Οι πιο πολλές χρωμοσωμικές ανωμαλίες είναι αποτέλεσμα μη φυσιολογικού διαχωρισμού των χρωμοσωμάτων σε κάποιο στάδιο της κυτταρικής διαίρεσης μείωσης

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Οι πιο πολλές χρωμοσωμικές ανωμαλίες είναι αποτέλεσμα μη φυσιολογικού διαχωρισμού των χρωμοσωμάτων σε κάποιο στάδιο της κυτταρικής διαίρεσης μείωσης"

Transcript

1 1

2 Οι πιο πολλές χρωμοσωμικές ανωμαλίες είναι αποτέλεσμα μη φυσιολογικού διαχωρισμού των χρωμοσωμάτων σε κάποιο στάδιο της κυτταρικής διαίρεσης μείωσης Γαμετογένεση ή μίτωσης. 1. Το γενετικό λάθος μπορεί να είναι αποτέλεσμα μη διαχωρισμού των ομολόγων χρωμοσωμάτων κατά τη μείωση Ι 2. Το λάθος μπορεί να γίνει κατά τη Μείωση ΙΙ όταν δεν διαχωρίζωνται οι αδελφές χρωματίδες Και στις δυο πιο πάνω περιπτώσεις δημιουργούνται γαμέτες με λιγότερα ή περισσότερα χρωμοσώματα από το φυσιολογικό. Τα έμβρυα που προκύπτουν από τη γονιμοποίηση τους με άλλους φυσιολογικούς γαμέτες εμφανίζουν αριθμητικές ανωμαλίες. 3 Η τελευταία περίπτωση μπορεί να συμβεί σε φυσιολογικό έμβρυο στο οποίο τα χρωμοσώματα δεν διαχωρίζονται σωστά κατά τη μίτωση με αποτέλεσμα τη δημιουργία 2 ή περισσοτέρων κυτταρικών σειρών με ανάλογο αριθμό χρωμοσωμάτων. 2

3 Πρώτα θα δούμε το σύνδρομο klinefelter 3

4 Αυτός είναι ο καρυότυπος των κυττάρων του ατόμου με σύνδρομο Klinefelter. Τα φυλετικά χρωμοσώματα είναι 3 με δυο χρωμοσώματα Χ και ένα Υ. Ο καρυότυπος αρα είναι 47, ΧΧΥ Στα θηλαστικά με περισσότερα από ένα χρωμόσωματα Χ, τα γονίδια σε ένα από αυτά δεν εκφράζονται. Ο μηχανισμός αυτός είναι γνωστός ως αδρανοποίηση Χ. Αυτό συμβαίνει τόσο σε XXY αρσενικά όσο και στα φυσιολογικά θηλυκά άτομα XX. Σε άτομα με Klinefelter παρόλο που μερικά γονίδια του Χ χρωματοσώματος αδρανοποιούνται εντούτοις μερικά παραμένουν ενεργά με αποτέλεσμα το άτομο να παρουσιάζει και θηλυκά και αρσενικά χαρακτηριστικά! Το σύνδρομο μπορεί να διαγνωσθεί και προγεννητικά με αμνιοκέντηση δηλαδή ανάλυση των χρωμοσωμάτων, του γενετικού υλικού στα κύτταρα του αμνιακού υγρού. 4

5 Ο φαινότυπος είναι κατευθείαν αποτέλεσμα της παρουσίας δυο Χ χρωμοσωμάτων και μόνο ενός Υ. Τα κυριότερα φαινοτυπικά χαρακτηριστικά είναι η έντονη Γυναικομαστία και ο υπογοναδιτισμόs δηλαδή μικρά γεννητικά όργανα ένα χαρακτηριστικό που συνοδεύεται με μειωμένα επίπεδα ορμονών, αζοοσπερμία δηλαδή έλλειψη σπερματοζωαρίων και στειρότητα. 5

6 6

7 Το σύνδρομο ΧΥΥ είναι ένας ανευπλοειδίσμός (μη φυσιολογικός αριθμός των φυλετικών χρωμοσωμάτων), στην οποία ένα άντρας λαμβάνει ένα επιπλέον χρωμόσωμα Υ, δίνοντας συνολικά 47 χρωμοσώματα αντί 46. με αποτελεσμα τον καρυότυπο 47, ΧΥΥ, ο οποίος εμφανίζεται σε 1 στις αρσενικές γεννήσεις. 7

8 Αυτός είναι ο καρυότυπος ατόμου με το σύνδρομο. Φαίνεται καθαρά το επιπλέον χρωμόσωμα Υ. Το σύνδρομο δεν είναι κληρονομικό αλλά ένα τυχαίο γεγονός που συμβαίνει κατά τη σπερματογένεση όπου τα δυο ομόλογα χρωμοσώματα Υ δεν διαχωρίζονται και μπαίνουν στο ίδιο σπερματοζωάριο. Το λάθος αυτό συμβαίνει συνήθως κατά τη δεύτερη μειωτική διαίρεση στη σπερματογένεση ή κατά τα αρχικά στάδια της ανάπτυξης του ζυγωτού. 8

9 Τα αγόρια με καρυότυπο 47,XYY δεν είναι διαφορετικά από άλλα αγόρια της ηλικίας τους. Παρόλο που είναι πιο ψηλοί από τον μέσο όρο με πολύ έντονη ακμή, δεν εμφανίζουν άλλα φαινοτυπικά χαρακτηριστικά και έχουν φυσιολογική γονιμότητα δηλαδή μπορούν να κάνουν παιδιά. Άτομα με το σύνδρομο ΧΥΥ έχουν αυξημένες πιθανότητες να έχουν μαθησιακές δυσκολίες, και καθυστέρηση στην ανάπτυξη δεξιοτήτων τόσο πνευματικών οσο και κινητικών. Οι δυσκολίες αυτές είναι κοινές και εμφανίζονται συχνά και σε αγόρια με φυσιολογικό καρυότυπο ΧΥ. Τη δεκαετία του 70 μετά από μια μελέτη σε φυλακές της Αμερικής, είχε συνδεθεί η εμφάνιση του συνδρόμου με αυξημένη εγκληματική συμπεριφορά. Αυτό πια δεν είναι αποδεκτό και ο αυξημένος αριθμός κατάδικων με ΧΥΥ καρυότυπο φαίνεται να σχετίζεται με την αυξημένη σωματική διάπλαση και χαμηλή ευφυία τους. Ενας συνδυασμός που τους καθιστούσε ευάλωτους σε... Ας πούμε... Κακές παρέες και κακές επιρροές. syndrome is characterized by an extra copy of the Y chromosome in each of a male's cells. Although males with this condition may be taller than average, this chromosomal change typically causes no unusual physical features. Most males with 47,XYY syndrome have normal sexual development and are able to father children. 47,XYY syndrome is associated with an increased risk of learning disabilities and delayed development of speech and language skills. Delayed development of motor skills (such as sitting and walking), weak muscle tone (hypotonia), hand tremors or other involuntary movements (motor tics), and behavioral and emotional difficulties are also possible. These characteristics vary widely among affected boys and men. A small percentage of males with 47,XYY syndrome are diagnosed with autistic spectrum disorders, which are developmental conditions that affect communication and social interaction. How common is 47,XYY syndrome? This condition occurs in about 1 in 1,000 newborn boys. Five to 10 boys with 47,XYY syndrome are born in the United States each day. 9

10 Το σύνδρομο Τέρνερ χαρακτηρίζεται από μονοσωμία Χ Η απουσία ενός δεύτερου φυλετικού χρωμοσώματος έχει σαν αποτέλεσμα την εμφάνιση θηλυκού φαινότυπου. Το σύνδρομο έχει συχνότητα περίπου 1 στα 2,500 νεογέννητα κορίτσια αλλά είναι πολύ πιο συχνό σε έμβρυα που δεν ολοκληρώνουν τη κύηση και αποβάλονται φυσιολογικά ή γεννιούνται νεκρά. 10

11 Εδώ φαίνεται ο καρυότυπος ενός τέτοιου ατόμου με μόνο ένα χρωμόσωμα Χ 11

12 Τα ποιο συχνά φαινοτυπικά χαρακτηριστικά του συνδρόμου Turner είναι το χαμηλό ύψος το οποίο γίνεται ποιο εμφανές μετά την ηλικία των 5. Από τα πρώτα στάδια σταματά η λειτουργία των ωοθηκών και παρόλο που σε κάποιες περιπτώσεις οι ωοθήκες ξεκινούν και αναπτύσονται φυσιολογικά, η ανάπτυξη σταματά, τα ωοκύτταρα καταστρέφονται και ο ωοθηκικός ιστός εκφυλίζεται. Πολλά από τα κορίτσια δεν μπαίνουν καν στην εφηβεία εκτός και αν πάρουν ορμονική θεραπεία. Περίπου το 30% των ατόμων με σύνδρομο Turner έχουν πλατυύ πτυχωτό λαιμό και αυξημένη τριχοφυία. Εμφανίζουν επίσης οίδημα ( φούσκωμα ) στα χέρια και τα πόδια, όπως και σκελετικές ανωμαλίες και προβλήματα στα νεφρά. Το 1/3 των ατόμων με το σύνδρομο γεννιέται με καρδιακά προβλήματα όπως στένωση της αρτηρίας ή ανωμαλίες στις βαλβίδες. An early loss of ovarian function (ovarian hypofunction or premature ovarian failure) is also very common. The ovaries develop normally at first, but egg cells (oocytes) usually die prematurely and most ovarian tissue degenerates before birth. Many affected girls do not undergo puberty unless they receive hormone therapy, and most are unable to conceive (infertile). A small percentage of females with Turner syndrome retain normal ovarian function through young adulthood. About 30 percent of females with Turner syndrome have extra folds of skin on the neck (webbed neck), a low hairline at the back of the neck, puffiness or swelling (lymphedema) of the hands and feet, skeletal abnormalities, or kidney problems. One third to one half of individuals with Turner syndrome are born with a heart defect, such as a narrowing of the large artery leaving the heart (coarctation of the aorta) or abnormalities of the valve that connects the aorta with the heart (the aortic valve). Complications associated with these heart defects can be life- 12

13 threatening. Most girls and women with Turner syndrome have normal intelligence. Developmental delays, nonverbal learning disabilities, and behavioral problems are possible, although these characteristics vary among affected individuals. 12

14 Το μέσο ύψος είναι κάτω από ενάμιση μέτρο και τους παρέχεται ορμονική θεραπεία για να ψηλώσουν στα φυσιολογικά επίπεδα. Οι περισσότερες γυναίκες με το σύνδρομο παρουσιάζουν ύψος ενηλίκου μεταξύ cm. Η χορήγηση αυξητικής ορμόνης οδηγεί σε κάποια αύξηση του τελικού ύψους, Δεν είναι ακόμα ξεκάθαρο για το ποια γονίδια στο χρωμόσωμα Χ είναι υπεύθυνα για τον χαρακτηριστικό φαινότυπο των ατόμων με το σύνδρομο Turner. Έχουν όμως συνδέσει το γονίδιο SHOX short stature homeo box. το οποίο είναι σημαντικό και συνδέεται με την ανάπτυξη των οστών. Το γονίδιο βρίσκεται στη ψευδοαυτοσωμική περιοχή των φυλετικών χρωμοσωμάτων Χ και Υ. Η απώλεια του γονιδίου μπορεί να δικαιολογεί το χαμηλό ανάστημα και τις άλλες σκελετικές ανωμαλίες που εμφανίζουν τα άτομα με το σύνδρομο. 13

15 Άτομα με το σύνδρομο δεν έχουν νοητικά προβλήματα και μπορούν να έχουν μια φυσιολογική ζωή. 14

16 Το σύνδρομο με τρισωμία του χρωμοσώματος Χ 47,XXX, Γυναίκες με το σύνδρομο δεν έχουν κάποιο ιδιαίτερο φαινοτυπικό χαρακτηριστικό. Οι γυναίκες αυτές μπορεί να είναι πιο ψηλές από το μέσο όρο και έχουν φυσιολογική σεξουαλική ανάπτυξη. Εμφανίζεται με συχνότητα 1 στις 100 γεννήσεις κοριτσιών. Μπορεί να βρεθεί σε μωσαϊκή μορφή σε άτομα με σύνδρομο Turner. Triple X syndrome is associated with an increased risk of learning disabilities and delayed development of speech and language skills. Delayed development of motor skills (such as sitting and walking), weak muscle tone (hypotonia), and behavioral and emotional difficulties are also possible, but these characteristics vary widely among affected girls and women. Seizures or kidney abnormalities occur in about 10 percent of affected females. How common is triple X syndrome? This condition occurs in about 1 in 1,000 newborn girls. Five to 10 girls with triple X syndrome are born in the United States each day. What are the genetic changes related to triple X syndrome? People normally have 46 chromosomes in each cell. Two of the 46 chromosomes, known as X and Y, are called sex chromosomes because they help determine whether a person will develop male or female sex characteristics. Females typically have two X chromosomes (46,XX), and males have one X chromosome and one Y chromosome (46,XY). Triple X syndrome results from an extra copy of the X chromosome in each of a female's cells. As a result of the extra X chromosome, each cell has a total of 47 chromosomes (47,XXX) instead of the usual 46. An extra copy of the X chromosome is associated with tall stature, learning problems, and other features in some girls and women. Some females with triple X syndrome have an extra X chromosome in only some of their cells. This phenomenon is called 46,XX/47,XXX mosaicism. Read more about the X chromosome. Can triple X syndrome be inherited? Most cases of triple X syndrome are not inherited. The chromosomal change usually occurs as a random event during the formation of reproductive cells (eggs and sperm). An error in cell division called nondisjunction can result in reproductive cells with an abnormal number of chromosomes. For example, an egg or sperm cell may gain an extra copy of the X chromosome as a result of nondisjunction. If one of these atypical reproductive cells contributes to the genetic makeup of a child, the child will have an extra X chromosome in each of the body's cells. 46,XX/47,XXX mosaicism is also not inherited. It occurs as a random event during cell division in early embryonic development. As a result, some of an affected person's cells have two X chromosomes (46,XX), and other cells have three X chromosomes (47,XXX). 15

17 Ευχααααααααριστούμεε! 16

ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ

ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ 1) ΑΝΩΜΑΛΙΕΣ ΣΤΟΝ ΑΡΙΘΜΟ ΤΩΝ ΧΡΩΜΟΣΩΜΑΤΩΝ ΕΥΠΛΟΕΙΔΙΑ: ΚΑΘΕ ΠΟΛΛΑΠΛΑΣΙΟ ΤΟΥ ΑΡΙΘΜΟΥ Ν (ΑΠΛΟΕΙΔΕΣ ΓΟΝΙΔΙΩΜΑ) 3Ν ΑΥΘΟΡΜΗΤΕΣ ΑΠΟΒΟΛΕΣ 4Ν τριπλοειδία Α) Γονιμοποίηση ωαρίου

Διαβάστε περισσότερα

ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ

ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ Σύνδροµο Down Το σύνδροµο Down είναι µια γενετική ανωµαλία ου εριλαµβάνει συνδυασµό χαρακτηριστικών, ό ως νευµατική καθυστέρηση, συγκεκριµένα χαρακτηριστικά ροσώ ου και συχνά καρδιακά

Διαβάστε περισσότερα

Χρωμοσωματικές ανωμαλίες

Χρωμοσωματικές ανωμαλίες Χρωμοσωματικές ανωμαλίες ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ ΕΥΘΥΝΟΝΤΑΙ ΓΙΑ: 50% ΤΩΝ ΑΥΘΟΡΜΗΤΩΝ ΑΠΟΒΟΛΩΝ ΠΕΡΙΣΣΟΤΕΡΑ ΑΠΟ 60 ΣΥΝΔΡΟΜΑ ΕΜΦΑΝΙΖΟΝΤΑΙ ΣΤΟ ~0.7% ΤΩΝ ΒΡΕΦΩΝ ΕΜΦΑΝΙΖΟΝΤΑΙ ΣΤΟ 2 % ΤΩΝ ΚΥΗΣΕΩΝ ΜΗΤΕΡΩΝ ΑΝΩ ΤΩΝ

Διαβάστε περισσότερα

Στα πτηνά το φύλο «καθορίζεται από τη μητέρα». Αυτό γιατί, το αρσενικό άτομο φέρει τα χρωμοσώματα ZZ ενώ το θηλυκό τα ZW. Έτσι εναπόκειται στο που θα

Στα πτηνά το φύλο «καθορίζεται από τη μητέρα». Αυτό γιατί, το αρσενικό άτομο φέρει τα χρωμοσώματα ZZ ενώ το θηλυκό τα ZW. Έτσι εναπόκειται στο που θα 1 Όπως όλοι γνωρίζουμε κάθε ζωντανός οργανισμός αποτελείται από κύτταρα. Μέσα στον πυρήνα των κυττάρων υπάρχουν τα χρωμοσώματα, τα οποία αποτελούν to γενετικό υλικό (DNA). Στα χρωμοσώματα αυτά βρίσκονται

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 ΘΕΜΑ 1ο 1. δ, ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 2. β, 3. β, 4. γ, 5. δ. ΘΕΜΑ2ο 1. Σχολικό βιβλίο, σελίδα 31: «Υπάρχουν τέσσερα είδη μορίων RNA και το μεταφέρει στη θέση της πρωτεϊνοσύνθεσης».

Διαβάστε περισσότερα

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά»

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2ο 1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» 2. σελ. 119-120: «Θεραπευτικά. Τα αντισώματα μπορούν να

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ. Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ. Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης 5/3/2013 Η κυτταρική διαίρεση είναι η διαδικασία κατά την οποία ένα αρχικό κύτταρο διαιρείται σε δύο θυγατρικά. Στους πολυκύτταρους

Διαβάστε περισσότερα

Μάθημα Ουρολογίας. Ανωμαλίες σεξουαλικής Διαφοροποίησης Καλοήθεις Παθήσεις Γεννητικού Συστήματος

Μάθημα Ουρολογίας. Ανωμαλίες σεξουαλικής Διαφοροποίησης Καλοήθεις Παθήσεις Γεννητικού Συστήματος Μάθημα Ουρολογίας Ανωμαλίες σεξουαλικής Διαφοροποίησης Καλοήθεις Παθήσεις Γεννητικού Συστήματος Μανώλης Μαυρομανωλάκης Διευθυντής ΕΣΥ Ουρολογική Κλινική Πα.Γ.Ν.Η Ηράκλειο 2011 Ανωμαλίες Σεξουαλικής Διαφοροποίησης

Διαβάστε περισσότερα

Μείωση-Βιολογία Κατεύθυνσης

Μείωση-Βιολογία Κατεύθυνσης κύτταρο -γυναίκας 1η μειωτική διαίρεση-αποχωρισμός ομολόγων 2η μειωτική διαίρεση-αποχωρισμός αδελφών Γαμέτης-3 Γαμέτης-4 Χ.Κ.ΦΙΡΦΙΡΗΣ-ΦΡΟΝΤΙΣΤΗΡΙΑ ΠΡΟΟΠΤΙΚΗ-ΠΑΠΑΝΑΣΤΑΣΙΟΥ 101 Σελίδα 1 κύτταρο -άνδρα 1η

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΚΑΙ ΣΥΝΔΡΟΜΟ DOWN ΥΠΟ ΤΗΝ ΑΙΓΊΔΑ ΤΗΣ ΙΕΡΗΣ ΜΗΤΡΟΠΟΛΗΣ ΑΛΕΞΑΝΔΡΟΥΠΟΛΗΣ. Μαλτέζος Ιωάννης

ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΚΑΙ ΣΥΝΔΡΟΜΟ DOWN ΥΠΟ ΤΗΝ ΑΙΓΊΔΑ ΤΗΣ ΙΕΡΗΣ ΜΗΤΡΟΠΟΛΗΣ ΑΛΕΞΑΝΔΡΟΥΠΟΛΗΣ. Μαλτέζος Ιωάννης ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΚΑΙ ΣΥΝΔΡΟΜΟ DOWN ΥΠΟ ΤΗΝ ΑΙΓΊΔΑ ΤΗΣ ΙΕΡΗΣ ΜΗΤΡΟΠΟΛΗΣ ΑΛΕΞΑΝΔΡΟΥΠΟΛΗΣ Μαλτέζος Ιωάννης Κληρονομικότητα Το σώμα μας αποτελείται από εκατομμύρια κύτταρα εκ των οποίων τα περισσότερα εξ αυτών

Διαβάστε περισσότερα

Εργασία στη Βιολογία

Εργασία στη Βιολογία Εργασία στη Βιολογία Τι είναι το χρωμόσωμα? Το χρωμόσωμα είναι μια οργανωμένη δομή DNA και πρωτεϊνών που βρίσκεται στα κύτταρα. Είναι ένα μοναδικό κομμάτι DNA που περιλαμβάνει πολλά γονίδια και άλλες ακολουθίες

Διαβάστε περισσότερα

ΔΟΜΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ

ΔΟΜΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ ΔΟΜΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ 2) ΑΝΩΜΑΛΙΕΣ ΣΤΗ ΔΟΜΗ ΤΩΝ ΧΡΩΜΟΣΩΜΑΤΩΝ Αποτέλεσμα θραύσης και ανώμαλης ανασύστασης χρωμοσωμάτων Αφορούν ή ένα χρωμόσωμα περισσότερα χρωμοσώματα Είναι ή Ισοζυγισμένες (διατηρείται

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ B B1. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β- θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA.

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο

Διαβάστε περισσότερα

ΑΝΑΠΤΥΞΗ ΤΟΥ ΠΤΥΧΙΑΚΗ. Λεμεσός

ΑΝΑΠΤΥΞΗ ΤΟΥ ΠΤΥΧΙΑΚΗ. Λεμεσός ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΤΟ ΚΑΠΝΙΣΜΑ ΚΑΤΑ ΤΗΝ ΕΓΚΥΜΟΣΥΝΗ ΚΑΙ Η ΒΛΑΠΤΙΚΗ ΕΠΙΔΡΑ ΑΣΗ ΤΟΥ ΣΤΗΝ ΑΝΑΠΤΥΞΗ ΤΟΥ ΝΕΟΓΝΟΥ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Ονοματεπώνυμο Αγγελική Παπαπαύλου Αριθμός Φοιτητικής

Διαβάστε περισσότερα

Newborn Upfront Payment & Newborn Supplement

Newborn Upfront Payment & Newborn Supplement GREEK Newborn Upfront Payment & Newborn Supplement Female 1: Το μωρό μου θα ρθει σύντομα, θα πρέπει να κανονίσω τα οικονομικά μου. Άκουσα ότι η κυβέρνηση δεν δίνει πλέον το Baby Bonus. Ξέρεις τίποτα γι

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β Β2. Σελίδα 40 σχολικού βιβλίου (έκδοση 2014-2015) Η παράγραφος «Έναρξη

Διαβάστε περισσότερα

Code Breaker. TEACHER s NOTES

Code Breaker. TEACHER s NOTES TEACHER s NOTES Time: 50 minutes Learning Outcomes: To relate the genetic code to the assembly of proteins To summarize factors that lead to different types of mutations To distinguish among positive,

Διαβάστε περισσότερα

ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΙΑΤΡΙΚΗ ΣΧΟΛΗ. ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥ ΩΝ «Ιατρική Ερευνητική Μεθοδολογία» ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ

ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΙΑΤΡΙΚΗ ΣΧΟΛΗ. ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥ ΩΝ «Ιατρική Ερευνητική Μεθοδολογία» ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΙΑΤΡΙΚΗ ΣΧΟΛΗ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥ ΩΝ «Ιατρική Ερευνητική Μεθοδολογία» ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Νόσος Pompe: Νεότερα κλινικά, γενετικά, διαγνωστικά και θεραπευτικά

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα

Φυλοσύνδετη κληρονοµικότητα. Π. Πάσχου, PhD

Φυλοσύνδετη κληρονοµικότητα. Π. Πάσχου, PhD Φυλοσύνδετη κληρονοµικότητα Π. Πάσχου, PhD Thomas Hunt Morgan Βραβείο Nobel 1933 στην κατηγορία Φυσιολογία ή Ιατρική. Του δόθηκε για τα αποτελέσµατά της έρευνάς του στο πανεπιστήµιο Columbia, η οποία ξεκίνησε

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ

ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ 15:Γ, 39:Γ, 14:Α, 21:Β, 15:Δ, 11:Δ, 28: I Σ, II Λ, III Σ, IV Σ, V Σ, 41:Β, 29:Α, Β, Γ, 29:Β, 30:Α, 19:Β, 20:Β, 15:Α, 37:Β, 28:Α, 11:Δ, 15:Β, 31:Δ, 32:Γ,

Διαβάστε περισσότερα

Πτυχιακή Εργασία Η ΠΟΙΟΤΗΤΑ ΖΩΗΣ ΤΩΝ ΑΣΘΕΝΩΝ ΜΕ ΣΤΗΘΑΓΧΗ

Πτυχιακή Εργασία Η ΠΟΙΟΤΗΤΑ ΖΩΗΣ ΤΩΝ ΑΣΘΕΝΩΝ ΜΕ ΣΤΗΘΑΓΧΗ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή Εργασία Η ΠΟΙΟΤΗΤΑ ΖΩΗΣ ΤΩΝ ΑΣΘΕΝΩΝ ΜΕ ΣΤΗΘΑΓΧΗ Νικόλας Χριστοδούλου Λευκωσία, 2012 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

Διαβάστε περισσότερα

Τ.Ε.Ι. ΔΥΤΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ ΠΑΡΑΡΤΗΜΑ ΚΑΣΤΟΡΙΑΣ ΤΜΗΜΑ ΔΗΜΟΣΙΩΝ ΣΧΕΣΕΩΝ & ΕΠΙΚΟΙΝΩΝΙΑΣ

Τ.Ε.Ι. ΔΥΤΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ ΠΑΡΑΡΤΗΜΑ ΚΑΣΤΟΡΙΑΣ ΤΜΗΜΑ ΔΗΜΟΣΙΩΝ ΣΧΕΣΕΩΝ & ΕΠΙΚΟΙΝΩΝΙΑΣ Τ.Ε.Ι. ΔΥΤΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ ΠΑΡΑΡΤΗΜΑ ΚΑΣΤΟΡΙΑΣ ΤΜΗΜΑ ΔΗΜΟΣΙΩΝ ΣΧΕΣΕΩΝ & ΕΠΙΚΟΙΝΩΝΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Η προβολή επιστημονικών θεμάτων από τα ελληνικά ΜΜΕ : Η κάλυψή τους στον ελληνικό ημερήσιο τύπο Σαραλιώτου

Διαβάστε περισσότερα

Επιβλέπουσα Καθηγήτρια: ΣΟΦΙΑ ΑΡΑΒΟΥ ΠΑΠΑΔΑΤΟΥ

Επιβλέπουσα Καθηγήτρια: ΣΟΦΙΑ ΑΡΑΒΟΥ ΠΑΠΑΔΑΤΟΥ EΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΕΚΠΑΙΔΕΥΤΙΚΟ ΤΕΧΝΟΛΟΓΙΚΟ ΙΔΡΥΜΑ ΤΕΙ ΙΟΝΙΩΝ ΝΗΣΩΝ ΤΜΗΜΑ ΔΗΜΟΣΙΩΝ ΣΧΕΣΕΩΝ & ΕΠΙΚΟΙΝΩΝΙΑΣ Ταχ. Δ/νση : Λεωφ. Αντ.Τρίτση, Αργοστόλι Κεφαλληνίας Τ.Κ. 28 100 τηλ. : 26710-27311 fax : 26710-27312

Διαβάστε περισσότερα

Homework 3 Solutions

Homework 3 Solutions Homework 3 Solutions Igor Yanovsky (Math 151A TA) Problem 1: Compute the absolute error and relative error in approximations of p by p. (Use calculator!) a) p π, p 22/7; b) p π, p 3.141. Solution: For

Διαβάστε περισσότερα

Παιδί βαρήκοο ή με διαταραχή στο φάσμα του αυτισμού;

Παιδί βαρήκοο ή με διαταραχή στο φάσμα του αυτισμού; ΕΡΕΥΝΗΤΙΚΗ ΕΡΓΑΣΙΑ / ORIGINAL ARTICLE Παιδί βαρήκοο ή με διαταραχή στο φάσμα του αυτισμού; Hard of hearing child or suffering from autism spectrum disorder? Χειμώνα Θ 1 Βλατάκη Μ 2 Πρώιμος Ε 1 Παπουτσάκη

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή διατριβή Η ΚΑΤΑΘΛΙΨΗ ΩΣ ΠΑΡΑΓΟΝΤΑΣ ΚΙΝΔΥΝΟΥ ΓΙΑ ΑΠΟΠΕΙΡΑ ΑΥΤΟΚΤΟΝΙΑΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή διατριβή Η ΚΑΤΑΘΛΙΨΗ ΩΣ ΠΑΡΑΓΟΝΤΑΣ ΚΙΝΔΥΝΟΥ ΓΙΑ ΑΠΟΠΕΙΡΑ ΑΥΤΟΚΤΟΝΙΑΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή διατριβή Η ΚΑΤΑΘΛΙΨΗ ΩΣ ΠΑΡΑΓΟΝΤΑΣ ΚΙΝΔΥΝΟΥ ΓΙΑ ΑΠΟΠΕΙΡΑ ΑΥΤΟΚΤΟΝΙΑΣ Παναγιώτου Νεοφύτα 2008969752 Επιβλέπων καθηγητής Δρ. Νίκος Μίτλεττον,

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΨΥΧΟΛΟΓΙΚΕΣ ΕΠΙΠΤΩΣΕΙΣ ΣΕ ΓΥΝΑΙΚΕΣ ΜΕΤΑ ΑΠΟ ΜΑΣΤΕΚΤΟΜΗ ΓΕΩΡΓΙΑ ΤΡΙΣΟΚΚΑ Λευκωσία 2012 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) DNA

Διαβάστε περισσότερα

Number All 397 Women 323 (81%) Men 74 (19%) Age(years) 39,1 (17-74) 38,9 (17-74) 40,5 (18-61) Maximum known weight(kg) 145,4 (92,0-292,0) 138,9 (92,0-202,0) 174,1 (126,0-292,0) Body mass index (kg/m 2

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ. Πτυχιακή εργασία

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ. Πτυχιακή εργασία ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ Πτυχιακή εργασία ΣΥΝΔΡΟΜΟ ΠΟΛΥΚΥΣΤΙΚΩΝ ΩΟΘΗΚΩΝ ΚΑΙ ΟΙ ΨΥΧΟΚΟΙΝΩΝΙΚΕΣ ΕΠΙΠΤΩΣΕΙΣ ΣΤΟ ΑΤΟΜΟ ΠΟΥ ΝΟΣΕΙ Ραφαέλλα Χαραλάμπους Λεμεσός 2014 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ

Διαβάστε περισσότερα

ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ. ΘΕΜΑ: «ιερεύνηση της σχέσης µεταξύ φωνηµικής επίγνωσης και ορθογραφικής δεξιότητας σε παιδιά προσχολικής ηλικίας»

ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ. ΘΕΜΑ: «ιερεύνηση της σχέσης µεταξύ φωνηµικής επίγνωσης και ορθογραφικής δεξιότητας σε παιδιά προσχολικής ηλικίας» ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΙΓΑΙΟΥ ΣΧΟΛΗ ΑΝΘΡΩΠΙΣΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΩΝ ΤΗΣ ΠΡΟΣΧΟΛΙΚΗΣ ΑΓΩΓΗΣ ΚΑΙ ΤΟΥ ΕΚΠΑΙ ΕΥΤΙΚΟΥ ΣΧΕ ΙΑΣΜΟΥ «ΠΑΙ ΙΚΟ ΒΙΒΛΙΟ ΚΑΙ ΠΑΙ ΑΓΩΓΙΚΟ ΥΛΙΚΟ» ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ που εκπονήθηκε για τη

Διαβάστε περισσότερα

Σύγκριση Πραγματολογικών Ικανοτήτων σε Παιδιά Σχολικής Ηλικίας με Διάχυτες Αναπτυξιακές Διαταραχές και Νοητική Υστέρηση

Σύγκριση Πραγματολογικών Ικανοτήτων σε Παιδιά Σχολικής Ηλικίας με Διάχυτες Αναπτυξιακές Διαταραχές και Νοητική Υστέρηση ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΚΑΛΑΜΑΤΑΣ ΣΧΟΛΗ ΕΠΑΓΓΕΛΜΑΤΩΝ ΥΓΕΙΑΣ ΚΑΙ ΠΡΟΝΟΙΑΣ ΤΜΗΜΑ ΛΟΓΟΘΕΡΑΠΕΙΑΣ Λ Λ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Σύγκριση Πραγματολογικών Ικανοτήτων σε Παιδιά Σχολικής Ηλικίας με Διάχυτες Αναπτυξιακές

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΗΡΑΚΛΕΙΟ ΚΡΗΤΗΣ ΣΧΟΛΗ ΔΙΟΙΚΗΣΗΣ ΚΑΙ ΟΙΚΟΝΟΜΙΑΣ ΤΜΗΜΑ ΛΟΓΙΣΤΙΚΗΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΗΡΑΚΛΕΙΟ ΚΡΗΤΗΣ ΣΧΟΛΗ ΔΙΟΙΚΗΣΗΣ ΚΑΙ ΟΙΚΟΝΟΜΙΑΣ ΤΜΗΜΑ ΛΟΓΙΣΤΙΚΗΣ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΗΡΑΚΛΕΙΟ ΚΡΗΤΗΣ ΣΧΟΛΗ ΔΙΟΙΚΗΣΗΣ ΚΑΙ ΟΙΚΟΝΟΜΙΑΣ ΤΜΗΜΑ ΛΟΓΙΣΤΙΚΗΣ Π Τ Υ Χ Ι Α Κ Η Ε Ρ Γ Α Σ Ι Α: Ο ΡΟΛΟΣ ΤΗΣ ΣΥΝΑΙΣΘΗΜΑΤΙΚΗΣ ΝΟΗΜΟΣΥΝΗΣ ΣΤΗΝ ΑΠΟΤΕΛΕΣΜΑΤΙΚΗ ΗΓΕΣΙΑ ΕΠΙΜΕΛΕΙΑ

Διαβάστε περισσότερα

ΔΙΕΡΕΥΝΗΣΗ ΤΗΣ ΣΕΞΟΥΑΛΙΚΗΣ ΔΡΑΣΤΗΡΙΟΤΗΤΑΣ ΤΩΝ ΓΥΝΑΙΚΩΝ ΚΑΤΑ ΤΗ ΔΙΑΡΚΕΙΑ ΤΗΣ ΕΓΚΥΜΟΣΥΝΗΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

ΔΙΕΡΕΥΝΗΣΗ ΤΗΣ ΣΕΞΟΥΑΛΙΚΗΣ ΔΡΑΣΤΗΡΙΟΤΗΤΑΣ ΤΩΝ ΓΥΝΑΙΚΩΝ ΚΑΤΑ ΤΗ ΔΙΑΡΚΕΙΑ ΤΗΣ ΕΓΚΥΜΟΣΥΝΗΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή Εργασία ΔΙΕΡΕΥΝΗΣΗ ΤΗΣ ΣΕΞΟΥΑΛΙΚΗΣ ΔΡΑΣΤΗΡΙΟΤΗΤΑΣ ΤΩΝ ΓΥΝΑΙΚΩΝ ΚΑΤΑ ΤΗ ΔΙΑΡΚΕΙΑ ΤΗΣ ΕΓΚΥΜΟΣΥΝΗΣ ΑΝΔΡΕΟΥ ΣΤΕΦΑΝΙΑ Λεμεσός 2012 i ii ΤΕΧΝΟΛΟΓΙΚΟ

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα

Advanced Subsidiary Unit 1: Understanding and Written Response

Advanced Subsidiary Unit 1: Understanding and Written Response Write your name here Surname Other names Edexcel GE entre Number andidate Number Greek dvanced Subsidiary Unit 1: Understanding and Written Response Thursday 16 May 2013 Morning Time: 2 hours 45 minutes

Διαβάστε περισσότερα

ΠΑΝΔΠΗΣΖΜΗΟ ΠΑΣΡΩΝ ΣΜΖΜΑ ΖΛΔΚΣΡΟΛΟΓΩΝ ΜΖΥΑΝΗΚΩΝ ΚΑΗ ΣΔΥΝΟΛΟΓΗΑ ΤΠΟΛΟΓΗΣΩΝ ΣΟΜΔΑ ΤΣΖΜΑΣΩΝ ΖΛΔΚΣΡΗΚΖ ΔΝΔΡΓΔΗΑ

ΠΑΝΔΠΗΣΖΜΗΟ ΠΑΣΡΩΝ ΣΜΖΜΑ ΖΛΔΚΣΡΟΛΟΓΩΝ ΜΖΥΑΝΗΚΩΝ ΚΑΗ ΣΔΥΝΟΛΟΓΗΑ ΤΠΟΛΟΓΗΣΩΝ ΣΟΜΔΑ ΤΣΖΜΑΣΩΝ ΖΛΔΚΣΡΗΚΖ ΔΝΔΡΓΔΗΑ ΠΑΝΔΠΗΣΖΜΗΟ ΠΑΣΡΩΝ ΣΜΖΜΑ ΖΛΔΚΣΡΟΛΟΓΩΝ ΜΖΥΑΝΗΚΩΝ ΚΑΗ ΣΔΥΝΟΛΟΓΗΑ ΤΠΟΛΟΓΗΣΩΝ ΣΟΜΔΑ ΤΣΖΜΑΣΩΝ ΖΛΔΚΣΡΗΚΖ ΔΝΔΡΓΔΗΑ Γηπισκαηηθή Δξγαζία ηνπ Φνηηεηή ηνπ ηκήκαηνο Ζιεθηξνιόγσλ Μεραληθώλ θαη Σερλνινγίαο Ζιεθηξνληθώλ

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία των νουκλεοτιδίων που συμβαίνουν στο γενετικό υλικό ενός οργανισμού τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις)

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή Εργασία Η ΑΝΤΙΛΑΜΒΑΝΟΜΕΝΗ ΚΟΙΝΩΝΙΚΗ ΣΤΗΡΙΞΗ ΑΝΑΜΕΣΑ ΣΤΟΥΣ ΓΟΝΕΙΣ ΠΟΥ ΕΧΟΥΝ ΠΑΙΔΙ ΜΕ ΑΥΤΙΣΤΙΚΗ ΔΙΑΤΑΡΑΧΗ Γαβριέλα Νικολάου Λεμεσός 2014 ΤΕΧΝΟΛΟΓΙΚΟ

Διαβάστε περισσότερα

ΠΑΡΑΜΕΤΡΟΙ ΕΠΗΡΕΑΣΜΟΥ ΤΗΣ ΑΝΑΓΝΩΣΗΣ- ΑΠΟΚΩΔΙΚΟΠΟΙΗΣΗΣ ΤΗΣ BRAILLE ΑΠΟ ΑΤΟΜΑ ΜΕ ΤΥΦΛΩΣΗ

ΠΑΡΑΜΕΤΡΟΙ ΕΠΗΡΕΑΣΜΟΥ ΤΗΣ ΑΝΑΓΝΩΣΗΣ- ΑΠΟΚΩΔΙΚΟΠΟΙΗΣΗΣ ΤΗΣ BRAILLE ΑΠΟ ΑΤΟΜΑ ΜΕ ΤΥΦΛΩΣΗ ΠΑΝΕΠΙΣΤΗΜΙΟ ΜΑΚΕΔΟΝΙΑΣ ΟΙΚΟΝΟΜΙΚΩΝ ΚΑΙ ΚΟΙΝΩΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΚΑΙ ΚΟΙΝΩΝΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΠΑΡΑΜΕΤΡΟΙ ΕΠΗΡΕΑΣΜΟΥ ΤΗΣ ΑΝΑΓΝΩΣΗΣ- ΑΠΟΚΩΔΙΚΟΠΟΙΗΣΗΣ ΤΗΣ BRAILLE

Διαβάστε περισσότερα

ΠΕΡΙΛΗΨΗ. Εισαγωγή. Σκοπός

ΠΕΡΙΛΗΨΗ. Εισαγωγή. Σκοπός ΠΕΡΙΛΗΨΗ Εισαγωγή Η παιδική παχυσαρκία έχει φτάσει σε επίπεδα επιδημίας στις μέρες μας. Μαστίζει παιδιά από μικρές ηλικίες μέχρι και σε εφήβους. Συντείνουν αρκετοί παράγοντες που ένα παιδί γίνεται παχύσαρκο

Διαβάστε περισσότερα

ΑΝΩΤΑΤΟ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΗΠΕΙΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΚΑΙ ΠΡΟΝΟΙΑΣ ΤΕΙ ΗΠΕΙΡΟΥ ΤΜΗΜΑ ΛΟΓΟΘΕΡΑΠΕΙΑΣ

ΑΝΩΤΑΤΟ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΗΠΕΙΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΚΑΙ ΠΡΟΝΟΙΑΣ ΤΕΙ ΗΠΕΙΡΟΥ ΤΜΗΜΑ ΛΟΓΟΘΕΡΑΠΕΙΑΣ ΑΝΩΤΑΤΟ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΗΠΕΙΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΚΑΙ ΠΡΟΝΟΙΑΣ ΤΕΙ ΗΠΕΙΡΟΥ ΤΜΗΜΑ ΛΟΓΟΘΕΡΑΠΕΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΜΕ ΤΙΤΛΟ: Αυτισμός: Μουσικοθεραπεία και εναλλακτικές θεραπευτικές προσεγγίσεις

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α)

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα

Η ΕΡΕΥΝΑ ΤΗΣ ΓΛΩΣΣΙΚΗΣ ΑΛΛΑΓΗΣ ΣΤΑ ΚΕΙΜΕΝΑ ΤΗΣ ΜΕΣΑΙΩΝΙΚΗΣ ΕΛΛΗΝΙΚΗΣ: ΜΕΘΟΔΟΛΟΓΙΚΗ ΔΙΕΡΕΥΝΗΣΗ ΤΩΝ

Η ΕΡΕΥΝΑ ΤΗΣ ΓΛΩΣΣΙΚΗΣ ΑΛΛΑΓΗΣ ΣΤΑ ΚΕΙΜΕΝΑ ΤΗΣ ΜΕΣΑΙΩΝΙΚΗΣ ΕΛΛΗΝΙΚΗΣ: ΜΕΘΟΔΟΛΟΓΙΚΗ ΔΙΕΡΕΥΝΗΣΗ ΤΩΝ Η ΕΡΕΥΝΑ ΤΗΣ ΓΛΩΣΣΙΚΗΣ ΑΛΛΑΓΗΣ ΣΤΑ ΚΕΙΜΕΝΑ ΤΗΣ ΜΕΣΑΙΩΝΙΚΗΣ ΕΛΛΗΝΙΚΗΣ: ΜΕΘΟΔΟΛΟΓΙΚΗ ΔΙΕΡΕΥΝΗΣΗ ΤΩΝ ΠΗΓΩΝ Θεόδωρος Μαρκόπουλος University of Uppsala thodorismark@yahoo.gr Abstract This paper discusses methodological

Διαβάστε περισσότερα

Ενότητα 10: Κυτταρική Διαίρεση

Ενότητα 10: Κυτταρική Διαίρεση Ενότητα 10: Κυτταρική Διαίρεση Κυτταρική διαίρεση: παραγωγή γενετικά πανομοιότυπων θυγατρικών κυττάρων Κυτταρική διαίρεση Μονοκύτταροι οργανισμοί: η διαίρεση του κυττάρου συνεπάγεται αναπαραγωγή ολόκληρου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στην λέξη ή τη φράση, η

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΤΜΗΜΑ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ ΣΥΣΤΗΜΑΤΩΝ ΗΛΕΚΤΡΙΚΗΣ ΕΝΕΡΓΕΙΑΣ

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΤΜΗΜΑ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ ΣΥΣΤΗΜΑΤΩΝ ΗΛΕΚΤΡΙΚΗΣ ΕΝΕΡΓΕΙΑΣ ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΤΜΗΜΑ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ ΣΥΣΤΗΜΑΤΩΝ ΗΛΕΚΤΡΙΚΗΣ ΕΝΕΡΓΕΙΑΣ ιπλωµατική Εργασία του φοιτητή του τµήµατος Ηλεκτρολόγων Μηχανικών και Τεχνολογίας Ηλεκτρονικών

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

HISTOGRAMS AND PERCENTILES What is the 25 th percentile of a histogram? What is the 50 th percentile for the cigarette histogram?

HISTOGRAMS AND PERCENTILES What is the 25 th percentile of a histogram? What is the 50 th percentile for the cigarette histogram? HISTOGRAMS AND PERCENTILES What is the 25 th percentile of a histogram? The point on the horizontal axis such that of the area under the histogram lies to the left of that point (and to the right) What

Διαβάστε περισσότερα

ΔΘΝΗΚΖ ΥΟΛΖ ΓΖΜΟΗΑ ΓΗΟΗΚΖΖ

ΔΘΝΗΚΖ ΥΟΛΖ ΓΖΜΟΗΑ ΓΗΟΗΚΖΖ Ε ΔΘΝΗΚΖ ΥΟΛΖ ΓΖΜΟΗΑ ΓΗΟΗΚΖΖ Κ ΔΚΠΑΗΓΔΤΣΗΚΖ ΔΗΡΑ ΣΜΖΜΑ : Σνπξηζηηθήο Οηθνλνκίαο θαη Αλάπηπμεο (ΣΟΑ) ΣΔΛΗΚΖ ΔΡΓΑΗΑ Θέκα: Σνπξηζκφο θαη Οηθνλνκηθή Κξίζε Δπηβιέπσλ : Νηνχβαο Λνπθάο πνπδάζηξηα : Σζαγθαξάθε

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

AKAΔΗΜΙΑ ΕΜΠΟΡΙΚΟΥ ΝΑΥΤΙΚΟΥ ΜΑΚΕΔΟΝΙΑΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΘΕΜΑ: Η ΧΡΗΣΗ ΒΙΟΚΑΥΣΙΜΩΝ ΣΤΗΝ ΝΑΥΤΙΛΙΑ ΠΛΕΟΝΕΚΤΗΜΑΤΑ-ΜΕΙΟΝΕΚΤΗΜΑΤΑ ΠΡΟΟΠΤΙΚΕΣ

AKAΔΗΜΙΑ ΕΜΠΟΡΙΚΟΥ ΝΑΥΤΙΚΟΥ ΜΑΚΕΔΟΝΙΑΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΘΕΜΑ: Η ΧΡΗΣΗ ΒΙΟΚΑΥΣΙΜΩΝ ΣΤΗΝ ΝΑΥΤΙΛΙΑ ΠΛΕΟΝΕΚΤΗΜΑΤΑ-ΜΕΙΟΝΕΚΤΗΜΑΤΑ ΠΡΟΟΠΤΙΚΕΣ AKAΔΗΜΙΑ ΕΜΠΟΡΙΚΟΥ ΝΑΥΤΙΚΟΥ ΜΑΚΕΔΟΝΙΑΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΘΕΜΑ: Η ΧΡΗΣΗ ΒΙΟΚΑΥΣΙΜΩΝ ΣΤΗΝ ΝΑΥΤΙΛΙΑ ΠΛΕΟΝΕΚΤΗΜΑΤΑ-ΜΕΙΟΝΕΚΤΗΜΑΤΑ ΠΡΟΟΠΤΙΚΕΣ ΣΠΟΥΔΑΣΤΕΣ : ΜΟΤΣΚΑΛΙΔΗΣ ΒΑΛΕΡΙΟΣ, ΠΕΛΕΚΑΝΟΣ ΙΩΑΝΝΗΣ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή εργασία Η ΚΑΤΑΘΛΙΨΗ ΣΕ ΕΦΗΒΟΥΣ ΜΕ ΣΑΚΧΑΡΩΔΗ ΔΙΑΒΗΤΗ ΤΥΠΟΥ 1

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή εργασία Η ΚΑΤΑΘΛΙΨΗ ΣΕ ΕΦΗΒΟΥΣ ΜΕ ΣΑΚΧΑΡΩΔΗ ΔΙΑΒΗΤΗ ΤΥΠΟΥ 1 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή εργασία Η ΚΑΤΑΘΛΙΨΗ ΣΕ ΕΦΗΒΟΥΣ ΜΕ ΣΑΚΧΑΡΩΔΗ ΔΙΑΒΗΤΗ ΤΥΠΟΥ 1 ΑΝΔΡΕΑΣ ΑΝΔΡΕΟΥ Φ.Τ:2008670839 Λεμεσός 2014 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ

Διαβάστε περισσότερα

Αναερόβια Φυσική Κατάσταση

Αναερόβια Φυσική Κατάσταση Αναερόβια Φυσική Κατάσταση Γιάννης Κουτεντάκης, BSc, MA. PhD Αναπληρωτής Καθηγητής ΤΕΦΑΑ, Πανεπιστήµιο Θεσσαλίας Περιεχόµενο Μαθήµατος Ορισµός της αναερόβιας φυσικής κατάστασης Σχέσης µε µηχανισµούς παραγωγής

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

«ΑΓΡΟΤΟΥΡΙΣΜΟΣ ΚΑΙ ΤΟΠΙΚΗ ΑΝΑΠΤΥΞΗ: Ο ΡΟΛΟΣ ΤΩΝ ΝΕΩΝ ΤΕΧΝΟΛΟΓΙΩΝ ΣΤΗΝ ΠΡΟΩΘΗΣΗ ΤΩΝ ΓΥΝΑΙΚΕΙΩΝ ΣΥΝΕΤΑΙΡΙΣΜΩΝ»

«ΑΓΡΟΤΟΥΡΙΣΜΟΣ ΚΑΙ ΤΟΠΙΚΗ ΑΝΑΠΤΥΞΗ: Ο ΡΟΛΟΣ ΤΩΝ ΝΕΩΝ ΤΕΧΝΟΛΟΓΙΩΝ ΣΤΗΝ ΠΡΟΩΘΗΣΗ ΤΩΝ ΓΥΝΑΙΚΕΙΩΝ ΣΥΝΕΤΑΙΡΙΣΜΩΝ» I ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΝΟΜΙΚΩΝ ΟΙΚΟΝΟΜΙΚΩΝ ΚΑΙ ΠΟΛΙΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΟΙΚΟΝΟΜΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΗΝ «ΔΙΟΙΚΗΣΗ ΚΑΙ ΟΙΚΟΝΟΜΙΑ» ΚΑΤΕΥΘΥΝΣΗ: ΟΙΚΟΝΟΜΙΚΗ

Διαβάστε περισσότερα

Πώς αλλάζει η σεξουαλική ζωή και η αυτοεικόνα της γυναίκας μετά από μαστεκτομή. ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

Πώς αλλάζει η σεξουαλική ζωή και η αυτοεικόνα της γυναίκας μετά από μαστεκτομή. ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Πώς αλλάζει η σεξουαλική ζωή και η αυτοεικόνα της γυναίκας μετά από μαστεκτομή. Μαριλένα Παναγή Λεμεσός 2014 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ

Διαβάστε περισσότερα

Inverse trigonometric functions & General Solution of Trigonometric Equations. ------------------ ----------------------------- -----------------

Inverse trigonometric functions & General Solution of Trigonometric Equations. ------------------ ----------------------------- ----------------- Inverse trigonometric functions & General Solution of Trigonometric Equations. 1. Sin ( ) = a) b) c) d) Ans b. Solution : Method 1. Ans a: 17 > 1 a) is rejected. w.k.t Sin ( sin ) = d is rejected. If sin

Διαβάστε περισσότερα

Π Δ Ρ Η Δ Υ Ο Μ Δ Ν Α

Π Δ Ρ Η Δ Υ Ο Μ Δ Ν Α ΠΡΟΓΡΑΜΜΑ ΜΔΣΑΠΣΤΥΗΑΚΧΝ ΠΟΤΓΧΝ ΣΜΖΜΑΣΟ ΔΚΠΑΗΓΔΤΣΗΚΖ ΚΑΗ ΚΟΗΝΧΝΗΚΖ ΠΟΛΗΣΗΚΖ ΚΑΣΔΤΘΤΝΖ ΔΗΓΗΚΖ ΑΓΧΓΖ Γηπισκαηηθή Δξγαζία: «Οη αηζζεηεξηαθέο δηαηαξαρέο καζεηώλ κε Γηαηαξαρέο Απηηζηηθνύ Φάζκαηνο (ΓΑΦ)» Μεηαπηπρηαθή

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα

Η ΨΥΧΙΑΤΡΙΚΗ - ΨΥΧΟΛΟΓΙΚΗ ΠΡΑΓΜΑΤΟΓΝΩΜΟΣΥΝΗ ΣΤΗΝ ΠΟΙΝΙΚΗ ΔΙΚΗ

Η ΨΥΧΙΑΤΡΙΚΗ - ΨΥΧΟΛΟΓΙΚΗ ΠΡΑΓΜΑΤΟΓΝΩΜΟΣΥΝΗ ΣΤΗΝ ΠΟΙΝΙΚΗ ΔΙΚΗ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΝΟΜΙΚΗ ΣΧΟΛΗ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΤΟΜΕΑΣ ΙΣΤΟΡΙΑΣ ΦΙΛΟΣΟΦΙΑΣ ΚΑΙ ΚΟΙΝΩΝΙΟΛΟΓΙΑΣ ΤΟΥ ΔΙΚΑΙΟΥ Διπλωματική εργασία στο μάθημα «ΚΟΙΝΩΝΙΟΛΟΓΙΑ ΤΟΥ ΔΙΚΑΙΟΥ»

Διαβάστε περισσότερα

Φορτίο Νοσηρότητας Κεφάλαιο 16

Φορτίο Νοσηρότητας Κεφάλαιο 16 Φορτίο Νοσηρότητας Κεφάλαιο 16 Γεωργία Σαλαντή Επικ. Καθηγήτρια Εργαστήριο Υγιεινής και Επιδημιολογίας Ευχαριστίες στον Κώστα Τσιλίδη & Ορέστη Ευθυμίου για κάποιες από τις διαφάνειες Εισαγωγή Ø Η υγεία

Διαβάστε περισσότερα

Final Test Grammar. Term C'

Final Test Grammar. Term C' Final Test Grammar Term C' Book: Starting Steps 1 & Extra and Friends Vocabulary and Grammar Practice Class: Junior AB Name: /43 Date: E xercise 1 L ook at the example and do the same. ( Κξίηα ηξ παοάδειγμα

Διαβάστε περισσότερα

Η θέση ύπνου του βρέφους και η σχέση της με το Σύνδρομο του αιφνίδιου βρεφικού θανάτου. ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

Η θέση ύπνου του βρέφους και η σχέση της με το Σύνδρομο του αιφνίδιου βρεφικού θανάτου. ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Η θέση ύπνου του βρέφους και η σχέση της με το Σύνδρομο του αιφνίδιου βρεφικού θανάτου. Χρυσάνθη Στυλιανού Λεμεσός 2014 ΤΕΧΝΟΛΟΓΙΚΟ

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 ΘΕΜΑ Α Α1.β Α2.γ Α3.α Α4.δ Α5.γ ΘΕΜΑ Β Β1. 1A, 2B, 3B, 4A, 5A, 6A, 7B, 8B Β2. σελίδα 40 σχολικού

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. 1. Στην πλειονότητά

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΚΑΠΝΙΣΤΙΚΕΣ ΣΥΝΗΘΕΙΕΣ ΓΟΝΕΩΝ ΚΑΙ ΕΠΙΡΡΟΗ ΤΟΥΣ ΣΤΗΝ ΕΝΑΡΞΗ ΤΟΥ ΚΑΠΝΙΣΜΑΤΟΣ ΣΤΟΥΣ ΕΦΗΒΟΥΣ Ονοματεπώνυμο Φοιτήτριας: Χριστοφόρου Έλενα

Διαβάστε περισσότερα

ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΒΑΛΕΝΤΙΝΑ ΠΑΠΑΔΟΠΟΥΛΟΥ Α.Μ.: 09/061. Υπεύθυνος Καθηγητής: Σάββας Μακρίδης

ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΒΑΛΕΝΤΙΝΑ ΠΑΠΑΔΟΠΟΥΛΟΥ Α.Μ.: 09/061. Υπεύθυνος Καθηγητής: Σάββας Μακρίδης Α.Τ.Ε.Ι. ΙΟΝΙΩΝ ΝΗΣΩΝ ΠΑΡΑΡΤΗΜΑ ΑΡΓΟΣΤΟΛΙΟΥ ΤΜΗΜΑ ΔΗΜΟΣΙΩΝ ΣΧΕΣΕΩΝ ΚΑΙ ΕΠΙΚΟΙΝΩΝΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ «Η διαμόρφωση επικοινωνιακής στρατηγικής (και των τακτικών ενεργειών) για την ενδυνάμωση της εταιρικής

Διαβάστε περισσότερα

Η πρώιμη παρέμβαση σε παιδιά με διαταραχές όρασης και πρόσθετες αναπηρίες στην Ελλάδα

Η πρώιμη παρέμβαση σε παιδιά με διαταραχές όρασης και πρόσθετες αναπηρίες στην Ελλάδα Παιδιατρική ΒΟΡΕΙΟΥ ΕΛΛΑΔΟΣ, 23, 3 71 Η πρώιμη παρέμβαση σε παιδιά με διαταραχές όρασης και πρόσθετες αναπηρίες στην Ελλάδα Κ. Νεοφωτίστου, Ε. Φωτιάδου Εργαστήριο Αναπτυξιακής Ιατρικής και Ειδικής Αγωγής,

Διαβάστε περισσότερα

ΚΑΘΟΡΙΣΜΟΣ ΠΑΡΑΓΟΝΤΩΝ ΠΟΥ ΕΠΗΡΕΑΖΟΥΝ ΤΗΝ ΠΑΡΑΓΟΜΕΝΗ ΙΣΧΥ ΣΕ Φ/Β ΠΑΡΚΟ 80KWp

ΚΑΘΟΡΙΣΜΟΣ ΠΑΡΑΓΟΝΤΩΝ ΠΟΥ ΕΠΗΡΕΑΖΟΥΝ ΤΗΝ ΠΑΡΑΓΟΜΕΝΗ ΙΣΧΥ ΣΕ Φ/Β ΠΑΡΚΟ 80KWp ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΣΧΟΛΗ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΜΗΧΑΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ ΣΥΣΤΗΜΑΤΩΝ ΜΕΤΑΔΟΣΗΣ ΠΛΗΡΟΦΟΡΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΥΛΙΚΩΝ ΚΑΘΟΡΙΣΜΟΣ ΠΑΡΑΓΟΝΤΩΝ ΠΟΥ ΕΠΗΡΕΑΖΟΥΝ ΤΗΝ ΠΑΡΑΓΟΜΕΝΗ ΙΣΧΥ

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή Εργασία

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή Εργασία ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή Εργασία ΙΕΡΕΥΝΗΣΗ ΤΩΝ ΕΠΙΠΕ ΩΝ ΘΝΗΣΙΜΟΤΗΤΑΣ ΚΑΙ ΤΩΝ ΚΥΡΙΟΤΕΡΩΝ ΑΙΤΙΩΝ ΠΡΟΚΛΗΣΗΣ ΘΑΝΑΤΟΥ ΑΤΟΜΩΝ ΜΕ ΨΥΧΟΓΕΝΗ ΑΝΟΡΕΞΙΑ Γεωργία Χαραλάµπους Λεµεσός

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΚΡΗΤΗΣ ΣΧΟΛΗ ΔΙΟΙΚΗΣΗΣ ΚΑΙ ΟΙΚΟΝΟΜΙΑΣ ΤΜΗΜΑ ΛΟΓΙΣΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ

ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΚΡΗΤΗΣ ΣΧΟΛΗ ΔΙΟΙΚΗΣΗΣ ΚΑΙ ΟΙΚΟΝΟΜΙΑΣ ΤΜΗΜΑ ΛΟΓΙΣΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΚΡΗΤΗΣ ΣΧΟΛΗ ΔΙΟΙΚΗΣΗΣ ΚΑΙ ΟΙΚΟΝΟΜΙΑΣ ΤΜΗΜΑ ΛΟΓΙΣΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΛΟΓΙΣΤΙΚΗ ΚΑΙ ΦΟΡΟΛΟΓΙΑ Ο.Ε. ΕΙΣΗΓΗΤΡΙΑ ΚΑΘΗΓΗΤΡΙΑ: κ. ΟΥΡΑΝΟΥ ΕΡΜΙΟΝΗ ΣΠΟΥΔΑΣΤΡΙΕΣ: ΔΕΜΕΤΖΟΥ ΑΓΛΑΪΑ

Διαβάστε περισσότερα

ΣΚΟΛΙΩΣΗ ΚΑΙ ΣΥΓΓΕΝΕΙΣ ΚΑΡΔΙΟΠΑΘΕΙΕΣ

ΣΚΟΛΙΩΣΗ ΚΑΙ ΣΥΓΓΕΝΕΙΣ ΚΑΡΔΙΟΠΑΘΕΙΕΣ ΣΚΟΛΙΩΣΗ ΚΑΙ ΣΥΓΓΕΝΕΙΣ ΚΑΡΔΙΟΠΑΘΕΙΕΣ 18 ΦΕΒΡΟΥΑΡΙΟΥ 2010 ΘΕΣΣΑΛΟΝΙΚΗ ΜΑΡΙΑ Θ. ΠΑΠΑΦΥΛΑΚΤΟΥ ΩΝΑΣΕΙΟ ΚΑΡΔΙΟΧΕΙΡΟΥΡΓΙΚΟ ΚΕΝΤΡΟ ΕΙΣΑΓΩΓΗ Σκελετικές ανωμαλίες παρατηρούνται συχνά σε ασθενείς με συγγενή καρδιοπάθεια

Διαβάστε περισσότερα

Τα ηδαληθά θαη νη ζηόρνη δωήο ηωλ εξώωλ θαη ηωλ εξωίδωλ ζηα ζεαηξηθά έξγα γηα παηδηά. Μαξία Κιαδάθε. Παλεπηζηήκην Αηγαίνπ mkladaki@rhodes.aegean.

Τα ηδαληθά θαη νη ζηόρνη δωήο ηωλ εξώωλ θαη ηωλ εξωίδωλ ζηα ζεαηξηθά έξγα γηα παηδηά. Μαξία Κιαδάθε. Παλεπηζηήκην Αηγαίνπ mkladaki@rhodes.aegean. Τα ηδαληθά θαη νη ζηόρνη δωήο ηωλ εξώωλ θαη ηωλ εξωίδωλ ζηα ζεαηξηθά έξγα γηα παηδηά Μαξία Κιαδάθε Παλεπηζηήκην Αηγαίνπ mkladaki@rhodes.aegean.gr Abstract This paper examines the ideals and life goals

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΩΝ ΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΚΑΙ ΤΗΣ ΑΓΩΓΗΣ ΣΤΗΝ ΠΡΟΣΧΟΛΙΚΗ ΗΛΙΚΙΑ ΜΕΤΑΠΤΥΧΙΑΚΟΣ ΚΥΚΛΟΣ ΣΠΟΥΔΩΝ 2011-2013

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΩΝ ΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΚΑΙ ΤΗΣ ΑΓΩΓΗΣ ΣΤΗΝ ΠΡΟΣΧΟΛΙΚΗ ΗΛΙΚΙΑ ΜΕΤΑΠΤΥΧΙΑΚΟΣ ΚΥΚΛΟΣ ΣΠΟΥΔΩΝ 2011-2013 ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΩΝ ΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΚΑΙ ΤΗΣ ΑΓΩΓΗΣ ΣΤΗΝ ΠΡΟΣΧΟΛΙΚΗ ΗΛΙΚΙΑ ΜΕΤΑΠΤΥΧΙΑΚΟΣ ΚΥΚΛΟΣ ΣΠΟΥΔΩΝ 2011-2013 ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ «Αποτίμηση αφηγηματικών ικανοτήτων παιδιών

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΑΞΙΟΛΟΓΗΣΗ ΣΤΑΣΕΩΝ ΚΑΙ ΕΠΙΠΕΔΟΥ ΓΝΩΣΕΩΝ ΤΩΝ ΝΟΣΗΛΕΥΤΩΝ ΣΕ ΜΟΝΑΔΕΣ ΕΝΤΑΤΙΚΗΣ ΘΕΡΑΠΕΙΑΣ ΣΧΕΤΙΚΑ ΜΕ ΤΗ ΜΕΤΑΜΟΣΧΕΥΣΗ ΟΡΓΑΝΩΝ ΑΠΟ ΕΓΚΕΦΑΛΙΚΑ

Διαβάστε περισσότερα

Σχέση στεφανιαίας νόσου και άγχους - κατάθλιψης

Σχέση στεφανιαίας νόσου και άγχους - κατάθλιψης Τρίμηνη, ηλεκτρονική έκδοση του Τμήματος Νοσηλευτικής Α, Τεχνολογικό Εκπαιδευτικό Ίδρυμα Αθήνας _ΑΝΑΣΚΟΠΗΣΗ_ Πολυκανδριώτη Μαρία 1, Φούκα Γεωργία 2 1. Καθηγήτρια Εφαρμογών Νοσηλευτικής Α, ΤΕΙ Αθήνας 2.

Διαβάστε περισσότερα

cell-free DNA στο μητρικό αίμα

cell-free DNA στο μητρικό αίμα cell-free DNA στο μητρικό αίμα Εφαρμογή στην κλινική πράξη στην Ελλάδα Παπαϊωάννου Γεώργιος-Κων/νος, PhD Υπεύθυνος Ιατρικής Εμβρύου Maιευτική & Γυναικολογική Κλινική ΓΑΙΑ Cell free DNA / Εισαγωγή στην

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ. Πτυχιακή Διατριβή

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ. Πτυχιακή Διατριβή ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ Πτυχιακή Διατριβή Η ΣΥΝΗΘΕΙΑ ΤΟΥ ΑΛΚΟΟΛ ΚΑΤΑ ΤΗΝ ΠΕΡΙΟΔΟ ΤΗΣ ΕΓΚΥΜΟΣΥΝΗΣ, ΚΑΙ Η ΕΠΙΔΡΑΣΕΙΣ ΤΟΥ ΣΤΟ ΕΜΒΡΥΟ ΣΤΕΦΑΝΗ ΘΡΑΣΥΒΟΥΛΟΥ Λεμεσός 2014 ΤΕΧΝΟΛΟΓΙΚΟ

Διαβάστε περισσότερα

LESSON 16 (ΜΑΘΗΜΑ ΔΕΚΑΕΞΙ) REF : 102/018/16-BEG. 4 March 2014

LESSON 16 (ΜΑΘΗΜΑ ΔΕΚΑΕΞΙ) REF : 102/018/16-BEG. 4 March 2014 LESSON 16 (ΜΑΘΗΜΑ ΔΕΚΑΕΞΙ) REF : 102/018/16-BEG 4 March 2014 Family η οικογένεια a/one(fem.) μία a/one(masc.) ένας father ο πατέρας mother η μητέρα man/male/husband ο άντρας letter το γράμμα brother ο

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

Καρκίνος του Μαστού: Οι παράγοντες που επηρεάζουν τη ψυχοσωματική υγεία των γυναικών που υποβλήθηκαν σε μαστεκτομή και ο ρόλος του νοσηλευτή.

Καρκίνος του Μαστού: Οι παράγοντες που επηρεάζουν τη ψυχοσωματική υγεία των γυναικών που υποβλήθηκαν σε μαστεκτομή και ο ρόλος του νοσηλευτή. ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ Πτυχιακή Εργασία Καρκίνος του Μαστού: Οι παράγοντες που επηρεάζουν τη ψυχοσωματική υγεία των γυναικών που υποβλήθηκαν σε μαστεκτομή

Διαβάστε περισσότερα

Στοιχειώδεις παθολογικές μεταβολές του Γεννητικού Συστήματος

Στοιχειώδεις παθολογικές μεταβολές του Γεννητικού Συστήματος Στοιχειώδεις παθολογικές μεταβολές του Γεννητικού Συστήματος του Θήλεος ΠΑΡΟΥΣΙΑΣΕΙΣ ΜΑΘΗΜΑΤΩΝ ΟΙΚΟΝΟΜΟΠΟΥΛΟΣ ΙΩΑΝΝΗΣ Προσοχή: Οι παρουσιάσεις μαθημάτων αποτελούν βοήθημα παρακολούθησης των παραδόσεων

Διαβάστε περισσότερα