP. PrP. mrna
PrP C PrP SC PrP C PrP C PrP SC PrP C PrP SC PrP C PrP SC PrP PrP SC PrP SC PrP PrP SC PCR PCR mrna PrP PrP C RT-PCR PrP mrna PrP E-mail:zhaodm@ cau.edu.cn 1 SPF Ecoli DH 5α TRIZOL RNA Gibco dntpstakara
BL21 (D E3)2p E T28a ( + )2bgl 2
28 2 2009 3 Journal of Food Science and Biotechnology 28 No. 2 Vol. Mar. 2009 :167321689 (2009) 0220250206 BL21 (D E3)2p E T28a ( + )2bgl 2,, 3, (, 214122) : 2E. coli BL21 (DE3)2p ET28a ( + )2bgl LB, p
Differential Expression of DNMTs Between Gastric Tissues with and without H. Pylori Infection
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2011 11 27 11 1032 ~ 1038 DNMT 1 2 3 1 1 4 1 * 1 400016 2 400016 3 400016 4 400016 DNA DNA
Electronic Supplementary Information
Electronic Supplementary Information Unprecedented Carbon-Carbon Bond Cleavage in Nucleophilic Aziridine Ring Opening Reaction, Efficient Ring Transformation of Aziridines to Imidazolidin-4-ones Jin-Yuan
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology H 2 O 2 AKT2 TUNEL DNA ladder AKT2 sirna PI3K / AKT
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2011 11 27 11 1044 ~ 1050 AKT2 * 350025 AKT2 H 2 RT-PCR AKT2 cdna pcdna3 1 / myc-his - A AKT2