Νικολακοπούλου Κωνσταντίνα Κάτσα Ελένη-Μαρία Δάσκου Μαρία. β-θαλασσαιμία

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Νικολακοπούλου Κωνσταντίνα Κάτσα Ελένη-Μαρία Δάσκου Μαρία. β-θαλασσαιμία"

Transcript

1 Νικολακοπούλου Κωνσταντίνα Κάτσα Ελένη-Μαρία Δάσκου Μαρία β-θαλασσαιμία

2 Θάλασσα + αίμα = θαλασσαιμία Εισαγωγή Η πιο κοινή γενετική νόσος που κληρονομείται Mενδελικά ~ 1 : παγκοσμίως ~ 1 : στην Eυρώπη ( Renzo Galanello and Raffaella Origa, Beta-Thalassemia, 2011 ) Αυτοσωμικός υπολειπόμενος τρόπος κληρονόμησης

3 Μοριακή βάση β-θαλασσαιμίας H σύνθεση της β-σφαιρίνης ελέγχεται από δύο β-γονίδια (ένα σε κάθε αντίγραφο του χρωμοσώματος 11) Πλήρης απουσία της β αλυσίδας (β 0 ) Μειωμένη σύνθεση της β-αλυσίδας (β + ) Τύποι Μετάλλαξη Γονότυπος Φαινότυπος Ελάσσων β-θαλασσαιμία Ενδιάμεση β-θαλασσαιμία Μετάλλαξη σε ένα γονίδιο Ετεροζυγώτες (β/β Τ ) Ενδιάμεση κατάσταση μεταξύ ετεροζυγωτίας και των μεταγγισοεξαρτώμενων ασθενών Ήπια αναιμία Μεγάλη ετερογένεια φαινοτύπου Μείζων β- θαλασσαιμία Μεταλλάξεις και στα δύο β-γονίδια Ομοζυγώτες (β Τ /β Τ ) ή σύνθετοι ετεροζυγώτες Σοβαρή αναιμία (μεταγγισοεξαρτώμενη)

4 Παθοφυσιολογία της β-θαλασσαιμίας 1. Μειωμένη ή καθόλου παραγωγή των β-αλυσίδων 2. Αδυναμία αλληλεπίδρασης με τις α-αλυσίδες για την σύνθεση της ενήλικης αιμοσφαιρίνης HbA( α 2 β 2 ) 3. Περίσσεια των α-αλυσίδων 4. Καθίζηση α-αλυσίδων στους ανώριμους ερυθροβλάστες του μυελού των οστών μη αποτελεσματική ερυθροποίηση 5. Καθίζηση α-αλυσίδων στα ώριμα ερυθροκύτταρα οξειδωτική καταστροφή μεμβράνης ερυθροκυττάρων και αιμόλυση

5 Κλινική περιγραφή β-θαλασσαιμίας β-μείζονα θαλασσαιμία ή μεσογειακή αναιμία ή νόσος Cooley (1928)

6 Ενδιάμεση β- θαλασσαιμία Μη εξάρτηση του ασθενούς από μεταγγίσεις Φαινοτυπική ετερογένεια Ποικίλλει η ηλικία διάγνωσης της νόσου Σε ασθενείς με ήπιο φαινότυπο, καθυστερημένη διάγνωση Σε ασθενείς με σοβαρό φαινότυπο, διάγνωση γίνεται σε ηλικία 2-6 ετών Ελάσσων β-θαλασσαιμία ή στίγμα ή φορέας Μικροκυττάρωση και υποχρωμία Ήπια αναιμία όπου τα άτομα είναι ασυμπτωματικά Αυξημένη συγκέντρωση HbA 2 Ελάσσων β-θαλασσαιμία Μείζων β-θαλασσαιμία

7 Αιτίες θανάτου σε ασθενείς με β-θαλασσαιμία Χρόνια αναιμία Υπερφόρτωση με σίδηρο Διαταραχή της δομής και λειτουργικότητας αγγείων Υπερπηκτικότητα A national registry of haemoglobinopathies in Greece: Deducted demographics, trends in mortality and affected births, 2012

8 Επιδημιολογία Ποσοστιαία κατανομή φορέων β- θαλασσαιμίας Εμφανίζεται στις: Ν.Ακτές της Αφρικής Μεσόγειος Μέση Ανατολή Κεντρική Ασία Ινδία Νότια Κίνα Νότια Αμερική Το μεγαλύτερο ποσοστό φορέων εμφανίζεται στην Κύπρο (14%), Σαρδηνία (10,3%) και Νότια Ασία. Υποχρεωτικός έλεγχος φορέων το 1980 Nicole E Cousens et.al Carrier screening for Beta-thalassaemia : a review for international practice, 2010

9 Locus Control Region (LCR) της ανθρώπινης β-σφαιρίνης Patrinos et al genes and development 2004 Padraic P. Levings and Jorg Bungert The human b-globin locus control region, 2002

10 Συχνότερες μεταλλάξεις στην Ελλάδα (β-locus) Τύποι μεταλλάξεων παγκοσμίως

11 Βάσεις δεδομένων για την β-θαλασσαιμία

12 Δείγμα : περιφερικό αίμα Κλινική Διάγνωση Γενική αίματος ( RBC, Hb, MCV, MCH, RDW, μορφολογία ερυθροκυττάρων) Έλεγχος για σιδηροπενία (σίδηρος και φερριτίνη ορού) Ανάλυση των αιμοσφαιρινικών κλασμάτων με ηλεκτροφόρηση αλυσίδων αιμοσφαιρίνης ή υγρή χρωματογραφία υψηλής απόδοσης (HPLC) Ποσοτικός προσδιορισμός της HbA2, HbF Προσδιορισμός Hb με αυξημένη ή μειωμένη συγγένεια για το οξυγόνο (καμπύλη κορεσμού της αιμοσφαιρίνης) Ισοηλεκτρική εστίαση (IEF- Iso-Electric Focusing) Ανοσολογικές μέθοδοι (μονοκλωνικά αντισώματα)

13 Δείγμα : κύτταρα του εμβρύου Προγεννητική διάγνωση Εναλλακτικά, Μη παρεμβατική προγεννητική διάγνωση (ανάλυση εμβρυϊκών κυττάρων ή ελεύθερου εμβρυϊκού DNA στο περιφερικό αίμα της εγκύου) Προεμφυτευτική Γενετική Διάγνωση (έναρξη εγκυμοσύνης με φυσιολογικό έμβρυο) Πιθανότητα αποβολής : 2%

14 Γνωστών μεταλλάξεων Μοριακή διάγνωση PCR (Ενίσχυση του γονιδίου που ερευνάται) PCR/RFLP (Ένζυμα περιοριστισμού αναγνωρίζουν στο προϊόν PCR με συγκεκριμένη σημειακή μετάλλαξη) Multiplex PCR Real-Time PCR PCR ASO (Allele specific oligonucleotide) dot blot Μικροσυστοιχίες Gap PCR παραλλαγή της PCR με δυνατότητα ανίχνευσης κενού στην αλληλουχία

15 Μοριακή διάγνωση ARMS (Amplification Refractory Mutation System) παραλλαγή της PCR με δυνατότητα αξιολόγησης του αποτελέσματος αμέσως μετά την αντίδραση χωρίς την ανάγκη υβριδισμού set εκκινητών (primers) για φυσιολογική και παθολογική αλληλουχία

16 Άγνωστων μεταλλάξεων DGGE (Denaturing Gradient Gel Electrophoresis) Ηλεκτροφόρηση του PCR προϊόντος σε αποδιατακτικό gel ακρυλαμίδης με κλίση πυκνότητας DNA sequencing μελέτη της νουκλεοτιδικής αλληλουχίας cdna sequencing Μοριακή διάγνωση

17 Θεραπεία Ελάσσων β-θαλασσαιμία Χωρίς θεραπεία Χορήγηση καθημερινά 0,5mg φυλλικού οξέος Μείζων β-θαλασσαιμία Τακτικές μεταγγίσεις ερυθρών αιμοσφαιρίων Αποσιδήρωση (χηλικοί παράγοντες για δέσμευση Fe) Αντιμετώπιση δευτερογενών συμπτωμάτων Μεταμόσχευση μυελού ή βλαστοκυττάρων (μοναδική ριζική θεραπεία) Γονιδιακή θεραπεία (ακόμα σε ερευνητικό επίπεδο)

18 Κόστος θεραπείας A national registry of haemoglobinopathies in Greece: Deducted demographics, trends in mortality and affected births, 2012

19 Συμπέρασμα Η αντιμετώπιση της μεσογειακής αναιμίας απαιτεί ενθάρρυνση των επαγγελματιών υγείας για την καλύτερη θεραπευτική αντιμετώπιση και ευαισθητοποίηση της κοινής γνώμης σχετικά με τα προβλήματα των ατόμων με μεσογειακή αναιμία καθώς είναι ευρέως αποδεκτό, ότι η ενημέρωση μπορεί αφενός να διαμορφώσει και να αλλάξει αρνητικές στάσεις απέναντι στη νόσο αφετέρου να συμβάλλει σημαντικά στην διεξαγωγή προγεννητικού ελέγχου.

20 Ευχαριστούμε για την προσοχή σας!

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας»

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Εργαστήριο Κυτταρογενετικής ΕΚΕΦΕ «Δημόκριτος» «β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Ζαχάκη Σοφία - Ουρανία Βιολόγος, MSc, PhD β μεσογειακή αναιμία Η θαλασσαιμία ή νόσος

Διαβάστε περισσότερα

ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ ΕΙΣΑΓΩΓΗ ΤΑΞΙΝΟΜΗΣΗ ΓΕΝΕΤΙΚΗ ΚΛΙΝΙΚΗ ΕΙΚΟΝΑ ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΕΡΕΥΝΗΣΗ ΘΕΡΑΠΕΙΑ

ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ ΕΙΣΑΓΩΓΗ ΤΑΞΙΝΟΜΗΣΗ ΓΕΝΕΤΙΚΗ ΚΛΙΝΙΚΗ ΕΙΚΟΝΑ ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΕΡΕΥΝΗΣΗ ΘΕΡΑΠΕΙΑ ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ ΕΙΣΑΓΩΓΗ ΤΑΞΙΝΟΜΗΣΗ ΓΕΝΕΤΙΚΗ ΚΛΙΝΙΚΗ ΕΙΚΟΝΑ ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΕΡΕΥΝΗΣΗ ΘΕΡΑΠΕΙΑ ΖΩΗ ΡΕΠΑΠΙΝΟΥ - ΝΕΡΑΝΤΖΟΥΛΑΚΗ ΒΙΟΠΑΘΟΛΟΓΟΣ - ΔΙΕΥΘΥΝΤΡΙΑ ΥΠΕΥΘΥΝΗ ΤΜΗΜΑΤΟΣ ΑΙΜΟΛΥΤΙΚΟΥ ΕΛΕΓΧΟΥ - ΜΕΣΟΓΕΙΑΚΗΣ

Διαβάστε περισσότερα

ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΑΓΝΩΣΗ

ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΑΓΝΩΣΗ ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΑΓΝΩΣΗ ΔΩΡΙΖΑ ΖΑΜΠΕΤΑ Επιμελήτρια Β Αιματολογικού Εργαστηρίου Γ.Ν.Α. «Ο ΕΥΑΓΓΕΛΙΣΜΟΣ» Οι αιμοσφαιρινοπάθειες αποτελούν τις πιο κοινές μονογονιδιακές ασθένειες παγκοσμίως.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία των νουκλεοτιδίων που συμβαίνουν στο γενετικό υλικό ενός οργανισμού τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις)

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. β 2. γ 3. α 4. γ 5. δ ΘΕΜΑ 2ο 1. Σχολικό

Διαβάστε περισσότερα

Μαθαίνω για τη Δρεπανοκυτταρική Αναιμία- Αιμοσφαιρίνη S (HbS)

Μαθαίνω για τη Δρεπανοκυτταρική Αναιμία- Αιμοσφαιρίνη S (HbS) κυτταρική Μαθαίνω για τη Δρεπανοκυτταρική Αναιμία- Αιμοσφαιρίνη S (HbS) ΚΥΠΡΙΑΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΙΕΘΝΗΣ ΟΜΟΣΠΟΝ ΙΑ ΘΑΛΑΣΣΑΙΜΙΑΣ Γ.Τ.Π. 138/2013-5.000 Εκδόθηκε από το Γραφείο Τύπου και Πληροφοριών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΛΑΡΙΣΑΣ ΣΧΟΛΗ:ΣΕΥΠ ΤΜΗΜΑ:ΝΟΣΗΛΕΥΤΙΚΗ ΚΑΘΗΓΗΤΗΣ:κ.ΚΥΠΑΡΙΣΣΗ ΓΕΩΡΓΙΑ ΜΑΘΗΜΑ:ΚΟΙΝΟΤΙΚΗ ΝΟΣΗΛΕΥΤΙΚΗ II

ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΛΑΡΙΣΑΣ ΣΧΟΛΗ:ΣΕΥΠ ΤΜΗΜΑ:ΝΟΣΗΛΕΥΤΙΚΗ ΚΑΘΗΓΗΤΗΣ:κ.ΚΥΠΑΡΙΣΣΗ ΓΕΩΡΓΙΑ ΜΑΘΗΜΑ:ΚΟΙΝΟΤΙΚΗ ΝΟΣΗΛΕΥΤΙΚΗ II ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΛΑΡΙΣΑΣ ΣΧΟΛΗ:ΣΕΥΠ ΤΜΗΜΑ:ΝΟΣΗΛΕΥΤΙΚΗ ΚΑΘΗΓΗΤΗΣ:κ.ΚΥΠΑΡΙΣΣΗ ΓΕΩΡΓΙΑ ΜΑΘΗΜΑ:ΚΟΙΝΟΤΙΚΗ ΝΟΣΗΛΕΥΤΙΚΗ II ΘΕΜΑ:ΑΓΩΓΗ ΥΓΕΙΑΣ ΚΑΙ ΜΕΣΟΓΕΙΑΚΗ ΑΝΑΙΜΙΑ ΜΠΑΡΟΥΤΑ ΣΠΥΡΙΔΟΥΛΑ 2008 ΠΕΡΙΕΧΟΜΕΝΑ:

Διαβάστε περισσότερα

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Μπορούν τα γονίδια που ελέγχουν τη σύνθεση της α-αλυσίδας της αιμοσφαιρίνης να χαρακτηριστούν ως πολλαπλά αλληλόμορφα; Τα γονίδια που ελέγχουν την α-αλυσίδα της αιμοσφαιρίνης

Διαβάστε περισσότερα

ΤΑΞΙΝΟΜΗΣΗ-ΔΙΕΡΕΥΝΗΣΗ ΑΝΑΙΜΙΑΣ

ΤΑΞΙΝΟΜΗΣΗ-ΔΙΕΡΕΥΝΗΣΗ ΑΝΑΙΜΙΑΣ ΤΑΞΙΝΟΜΗΣΗ-ΔΙΕΡΕΥΝΗΣΗ ΑΝΑΙΜΙΑΣ ΑΠΑΡΤΙΩΜΕΝΗ ΔΙΔΑΣΚΑΛΙΑ ΣΤΗΝ ΑΙΜΑΤΟΛΟΓΙΑ ΦΕΒΡΟΥΑΡΙΟΣ-ΜΑΡΤΙΟΣ 2015 Αλ. Κουράκλη-Συμεωνίδου ΕΡΓΑΣΤΗΡΙΑΚΗ ΠΡΟΣΕΓΓΙΣΗ ΑΣΘΕΝΟΥΣ ΜΕ ΑΝΑΙΜΙΑ Βαρύτητα αναιμίας Μικρή (Ηb >10 gr/dl)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. 1. β 2. β 3. γ 4. β Β. Ζύμωση: Διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες Υβριδοποίηση:

Διαβάστε περισσότερα

ΟΡΘΟΧΡΩΜΕΣΟΡΘΟΚΥΤΤΑΡΙΚΕΣ ΑΝΑΙΜΙΕΣ. ΑΗΔΟΝΟΠΟΥΛΟΣ ΣΤΥΛΙΑΝΟΣ Διευθυντής Αιματολογικού Εργαστηρίου Γ.Ν.Α. «Ο Ευαγγελισμός»

ΟΡΘΟΧΡΩΜΕΣΟΡΘΟΚΥΤΤΑΡΙΚΕΣ ΑΝΑΙΜΙΕΣ. ΑΗΔΟΝΟΠΟΥΛΟΣ ΣΤΥΛΙΑΝΟΣ Διευθυντής Αιματολογικού Εργαστηρίου Γ.Ν.Α. «Ο Ευαγγελισμός» ΟΡΘΟΧΡΩΜΕΣΟΡΘΟΚΥΤΤΑΡΙΚΕΣ ΑΝΑΙΜΙΕΣ ΑΗΔΟΝΟΠΟΥΛΟΣ ΣΤΥΛΙΑΝΟΣ Διευθυντής Αιματολογικού Εργαστηρίου Γ.Ν.Α. «Ο Ευαγγελισμός» ΤΑΞΙΝΟΜΗΣΗ ΑΝΑΙΜΙΩΝ ΣΥΣΤΗΜΑΤΑ ΤΑΞΙΝΟΜΗΣΗΣ ΚΛΙΝΙΚΗ ΤΑΞΙΝΟΜΗΣΗ ΑΙΤΙΟΛΟΓΙΚΗ ΤΑΞΙΝΟΜΗΣΗ

Διαβάστε περισσότερα

Θαλασσαιμικά σύνδρομα: Γονίδια αλύσων, Δομή αιμοσφαιρίνης, Μεταλλάξεις. Θεραπεία

Θαλασσαιμικά σύνδρομα: Γονίδια αλύσων, Δομή αιμοσφαιρίνης, Μεταλλάξεις. Θεραπεία Θαλασσαιμικά σύνδρομα: Γονίδια αλύσων, Δομή αιμοσφαιρίνης, Μεταλλάξεις Θεραπεία Α.Αθανασιάδου 21.2.2012 Εκπαιδευτικοί Στόχοι: Να γνωρίζετε 1.ποιά γονίδια κωδικοποιούν τις αιμοσφαιρινικές αλύσους ( γενετικοί

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

25. RHESUS (Rh) ANOΣΟΠΟΙΗΣΗ

25. RHESUS (Rh) ANOΣΟΠΟΙΗΣΗ Η Rh ανοσοποίηση οφείλεται σε εμβρυο-μητρική μετάγγιση (ΕΜΜ), όπου ποσότητα Rh θετικού εμβρυϊκού αίματος εισέρχεται στη μητρική κυκλοφορία Rh αρνητικής εγκύου και δημιουργούνται αντισώματα κατά του παράγοντα

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

Ποικιλίες RhD - Σύγχρονη προσέγγιση κατά τις μεταγγίσεις. M. Ξημέρη, ειδικ. Αιματολογίας

Ποικιλίες RhD - Σύγχρονη προσέγγιση κατά τις μεταγγίσεις. M. Ξημέρη, ειδικ. Αιματολογίας Ποικιλίες RhD - Σύγχρονη προσέγγιση κατά τις μεταγγίσεις M. Ξημέρη, ειδικ. Αιματολογίας Εισαγωγή Σύστημα RhD : - αναγνωρίστηκε το 1939 - το πιο σημαντικό κλινικά σύστημα μετά το ΑΒΟ - προκαλεί αιμολυτικές

Διαβάστε περισσότερα

Προβλήματα σχετιζόμενα με την τυποποίηση αντιγόνων Ι

Προβλήματα σχετιζόμενα με την τυποποίηση αντιγόνων Ι Β Προβλήματα Φαινότυπος Β(Α): ασθενής αντίδραση με αντι-α, έντονη αντίδραση με αντι-β, και ο ορός αντιδρά με ερυθρά Α₁. Ο αντιορός Α περιέχει τον κλώνο ΜΗΟ4? Επίκτητος Β φαινότυπος: έντονη αντίδραση με

Διαβάστε περισσότερα

ΕΞΕΤΑΣΤΕΑ ΥΛΗ Γενετική, σελ. 339 369 (εκτός ύλης: 16.7 Χιασματυπία ή διασκελισμός, σελ. 365-368)

ΕΞΕΤΑΣΤΕΑ ΥΛΗ Γενετική, σελ. 339 369 (εκτός ύλης: 16.7 Χιασματυπία ή διασκελισμός, σελ. 365-368) ΓΕΝΕΤΙΚΗ: Από τον Gregor Mendel. στους Watson and Crick. Γενετική είναι ο κλάδος της βιολογίας που μελετά επιστημονικά τους κληρονομικούς χαρακτήρες. Χαρακτηριστικά που δεν κληρονομούνται αλλά αναπτύσσονται

Διαβάστε περισσότερα

Λέξεις κλειδιά στη γενετική

Λέξεις κλειδιά στη γενετική ΓΕΝΕΤΙΚΗ: Από τον Gregor Mendel. στους Watson and Crick. Γενετική είναι ο κλάδος της βιολογίας που μελετά επιστημονικά τους κληρονομικούς χαρακτήρες. Χαρακτηριστικά που δεν κληρονομούνται αλλά αναπτύσσονται

Διαβάστε περισσότερα

Νεογνικές και παιδιατρικές μεταγγίσεις. Ελισάβετ Γεωργίου Αιματολόγος, Επίμ. Β Αιματολογικό Τμήμα Γ. Ν. Παπαγεωργίου

Νεογνικές και παιδιατρικές μεταγγίσεις. Ελισάβετ Γεωργίου Αιματολόγος, Επίμ. Β Αιματολογικό Τμήμα Γ. Ν. Παπαγεωργίου Νεογνικές και παιδιατρικές μεταγγίσεις Ελισάβετ Γεωργίου Αιματολόγος, Επίμ. Β Αιματολογικό Τμήμα Γ. Ν. Παπαγεωργίου Μεταγγίσεις σε νεογνά και παιδιά Μεταγγίσεις στον νεογνικό πληθυσμό Μεταγγίσεις στον

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΘΕΜΑ 1 Ο Α. 1 β, 2 α, 3 δ, 4 δ, 5 γ Β. 1 Λ, 2 Σ, 3 Λ, 4 Λ, 5 Λ ΘΕΜΑ 2 Ο Α. 1) α- θαλασσαιμία Σελ 93 σχολικού βιβλίου: ʽʽΤα γονίδια

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

Παρουσίαση ανοσοαιματολογικής εικόνας εγκύου και εμβρύου νεογνού με αιμολυτική νόσο από anti-d

Παρουσίαση ανοσοαιματολογικής εικόνας εγκύου και εμβρύου νεογνού με αιμολυτική νόσο από anti-d Παρουσίαση ανοσοαιματολογικής εικόνας εγκύου και εμβρύου νεογνού με αιμολυτική νόσο από anti-d Ε. Λυδάκη, Αιματολόγος, επιμ Α Υπηρεσία αιμοδοσίας ΠΑΓΝΗ Γυναίκα, έγκυος, 37 ετών, Α (-), Kell (-) (σύζυγος

Διαβάστε περισσότερα

Προγεννητικός Μοριακός Καρυότυπος. Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά

Προγεννητικός Μοριακός Καρυότυπος. Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά Προγεννητικός Μοριακός Καρυότυπος Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά Η νέα εποχή στον Προγεννητικό Έλεγχο: Μοριακός Καρυότυπος - array CGH - Συγκριτικός γενωμικός υβριδισμός με μικροσυστοιχίες

Διαβάστε περισσότερα

ΣΥΓΧΡΟΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΔΗΜΟΣΙΑ ΥΓΕΙΑ ΤΟΥ ΠΑΙΔΙΟΥ. Δρ.Δ.Λάγγας Αθήνα 2008

ΣΥΓΧΡΟΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΔΗΜΟΣΙΑ ΥΓΕΙΑ ΤΟΥ ΠΑΙΔΙΟΥ. Δρ.Δ.Λάγγας Αθήνα 2008 ΣΥΓΧΡΟΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΔΗΜΟΣΙΑ ΥΓΕΙΑ ΤΟΥ ΠΑΙΔΙΟΥ Δρ.Δ.Λάγγας Αθήνα 2008 Ορισμοί Γενετική: μελέτη της κληρονομικότητας και των παραλλαγών της Ιατρική γενετική: η γενετική του ανθρώπινου είδους Κλινική γενετική:

Διαβάστε περισσότερα

ΜΕΝΔΕΛΙΚΑ ΚΛΗΡΟΝΟΜΟΥΜΕΝΑ ΝΟΣΗΜΑΤΑ

ΜΕΝΔΕΛΙΚΑ ΚΛΗΡΟΝΟΜΟΥΜΕΝΑ ΝΟΣΗΜΑΤΑ ΜΕΝΔΕΛΙΚΑ ΚΛΗΡΟΝΟΜΟΥΜΕΝΑ ΝΟΣΗΜΑΤΑ Νοσήματα κληρονομούμενα με μενδελικό τρόπο : ~4000 Από αυτά, τα ~3300 οφείλονται σε μεταλλάξεις σε ~2000 γονίδια 50% αυτοσωματικά επικρατή ~35% αυτοσωματικά υπολειπόμενα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

Κληρονοµικά νοσήµατα και καταστάσεις που οφείλονται σε γονιδιακές µεταλλάξεις

Κληρονοµικά νοσήµατα και καταστάσεις που οφείλονται σε γονιδιακές µεταλλάξεις Κληρονοµικά νοσήµατα και καταστάσεις που οφείλονται σε γονιδιακές µεταλλάξεις ΤΡΟΠΟΣ ΚΛΗΡΟΝΟΜΗΣΗΣ ΤΩΝ ΚΥΡΙΟΤΕΡΩΝ ΚΛΗΡΟΝΟΜΙΚΩΝ ΝΟΣΩΝ ΑΥΤΟΣΩΜΙΚΗ ΕΠΙΚΡΑΤΗΣ ΑΥΤΟΣΩΜΙΚΗ ΥΠΟΛΕΙΠΟΜΕΝΗ ΦΥΛΟΣΥΝ ΕΤΗ ΥΠΟΛΕΙΠΟΜΕΝΗ

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι λανθασμένη.

Διαβάστε περισσότερα

Επίλυση προβλημάτων ασυμβατότητας. Νίκη Βγόντζα

Επίλυση προβλημάτων ασυμβατότητας. Νίκη Βγόντζα Επίλυση προβλημάτων ασυμβατότητας Νίκη Βγόντζα Βασικά στάδια ελέγχου συμβατότητας του αίματος μεταξύ δότη και λήπτη 1.Αίτηση αίματος (παραπεμπτικό) και δείγμα ασθενή 2.Ομάδα ABO,RhD στο δείγμα του ασθενή

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ο µέγιστος αριθµός διαφορετικών

Διαβάστε περισσότερα

ΕΠΕΑΕΚ ΑΝΑΜΟΡΦΩΣΗ ΤΟΥ ΠΡΟΓΡΑΜΜΑΤΟΣ ΣΠΟΥΔΩΝ ΤΟΥ Τ.Ε.Φ.Α.Α.ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΘΕΣΣΑΛΙΑΣ - ΑΥΤΕΠΙΣΤΑΣΙΑ

ΕΠΕΑΕΚ ΑΝΑΜΟΡΦΩΣΗ ΤΟΥ ΠΡΟΓΡΑΜΜΑΤΟΣ ΣΠΟΥΔΩΝ ΤΟΥ Τ.Ε.Φ.Α.Α.ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΘΕΣΣΑΛΙΑΣ - ΑΥΤΕΠΙΣΤΑΣΙΑ ΕΠΕΑΕΚ ΑΝΑΜΟΡΦΩΣΗ ΤΟΥ ΠΡΟΓΡΑΜΜΑΤΟΣ ΣΠΟΥΔΩΝ ΤΟΥ Τ.Ε.Φ.Α.Α.ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΘΕΣΣΑΛΙΑΣ - ΑΥΤΕΠΙΣΤΑΣΙΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΦΥΣΙΚΗΣ ΑΓΩΓΗΣ & ΑΘΛΗΤΙΣΜΟΥ ΚΕ 0918 «Βιοχημική Αξιολόγηση Αθλητών»

Διαβάστε περισσότερα

ΑΝΙΧΝΕΥΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ- ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Δρ. Ε.Τρακάκης

ΑΝΙΧΝΕΥΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ- ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Δρ. Ε.Τρακάκης ΑΝΙΧΝΕΥΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ- ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Δρ. Ε.Τρακάκης Οι ανιχνευτικές εξετάσεις (screening test) έχουν ευρεία εφαρμογή και μεγάλη πρακτική χρησιμότητα στον προγεννητικό έλεγχο. Ο προγεννητικός έλεγχος

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. H β- θαλασσαιμία είναι

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Στοιχεία Mοριακής ιαγνωστικής των Γενετικών Νόσων: Τέσσερα Παραδείγµατα

Στοιχεία Mοριακής ιαγνωστικής των Γενετικών Νόσων: Τέσσερα Παραδείγµατα Στοιχεία Mοριακής ιαγνωστικής των Γενετικών Νόσων: Τέσσερα Παραδείγµατα Εύθραυστο Χ, Κυστική Ίνωση, Μυΐκη υστροφία Duchenne, Οικογενής Καρκίνος Μαστού-Ωοθηκών Λάµπρος Μαυρόγιαννης Οπως η Συµβατική Εργαστηριακή

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 22 Μαΐου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1. β Α.2. γ Α.3. α Α.4. δ Α.5. γ ΘΕΜΑ B B.1. 1. A 2. B 3. B 4. A 5. A 6. A 7. B 8.

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα

γονείς; neo screen Προγεννητικός Έλεγχος Σκέφτεστε να γίνετε Τα παιδιά αξίζουν μία ζωή γεμάτη υγεία, ελεύθερη από γενετικές ασθένειες Μοριακός

γονείς; neo screen Προγεννητικός Έλεγχος Σκέφτεστε να γίνετε Τα παιδιά αξίζουν μία ζωή γεμάτη υγεία, ελεύθερη από γενετικές ασθένειες Μοριακός Σκέφτεστε γονείς; να γίνετε Τα παιδιά αξίζουν μία ζωή γεμάτη υγεία, ελεύθερη από γενετικές ασθένειες Μοριακός Προγεννητικός Έλεγχος neo screen ΕΡΓΑΣΤΗΡΙΟ ΠΡΟΓΕΝΝΗΤΙΚΟΥ ΚΑΙ ΝΕΟΓΝΙΚΟΥ ΕΛΕΓΧΟΥ Κυστική Ίνωση

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 ΘΕΜΑ 1ο 1. δ, ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 2. β, 3. β, 4. γ, 5. δ. ΘΕΜΑ2ο 1. Σχολικό βιβλίο, σελίδα 31: «Υπάρχουν τέσσερα είδη μορίων RNA και το μεταφέρει στη θέση της πρωτεϊνοσύνθεσης».

Διαβάστε περισσότερα

Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015

Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015 Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015 Θέμα Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ Θέμα Β Β1. 1. Α 2. Β 3. Β 4. Α 5. Α 6. Α 7. Β 8. Β Β2. Το σύμπλοκο που δημιουργείται μετά την πρόσδεση του

Διαβάστε περισσότερα

ΚΑΤΣΑΤΟΥ ΜΑΡΙΑΝΝΑ ΑΙΜΑΤΟΛΟΓΟΣ ΑΙΜΑΤΟΛΟΓΙΚΟ ΕΡΓΑΣΤΗΡΙΟ Ν.Υ. ΑΙΜΟΔΟΣΙΑΣ Π.Γ.Ν. «ΑΤΤΙΚΟΝ»

ΚΑΤΣΑΤΟΥ ΜΑΡΙΑΝΝΑ ΑΙΜΑΤΟΛΟΓΟΣ ΑΙΜΑΤΟΛΟΓΙΚΟ ΕΡΓΑΣΤΗΡΙΟ Ν.Υ. ΑΙΜΟΔΟΣΙΑΣ Π.Γ.Ν. «ΑΤΤΙΚΟΝ» ΚΑΤΣΑΤΟΥ ΜΑΡΙΑΝΝΑ ΑΙΜΑΤΟΛΟΓΟΣ ΑΙΜΑΤΟΛΟΓΙΚΟ ΕΡΓΑΣΤΗΡΙΟ Ν.Υ. ΑΙΜΟΔΟΣΙΑΣ Π.Γ.Ν. «ΑΤΤΙΚΟΝ» 1 η ΚΛΙΝΙΚΗ ΠΕΡΙΠΤΩΣΗ ΑΣΥΜΦΩΝΙΑ ΜΕΤΑΞΥ ΟΡΟΛΟΓΙΚΟΥ ΚΑΙ ΕΡΥΘΡΟΚΥΤΤΑΡΙΚΟΥ ΠΡΟΣΔΙΟΡΙΣΜΟΥ ΤΗΣ ΑΒΟ ΟΜΑΔΑΣ Επίτοκος 36 ετών

Διαβάστε περισσότερα

Πρόληψη των αιμοσφαιρινοπαθειών

Πρόληψη των αιμοσφαιρινοπαθειών Πρόληψη των αιμοσφαιρινοπαθειών Δημήτρης Λουκόπουλος Καθηγητής της Ιατρικής Σχολής του Πανεπιστημίου Αθηνών 1 υχαριστώ τους οργανωτές για την πρόσκληση τους να μιλήσω για τη μεσογειακή αναιμία, ένα σημαντικό

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ B B1. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β- θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 6 ΚΕΦΑΛΑΙΟ 6 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά»

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2ο 1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» 2. σελ. 119-120: «Θεραπευτικά. Τα αντισώματα μπορούν να

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 8 ΚΕΦΑΛΑΙΟ 8 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Απλαστική κρίση από λοίμωξη Parvovirus B19 ως πρώτη κλινική εκδήλωση σε κορίτσι με ενδιάμεση Μεσογειακή Αναιμία

Απλαστική κρίση από λοίμωξη Parvovirus B19 ως πρώτη κλινική εκδήλωση σε κορίτσι με ενδιάμεση Μεσογειακή Αναιμία ΠΑΡΟΥΣΙΑΣΕΙΣ ΠΑΙΔΙΑΤΡΙΚΩΝ ΠΕΡΙΠΤΩΣΕΩΝ 12 Απλαστική κρίση από λοίμωξη Parvovirus B19 ως πρώτη κλινική εκδήλωση σε κορίτσι με ενδιάμεση Μεσογειακή Αναιμία Χατζηδημητρίου Βενιζέλος Οικονόμου Μαρίνα Εισαγωγή

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α)

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα

Παρουσίαση περιστατικού

Παρουσίαση περιστατικού Παρουσίαση περιστατικού 1 Τζήμου Μαρία, Ειδικευόμενη Παθολογίας Β Προπαιδευτική Παθολογική Κλινική Καθηγητής: Αστέριος Καραγιάννης Ιπποκράτειο Νοσοκομείο Θεσσαλονίκης Παρουσίαση περιστατικού 2 Ασθενής,

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΣΥΓΓΕΝΕΙΣ ΑΙΜΟΛΥΤΙΚΕΣ ΑΝΑΙΜΙΕΣ

ΣΥΓΓΕΝΕΙΣ ΑΙΜΟΛΥΤΙΚΕΣ ΑΝΑΙΜΙΕΣ Γ ΠΑΙ ΙΑΤΡΙΚΗ ΚΛΙΝΙΚΗ ΙΕΥΘΥΝΤΗΣ: ΚΑΘΗΓΗΤΗΣ κ. ΙΩΑΝΝΗΣ Ν. ΤΣΑΝΑΚΑΣ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: κ. ΚΑΡΑΤΖΑ ΕΛΙΖΑ ΣΥΓΓΕΝΕΙΣ ΑΙΜΟΛΥΤΙΚΕΣ ΑΝΑΙΜΙΕΣ Τσαβδαρίδου Ιωάννα Τούλια Ηλέκτρα ΣΥΓΓΕΝΕΙΣ ΑΙΜΟΛΥΤΙΚΕΣ ΑΝΑΙΜΙΕΣ Οφείλονται

Διαβάστε περισσότερα

Ε Ν Η Μ Ε Ρ Ω Σ Ο Υ. νεφρά

Ε Ν Η Μ Ε Ρ Ω Σ Ο Υ. νεφρά Ε Ν Η Μ Ε Ρ Ω Σ Ο Υ νεφρά νεφρών Η υψηλή αρτηριακή πίεση (υπέρταση) είναι ένα από τα δύο κύρια αίτια χρόνιας νεφρικής νόσου παγκοσμίως (το άλλο είναι ο διαβήτης). Επίσης, τα νεφρά έχουν βασικό ρόλο στη

Διαβάστε περισσότερα

Ανάπτυξη επισωματικού φορέα για τη γονιδιακή μεταφορά του τεχνητού μεταγραφικού παράγοντα ενεργοποίησης της γ-σφαιρίνης

Ανάπτυξη επισωματικού φορέα για τη γονιδιακή μεταφορά του τεχνητού μεταγραφικού παράγοντα ενεργοποίησης της γ-σφαιρίνης Ανάπτυξη επισωματικού φορέα για τη γονιδιακή μεταφορά του τεχνητού μεταγραφικού παράγοντα ενεργοποίησης της γ-σφαιρίνης Γεώργιος Δρύλλης Μεταπτυχιακό Πρόγραμμα Βασικών Ιατρικών Επιστημών Ιατρική Πατρών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ. Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη

Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ. Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη 2013 ΠΕΡΙΕΧΟΜΕΝΑ : Ορολογία και λίγα λόγια για τον καρκίνο Χαρακτηριστικά του καρκίνου Μεταλλάξεις Μεταλλάξεις και καρκίνος

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ ΔΕΙΓΜΑ ΑΠΟ ΤΗΝ ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ ΤΩΝ ΕΚΑΤΟΝΤΑΔΩΝ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ ΠΟΥ ΔΙΑΘΕΤΟΥΜΕ ΚΑΙ ΠΟΥ ΑΝΟΙΓΟΥΝ ΤΟ ΔΡΟΜΟ ΓΙΑ ΤΟΝ ΔΙΟΡΙΣΜΟ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΜΑΣ ΣΤΟ ΔΗΜΟΣΙΟ ΓΕΝΕΤΙΚΗ 1) Γονιδιακές μεταλλάξεις, χρωμοσωμικές

Διαβάστε περισσότερα

Σύνδρομο Lesch-Nyhan. Πανεπιστήμιο Θεσσαλίας Τμήμα Βιοχημείας-Βιοτεχνολογίας. Ντουντούμη Χρυσούλα Παπαδοπούλου Μαρία-Άννα Στεργίου Δήμητρα

Σύνδρομο Lesch-Nyhan. Πανεπιστήμιο Θεσσαλίας Τμήμα Βιοχημείας-Βιοτεχνολογίας. Ντουντούμη Χρυσούλα Παπαδοπούλου Μαρία-Άννα Στεργίου Δήμητρα Πανεπιστήμιο Θεσσαλίας Τμήμα Βιοχημείας-Βιοτεχνολογίας Μοριακή Βάση Γενετικών Ασθενειών Σύνδρομο Lesch-Nyhan Ντουντούμη Χρυσούλα Παπαδοπούλου Μαρία-Άννα Στεργίου Δήμητρα Εισαγωγή Σπάνια (συνδεδεμένη με

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 5 ΚΕΦΑΛΑΙΟ 5 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα

Α.Τ.Ε.Ι ΗΡΑΚΛΕΙΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ

Α.Τ.Ε.Ι ΗΡΑΚΛΕΙΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ Α.Τ.Ε.Ι ΗΡΑΚΛΕΙΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ιερεύνηση του βαθµού συµµόρφωσης των ασθενών µεσογειακής αναιµίας στην Κρήτη στις οδηγίες και στις προτεινόµενες συνθήκες διαβίωσης. Αγωγή υγείας στη µεσογειακή αναιµία.

Διαβάστε περισσότερα

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική 5.5.24.Δίνεται το γενεαλογικό δένδρο μίας οικογένειας στην οποία εμφανίζεται η ασθένεια της αιμορροφιλίας Α. Τα άτομα 3, 6 και 7 πάσχουν από αιμορροφιλία. α. Να βρεθούν οι πιθανοί γονότυποι όλων των μελών

Διαβάστε περισσότερα

Αθ. Ζώμας Αιματολόγος

Αθ. Ζώμας Αιματολόγος Αθ. Ζώμας Αιματολόγος Το πιο άφθονο χημικό στοιχείο (κατά μάζα) στη Γη και το τέταρτο πιο άφθονο στοιχείο στον στερεό φλοιό της, μετά το Ο2 το Si και το Al Χρησιμεύει στην - μεταφορά Ο2 - αποθήκευση Ο2

Διαβάστε περισσότερα

Να σημειώσετε στο τετράδιό σας ποια από τις παρακάτω απαντήσεις συμπληρώνει σωστά τις ακόλουθες φράσεις ή προτάσεις

Να σημειώσετε στο τετράδιό σας ποια από τις παρακάτω απαντήσεις συμπληρώνει σωστά τις ακόλουθες φράσεις ή προτάσεις ΦΡΟΝΤΙΣΤΗΡΙΑΚΟΣ ΟΡΓΑΝΙΣΜΟΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΓΙΑ ΤΑ ΤΜΗΜΑΤΑ ΠΓΘΤ, ΓΘΤ, ΠαΘΤ Θέμα Α Να σημειώσετε στο τετράδιό σας ποια από τις παρακάτω

Διαβάστε περισσότερα

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ Μανδηλαρά Γεωργία Βιολόγος PhD, Επιστημονικός Συνεργάτης Εθνική Σχολή Δημόσιας Υγείας Τμήμα Μικροβιολογίας Υδατογενείς λοιμώξεις: χρήση νερού

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα

ΣΥΓΧΡΟΝΕΣ ΑΠΟΨΕΙΣ ΓΙΑ ΤΗΝ ΘΕΡΑΠΕΙΑ ΤΩΝ ΕΠΑΝΕΙΛΗΜΜΕΝΩΝ ΑΠΟΒΟΛΩΝ

ΣΥΓΧΡΟΝΕΣ ΑΠΟΨΕΙΣ ΓΙΑ ΤΗΝ ΘΕΡΑΠΕΙΑ ΤΩΝ ΕΠΑΝΕΙΛΗΜΜΕΝΩΝ ΑΠΟΒΟΛΩΝ ΣΥΓΧΡΟΝΕΣ ΑΠΟΨΕΙΣ ΓΙΑ ΤΗΝ ΘΕΡΑΠΕΙΑ ΤΩΝ ΕΠΑΝΕΙΛΗΜΜΕΝΩΝ ΑΠΟΒΟΛΩΝ Σ. ΔΕΝΔΡΙΝΟΣ ΑΝ. ΚΑΘΗΓΗΤΗΣ Β ΜΑΙΕΥΤΙΚΗΣ-ΓΥΝΑΙΚΟΛΟΓΙΚΗΣ ΚΛΙΝΙΚΗΣ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ ΟΡΙΣΜΟΣ 2 ή 3 αποβολές προ των 20 wks ΠΟΣΟΣΤΟ ΕΜΦΑΝΙΣΗΣ

Διαβάστε περισσότερα

Θεραπεία της μεσογειακής αναιμίας

Θεραπεία της μεσογειακής αναιμίας Θεραπεία της μεσογειακής αναιμίας Ομότ. Καθηγητής Παιδιατρικής, Ιατρική Σχολή Πανεπιστημίου Χρήστος Καπάμης Αθηνών 1. ΕΙΣΑΓΩΓΗ θεραπεία της μεσογειακής αναιμίας βασίζεται κυρίως στην παθογένεια της και

Διαβάστε περισσότερα

ΣΥΝΟΨΗ ΠΕΡΙ ΤΗΣ ΑΝΑΙΜΙΑΣ. Αργύρης Σ. Συμεωνίδης Αναπλ. Καθηγητής Αιματολογίας Πανεπιστημίου Πατρών

ΣΥΝΟΨΗ ΠΕΡΙ ΤΗΣ ΑΝΑΙΜΙΑΣ. Αργύρης Σ. Συμεωνίδης Αναπλ. Καθηγητής Αιματολογίας Πανεπιστημίου Πατρών ΣΥΝΟΨΗ ΠΕΡΙ ΤΗΣ ΑΝΑΙΜΙΑΣ Αργύρης Σ. Συμεωνίδης Αναπλ. Καθηγητής Αιματολογίας Πανεπιστημίου Πατρών Βασικό γνωσιολογικό υπόστρωμα Το αίμα αποτελείται από: ερυθρά και λευκά αιμοσφαίρια, αιμοπετάλια και πλάσμα

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 4: Τεχνολογία του Ανασυνδυασµένου DNA

KΕΦΑΛΑΙΟ 4: Τεχνολογία του Ανασυνδυασµένου DNA KΕΦΑΛΑΙΟ 4: Τεχνολογία του Ανασυνδυασµένου DNA Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1. Πώς ονοµάζονται

Διαβάστε περισσότερα

Γνωρίζετε για τις μεταγγίσεις των ερυθρών αιμοσφαιρίων

Γνωρίζετε για τις μεταγγίσεις των ερυθρών αιμοσφαιρίων Σκοπός του φυλλαδίου δεν είναι να αντικαταστήσει τις συμβουλές του γιατρού σας, ο οποίος σας εξέτασε και διέγνωσε την πάθησή σας. Μη διστάσετε να ρωτήσετε το γιατρό ή νοσηλευτή σας για ο,τιδήποτε που τυγχάνει

Διαβάστε περισσότερα

ΟΔΗΓΟΣ ΝΟΣΗΛΕΥΤΙΚΗΣ ΓΙΑ ΤΙΣ ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ

ΟΔΗΓΟΣ ΝΟΣΗΛΕΥΤΙΚΗΣ ΓΙΑ ΤΙΣ ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ ΟΔΗΓΟΣ ΝΟΣΗΛΕΥΤΙΚΗΣ ΓΙΑ ΤΙΣ ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ ΣΥΓΓΡΑΦΕΙΣ Edith Aimiuwu Aldine Thomas Naseer Roheemun Therese Khairallah Najat Ajami Nacouzi Αντωνία Γεωργίου Χριστίνα Παπαδοπούλου Επιµέλεια Ελληνικής

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα