ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΑΓΝΩΣΗ

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΑΓΝΩΣΗ"

Transcript

1 ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΑΓΝΩΣΗ ΔΩΡΙΖΑ ΖΑΜΠΕΤΑ Επιμελήτρια Β Αιματολογικού Εργαστηρίου Γ.Ν.Α. «Ο ΕΥΑΓΓΕΛΙΣΜΟΣ»

2 Οι αιμοσφαιρινοπάθειες αποτελούν τις πιο κοινές μονογονιδιακές ασθένειες παγκοσμίως. Ο όρος αιμοσφαιρινοπάθειες υπονοεί διαταραχή της αιμοσφαιρίνης και επομένως περιλαμβάνει εννοιολογικά δύο οντότητες, αυτή των διαταραχών του μεταβολισμού της αίμης (πορφυρίες) και αυτή των διαταραχών της σφαιρίνης. Ωστόσο, στην πράξη έχει επικρατήσει να αναφέρεται σε διαταραχές της σφαιρίνης και μόνο.

3 Οι αιμοσφαιρινοπάθειες μπορούν να διακριθούν σε (Α) ποσοτικές, όπου παρατηρείται έλλειψη ή ελάττωση της παραγωγής μιας αλυσίδας. Εδώ ανήκουν τα θαλασσαιμικά σύνδρομα. 1. β-θαλασσαιμικά σύνδρομα ομόζυγη β-θαλασσαιμία ενδιάμεση β-θαλασσαιμία ετερόζυγη β-θαλασσαιμία δβ - θαλασσαιμία γδβ - θαλασσαιμία δ - θαλασσαιμία Hb-Lepore 2. α-θαλασσαιμικά σύνδρομα α 1 θαλασσαιμία (σιωπηλός φορέας) (_α/αα) α 2 θαλασσαιμία (ετερόζυγη) (_α/αα) ή (_α/_α) α 3 θαλασσαιμία (ενδιάμεση, Hb H) ( /_α) α 4 θαλασσαιμία (εμβρυϊκός ύδρωπας ή μείζων α-θαλασσαιμία ( / ) 3. Hb Constant Spring

4 Β) Ποιοτικές ή αλλιώς παθολογικές αιμοσφαιρίνες όπου χαρακτηρίζονται από αντικατάσταση ενός ή περισσότερων αμινοξέων στην πολυπεπτιδική αλυσίδα, έτσι ώστε η νέα αλυσίδα να προσδίδει διαφορετικές φυσικοχημικές ιδιότητες στην παραγόμενη αιμοσφαιρίνη. 1. Προκαλούσες αιμολυτική αναιμία Με διαταραχές της μορφολογίας των ερυθροκυττάρων (Hb S) Με διαταραχές της σταθερότητας της Hb (ασταθείς Hb) 2. Προκαλούσες πολυκυτταραιμία 3. Προκαλούσες κυάνωση (Hb M) 4. Φαινοτυπικά όμοιες με θαλασσαιμία Με ελαττωμένο ρυθμό σύνθεσης Hb E Με παθολογικό τερματισμό αλυσίδας Ενώ έχουμε και τις μικτές ετεροζυγωτίες, όπως η μικροδρεπανοκυτταρική αναιμία (συνύπαρξη δρεπανοκυτταρικού και β- θαλασσαιμικού γονιδίου).

5 ΔΙΑΓΝΩΣΤΙΚΗ ΠΡΟΣΕΓΓΙΣΗ Οι αιμοσφαιρινοπάθειες είναι ίσως το μοναδικό γενετικό νόσημα στο οποίο η αναγνώριση των φορέων επιτυγχάνεται με απλή αιματολογική εξέταση. Ηδιάγνωσημπορείναγίνειείτε στο πλαίσιο της πρόληψης (Μονάδες Μεσογειακής Αναιμίας, Γενικό Νοσοκομείο, ιδιωτικό εργαστήριο), είτε τυχαία κατά τη διερεύνηση μιας υπόχρωμης μικροκυτταρικής αναιμίας. Για τη διάγνωση των αιμοσφαιρινοπαθειών πρέπει να προηγείται ο αιματολογικός και βιοχημικός έλεγχος και να ακολουθούν οι πιο εξειδικευμένες τεχνικές και η μελέτη του οικογενειακού ιστορικού. Απαραίτητη προϋπόθεση για την ασφαλή διάγνωση είναι η κοινή αποδοχή αλγόριθμου εργαστηριακής διάγνωσης.

6 ΕΡΓΑΣΤΗΡΙΑΚΟΣ ΑΛΓΟΡΙΘΜΟΣ ΑΙΜΑΤΟΛΟΓΙΚΗ ΜΕΛΕΤΗ 1. Γενική αίματος 2. Μελέτη μορφολογίας ερυθροκυττάρων 3. Ερυθροκυτταρικά έγκλειστα ΒΙΟΧΗΜΙΚΗ ΜΕΛΕΤΗ 1. Ηλεκτροφόρηση Hb 2. Ισοηλεκτρική εστίαση 3. HPLC (Υγρή χρωματογραφία υψηλής πίεσης) 4. Ποσοτικός προσδιορισμός HbA 2, HbS κ.ά. 5. Δοκιμασία δρεπάνωσης 6. Ωσμωτική αντίσταση ερυθροκυττάρων 7. Μέτρηση σιδήρου, φερριτίνης 8. Βιοσύνθεση αιμοσφαιρίνης ΜΟΡΙΑΚΗΜΕΛΕΤΗΤΟΥDNA 1. RFLP (Restriction Fragment Length Polymorphism) 2. PCR (Polymerase Chain Reaction)

7 ΓΕΝΙΚΗ ΑΙΜΑΤΟΣ Οι παράμετροι που αξιολογούνται στη γενική αίματος είναι RBC, Hb, MCV, MCH, RDW. Ο συνδυασμός των δεικτών MCV, MCH και RDW αποτελεί σημαντική βοήθεια στην εργαστηριακή διάγνωση των αιμοσφαιρινοπαθειών. Κατά την αξιολόγηση της γενικής αίματος μπορούμε να διαπιστώσουμε την ύπαρξη: α. Υπόχρωμης, μικροκυτταρικής αναιμίας β. Υποχρωμία, μικροκυττάρωση χωρίς αναιμία γ. Οριακούς δείκτες (MCV, MCH) Δεν είναι σπάνιο να συνυπάρχει σιδηροπενία σε ετεροζυγώτες θαλασσαιμίας. Σε περίπτωση ελέγχου αποκαθίσταται σε πρώτη φάση η σιδηροπενία (εφόσον υπάρχει) και ακολουθεί ο έλεγχος.

8 ΕΠΙΧΡΙΣΜΑ ΠΕΡΙΦΕΡΙΚΟΥ ΑΙΜΑΤΟΣ ΚΑΙ ΕΡΥΘΡΟΚΥΤΤΑΡΙΚΑ ΕΓΚΛΕΙΣΤΑ Κατά τη μελέτη του επιχρίσματος περιγράφεται η ύπαρξη ή όχι υποχρωμίας, πολυχρωματοφιλίας, μικροκυττάρωσης, ποικιλοκυττάρωσης, ανισοκυττάρωσης, στοχοκυττάρωσης, δρεπανοκυττάρων, βασεόφιλης στίξης, καθώς και η ανεύρεση εμπύρηνων ερυθροκυττάρων. Ερυθροκυτταρικά έγκλειστα αναζητούνται εφόσον: α. Υπάρχει υποψία HbH ή στην ηλεκτροφόρηση υπάρχει ταχύ κλάσμα. β. Υπάρχει υποψία α-θαλασσαιμίας. γ. Πιθανολογείται ύπαρξη ασταθούς αιμοσφαιρίνης Στα ερυθρά αιμοσφαίρια πασχόντων από α-μα παρατηρούνται σφαιρικά έγκλειστα στα οποία οφείλονται σε τετραμερή B 4.

9 Ετερόζυγη β-θαλασσαιμία

10 Ομόζυγη β-θαλασσαιμία

11 Δρεπανοκύτταρο Δρεπανοκυτταρική αναιμία

12 Αιμοσφαιρινοπάθεια Η Επίχρισμα περιφερικού Έγκλειστα (Β 4 τετραμερή)

13 Εμβρυϊκός ύδρωπας

14 ΗΛΕΚΤΡΟΦΟΡΗΣΗ Hb (1) ΗηλεκτροφόρησηHb παραμένει η πιο συνηθισμένη τεχνική στην άμεση ανίχνευση και χαρακτηρισμό των διάφορων αιμοσφαιρινών. Η συλλογή αίματος γίνεται σε σωληνάριο γενικής αίματος. Το δείγμα αίματος και το αιμόλυμα μπορεί να διατηρηθεί εντός ψυγείου (4 C) και να χρησιμοποιηθεί μέσα σε μια εβδομάδα.

15 ΗΛΕΚΤΡΟΦΟΡΗΣΗ Hb (2) Η ηλεκτροφόρηση Hb σε οξεική κυτταρίνη σε αλκαλικό PH ( ) είναι η συνηθέστερη μέθοδος για την ανίχνευση και το χαρακτηρισμό των διάφορων αιμοσφαιρινών. Η αλκαλική ηλεκτροφόρηση διακρίνει αποτελεσματικά τις φυσιολογικές αιμοσφαιρίνες Α, Α 2 και F και τις παθολογικές S και C. Η ηλεκτροφόρηση σε όξινο PH γίνεται σε κιτρικό άγαρήγέληαγαρόζης. Έτσι διαχωρίζονται: Η Hb C από την Hb E. Η Hb S από τις Hb D, Hb G και HD Lepore.

16

17 α-θαλασσαιμικά σύνδρομα ΚΛΙΝΙΚΗ ΕΙΚΟΝΑ Εμβρυϊκός ύδρωπας Αιμοσφαιρινοπά θεια Η ΗΛΕΚΤΡΟΦΟΡΗΤΙΚΑ ΕΥΡΗΜΑΤΑ HbA=0Hb Bart (γ4) μη HbF=0 HbH (β4) λειτουργικές Hb Portland HbH: 1-30% (ταχύ κλάσμα) HbA HbA 2 : 1-2% Αιμολυτική αναιμία ποικίλης βαρύτητας Ετερόζυγη α-μα HbΑ: κ.φ. MCV, MCH HbA 2 : κ.φ. 3-5% Hb Bart κατά τη γέννηση Σιωπηλός φορέας α-μα HbΑ: κ.φ. MCV, MCH ή HbA 2 : κ.φ. Οριακά ή κ.φ. ΓΟΝΟΤΥΠΟΣ α 0 thal/α 0 thal α 0 thal/α + thal α 0 thal/α ή α + thal/α + thal α + thal/α

18 Γενική αίματος: κ.φ. MCV>82 fl, MCH>28 pg M. EP: κ.φ. A 2 <3%, F<2% Υγιείς A 2 3%, F<2% Υγιείς ή β-σιωπηλοί φορείς (μελέτη DNA) A 2 <3%, F>3% HPFH Χρώση Kleihauer - Betke Μελέτη DNA A 2 <1,8%, F<2% Σιδηροπενία* ετερ. δ. ΜΑ Hb Κνωσσός * Η διόρθωση υπάρχουσας σιδηροπενίας είναι απαραίτητη προϋπόθεση για την αξιόπιστη μέτρηση της HbA 2.

19 Γενική αίματος MCV<82 fl, MCH<28 pg M. EP: + A 2 >3,5%, F 1-3% Τυπική β ετεροζυγώτες (30% των περιπτώσεων) A 2 6%, F 3-15% β-ετεροζυγώτες (~15%) A 2 3,5-4% MCV, MCH A 2 <3%, MCV, MCH οριακά A 2 >3,5% MCV-MCH A 2 <3%, F<2% A 2 <3%, F>5% β-ετεροζυγώτες ΣχετικάήπιαμετάλλαξηIVSI-6 Ήπιοι β-ετεροζυγώτες (-101/Ν1) Διπλοί ετεροζυγώτες α+β Έλεγχος γονέων-βιοσύνθεση-dna α-μα (Έγκλειστα ερυθροκυττάρων) γδβ-μα Σιδηροπενία Ετερ δβ - ΜΑ HPFH + α - ΜΑ Μοριακή μελέτη DNA

20 Μεθοδολογία Εργαστηριακής Διερεύνησης Παθολογικών Hb Ηλεκτροφόρηση Hb (Αλκαλικό ΡΗ 8,6) ή HPLC Παρουσία παθολογικού κλάσματος Δοκιμασία Δρεπάνωσης Θετική Παρουσία HbS Αρνητική Ηλεκτροφόρηση Hb (όξινο ΡΗ 6,4) Ηλεκτροφόρηση πεπτιδικών αλυσίδων Ισοηλεκτρική εστίαση Ποσοτική μέτρηση Βιοσύνθεση Hb DNA

21 A 2 3%, S<50% A 2 <3% S70-95% A=O Ετερόζυγη δρεπανοκυτταρική αναιμία Ομόζυγη δρεπανοκυτταρική αναιμία A 2 >3% S>50% A 10-30% F 5-30% HbS/Hbβ + A 2 >3% S>50% A=Ο F 1-15% HbS/Hbβ ο

22 HPLC Χρησιμοποιείται σε εργαστήρια με μεγάλο φόρτο εργασίας, αν και έχει πλέον αντικαταστήσει την κλασσική ηλεκτρόφορηση Hb. Τα πλεονεκτήματα, σε σχέση με την κλασσική ηλεκτροφόρηση, είναι τα εξής: Λιγότερο επίπονη και συντομότερη μέθοδος, ενώ δεν απαιτεί εξειδικευμένο προσωπικό. Απαιτεί μικρότερη ποσότητα δείγματος (5 μl). Ανιχνεύονται περισσότερες παθολογικές αιμοσφαιρίνες. Με την ποσοτική μέτρηση της HbA 2 επιτρέπει τη διάγνωση της ετερόζυγης β-θαλασσαιμίας σε ένα στάδιο, αποφεύγοντας έτσι την ηλεκτροφόρηση και τη χρωματογραφία σε στήλη ρητίνης. Μειονέκτημα: Το μεγάλο κόστος τόσο του μηχανήματος όσο και των αντιδραστηρίων.

23

24 ΠΟΣΟΤΙΚΟΣ ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΑΙΜΟΣΦΑΙΡΙΝΩΝ Οι μέθοδοι που χρησιμοποιούνται για τον ποσοτικό προσδιορισμό της HbA 2 είναι: Ο χρωματογραφικός δαχωρισμός σε μικροστήλες ρητίνης (μέθοδος αναφοράς). Ο αυτόματος χρωματογραφικός διαχωρισμός με την HPLC. Η έκλουση του κλάσματος της Α 2 μετά από ηλεκτροφόρηση σε οξεική κυτταρίνη και η μέτρησή του σε φωτόμετρο. ΗαύξησητηςHbA 2 είναι ένα από τα πιο αξιόπιστα και ειδικά κριτήρια για τη διάγνωση της ετερόζυγης β-μα.!! Η HPLC δεν συνιστάται για την ποσοτική μέτρηση της HbA 2 σε περίπτωση που συνυπάρχει HbS ή Hb Lepore.

25 ΧΡΩΣΗ KLEIHAUER-BETKE (ΚΥΤΤΑΡΑ F) Χρησιμοποιείται για τη διαφορική διάγνωση της HPFH από τις θαλασσαιμίες με αυξημένη HbF. Τα κύτταρα που περιέχουν HbF βάφονται ροζ, ενώ τα ερυθροκύτταρα, που δεν περιέχουν HbF, δεν βάφονται (ghost cells). Στις θαλασσαιμίες παρατηρείται ετερογενής κατανομή της HbF, ενώ στην HPFH όλα σχεδόν τα ερυθροκύτταρα περιέχουν HbF.

26 Χρώση Kleihauer-Betke

27 ΔΟΚΙΜΑΣΙΑ ΔΡΕΠΑΝΩΣΗΣ Χρησιμοποιείται για το διαχωρισμό των παθολογικών αιμοσφαιρινών που μεταναστεύουν μαζί με την HbS (Hb D, Hb G, Hb Lepore ) στην αλκαλική ηλεκτροφόρηση σε οξεική κυτταρίνη. Η δοκιμασία στηρίζεται στο γεγονός ότι τα ερυθροκύτταρα που περιέχουν HbS μετατρέπονται σε δρεπανοκύτταρα όταν το αίμα αποξυγονοποιηθεί (προϋπόθεση ποσοστό HbS>15%). Το φαινόμενο της δρεπάνωσης εμφανίζεται γρήγορα στην ομόζυγη ΔΑ και αργά στην ετερόζυγη ΔΑ και στη ΜΔΚ.

28 Δοκιμασία δρεπάνωσης

29 ΒΙΟΣΥΝΘΕΣΗ ΑΙΜΟΣΦΑΙΡΙΝΗΣ Με την in vitro βιοσύνθεση των αιμοσφαιρινικών αλυσίδων παρουσία ενός τουλάχιστον ραδιοσεσημασμένου αμινοξέος, υπάρχει η δυνατότητα να καθοριστεί με αυξημένη ακρίβεια η αναλογία των συντιθέμενων αλυσίδων. Βιοσυνθετικός λόγος α/β > 1,20 υποδηλώνει β-μα, ενώ βιοσυνθετικός λόγος α/β < 0,85 υποδηλώνει α-μα. Φυσιολογικά ο βιοσυνθετικός λόγος α/β είναι περίπουίσοςμετημονάδα.

30

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ)

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» Η κυκλοφορία του αίματος και

Διαβάστε περισσότερα

ΜΕΣΟΓΕΙΑΚΗ ΑΝΑΙΜΙΑ (ΘΑΛΑΣΣΑΙΜΙΑ)

ΜΕΣΟΓΕΙΑΚΗ ΑΝΑΙΜΙΑ (ΘΑΛΑΣΣΑΙΜΙΑ) ΜΕΣΟΓΕΙΑΚΗ ΑΝΑΙΜΙΑ (ΘΑΛΑΣΣΑΙΜΙΑ) Αλεξάνδρα Κουράκλη-Συμεωνίδου Απαρτιωμένη διδασκαλία Φεβρουάριος-Μάρτιος 2015 ΜΕΣΟΓΕΙΑΚΗ ΑΝΑΙΜΙΑ (Θαλασσαιμία) Πρόκειται για μία ετερογενή ομάδα κληρονομικών αναιμιών (αυτοσωματικών-υπολοιπόμενων)

Διαβάστε περισσότερα

αμινοξύ. Η αλλαγή αυτή έχει ελάχιστη επίδραση στη στερεοδιάταξη και τη λειτουργικότητα της πρωτεϊνης. Επιβλαβής

αμινοξύ. Η αλλαγή αυτή έχει ελάχιστη επίδραση στη στερεοδιάταξη και τη λειτουργικότητα της πρωτεϊνης. Επιβλαβής Κεφάλαιο 6: ΜΕΤΑΛΛΑΞΕΙΣ -ΘΕΩΡΙΑ- Μεταλλάξεις είναι οι αλλαγές που συμβαίνουν στο γενετικό υλικό ενός οργανισμού, τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις) όσο και σε χρωμοσωμικό επίπεδο (χρωμοσωμικές

Διαβάστε περισσότερα

Νικολακοπούλου Κωνσταντίνα Κάτσα Ελένη-Μαρία Δάσκου Μαρία. β-θαλασσαιμία

Νικολακοπούλου Κωνσταντίνα Κάτσα Ελένη-Μαρία Δάσκου Μαρία. β-θαλασσαιμία Νικολακοπούλου Κωνσταντίνα Κάτσα Ελένη-Μαρία Δάσκου Μαρία β-θαλασσαιμία Θάλασσα + αίμα = θαλασσαιμία Εισαγωγή Η πιο κοινή γενετική νόσος που κληρονομείται Mενδελικά ~ 1 : 100.000 παγκοσμίως ~ 1 : 10.000

Διαβάστε περισσότερα

ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ ΕΙΣΑΓΩΓΗ ΤΑΞΙΝΟΜΗΣΗ ΓΕΝΕΤΙΚΗ ΚΛΙΝΙΚΗ ΕΙΚΟΝΑ ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΕΡΕΥΝΗΣΗ ΘΕΡΑΠΕΙΑ

ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ ΕΙΣΑΓΩΓΗ ΤΑΞΙΝΟΜΗΣΗ ΓΕΝΕΤΙΚΗ ΚΛΙΝΙΚΗ ΕΙΚΟΝΑ ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΕΡΕΥΝΗΣΗ ΘΕΡΑΠΕΙΑ ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ ΕΙΣΑΓΩΓΗ ΤΑΞΙΝΟΜΗΣΗ ΓΕΝΕΤΙΚΗ ΚΛΙΝΙΚΗ ΕΙΚΟΝΑ ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΕΡΕΥΝΗΣΗ ΘΕΡΑΠΕΙΑ ΖΩΗ ΡΕΠΑΠΙΝΟΥ - ΝΕΡΑΝΤΖΟΥΛΑΚΗ ΒΙΟΠΑΘΟΛΟΓΟΣ - ΔΙΕΥΘΥΝΤΡΙΑ ΥΠΕΥΘΥΝΗ ΤΜΗΜΑΤΟΣ ΑΙΜΟΛΥΤΙΚΟΥ ΕΛΕΓΧΟΥ - ΜΕΣΟΓΕΙΑΚΗΣ

Διαβάστε περισσότερα

Κεφάλαιο 6: Μεταλλάξεις

Κεφάλαιο 6: Μεταλλάξεις Κεφάλαιο 6: Μεταλλάξεις ΕΛΕΓΧΟΣ ΓΝΩΣΕΩΝ 1. Τι ονομάζονται μεταλλάξεις και ποια τα κυριότερα είδη τους; 2. Ποιες οι διαφορές μεταξύ γονιδιακών και χρωμοσωμικών μεταλλάξεων; 3. Οι μεταλλάξεις στα σωματικά

Διαβάστε περισσότερα

ΤΑΞΙΝΟΜΗΣΗ-ΔΙΕΡΕΥΝΗΣΗ ΑΝΑΙΜΙΑΣ

ΤΑΞΙΝΟΜΗΣΗ-ΔΙΕΡΕΥΝΗΣΗ ΑΝΑΙΜΙΑΣ ΤΑΞΙΝΟΜΗΣΗ-ΔΙΕΡΕΥΝΗΣΗ ΑΝΑΙΜΙΑΣ ΑΠΑΡΤΙΩΜΕΝΗ ΔΙΔΑΣΚΑΛΙΑ ΣΤΗΝ ΑΙΜΑΤΟΛΟΓΙΑ ΦΕΒΡΟΥΑΡΙΟΣ-ΜΑΡΤΙΟΣ 2015 Αλ. Κουράκλη-Συμεωνίδου ΕΡΓΑΣΤΗΡΙΑΚΗ ΠΡΟΣΕΓΓΙΣΗ ΑΣΘΕΝΟΥΣ ΜΕ ΑΝΑΙΜΙΑ Βαρύτητα αναιμίας Μικρή (Ηb >10 gr/dl)

Διαβάστε περισσότερα

ΟΡΘΟΧΡΩΜΕΣΟΡΘΟΚΥΤΤΑΡΙΚΕΣ ΑΝΑΙΜΙΕΣ. ΑΗΔΟΝΟΠΟΥΛΟΣ ΣΤΥΛΙΑΝΟΣ Διευθυντής Αιματολογικού Εργαστηρίου Γ.Ν.Α. «Ο Ευαγγελισμός»

ΟΡΘΟΧΡΩΜΕΣΟΡΘΟΚΥΤΤΑΡΙΚΕΣ ΑΝΑΙΜΙΕΣ. ΑΗΔΟΝΟΠΟΥΛΟΣ ΣΤΥΛΙΑΝΟΣ Διευθυντής Αιματολογικού Εργαστηρίου Γ.Ν.Α. «Ο Ευαγγελισμός» ΟΡΘΟΧΡΩΜΕΣΟΡΘΟΚΥΤΤΑΡΙΚΕΣ ΑΝΑΙΜΙΕΣ ΑΗΔΟΝΟΠΟΥΛΟΣ ΣΤΥΛΙΑΝΟΣ Διευθυντής Αιματολογικού Εργαστηρίου Γ.Ν.Α. «Ο Ευαγγελισμός» ΤΑΞΙΝΟΜΗΣΗ ΑΝΑΙΜΙΩΝ ΣΥΣΤΗΜΑΤΑ ΤΑΞΙΝΟΜΗΣΗΣ ΚΛΙΝΙΚΗ ΤΑΞΙΝΟΜΗΣΗ ΑΙΤΙΟΛΟΓΙΚΗ ΤΑΞΙΝΟΜΗΣΗ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία των νουκλεοτιδίων που συμβαίνουν στο γενετικό υλικό ενός οργανισμού τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις)

Διαβάστε περισσότερα

ΑΙΜΟΣΦΑΙΡΙΝΗ: ΟΜΗ ΕΚΦΡΑΣΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ ΘΑΛΑΣΑΙΜΙΕΣ. Α. ΠΑΠΑΧΑΤΖΟΠΟΥΛΟΥ 23 Φεβρουαρίου 2016

ΑΙΜΟΣΦΑΙΡΙΝΗ: ΟΜΗ ΕΚΦΡΑΣΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ ΘΑΛΑΣΑΙΜΙΕΣ. Α. ΠΑΠΑΧΑΤΖΟΠΟΥΛΟΥ 23 Φεβρουαρίου 2016 ΑΙΜΟΣΦΑΙΡΙΝΗ: ΟΜΗ ΕΚΦΡΑΣΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΤΩΝ ΣΦΑΙΡΙΝΙΚΩΝ ΓΟΝΙ ΙΩΝ ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ ΘΑΛΑΣΑΙΜΙΕΣ Α. ΠΑΠΑΧΑΤΖΟΠΟΥΛΟΥ 23 Φεβρουαρίου 2016 ομή της αιμοσφαιρίνης Α του ανθρώπου γονιδιακοί τόποι ευθύνονται

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ)

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» Αιμοσφαιρινοπάθειες Οι αιμοσφαιρινοπάθειες,

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. β 2. γ 3. α 4. γ 5. δ ΘΕΜΑ 2ο 1. Σχολικό

Διαβάστε περισσότερα

ΕΚΤΟ ΚΕΦΑΛΑΙΟ ΜΕΤΑΛΛΑΞΕΙΣ

ΕΚΤΟ ΚΕΦΑΛΑΙΟ ΜΕΤΑΛΛΑΞΕΙΣ ΕΚΤΟ ΚΕΦΑΛΑΙΟ ΜΕΤΑΛΛΑΞΕΙΣ ΜΕΤΑΛΛΑΞΕΙΣ Γίνονται μόνο στο γενετικό υλικό των κυττάρων, δηλαδή στο DNA και έχουν μόνιμο χαρακτήρα. Δεν θεωρούνται μεταλλάξεις, μεταβολές των προϊόντων της έκφρασης του γενετικού

Διαβάστε περισσότερα

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας»

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Εργαστήριο Κυτταρογενετικής ΕΚΕΦΕ «Δημόκριτος» «β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Ζαχάκη Σοφία - Ουρανία Βιολόγος, MSc, PhD β μεσογειακή αναιμία Η θαλασσαιμία ή νόσος

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

Γενική αίµατος. Καταµέτρηση των έµµορφων στοιχείων του αίµατος

Γενική αίµατος. Καταµέτρηση των έµµορφων στοιχείων του αίµατος Γενική αίµατος Αθανασία Μουζάκη, Καθηγήτρια Εργαστηριακής Αιµατολογίας-Αιµοδοσίας, Εργαστήριο Αιµατολογίας, Αιµατολογικό Τµήµα, Παθολογική Κλινική, Τµήµα Ιατρικής, Παν/ο Πατρών Γενική αίµατος Καταµέτρηση

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ)

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» ΜΕΝΔΕΛΙΚΑ ΚΛΗΡΟΝΟΜΟΥΜΕΝΑ ΝΟΣΗΜΑΤΑ

Διαβάστε περισσότερα

Χριστοδουλίδου Μαργαρίτα, Κεραμάρης E. Κων/νος Μικροανάλυση Ιατρική Αθηνών ΑΕ Ιδιωτικά Ιατρικά ιαγνωστικά Εργαστήρια, Τμήματα HPLC και Ανοσολογικό.

Χριστοδουλίδου Μαργαρίτα, Κεραμάρης E. Κων/νος Μικροανάλυση Ιατρική Αθηνών ΑΕ Ιδιωτικά Ιατρικά ιαγνωστικά Εργαστήρια, Τμήματα HPLC και Ανοσολογικό. Συγκριτική μέτρηση των επιπέδων γλυκοζυλιωμένης αιμοσφαιρίνης (HbA1c) σε δείγματα ασθενών με αιμοσφαιρινοπάθειες. Σύγκριση μιας ανοσοχημικής μεθόδου (αναλυτής Architect Abbott Diagnostics) με HPLC (Menarini

Διαβάστε περισσότερα

ΤΥΠΟΣ Α ΠΡΟΔΙΑΓΡΑΦΕΣ ΑΥΤΟΜΑΤΩΝ ΑΙΜΑΤΟΛΟΓΙΚΩΝ ΑΝΑΛΥΤΩΝ ΡΟΥΤΙΝΑΣ ΚΑΙ ΕΠΕΙΓΟΝΤΩΝ

ΤΥΠΟΣ Α ΠΡΟΔΙΑΓΡΑΦΕΣ ΑΥΤΟΜΑΤΩΝ ΑΙΜΑΤΟΛΟΓΙΚΩΝ ΑΝΑΛΥΤΩΝ ΡΟΥΤΙΝΑΣ ΚΑΙ ΕΠΕΙΓΟΝΤΩΝ ΤΥΠΟΣ Α ΠΡΟΔΙΑΓΡΑΦΕΣ ΑΥΤΟΜΑΤΩΝ ΑΙΜΑΤΟΛΟΓΙΚΩΝ ΑΝΑΛΥΤΩΝ ΡΟΥΤΙΝΑΣ ΚΑΙ ΕΠΕΙΓΟΝΤΩΝ 1. Οι προμηθευτές υποχρεούνται με την υπογραφή της σύμβασης να προσφέρουν (πιστοποιημένα δύο νέους (μη χρησιμοποιημένους) αιματολογικούς

Διαβάστε περισσότερα

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Μπορούν τα γονίδια που ελέγχουν τη σύνθεση της α-αλυσίδας της αιμοσφαιρίνης να χαρακτηριστούν ως πολλαπλά αλληλόμορφα; Τα γονίδια που ελέγχουν την α-αλυσίδα της αιμοσφαιρίνης

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. 1. β 2. β 3. γ 4. β Β. Ζύμωση: Διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες Υβριδοποίηση:

Διαβάστε περισσότερα

3. Η αρχή λειτουργίας του προσφερόμενου αναλυτή να στηρίζεται σε διεθνώς αναγνωρισμένες μεθόδους μέτρησης.

3. Η αρχή λειτουργίας του προσφερόμενου αναλυτή να στηρίζεται σε διεθνώς αναγνωρισμένες μεθόδους μέτρησης. CellDyn Sapphire ΠΡΟΔΙΑΓΡΑΦΕΣ ΑΥΤΟΜΑΤΟΥ ΑΙΜΑΤΟΛΟΓΙΚΟΥ ΑΝΑΛΥΤΗ ΜΕΓΑΛΗΣ ΠΑΡΑΓΩΓΙΚΟΤΗΤΑΣ 1. Ο προσφερόμενος αναλυτής να έχει την δυνατότητα ανάλυσης φλεβικού αίματος. Όλες οι παράμετροι που ζητούνται ( και

Διαβάστε περισσότερα

έμμορφα στοιχεία του αίματος Κλινική σημασία

έμμορφα στοιχεία του αίματος Κλινική σημασία Είναι η πιο κοινή εργαστηριακή εξέταση στην κλινική πράξη και παρέχει πληροφορίες για τα έμμορφα στοιχεία του αίματος (αριθμός, όγκος, πυκνότητα κ.α.) Κλινική σημασία Προληπτικός έλεγχος Διάγνωση νοσημάτων

Διαβάστε περισσότερα

medicon MEDICON HELLAS A.E.

medicon MEDICON HELLAS A.E. ΠΡΟΣ: ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ 6 η YΓΕΙΟΝΟΜΙΚΗ ΠΕΡΙΦΕΡΕΙΑ ΠΕΛ/ΝΗΣΟΥ,Ι.ΝΗΣΩΝ,ΗΠΕΙΡΟΥ & Δ. ΕΛΛΑΔΑΣ ΓΕΝΙΚΟ ΠΑΝΑΡΚΑΔΙΚΟ ΝΟΣΟΚΟΜΕΙΟ ΤΡΙΠΟΛΗΣ «Η ΕΥΑΓΓΕΛΙΣΤΡΙΑ» Τέρμα Ερυθρού Σταυρού Τρίπολη Τ.Κ.

Διαβάστε περισσότερα

αιμοσφαιρίνη και αιμοσφαιρινοπάθεις Οκτώβριος 2014 Κ. Κωνσταντόπουλος

αιμοσφαιρίνη και αιμοσφαιρινοπάθεις Οκτώβριος 2014 Κ. Κωνσταντόπουλος αιμοσφαιρίνη και αιμοσφαιρινοπάθεις Οκτώβριος 2014 Κ. Κωνσταντόπουλος αιμοσφαιρίνη Καμμία πρωτεϊνη του ανθρώπου δεν έχει μελετηθεί περισσότερο από την αιμοσφαιρίνη Ιδεώδες «εργαλείο» γενετικών μελετών

Διαβάστε περισσότερα

ΜΕΣΟΓΕΙΑΚΗ ΑΝΑΙΜΙΑ ΠΡΟΛΟΓΟΣ ΠΡΟΕΛΕΥΣΗ-ΠΑΡΟΥΣΙΑ ΣΗΜΕΡΑ

ΜΕΣΟΓΕΙΑΚΗ ΑΝΑΙΜΙΑ ΠΡΟΛΟΓΟΣ ΠΡΟΕΛΕΥΣΗ-ΠΑΡΟΥΣΙΑ ΣΗΜΕΡΑ ΠΡΟΛΟΓΟΣ ΜΕΣΟΓΕΙΑΚΗ ΑΝΑΙΜΙΑ Η μεσογειακή αναιμία ή θαλασσαιμία είναι κληρονομική αυτοσωμική υπολειπόμενη νόσος η οποία εντοπίζεται κυρίως στην περιοχή της Μεσογείου Θάλασσας. Στη Μεσογειακή αναιμία η γονιδιακή

Διαβάστε περισσότερα

Μαθαίνω για τη Δρεπανοκυτταρική Αναιμία- Αιμοσφαιρίνη S (HbS)

Μαθαίνω για τη Δρεπανοκυτταρική Αναιμία- Αιμοσφαιρίνη S (HbS) κυτταρική Μαθαίνω για τη Δρεπανοκυτταρική Αναιμία- Αιμοσφαιρίνη S (HbS) ΚΥΠΡΙΑΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΙΕΘΝΗΣ ΟΜΟΣΠΟΝ ΙΑ ΘΑΛΑΣΣΑΙΜΙΑΣ Γ.Τ.Π. 138/2013-5.000 Εκδόθηκε από το Γραφείο Τύπου και Πληροφοριών

Διαβάστε περισσότερα

ΠΩΣ «ΔΙΑΒAΖΕΤΑΙ» Η ΓΕΝΙΚH AIΜΑΤΟΣ. Φυσιολογικές τιμές αιματολογικών παραμέτρων

ΠΩΣ «ΔΙΑΒAΖΕΤΑΙ» Η ΓΕΝΙΚH AIΜΑΤΟΣ. Φυσιολογικές τιμές αιματολογικών παραμέτρων ΠΩΣ «ΔΙΑΒAΖΕΤΑΙ» Η ΓΕΝΙΚH AIΜΑΤΟΣ Μ. Οικονόμου Εισαγωγή Η «γενική αίματος» αποτελεί τη συνηθέστερα χρησιμοποιούμενη εξέταση στην παιδιατρική κλινική πράξη. Ο προσδιορισμός των αιματολογικών παραμέτρων

Διαβάστε περισσότερα

Απλαστική κρίση από λοίμωξη Parvovirus B19 ως πρώτη κλινική εκδήλωση σε κορίτσι με ενδιάμεση Μεσογειακή Αναιμία

Απλαστική κρίση από λοίμωξη Parvovirus B19 ως πρώτη κλινική εκδήλωση σε κορίτσι με ενδιάμεση Μεσογειακή Αναιμία ΠΑΡΟΥΣΙΑΣΕΙΣ ΠΑΙΔΙΑΤΡΙΚΩΝ ΠΕΡΙΠΤΩΣΕΩΝ 12 Απλαστική κρίση από λοίμωξη Parvovirus B19 ως πρώτη κλινική εκδήλωση σε κορίτσι με ενδιάμεση Μεσογειακή Αναιμία Χατζηδημητρίου Βενιζέλος Οικονόμου Μαρίνα Εισαγωγή

Διαβάστε περισσότερα

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό Θέμα 1 ο 1. α 2. γ 3. γ 4.β 5. δ Θέμα 2 ο Α. Οι νόμοι του Mendel δεν ισχύουν σε πολυγονιδιακούς χαρακτήρες και σε συνδεδεμένα γονίδια (μη ανεξάρτητα), ενώ οι αναλογίες δεν είναι οι αναμενόμενες σε φυλοσύνδετα

Διαβάστε περισσότερα

ΜΙΚΡΟΚΥΤΤΑΡΙΚΕΣ ΑΝΑΙΜΙΕΣ. ΖΩΗ ΠΑΛΛΑΝΤΖΑ Δ/τρια Ν.Ιπποκράτειο

ΜΙΚΡΟΚΥΤΤΑΡΙΚΕΣ ΑΝΑΙΜΙΕΣ. ΖΩΗ ΠΑΛΛΑΝΤΖΑ Δ/τρια Ν.Ιπποκράτειο ΜΙΚΡΟΚΥΤΤΑΡΙΚΕΣ ΑΝΑΙΜΙΕΣ ΖΩΗ ΠΑΛΛΑΝΤΖΑ Δ/τρια Ν.Ιπποκράτειο ΜΙΚΡΟΚΥΤΤΑΡΙΚΕΣ ΑΝΑΙΜΙΕΣ 1. ΣΙΔΗΡΟΠΕΝΙΚΗ ANAIMIA 2. ΣΙΔΗΡΟΒΛΑΣΤΙΚEΣ ΑΝΑΙΜΙΕΣ 3. ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ ΑΝΑΙΜΙΕΣ ΙΣΤΟΡΙΚΟ ΑΣΘΕΝΟΥΣ Υπάρχουν στοιχεία

Διαβάστε περισσότερα

ΣΥΓΓΕΝΕΙΣ ΑΙΜΟΛΥΤΙΚΕΣ ΑΝΑΙΜΙΕΣ

ΣΥΓΓΕΝΕΙΣ ΑΙΜΟΛΥΤΙΚΕΣ ΑΝΑΙΜΙΕΣ Γ ΠΑΙ ΙΑΤΡΙΚΗ ΚΛΙΝΙΚΗ ΙΕΥΘΥΝΤΗΣ: ΚΑΘΗΓΗΤΗΣ κ. ΙΩΑΝΝΗΣ Ν. ΤΣΑΝΑΚΑΣ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: κ. ΚΑΡΑΤΖΑ ΕΛΙΖΑ ΣΥΓΓΕΝΕΙΣ ΑΙΜΟΛΥΤΙΚΕΣ ΑΝΑΙΜΙΕΣ Τσαβδαρίδου Ιωάννα Τούλια Ηλέκτρα ΣΥΓΓΕΝΕΙΣ ΑΙΜΟΛΥΤΙΚΕΣ ΑΝΑΙΜΙΕΣ Οφείλονται

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα γονίδια Ι Α και i που καθορίζουν τις ομάδες αίματος: Α. είναι ατελώς επικρατή Β. είναι συνεπικρατή

Διαβάστε περισσότερα

ΚΑΤΣΑΤΟΥ ΜΑΡΙΑΝΝΑ ΑΙΜΑΤΟΛΟΓΟΣ ΑΙΜΑΤΟΛΟΓΙΚΟ ΕΡΓΑΣΤΗΡΙΟ Ν.Υ. ΑΙΜΟΔΟΣΙΑΣ Π.Γ.Ν. «ΑΤΤΙΚΟΝ»

ΚΑΤΣΑΤΟΥ ΜΑΡΙΑΝΝΑ ΑΙΜΑΤΟΛΟΓΟΣ ΑΙΜΑΤΟΛΟΓΙΚΟ ΕΡΓΑΣΤΗΡΙΟ Ν.Υ. ΑΙΜΟΔΟΣΙΑΣ Π.Γ.Ν. «ΑΤΤΙΚΟΝ» ΚΑΤΣΑΤΟΥ ΜΑΡΙΑΝΝΑ ΑΙΜΑΤΟΛΟΓΟΣ ΑΙΜΑΤΟΛΟΓΙΚΟ ΕΡΓΑΣΤΗΡΙΟ Ν.Υ. ΑΙΜΟΔΟΣΙΑΣ Π.Γ.Ν. «ΑΤΤΙΚΟΝ» 1 η ΚΛΙΝΙΚΗ ΠΕΡΙΠΤΩΣΗ ΑΣΥΜΦΩΝΙΑ ΜΕΤΑΞΥ ΟΡΟΛΟΓΙΚΟΥ ΚΑΙ ΕΡΥΘΡΟΚΥΤΤΑΡΙΚΟΥ ΠΡΟΣΔΙΟΡΙΣΜΟΥ ΤΗΣ ΑΒΟ ΟΜΑΔΑΣ Επίτοκος 36 ετών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΣΥΝΟΨΗ ΠΕΡΙ ΤΗΣ ΑΝΑΙΜΙΑΣ. Αργύρης Σ. Συμεωνίδης Αναπλ. Καθηγητής Αιματολογίας Πανεπιστημίου Πατρών

ΣΥΝΟΨΗ ΠΕΡΙ ΤΗΣ ΑΝΑΙΜΙΑΣ. Αργύρης Σ. Συμεωνίδης Αναπλ. Καθηγητής Αιματολογίας Πανεπιστημίου Πατρών ΣΥΝΟΨΗ ΠΕΡΙ ΤΗΣ ΑΝΑΙΜΙΑΣ Αργύρης Σ. Συμεωνίδης Αναπλ. Καθηγητής Αιματολογίας Πανεπιστημίου Πατρών Βασικό γνωσιολογικό υπόστρωμα Το αίμα αποτελείται από: ερυθρά και λευκά αιμοσφαίρια, αιμοπετάλια και πλάσμα

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ

Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ // Γ γ ΙΑΤΡ λυκείου Γ ΘΕΤ2 ΗΜΕΡΟΜΗΝΙΑ: 29/12/

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ // Γ γ ΙΑΤΡ λυκείου Γ ΘΕΤ2 ΗΜΕΡΟΜΗΝΙΑ: 29/12/ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ // Γ γ ΙΑΤΡ λυκείου Γ ΘΕΤ2 ΗΜΕΡΟΜΗΝΙΑ: 29/12/2015 29 12 2016 ΘΕΜΑ 1 ο Επιλέξτε τη σωστή απάντηση που συμπληρώνει τις παρακάτω προτάσεις: 1. Η περιοριστική

Διαβάστε περισσότερα

Παρουσίαση περιστατικού

Παρουσίαση περιστατικού Παρουσίαση περιστατικού 1 Τζήμου Μαρία, Ειδικευόμενη Παθολογίας Β Προπαιδευτική Παθολογική Κλινική Καθηγητής: Αστέριος Καραγιάννης Ιπποκράτειο Νοσοκομείο Θεσσαλονίκης Παρουσίαση περιστατικού 2 Ασθενής,

Διαβάστε περισσότερα

ΑΝΑΙΜΙΕΣ. Αθ. ΖΩΜΑΣ Δ ΠΑΝ.ΠΑΘ.ΚΛΙΝΙΚΗ

ΑΝΑΙΜΙΕΣ. Αθ. ΖΩΜΑΣ Δ ΠΑΝ.ΠΑΘ.ΚΛΙΝΙΚΗ ΑΝΑΙΜΙΕΣ Αθ. ΖΩΜΑΣ Δ ΠΑΝ.ΠΑΘ.ΚΛΙΝΙΚΗ Ορισμός Aναιμίας Αναιμία είναι η κατάσταση κατά την οποία η τιμή της Αιμοσφαιρίνης (και ίσως των Ερυθρών αιμοσφαιρίων) βρίσκονται κατά μονάδα όγκου αίματος, κάτω από

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

Γενική αίματος και φυσιολογικός αιμοποιητικός μυελός

Γενική αίματος και φυσιολογικός αιμοποιητικός μυελός Γενική αίματος και φυσιολογικός αιμοποιητικός μυελός Αργύρης Συμεωνίδης Απαρτιωμένη διδασκαλία Αιματολογίας 2015 Γενική αίματος Ορισμός Η περιγραφική αποτύπωση μιάς αντιπροσωσωπευτικής εικόνας του αίματος,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα

ΣΙΔΗΡΟΠΕΝΙΚΗ ΑΝΑΙΜΙΑ. Αιτιολογία Διάγνωση Θεραπεία

ΣΙΔΗΡΟΠΕΝΙΚΗ ΑΝΑΙΜΙΑ. Αιτιολογία Διάγνωση Θεραπεία ΣΙΔΗΡΟΠΕΝΙΚΗ ΑΝΑΙΜΙΑ Αιτιολογία Διάγνωση Θεραπεία Εκπαιδευτικοί στόχοι στην σιδηροπενική αναιμία Κατανόηση της συχνότητας και της αιτιολογίας της σιδηροπενικής αναιμίας Γνώση των γενικών συμπτωμάτων της

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 18/09/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Η Χαρά

Διαβάστε περισσότερα

Αναιμία και εγκυμοσύνη. Κ. Μπακαλιάνου

Αναιμία και εγκυμοσύνη. Κ. Μπακαλιάνου Αναιμία και εγκυμοσύνη Κ. Μπακαλιάνου Σύμφωναμεταδεδομένακέντρωνγιατον έλεγχο των νοσημάτων, ήδη από το 1989, τα κατώτερα φυσιολογικά επίπεδα Hb στο α και γ τρίμηνο προσδιορίζονται στα 11,0 gr/dl και στα

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014

ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 Ονοματεπώνυμο εξεταζόμενου:. ΘΕΜΑ 1 Ο Να απαντήσετε στις ερωτήσεις πολλαπλής επιλογής: 1. Η ανευπλοειδία είναι είδος μετάλλαξης που οφείλεται:

Διαβάστε περισσότερα

«Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» Εργασία στο μάθημα της Βιολογίας ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ

«Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» Εργασία στο μάθημα της Βιολογίας ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ «Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» Εργασία στο μάθημα της Βιολογίας ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ Μια εργασία των: Μακρυδάκη Ελευθερία Μπούρλα Ελένη Τμήμα: Γ 3 Ημερομηνία: 27/1/2015 Γενικά με

Διαβάστε περισσότερα

Σιδηροπενική Αναιμία Α ΠΑΘΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ 15/12/2014. ΣΙΑΚΑΝΤΑΡΗ ΜΑΡΙΝΑ Επίκ. Καθηγήτρια

Σιδηροπενική Αναιμία Α ΠΑΘΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ 15/12/2014. ΣΙΑΚΑΝΤΑΡΗ ΜΑΡΙΝΑ Επίκ. Καθηγήτρια Σιδηροπενική Αναιμία Α ΠΑΘΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ 15/12/2014 ΣΙΑΚΑΝΤΑΡΗ ΜΑΡΙΝΑ Επίκ. Καθηγήτρια ΟΡΙΣΜΟΣ ΑΝΑΙΜΙΑΣ Αναιμία είναι η μείωση ενός ή περισσοτέρων παραμέτρων των ερυθρών αιμοσφαιρίων δηλ. αριθμού ερυθρών,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ 1-2-4-5-6 ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό αν η πρόταση είναι σωστή,

Διαβάστε περισσότερα

Έλενα Λεμεσίου Φεβρουάριος 2015

Έλενα Λεμεσίου Φεβρουάριος 2015 Έλενα Λεμεσίου Φεβρουάριος 2015 Στην Γενική Αίματος αξιολογούνται ποσοτικά και μορφολογικά τα έμμορφα στοιχεία του αίματος Η «γενική αίματος» αποτελεί τη συνηθέστερα χρησιμοποιούμενη εργαστηριακή εξέταση

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Θέμα A A1: β A2: β A3: γ A4: β A5: α. Θέμα Β Β1.

ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Θέμα A A1: β A2: β A3: γ A4: β A5: α. Θέμα Β Β1. ΠΝΤΗΣΕΙΣ ΜΘΗΜ: ΙΟΛΟΓΙ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Θέμα A A1: β A2: β A3: γ A4: β A5: α Θέμα 1. Για να εκφράζονται και τα δυο αλληλόμορφα σε ετερόζυγα άτομα, τα γονίδια αυτά θα πρέπει να έχουν μεταξύ τους σχέση ατελών

Διαβάστε περισσότερα

ΑΝΟΣΟΑΙΜΑΤΟΛΟΓΙΑ ΠΑΡΟΥΣΙΑΣΗ ΠΕΡΙΣΤΑΤΙΚΟΥ ΔΗΜΗΤΡΗΣ ΚΑΛΑΝΤΖΗΣ ΑΙΜΑΤΟΛΟΓΟΣ

ΑΝΟΣΟΑΙΜΑΤΟΛΟΓΙΑ ΠΑΡΟΥΣΙΑΣΗ ΠΕΡΙΣΤΑΤΙΚΟΥ ΔΗΜΗΤΡΗΣ ΚΑΛΑΝΤΖΗΣ ΑΙΜΑΤΟΛΟΓΟΣ ΑΝΟΣΟΑΙΜΑΤΟΛΟΓΙΑ ΠΑΡΟΥΣΙΑΣΗ ΠΕΡΙΣΤΑΤΙΚΟΥ ΔΗΜΗΤΡΗΣ ΚΑΛΑΝΤΖΗΣ ΑΙΜΑΤΟΛΟΓΟΣ ΠΕΡΙΣΤΑΤΙΚΟ 1-ΑΣΥΜΦΩΝΙΑ ΜΕΤΑΞΥ ΟΡΟΛΟΓΙΚΟΥ ΚΑΙ ΕΡΥΘΡΟΚΥΤΤΑΡΙΚΟΥ ΠΡΟΣΔΙΟΡΙΣΜΟΥ ΤΗΣ ΑΒΟ ΟΜΑΔΑΣ Επίτοκος 36 ετών προσέρχεται στο Νοσοκομείο

Διαβάστε περισσότερα

ΓΕΝΙΚΟ ΝΟΣΟΚΟΜΕΙΟ ΤΡΙΚΑΛΩΝ ΑΝΑΚΟΙΝΩΣΗ-ΠΡΟΣΚΛΗΣΗ ΥΠΟΒΟΛΗΣ ΤΕΧΝΙΚΩΝ ΠΡΟΔΙΑΓΡΑΦΩΝ ΓΙΑ ΑΝΤΙΔΡΑΣΤΗΡΙΑ ΑΙΜΑΤΟΛΟΓΙΑΣ

ΓΕΝΙΚΟ ΝΟΣΟΚΟΜΕΙΟ ΤΡΙΚΑΛΩΝ ΑΝΑΚΟΙΝΩΣΗ-ΠΡΟΣΚΛΗΣΗ ΥΠΟΒΟΛΗΣ ΤΕΧΝΙΚΩΝ ΠΡΟΔΙΑΓΡΑΦΩΝ ΓΙΑ ΑΝΤΙΔΡΑΣΤΗΡΙΑ ΑΙΜΑΤΟΛΟΓΙΑΣ ΓΕΝΙΚΟ ΝΟΣΟΚΟΜΕΙΟ ΤΡΙΚΑΛΩΝ ΑΝΑΚΟΙΝΩΣΗ-ΠΡΟΣΚΛΗΣΗ ΥΠΟΒΟΛΗΣ ΤΕΧΝΙΚΩΝ ΠΡΟΔΙΑΓΡΑΦΩΝ ΓΙΑ ΑΝΤΙΔΡΑΣΤΗΡΙΑ ΑΙΜΑΤΟΛΟΓΙΑΣ ΤΕΧΝΙΚΕΣ ΠΡΟΔΙΑΓΡΑΦΕΣ ΑΥΤΟΜΑΤΟΥ ΑΙΜΑΤΟΛΟΓΙΚΟΥ ΑΝΑΛΥΤΗ ΓΙΑ ΠΛΗΡΗ ΓΕΝΙΚΗ ΑΙΜΑΤΟΣ ΜΕ ΔΙΑΧΩΡΙΣΜΟ

Διαβάστε περισσότερα

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 1. 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990 50.20.990 2. 25ης Μαρτίου 74 Π. ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 3. Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

Διαβάστε περισσότερα

Γενική αίματος ΕΜΕ 17-3-2010. Π.ΠαρασκευοπούλουΠαρασκευοπούλου

Γενική αίματος ΕΜΕ 17-3-2010. Π.ΠαρασκευοπούλουΠαρασκευοπούλου Γενική αίματος ΕΜΕ 17-3-2010 Π.ΠαρασκευοπούλουΠαρασκευοπούλου Γενική Αίματος Συχνότερη εξέταση Πληροφορίες για τα έμμορφα στοιχεία του αίματος WBC (Λευκά( Λευκά) RBC ( Ερυθρά) PLT ( Αιμοπετάλια) Συνδυασμός

Διαβάστε περισσότερα

ΤΕΧΝΙΚΕΣ ΠΡΟ ΙΑΓΡΑΦΕΣ ΑΥΤΟΜΑΤΟΥ ΑΙΜΑΤΟΛΟΓΙΚΟΥ ΑΝΑΛΥΤΗ ΜΕΣΑΙΑΣ ΠΑΡΑΓΩΓΙΚΟΤΗΤΑΣ ΤΥΠΟΥ Β

ΤΕΧΝΙΚΕΣ ΠΡΟ ΙΑΓΡΑΦΕΣ ΑΥΤΟΜΑΤΟΥ ΑΙΜΑΤΟΛΟΓΙΚΟΥ ΑΝΑΛΥΤΗ ΜΕΣΑΙΑΣ ΠΑΡΑΓΩΓΙΚΟΤΗΤΑΣ ΤΥΠΟΥ Β ΤΕΧΝΙΚΕΣ ΠΡΟ ΙΑΓΡΑΦΕΣ ΑΥΤΟΜΑΤΟΥ ΑΙΜΑΤΟΛΟΓΙΚΟΥ ΑΝΑΛΥΤΗ ΜΕΣΑΙΑΣ ΠΑΡΑΓΩΓΙΚΟΤΗΤΑΣ ΤΥΠΟΥ Β 1. Να λειτουργεί υπό τάση 220 V 2. Η αρχή λειτουργίας του αναλυτή να στηρίζεται σε διεθνώς αναγνωρισµένες µεθόδους

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΓΕΝΙΚΟ ΝΟΣΟΚΟΜΕΙΟ ΧΑΝΙΩΝ «ΑΓΙΟΣ ΓΕΩΡΓΙΟΣ» Ταχ. Διεύθυνση : Μουρνιές Κυδωνίας

ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΓΕΝΙΚΟ ΝΟΣΟΚΟΜΕΙΟ ΧΑΝΙΩΝ «ΑΓΙΟΣ ΓΕΩΡΓΙΟΣ» Ταχ. Διεύθυνση : Μουρνιές Κυδωνίας ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΓΕΝΙΚΟ ΝΟΣΟΚΟΜΕΙΟ ΧΑΝΙΩΝ «ΑΓΙΟΣ ΓΕΩΡΓΙΟΣ» Χανιά, 15-01-2015 Ταχ. Διεύθυνση : Μουρνιές Κυδωνίας Ταχ. Κωδ. : 73100 Αρ. πρωτ. 678 Πληροφορίες : ΣΥΜΝΙΑΝΑΚΗ ΑΡΓΥΡΩ Τηλέφωνο

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο Α. 1.α, 2.β, 3.δ, 4.γ, 5.α ΜΟΝΑ ΕΣ 10 (2 ΓΙΑ ΚΑΘΕ ΣΩΣΤΗ ΕΠΙΛΟΓΗ) Β. i) λήξης ii) αµινικό iii) τροποποιήσεις,

Διαβάστε περισσότερα

25. RHESUS (Rh) ANOΣΟΠΟΙΗΣΗ

25. RHESUS (Rh) ANOΣΟΠΟΙΗΣΗ Η Rh ανοσοποίηση οφείλεται σε εμβρυο-μητρική μετάγγιση (ΕΜΜ), όπου ποσότητα Rh θετικού εμβρυϊκού αίματος εισέρχεται στη μητρική κυκλοφορία Rh αρνητικής εγκύου και δημιουργούνται αντισώματα κατά του παράγοντα

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

Κεφάλαιο 15 (Ιατρική Γενετική) Προγεννητική διάγνωση

Κεφάλαιο 15 (Ιατρική Γενετική) Προγεννητική διάγνωση Κεφάλαιο 15 (Ιατρική Γενετική) Προγεννητική διάγνωση Η προγεννητική διάγνωση Ενδείξεις: -Προχωρημένη ηλικία μητέρας (πιο συχνό: σύνδρομο Down) -Προγενέστερο παιδί με de novo χρωμοσωμική ανωμαλία -Ύπαρξη

Διαβάστε περισσότερα

Σιδηροπενία: μία πολυσυστηματική διαταραχή. Μαρίνα Οικονόμου Επίκουρη Καθηγήτρια Παιδιατρικής Αιματολογίας ΑΠΘ

Σιδηροπενία: μία πολυσυστηματική διαταραχή. Μαρίνα Οικονόμου Επίκουρη Καθηγήτρια Παιδιατρικής Αιματολογίας ΑΠΘ Σιδηροπενία: μία πολυσυστηματική διαταραχή...... Μαρίνα Οικονόμου Επίκουρη Καθηγήτρια Παιδιατρικής Αιματολογίας ΑΠΘ Συχνές λοιμώξεις αναπνευστικού και επίμονο άσθμα Υποτροπιάζουσες φλεγμονές στοματικής

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

Αθ. Ζώμας Αιματολόγος

Αθ. Ζώμας Αιματολόγος Αθ. Ζώμας Αιματολόγος Το πιο άφθονο χημικό στοιχείο (κατά μάζα) στη Γη και το τέταρτο πιο άφθονο στοιχείο στον στερεό φλοιό της, μετά το Ο2 το Si και το Al Χρησιμεύει στην - μεταφορά Ο2 - αποθήκευση Ο2

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α)

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα

Απλαστική κρίση µετά από λοίµωξη Parvovirus B19 ως αφορµή για τη διάγνωση ενδιάµεσης β-µεσογειακής αναιµίας σε κορίτσι 3,5 ετών

Απλαστική κρίση µετά από λοίµωξη Parvovirus B19 ως αφορµή για τη διάγνωση ενδιάµεσης β-µεσογειακής αναιµίας σε κορίτσι 3,5 ετών ΠΕΡΙΓΡΑΦΗ ΠΕΡΙΠΤΩΣΗΣ Απλαστική κρίση µετά από λοίµωξη Parvovirus B19 ως αφορµή για τη διάγνωση ενδιάµεσης β-µεσογειακής αναιµίας σε κορίτσι 3,5 ετών Aικ. Τέλη, Μ. Οικονόµου, Β. Χατζηδηµητρίου, Ι. Τσάτρα

Διαβάστε περισσότερα

Νεογνικές και παιδιατρικές μεταγγίσεις. Ελισάβετ Γεωργίου Αιματολόγος, Επίμ. Β Αιματολογικό Τμήμα Γ. Ν. Παπαγεωργίου

Νεογνικές και παιδιατρικές μεταγγίσεις. Ελισάβετ Γεωργίου Αιματολόγος, Επίμ. Β Αιματολογικό Τμήμα Γ. Ν. Παπαγεωργίου Νεογνικές και παιδιατρικές μεταγγίσεις Ελισάβετ Γεωργίου Αιματολόγος, Επίμ. Β Αιματολογικό Τμήμα Γ. Ν. Παπαγεωργίου Μεταγγίσεις σε νεογνά και παιδιά Μεταγγίσεις στον νεογνικό πληθυσμό Μεταγγίσεις στον

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα

Παρουσίαση ανοσοαιματολογικής εικόνας εγκύου και εμβρύου νεογνού με αιμολυτική νόσο από anti-d

Παρουσίαση ανοσοαιματολογικής εικόνας εγκύου και εμβρύου νεογνού με αιμολυτική νόσο από anti-d Παρουσίαση ανοσοαιματολογικής εικόνας εγκύου και εμβρύου νεογνού με αιμολυτική νόσο από anti-d Ε. Λυδάκη, Αιματολόγος, επιμ Α Υπηρεσία αιμοδοσίας ΠΑΓΝΗ Γυναίκα, έγκυος, 37 ετών, Α (-), Kell (-) (σύζυγος

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ ΔΕΙΓΜΑ ΑΠΟ ΤΗΝ ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ ΤΩΝ ΕΚΑΤΟΝΤΑΔΩΝ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ ΠΟΥ ΔΙΑΘΕΤΟΥΜΕ ΚΑΙ ΠΟΥ ΑΝΟΙΓΟΥΝ ΤΟ ΔΡΟΜΟ ΓΙΑ ΤΟΝ ΔΙΟΡΙΣΜΟ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΜΑΣ ΣΤΟ ΔΗΜΟΣΙΟ ΓΕΝΕΤΙΚΗ 1) Γονιδιακές μεταλλάξεις, χρωμοσωμικές

Διαβάστε περισσότερα

Θαλασσαιμικά σύνδρομα: Γονίδια αλύσων, Δομή αιμοσφαιρίνης, Μεταλλάξεις. Θεραπεία

Θαλασσαιμικά σύνδρομα: Γονίδια αλύσων, Δομή αιμοσφαιρίνης, Μεταλλάξεις. Θεραπεία Θαλασσαιμικά σύνδρομα: Γονίδια αλύσων, Δομή αιμοσφαιρίνης, Μεταλλάξεις Θεραπεία Α.Αθανασιάδου 21.2.2012 Εκπαιδευτικοί Στόχοι: Να γνωρίζετε 1.ποιά γονίδια κωδικοποιούν τις αιμοσφαιρινικές αλύσους ( γενετικοί

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α 1. α 2. δ 3. γ 4. δ 5. γ. ΘΕΜΑ Β 1. Τα αντισώματα αποτελούν το πιο αποτελεσματικό φυσικό φάρμακο για την αντιμετώπιση

Διαβάστε περισσότερα

Κριτήριο αξιολόγησης-βιολογία Κατεύθυνσης

Κριτήριο αξιολόγησης-βιολογία Κατεύθυνσης ΘΕΜΑ Α. Στις παρακάτω προτάσεις από Α1 έως και Α5 να σημειώσετε το γράμμα που αντιστοιχεί στη σωστή απάντηση. Α1. Όταν ένας σύνθετος φάγος που έχει το πρωτεϊνικό κάλυμμα του φάγου Τ 2 και το DNA του φάγου

Διαβάστε περισσότερα

«Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα»

«Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» «Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» «Τι είναι Μετάλλαξη» Γενικά με τον όρο μετάλλαξη ονομάζουμε τις αλλαγές στο γενετικό υλικό, το DNA δηλαδή ενός ζωντανού οργανισμού και πρόκειται

Διαβάστε περισσότερα

Ασκησεις για το Κεφάλαιο 6: Μεταλλάξεις

Ασκησεις για το Κεφάλαιο 6: Μεταλλάξεις A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την πρόταση, αν υπάρχει. 1. Ένα ανθρώπινο σπερματοζωάριο

Διαβάστε περισσότερα

ΕΞΕΤΑΣΤΕΑ ΥΛΗ Γενετική, σελ. 339 369 (εκτός ύλης: 16.7 Χιασματυπία ή διασκελισμός, σελ. 365-368)

ΕΞΕΤΑΣΤΕΑ ΥΛΗ Γενετική, σελ. 339 369 (εκτός ύλης: 16.7 Χιασματυπία ή διασκελισμός, σελ. 365-368) ΓΕΝΕΤΙΚΗ: Από τον Gregor Mendel. στους Watson and Crick. Γενετική είναι ο κλάδος της βιολογίας που μελετά επιστημονικά τους κληρονομικούς χαρακτήρες. Χαρακτηριστικά που δεν κληρονομούνται αλλά αναπτύσσονται

Διαβάστε περισσότερα

Λέξεις κλειδιά στη γενετική

Λέξεις κλειδιά στη γενετική ΓΕΝΕΤΙΚΗ: Από τον Gregor Mendel. στους Watson and Crick. Γενετική είναι ο κλάδος της βιολογίας που μελετά επιστημονικά τους κληρονομικούς χαρακτήρες. Χαρακτηριστικά που δεν κληρονομούνται αλλά αναπτύσσονται

Διαβάστε περισσότερα

ΝΟΣΗΛΕΥΤΙΚΗ ΜΟΝΑΔΑ ΜΟΛΑΩΝ ΤΕΧΝΙΚΕΣ ΠΡΟΔΙΑΓΡΑΦΕΣ ΑΝΤΙΔΡΑΣΤΗΡΙΩΝ ΚΑΙ ΑΝΑΛΩΣΙΜΩΝ ΑΙΜΑΤΟΛΟΓΙΚΟΥ ΑΝΑΛΥΤΗ SYSMEX.

ΝΟΣΗΛΕΥΤΙΚΗ ΜΟΝΑΔΑ ΜΟΛΑΩΝ ΤΕΧΝΙΚΕΣ ΠΡΟΔΙΑΓΡΑΦΕΣ ΑΝΤΙΔΡΑΣΤΗΡΙΩΝ ΚΑΙ ΑΝΑΛΩΣΙΜΩΝ ΑΙΜΑΤΟΛΟΓΙΚΟΥ ΑΝΑΛΥΤΗ SYSMEX. ΝΟΣΗΛΕΥΤΙΚΗ ΜΟΝΑΔΑ ΜΟΛΑΩΝ ΤΕΧΝΙΚΕΣ ΠΡΟΔΙΑΓΡΑΦΕΣ ΑΝΤΙΔΡΑΣΤΗΡΙΩΝ ΚΑΙ ΑΝΑΛΩΣΙΜΩΝ ΑΙΜΑΤΟΛΟΓΙΚΟΥ ΑΝΑΛΥΤΗ SYSMEX. 1. ΙΣΟΤΟΝΟ ΔΙΑΛΥΜΑ Κατάλληλο για την αραίωση των δειγμάτων ολικού αίματος προκειμένου να πραγματοποιηθεί

Διαβάστε περισσότερα

ΖΗΤΟΥΜΕΝΟ ΕΡΓΟ ΤΕΧΝΙΚΕΣ ΠΡΟΔΙΑΓΡΑΦΕΣ 1. ΑΥΤΟΜΑΤΟΣ ΑΙΜΑΤΟΛΟΓΙΚΟΣ ΑΝΑΛΥΤΗΣ

ΖΗΤΟΥΜΕΝΟ ΕΡΓΟ ΤΕΧΝΙΚΕΣ ΠΡΟΔΙΑΓΡΑΦΕΣ 1. ΑΥΤΟΜΑΤΟΣ ΑΙΜΑΤΟΛΟΓΙΚΟΣ ΑΝΑΛΥΤΗΣ ΔΙΑΓΩΝΙΣΜΟΣ ΓΙΑ ΤΗΝ ΑΝΑΔΕΙΞΗ ΧΟΡΗΓΗΤΟΥ/ΤΩΝ ΓΙΑ ΤΗΝ ΠΡΟΜΗΘΕΙΑ ΑΝΤΙΔΡΑΣΤΗΡΙΩΝ ΚΑΙ ΑΝΑΛΩΣΙΜΩΝ ΓΙΑ ΤΗΝ ΚΑΛΥΨΗ ΤΩΝ ΑΝΑΓΚΩΝ ΣΕ ΕΞΕΤΑΣΕΙΣ ΤΗΣ ΚΛΙΝΙΚΗΣ ΑΙΜΑΤΟΛΟΓΙΚΗΣ ΚΑΙ ΛΕΜΦΩΜΑΤΩΝ ΤΟΥ Γ.Ν.Α. «Ο ΕΥΑΓΓΕΛΙΣΜΟΣ»

Διαβάστε περισσότερα

ΟΜΑ Α Α. ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ Ιατρική Σχολή 3 η Παιδιατρική Κλινική. Εξετάσεις E έτους, 7 Ιουνίου 2011. Ονοµατεπώνυµο φοιτητή:

ΟΜΑ Α Α. ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ Ιατρική Σχολή 3 η Παιδιατρική Κλινική. Εξετάσεις E έτους, 7 Ιουνίου 2011. Ονοµατεπώνυµο φοιτητή: ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ Ιατρική Σχολή 3 η Παιδιατρική Κλινική ιευθυντής : Καθηγητής Ιωάννης Ν. Τσανάκας Ι οκράτειο Νοσοκοµείο Κωνσταντινου όλεως 49 Θεσσαλονίκη 54642 Τηλ.: 2310-992982 FAX:

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 6 ΚΕΦΑΛΑΙΟ 6 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

ΑΙΜΟΣΦΑΙΡΙΝΗ (ΑΜΦ) ΑΙΜΟΣΦΑΙΡΙΝΗ: Hb, είναι τετραμερής πρωτείνη. ΜΕΤΑΠΤΩΣΗ ΑΠΟ Τ <=> R

ΑΙΜΟΣΦΑΙΡΙΝΗ (ΑΜΦ) ΑΙΜΟΣΦΑΙΡΙΝΗ: Hb, είναι τετραμερής πρωτείνη. ΜΕΤΑΠΤΩΣΗ ΑΠΟ Τ <=> R ΑΙΜΟΣΦΑΙΡΙΝΗ (ΑΜΦ) ΑΙΜΟΣΦΑΙΡΙΝΗ: Hb, είναι τετραμερής πρωτείνη. ΜΕΤΑΠΤΩΣΗ ΑΠΟ Τ R ΔΕΟΞΥΑΙΜΟΣΦΑΙΡΙΝΗ ΟΞΥΑΙΜΟΣΦΑΙΡΙΝΗ (Σταθερότητα, χαμηλή συγγένεια για Ο2Εύκαμπτη, υψηλή συγγένεια για Ο2) Λόγο των

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) DNA

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 8/09/06 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4 Κληρονομικές Παθήσεις της Αιμοσφαιρίνης

ΚΕΦΑΛΑΙΟ 4 Κληρονομικές Παθήσεις της Αιμοσφαιρίνης ΚΕΦΑΛΑΙΟ 4 Κληρονομικές Παθήσεις της Αιμοσφαιρίνης Περιεχόμενα ΜΕΡΟΣ ΠΡΩΤΟ. ΒΑΣΙΚΕΣ ΓΝΩΣΕΙΣ Εισαγωγή Ποσοτικές διαταραχές της σύνθεσης της αιμοσφαιρίνης. Θαλασσαιμίες β-θαλασσαιμίες Γενετική σύνθεση Επίπτωση

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΕΡΕΥΝΗΣΗ ΑΥΤΟΑΝΟΣΗΣ ΑΙΜΟΛΥΤΙΚΗΣ ΑΝΑΙΜΙΑΣ. Μαρία Γκανίδου Νοσοκομειακή Υπηρεσία Αιμοδοσίας ΓΝΘ Γ.Παπανικολάου

ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΕΡΕΥΝΗΣΗ ΑΥΤΟΑΝΟΣΗΣ ΑΙΜΟΛΥΤΙΚΗΣ ΑΝΑΙΜΙΑΣ. Μαρία Γκανίδου Νοσοκομειακή Υπηρεσία Αιμοδοσίας ΓΝΘ Γ.Παπανικολάου ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΕΡΕΥΝΗΣΗ ΑΥΤΟΑΝΟΣΗΣ ΑΙΜΟΛΥΤΙΚΗΣ ΑΝΑΙΜΙΑΣ Μαρία Γκανίδου Νοσοκομειακή Υπηρεσία Αιμοδοσίας ΓΝΘ Γ.Παπανικολάου Αυτοάνοση Αιμολυτική Αναιμία (ΑΑΑ) 1.Αυξημένη καταστροφή των ερυθρών αιμοσφαιρίων

Διαβάστε περισσότερα

Προγεννητικός Μοριακός Καρυότυπος. Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά

Προγεννητικός Μοριακός Καρυότυπος. Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά Προγεννητικός Μοριακός Καρυότυπος Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά Η νέα εποχή στον Προγεννητικό Έλεγχο: Μοριακός Καρυότυπος - array CGH - Συγκριτικός γενωμικός υβριδισμός με μικροσυστοιχίες

Διαβάστε περισσότερα