Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:




2 ΕΙΣΑΓΩΓΗ ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ Διαταραχές της αιμοσφαιρίνης Διαταραχές του μεταβολισμού της αίμης (πορφυρίες) Διαταραχές της σφαιρίνης δηλ των πολυπεπτιδικών αλυσίδων

3 ΤΑΞΙΝΟΜΗΣΗ 1) Με βάση την έκφραση της γονιδιακής διαταραχής Ποσοτικές Αιμοσφαιρινοπάθειες έλλειψη ή ελάττωση της παραγωγής μιας πολυπεπτιδικής αλυσίδας -Θαλασσαιμίες α-θαλασσαιμίες β- θαλασσαιμίες γ- θαλασσαιμίες δ- θαλασσαιμίες δβ- θαλασσαιμίες γδβ- θαλασσαιμίες Ποιοτικές Αιμοσφαιρινοπάθειες διαταραχή στη δομή της αιμοσφαιρίνης Δρεπανοκυτταρικά σύνδρομα HbS (β 6Glu Val) Θαλασσαιμικές Αιμοσφαιρινοπάθειες δημιουργία παθολογικής αιμοσφαιρίνης και ελαττωμένη σύνθεση αλυσίδων Hb Constant Spring (α2 142 Gln) HbE (β 26Glu Lys)

4 2) Με βάση τον τρόπο εκδήλωσης της διαταραχής Ασταθείς αιμοσφαιρίνες >100 1/3 de novo μεταλλάξεις Hb Setif (α2 94Asp Tyr) Hb Agrinio (α2 29 Le Pro) Hb Heraklion (α1cd36/37pro 0) Hb Ferrara (β 57Asn Lys) Hb Köln (β 98Val Met) Zürich (β 63His Arg) Αιμοσφαιρίνες που προκαλούν κυάνωση με χαμηλή δεσμευτική ικανότητα οξυγόνου (Hb Kansas β 102Asp Thr) με μετατροπή της αιμοσφαιρίνης σε μεθαιμοσφαιρίνη [Hbs Μ- Hb Boston (α2 58His Tyr), Hb Saskatoon (β 63His Tyr)] Αιμοσφαιρίνες που εκδηλώνονται με ερυθροκυττάρωση με αυξημένη δεσμευτική ικανότητα οξυγόνου >120 Hb San Diego (β 109Val Met) Hb Crete (β 129Ala Pro ) Hb Olympia (β 20Val Met)

5 3) Με βάση τον αριθμό και το είδος των γονιδίων που διαταράσσονται Ετερόζυγες (βο/β, α+/α, βs/β) Ομόζυγες (βο/βο, α+/α+) Διπλές ετεροζυγωτίες (μικροδρεπανοκυτταρική αναιμία - βs/βο, β+/βο,)

6 Κληρονομικές Επίκτητες Επίκτητη Hb/πάθεια H (συχνότερη) Σε μυελοδυσπλαστικά σύνδρομα και άλλα αιματολογικά νεοπλάσματα ATR (Alpha Thalassemia mental Retardation) θαλασσαιμικός φαινότυπος, δυσμορφίες και διανοητική καθυστέρηση Σύνδρομο ATR-16 μεγάλες ελλείψεις τμημάτων άλλων γονιδίων στο χρωμόσωμα γνωστές ελλείψεις Σύνδρομο ATR-X διαταραχή στο χρωμόσωμα Χ (πιθανόν ΧΗ2 Locus) που κωδικοποιεί μια DNA ελικάση η οποία επηρεάζει την έκφραση των α-γονιδίων.

7 ΓΕΝΕΤΙΚΗ Διαταραχή στη σύνθεση αιμοσφαιρινικών αλυσίδων Γονιδιακές μεταλλάξεις = αλλαγές στην αλληλουχία των βάσεων μέσα ή έξω από το γονίδιο νέος γονότυπος - νέος φαινόπυτος Αντικαταστάσεις βάσεων (1 βάση σημειακή μετάλλαξη) Σημειακές μεταλλάξεις (HbS, HbC, HbE, HbCS) Ελλείψεις ενός ή περισσοτέρων γονιδίων (οι περισσότερες α-θαλασσαιμίες και η HPFH ελλειπτικού τύπου) Διπλασιασμοί ενός ή περισσοτέρων γονιδίων (ααα/αα) Παθολογικός επιχιασμός κατά τη μείωση που οδηγεί σε σύντηξη γονιδίων (HbLepore) Έλλειψη νουκλεοτιδίων χωρίς αλλαγή του πλαισίου ανάγνωσης (HbGun Hill) β -5 nt Προσθήκη νουκλεοτιδίων χωρίς αλλαγή του πλαισίου ανάγνωσης (HbKoriyama) β -5 nt Μεταλλάξεις που οδηγούν σε αλλαγή του πλαισίου ανάγνωσης (frameshift mutations) Μεταθέσεις χρωμοσωμάτων

8 Μεταλλάξεις έξω από τα γονίδια των αιμοσφαιρινικών αλυσίδων μπορεί να οδηγήσουν σε ανώμαλη σύνθεση αλυσίδων όπως π.χ. σε: Ορισμένες μορφές της δβο-θαλασσαιμίας (έλλειψη στην περιοχή LCR-Locus Control Region του β-γονιδίου) Ορισμένες μορφές της HPFH (μετάλλαξη στο χρωμόσωμα Χ και 6) Το σύνδρομο ATR-X (μετάλλαξη του πιθανολογούμενου γονιδίου XH2 στο χρωμόσωμα Χ)

9 Σημειακές μεταλλάξεις μπορεί να προκύψουν αν κωδικοποιείται το ίδιο αμινοξύ καμμιά συνέπεια (same sense mutation) αν κωδικοποιείται άλλο αμινοξύ νέος φαινότυπος (missense mutation) HbS, HbC, HbE αν δεν κωδικοποιείται κανένα αμινοξύ κωδίκιο περάτωσης -βραχύτερη αλυσίδα (non-sense mutation) HbMcKees Rocks αν ένα κωδίκιο περάτωσης μετατρέπεται σε κωδίκιο αμινοξέος - επιμηκυσμένη αλυσίδα (new sense mutation) HbConstant Spring, HbIcaria

10 ΚΛΙΝΙΚΗ ΕΙΚΟΝΑ Ασυμπτωματικές (β+- θαλασσαιμία, δβ- θαλασσαιμία, HPFH, ετερόζυγη δρεπανοκυτταρική, α+- θαλασσαιμία, α0- θαλασσαιμία, δ-θαλασσαιμία ) Με ήπια κλινική εικόνα (β0- θαλασσαιμία, α0-θαλασσαιμία) Με ενδιάμεσης βαρύτητας κλινική εικόνα - ευρεία διακύμανση - (β+- θαλασσαιμία/ β+- θαλασσαιμία, δβθαλασσαιμία/ δβ- θαλασσαιμία, Hb/πάθεια H) Με βαρειά κλινική εικόνα (μείζων β-θαλασσαιμία, ομόζυγη δρεπανοκυτταρική μετά τον 6ο μήνα, εμβρυϊκός ύδρωπας με HbBart s, κλινικά σοβαρή αιμοσφαιρινοπάθεια H)

11 Ετερόζυγη β-θαλασσαιμία Αναιμία σε κύηση ή σε υποτροπιάζουσες λοιμώξεις Σπάνια σπληνομεγαλία Ενδιάμεση β-θαλασσαιμία Μέτρια αναιμία χωρίς ανάγκη μετάγγισης Πιθανός υπερσπληνισμός Μακρά επιβίωση Μείζων β-θαλασσαιμία Από τον 3ο-6ο μήνα

12 Χρόνια αιμολυτική αναιμία Έντονη ωχρότητα με λεμονοειδή απόχρωση λόγω αναιμίας και ικτέρου - αξιόλογη ηπατοσπληνομεγαλία Υπερσπληνισμός (αναιμία, λευκοπενία, θρομβοπενία) Καθυστέρηση ανάπτυξης λόγω της χρόνιας ιστικής υποξίας Εναπόθεση σιδήρου σε ευαίσθητα όργανα (καρδιά, ήπαρ) Υπογοναδισμός, καθυστέρηση εφηβείας, υποθυρεοειδισμός, μυοκαρδιοπάθεια, σακχαρώδης διαβήτης Χολολιθίαση συχνά Αυξημένη ερυθροποίηση στο Μ.Ο - παραμόρφωση οστών προσώπου Οστικά άλγη

13 Ετερόζυγη δρεπανοκυτταρική ασυμπτωματική αιματουρία - υποσθενουρία λόγω νεφρικών εμφράκτων κάτω από συνθήκες υποξίας ή αφυδάτωσης Ομόζυγη δρεπανοκυτταρική αναιμία χολολιθίαση λοιμώξεις κρίσεις (οξεία απλαστική, κρίση εγκλωβισμού, αγγειοαποφρακτική ή επώδυνη) άσηπτη νέκρωση της κεφαλής του μηριαίου αμφιβληστροειδοπάθεια έλκη κνημών πριαπισμός αγγειακά εγκεφαλικά επεισόδια οξύ πνευμονικό σύνδρομο

14 ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΕΡΕΥΝΗΣΗ α) Δείγμα : περιφερικό αίμα Διερεύνηση αναιμίας Για διαγνωστικούς λόγους Διάγνωση φορέων Για την ελάττωση της συχνότητας της νόσου Γενική αίματος (RBC, Hb, MCV, MCH, RDW, ΔΕΚ, μορφολογία ερυθροκυττάρων) - Φυσιολογικοί ερυθροκυτταρικοί δείκτες δεν αποκλείουν την παρουσία αιμοσφαιρινοπάθειας Έλεγχος για σιδηροπενία (Σίδηρος και φερριτίνη ορού) Ανάλυση των αιμοσφαιρινικών κλασμάτων με Ηλεκτροφόρηση αιμοσφαιρίνης ή Υγρή χρωματογραφία υψηλής απόδοσης (HPLC) Ποσοτικός προσδιορισμός της HbA2, HbF Δοκιμασία διαλυτότητας και δοκιμασία δρεπάνωσης Ενδοερυθροκυτταρικά έγκλειστα (έγκλειστα α-αλυσίδων, έγκλειστα HbH, σωμάτια Heinz) διάγνωση στο μεγαλύτερο ποσοστό των εξεταζομένων

15 Ωσμωτική αντίσταση ερυθροκυττάρων Δοκιμασίες ασταθούς αιμοσφαιρίνης (θέρμανση, ισοπροπανόλη) Προσδιορισμός HbM (φασματοφωτομετρία) Προσδιορισμός Hb με αυξημένη ή μειωμένη συγγένεια με το οξυγόνο (καμπύλη κορεσμού της αιμοσφαιρίνης) Ηλεκτροφόρηση αλυσίδων Ισοηλεκτρική εστίαση (IEF- Iso-Electric Focusing) Ανοσολογικές μέθοδοι (μονοκλωνικά αντισώματα) Βιοσύνθεση αλυσίδων Γονιδιακή ανάλυση η εφαρμογή τους κατά περίπτωση είναι απαραίτητη για τη διαγνωστική προσπέλαση και των σπάνιων μορφών αιμοσφαιρινοπαθειών

16 β) Δείγμα : κύτταρα του εμβρύου Προγεννητική διάγνωση Για την αποφυγή απόκτησης παιδιού με κλινικά σοβαρή αιμοσφαιρινοπάθεια σε ζευγάρι που διατρέχει σημαντικό κίνδυνο DNA από κύτταρα του εμβρύου Τρόποι λήψης του δείγματος Βιοψία τροφοβλάστης (CVS-Chorionic Villous Sampling) 10η -11η εβδομάδα συχνότητα επιπλοκών <1,5% Λήψη εμβρυϊκών κυττάρων με αμνιοπαρακέντηση 15η - 20η εβδομάδα Λήψη εμβρυϊκών κυττάρων από εμβρυϊκό αίμα με ομφαλιδοπαρακέντηση 18η-20η εβδομάδα Προσπάθεια για ανίχνευση εμβρυϊκών ερυθροβλαστών στο περιφερικό αίμα της εγκύου με κυτταρομετρία ροής Προεμφυτευτική γενετική διάγνωση ανάλυση του βλαστομεριδίου πριν από την εμφύτευση η γενετική καθοδήγηση πρέπει να γίνεται πρόσωπο με πρόσωπο και σε καμιά περίπτωση με τη μορφή γραπτής οδηγίας

17 Συνδυασμός εργαστηριακών ευρημάτων, κλινικών πληροφοριών και ιστορικού Γονιδιακή ανάλυση PCR (Polymerase Chain Reaction) Πολλαπλασιασμός / ενίσχυση (amplification) του γονιδίου που ερευνάται Διερεύνηση του PCR προϊόντος με : Probes (ανιχνευτές) και σταθερό υβριδισμό με σεσημασμένα ολιγονουκλεοτίδια συμπληρωματικά για τη φυσιολογική και την παθολογική αλληλουχία (dot blot hybridization) Περιοριστικά ένζυμα αναγνωρίζουν στο PCR προϊόν με συγκεκριμένη σημειακή μετάλλαξη Gap PCR παραλλαγή της PCR με δυνατότητα ανίχνευσης κενού στην αλληλουχία ARMS (Amplification Refractory Mutation System) παραλλαγή της PCR με δυνατότητα αξιολόγησης του αποτελέσματος αμέσως μετά την αντίδραση χωρίς την ανάγκη υβριδισμού set εκκινητών (primers) για φυσιολογική και παθολογική αλληλουχία DGGE (Denaturing Gradient Gel Electrophoresis) Ηλεκτροφόρηση του PCR προϊόντος σε αποδιατακτική γέλη ακρυλαμίδης με κλίση πυκνότητας όταν η σημειακή μετάλλαξη είναι άγνωστη DNA sequencing μελέτη της νουκλεοτιδικής αλληλουχίας

18 ΘΕΡΑΠΕΙΑ Ετερόζυγη β-θαλασσαιμία Χωρίς θεραπεία Χορήγηση καθημερινά 0,5mg φυλλικού οξέος Μείζων θαλασσαιμία Μετάγγιση - αποσιδήρωση Δρεπανοκυτταρική νόσος α) Προληπτική αντιμετώπηση Πενικιλλίνη, φυλλικό, εμβολιασμός Αποφυγή ψύχους, σωματικής κόπωσης, έκθεσης σε λοιμώξεις, λήψης οινοπνεύματος β) Αντιμετώπηση των επιπλοκών (δρεπανοκυτταρική κρίση, πριαπισμός, οξύ πνευμονικό οίδημα, εγκεφαλικό επεισόδιο) Παυσίπονα, ενυδάτωση, μετάγγιση γ) Αντιμετώπηση της νόσου υδροξυουρία Μικροδρεπανοκυτταρική νόσος Θεραπεία ανάλογη με αυτή της ομόζυγης δρεπανοκυτταρικής

19 Μεταμόσχευση αρχέγονων αιμοποιητικών κυττάρων Καταστολή των κυττάρων του μυελού των οστών και αντικατάστασή του με αρχέγονα αιμοποιητικά κύτταρα από συμβατό υγιή δότη BMT (Bone Marrow Transplantation) από μυελό των οστών SCT (Stem Cell Transplantation) από περιφερικό αίμα ή αίμα ομφαλίου λώρου Γονιδιακή θεραπεία Θεραπευτική διόρθωση β-θαλασσαιμίας και δρεπανοκυτταρικής αναιμίας Συλλογή και έγχυση αρχέγονων αιμοποιητικών κυττάρων από τον ίδιο τον ασθενή αφού προηγηθεί εισαγωγή διορθωμένου γονιδίου με τη βοήθεια ιϊκών φορέων

20 Η πρώτη επιτυχής γονιδιακή θεραπεία Έγινε σε άνδρα 18 ετών - σήμερα είναι 21 ετών Δημοσιεύθηκε στο περιοδικό Nature τον Σεπτέμβριο του 2010 και μετά από ένα μήνα η εφημερίδα «το Βήμα της Κυριακής» δημοσίευσε σχετικό άρθρο βο/βε γονείς από Ταϋλάνδη και Βιετνάμ διαμονή στη Γαλλία δεν υπήρχε συμβατός δότης για μεταμόσχευση μυελού Φιλίπ Λεμπούλς καθηγητής στο Εθνικό Ινστιτούτο Υγείας και Ιατρικής Έρευνας και επισκέπτης καθηγητής στο Πανεπιστήμιο του Χάρβαντ 30 χρόνια έρευνα για τη γονιδιακή θεραπεία Τα πρώτα χρόνια παρατηρήθηκαν σοβαρές παρενέργειες και θάνατος ασθενούς λόγω έντονης ανοσολογικής αντίδρασης στον αδενοϊό-φορέα του γονιδίου Πριν 10 χρόνια ο ίδιος και η ομάδα του εφάρμοσαν επιτυχημένη γονιδιακή θεραπεία σε ποντίκια με δρεπανοκυτταρική αναιμία Η προσπάθεια εστιάστηκε στην επιλογή κατάλληλου ιού-φορέα και τελευταία χρησιμοποιείται ο ιός HIV σε αδρανοποιημένη μορφή επειδή μπορεί να μεταφέρει μεγάλα τμήματα DNA

21 ΔΙΑΔΙΚΑΣΙΑ Το φυσιολογικό γονίδιο της β-σφαιρίνης τροποποιείται ελαφρά (1 αμινοξύ του) για να υπάρχει εικόνα της έκφρασής του Λσμβάνεται Μ.Ο και απομονώνονται σε τρυβλίο κύτταρα (CD34+, ο πληθυσμός τους περιέχει πολυδύναμα αιμοποιητικά βλαστικά κύτταρα από τα οποία προέρχονται τα κύτταρα του αίματος) Μεταφέρεται το υγιές γονίδιο στα αιμοποιητικά κύτταρα του ασθενούς στο τρυβλίο (καλλιέργεια) με όχημα μεταφοράς αδρανοποιημένη μορφή του ιού HIV. Τα κύτταρα στη συνέχεια καταψύχονται Υποβολή του ασθενούς σε χημειοθεραπεία για να απαλλαγεί ο οργανισμός του από τα «ελαττωματικά» κύτταρα πριν τη μεταμόσχευση Απόψυξη των κυττάρων και έγχυσή τους στην κυκλοφορία του αίματος Τα θέματα που προκύπτουν είναι Τα δεδομένα αφορούν ένα μόνο ασθενή Είναι αρκετά τα 3 χρόνια για να αποκλεισθεί ενδεχόμενο παρενεργειών? Στόχος είναι να γίνει γονιδιακή θεραπεία σε συνολικά 10 άτομα με θαλασσαιμία και δρεπανοκυτταρική αναιμία

Νικολακοπούλου Κωνσταντίνα Κάτσα Ελένη-Μαρία Δάσκου Μαρία. β-θαλασσαιμία

Νικολακοπούλου Κωνσταντίνα Κάτσα Ελένη-Μαρία Δάσκου Μαρία. β-θαλασσαιμία Νικολακοπούλου Κωνσταντίνα Κάτσα Ελένη-Μαρία Δάσκου Μαρία β-θαλασσαιμία Θάλασσα + αίμα = θαλασσαιμία Εισαγωγή Η πιο κοινή γενετική νόσος που κληρονομείται Mενδελικά ~ 1 : 100.000 παγκοσμίως ~ 1 : 10.000

Διαβάστε περισσότερα


ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΑΓΝΩΣΗ ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΑΓΝΩΣΗ ΔΩΡΙΖΑ ΖΑΜΠΕΤΑ Επιμελήτρια Β Αιματολογικού Εργαστηρίου Γ.Ν.Α. «Ο ΕΥΑΓΓΕΛΙΣΜΟΣ» Οι αιμοσφαιρινοπάθειες αποτελούν τις πιο κοινές μονογονιδιακές ασθένειες παγκοσμίως.

Διαβάστε περισσότερα


ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» Η κυκλοφορία του αίματος και

Διαβάστε περισσότερα

αμινοξύ. Η αλλαγή αυτή έχει ελάχιστη επίδραση στη στερεοδιάταξη και τη λειτουργικότητα της πρωτεϊνης. Επιβλαβής

αμινοξύ. Η αλλαγή αυτή έχει ελάχιστη επίδραση στη στερεοδιάταξη και τη λειτουργικότητα της πρωτεϊνης. Επιβλαβής Κεφάλαιο 6: ΜΕΤΑΛΛΑΞΕΙΣ -ΘΕΩΡΙΑ- Μεταλλάξεις είναι οι αλλαγές που συμβαίνουν στο γενετικό υλικό ενός οργανισμού, τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις) όσο και σε χρωμοσωμικό επίπεδο (χρωμοσωμικές

Διαβάστε περισσότερα


ΜΕΣΟΓΕΙΑΚΗ ΑΝΑΙΜΙΑ (ΘΑΛΑΣΣΑΙΜΙΑ) ΜΕΣΟΓΕΙΑΚΗ ΑΝΑΙΜΙΑ (ΘΑΛΑΣΣΑΙΜΙΑ) Αλεξάνδρα Κουράκλη-Συμεωνίδου Απαρτιωμένη διδασκαλία Φεβρουάριος-Μάρτιος 2015 ΜΕΣΟΓΕΙΑΚΗ ΑΝΑΙΜΙΑ (Θαλασσαιμία) Πρόκειται για μία ετερογενή ομάδα κληρονομικών αναιμιών (αυτοσωματικών-υπολοιπόμενων)

Διαβάστε περισσότερα

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας»

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Εργαστήριο Κυτταρογενετικής ΕΚΕΦΕ «Δημόκριτος» «β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Ζαχάκη Σοφία - Ουρανία Βιολόγος, MSc, PhD β μεσογειακή αναιμία Η θαλασσαιμία ή νόσος

Διαβάστε περισσότερα

Κεφάλαιο 6: Μεταλλάξεις

Κεφάλαιο 6: Μεταλλάξεις Κεφάλαιο 6: Μεταλλάξεις ΕΛΕΓΧΟΣ ΓΝΩΣΕΩΝ 1. Τι ονομάζονται μεταλλάξεις και ποια τα κυριότερα είδη τους; 2. Ποιες οι διαφορές μεταξύ γονιδιακών και χρωμοσωμικών μεταλλάξεων; 3. Οι μεταλλάξεις στα σωματικά

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία των νουκλεοτιδίων που συμβαίνουν στο γενετικό υλικό ενός οργανισμού τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις)

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΚΤΟ ΚΕΦΑΛΑΙΟ ΜΕΤΑΛΛΑΞΕΙΣ ΕΚΤΟ ΚΕΦΑΛΑΙΟ ΜΕΤΑΛΛΑΞΕΙΣ ΜΕΤΑΛΛΑΞΕΙΣ Γίνονται μόνο στο γενετικό υλικό των κυττάρων, δηλαδή στο DNA και έχουν μόνιμο χαρακτήρα. Δεν θεωρούνται μεταλλάξεις, μεταβολές των προϊόντων της έκφρασης του γενετικού

Διαβάστε περισσότερα

Μαθαίνω για τη Δρεπανοκυτταρική Αναιμία- Αιμοσφαιρίνη S (HbS)

Μαθαίνω για τη Δρεπανοκυτταρική Αναιμία- Αιμοσφαιρίνη S (HbS) κυτταρική Μαθαίνω για τη Δρεπανοκυτταρική Αναιμία- Αιμοσφαιρίνη S (HbS) ΚΥΠΡΙΑΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΙΕΘΝΗΣ ΟΜΟΣΠΟΝ ΙΑ ΘΑΛΑΣΣΑΙΜΙΑΣ Γ.Τ.Π. 138/2013-5.000 Εκδόθηκε από το Γραφείο Τύπου και Πληροφοριών

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. H β- θαλασσαιμία είναι

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» Αιμοσφαιρινοπάθειες Οι αιμοσφαιρινοπάθειες,

Διαβάστε περισσότερα

Β' Προπαιδευτική Παθολογική Κλινική

Β' Προπαιδευτική Παθολογική Κλινική Β' Προπαιδευτική Παθολογική Κλινική Παρουσίαση Αιματολογικών Περιστατικών Κολλάρη Εριέτα Ειδικευόμενη Παθολογίας Αιτία Εισαγωγής Γυναίκα 31 ετών με ομόζυγη δρεπανοκυτταρική αναιμία προσήλθε στην εφημερία

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα


ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Μπορούν τα γονίδια που ελέγχουν τη σύνθεση της α-αλυσίδας της αιμοσφαιρίνης να χαρακτηριστούν ως πολλαπλά αλληλόμορφα; Τα γονίδια που ελέγχουν την α-αλυσίδα της αιμοσφαιρίνης

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα γονίδια Ι Α και i που καθορίζουν τις ομάδες αίματος: Α. είναι ατελώς επικρατή Β. είναι συνεπικρατή

Διαβάστε περισσότερα

ΚΒφόίΙοιο 6 ΜειαΠΠά^εις

ΚΒφόίΙοιο 6 ΜειαΠΠά^εις ΚΒφόίΙοιο 6 ΜειαΠΠά^εις 1. Ενας γενετιστής βρήκε ότι μια μετάλλαξη σε ένα γονίδιο δεν είχε επίδραση στην πολυπεπτιδική αλυσίδα που κωδικοποιείται από αυτό. Σε τι μπορεί να οφείλεται η συγκεκριμένη μετάλλαξη;

Διαβάστε περισσότερα

Νεογνικές και παιδιατρικές μεταγγίσεις. Ελισάβετ Γεωργίου Αιματολόγος, Επίμ. Β Αιματολογικό Τμήμα Γ. Ν. Παπαγεωργίου

Νεογνικές και παιδιατρικές μεταγγίσεις. Ελισάβετ Γεωργίου Αιματολόγος, Επίμ. Β Αιματολογικό Τμήμα Γ. Ν. Παπαγεωργίου Νεογνικές και παιδιατρικές μεταγγίσεις Ελισάβετ Γεωργίου Αιματολόγος, Επίμ. Β Αιματολογικό Τμήμα Γ. Ν. Παπαγεωργίου Μεταγγίσεις σε νεογνά και παιδιά Μεταγγίσεις στον νεογνικό πληθυσμό Μεταγγίσεις στον

Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. 1. β 2. β 3. γ 4. β Β. Ζύμωση: Διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες Υβριδοποίηση:

Διαβάστε περισσότερα


ΜΕΣΟΓΕΙΑΚΗ ΑΝΑΙΜΙΑ ΠΡΟΛΟΓΟΣ ΠΡΟΕΛΕΥΣΗ-ΠΑΡΟΥΣΙΑ ΣΗΜΕΡΑ ΠΡΟΛΟΓΟΣ ΜΕΣΟΓΕΙΑΚΗ ΑΝΑΙΜΙΑ Η μεσογειακή αναιμία ή θαλασσαιμία είναι κληρονομική αυτοσωμική υπολειπόμενη νόσος η οποία εντοπίζεται κυρίως στην περιοχή της Μεσογείου Θάλασσας. Στη Μεσογειακή αναιμία η γονιδιακή

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό Θέμα 1 ο 1. α 2. γ 3. γ 4.β 5. δ Θέμα 2 ο Α. Οι νόμοι του Mendel δεν ισχύουν σε πολυγονιδιακούς χαρακτήρες και σε συνδεδεμένα γονίδια (μη ανεξάρτητα), ενώ οι αναλογίες δεν είναι οι αναμενόμενες σε φυλοσύνδετα

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

Θαλασσαιμικά σύνδρομα: Γονίδια αλύσων, Δομή αιμοσφαιρίνης, Μεταλλάξεις. Θεραπεία

Θαλασσαιμικά σύνδρομα: Γονίδια αλύσων, Δομή αιμοσφαιρίνης, Μεταλλάξεις. Θεραπεία Θαλασσαιμικά σύνδρομα: Γονίδια αλύσων, Δομή αιμοσφαιρίνης, Μεταλλάξεις Θεραπεία Α.Αθανασιάδου 21.2.2012 Εκπαιδευτικοί Στόχοι: Να γνωρίζετε 1.ποιά γονίδια κωδικοποιούν τις αιμοσφαιρινικές αλύσους ( γενετικοί

Διαβάστε περισσότερα

«Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» Εργασία στο μάθημα της Βιολογίας ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ

«Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» Εργασία στο μάθημα της Βιολογίας ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ «Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» Εργασία στο μάθημα της Βιολογίας ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ Μια εργασία των: Μακρυδάκη Ελευθερία Μπούρλα Ελένη Τμήμα: Γ 3 Ημερομηνία: 27/1/2015 Γενικά με

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


Τρίτη, 30 Μαΐου 2006 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 30 Μαΐου 2006 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

Αλλογενής Μεταµόσχευση Αρχέγονων Αιµοποιητικών Κυττάρων:βασικές αρχές, ενδείξεις και διαδικασία. Επιλεγόµενο Μάθηµα Αιµατολογίας

Αλλογενής Μεταµόσχευση Αρχέγονων Αιµοποιητικών Κυττάρων:βασικές αρχές, ενδείξεις και διαδικασία. Επιλεγόµενο Μάθηµα Αιµατολογίας Αλλογενής Μεταµόσχευση Αρχέγονων Αιµοποιητικών Κυττάρων:βασικές αρχές, ενδείξεις και διαδικασία Επιλεγόµενο Μάθηµα Αιµατολογίας Βασικές αρχές Η µεταµόσχευση αρχέγονων αιµοποιητικών κυττάρων αποτελεί σηµαντική

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

Κεφάλαιο 15 (Ιατρική Γενετική) Προγεννητική διάγνωση

Κεφάλαιο 15 (Ιατρική Γενετική) Προγεννητική διάγνωση Κεφάλαιο 15 (Ιατρική Γενετική) Προγεννητική διάγνωση Η προγεννητική διάγνωση Ενδείξεις: -Προχωρημένη ηλικία μητέρας (πιο συχνό: σύνδρομο Down) -Προγενέστερο παιδί με de novo χρωμοσωμική ανωμαλία -Ύπαρξη

Διαβάστε περισσότερα

Σύνοψη της προσέγγισης ασθενούς με πανκυτταροπενία. Ιατρικό Τμήμα Πανεπιστημίου Πατρών Απαρτιωμένη διδασκαλία στην Αιματολογία Αργύρης Συμεωνίδης

Σύνοψη της προσέγγισης ασθενούς με πανκυτταροπενία. Ιατρικό Τμήμα Πανεπιστημίου Πατρών Απαρτιωμένη διδασκαλία στην Αιματολογία Αργύρης Συμεωνίδης Σύνοψη της προσέγγισης ασθενούς με πανκυτταροπενία Ιατρικό Τμήμα Πανεπιστημίου Πατρών Απαρτιωμένη διδασκαλία στην Αιματολογία Αργύρης Συμεωνίδης Αρχική κλινική προσέγγιση Συμπτωματικός ή μη συμπτωματικός

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ // Γ γ ΙΑΤΡ λυκείου Γ ΘΕΤ2 ΗΜΕΡΟΜΗΝΙΑ: 29/12/ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ // Γ γ ΙΑΤΡ λυκείου Γ ΘΕΤ2 ΗΜΕΡΟΜΗΝΙΑ: 29/12/2015 29 12 2016 ΘΕΜΑ 1 ο Επιλέξτε τη σωστή απάντηση που συμπληρώνει τις παρακάτω προτάσεις: 1. Η περιοριστική

Διαβάστε περισσότερα

Οξεία μυελογενής λευχαιμία

Οξεία μυελογενής λευχαιμία Οξεία μυελογενής λευχαιμία Γενικά στοιχεία Ταξινόμηση και τύποι Ενδείξεις και συμπτώματα Αίτια πρόκλησης Διάγνωση Παρουσίαση και επαναστόχευση από Βικιπαίδεια Οξεία μυελογενής λευχαιμία : Ζήσου Ιωάννης

Διαβάστε περισσότερα

αιμοσφαιρίνη και αιμοσφαιρινοπάθεις Οκτώβριος 2014 Κ. Κωνσταντόπουλος

αιμοσφαιρίνη και αιμοσφαιρινοπάθεις Οκτώβριος 2014 Κ. Κωνσταντόπουλος αιμοσφαιρίνη και αιμοσφαιρινοπάθεις Οκτώβριος 2014 Κ. Κωνσταντόπουλος αιμοσφαιρίνη Καμμία πρωτεϊνη του ανθρώπου δεν έχει μελετηθεί περισσότερο από την αιμοσφαιρίνη Ιδεώδες «εργαλείο» γενετικών μελετών

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα γονίδια Ι Α και i που καθορίζουν τις ομάδες αίματος:

Διαβάστε περισσότερα

Νεογνικές και παιδιατρικές μεταγγίσεις

Νεογνικές και παιδιατρικές μεταγγίσεις Νεογνικές και παιδιατρικές μεταγγίσεις Ελισάβετ Γεωργίου Αιματολόγος Αιματολογικό Τμήμα Γ. Ν. Παπαγεωργίου Ακαδημία Αιμοδοσίας, Ιούνιος 2014 Μεταγγίσεις σε νεογνά και παιδιά Μεταγγίσεις στον νεογνικό πληθυσμό

Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα

Προγεννητικός Μοριακός Καρυότυπος. Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά

Προγεννητικός Μοριακός Καρυότυπος. Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά Προγεννητικός Μοριακός Καρυότυπος Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά Η νέα εποχή στον Προγεννητικό Έλεγχο: Μοριακός Καρυότυπος - array CGH - Συγκριτικός γενωμικός υβριδισμός με μικροσυστοιχίες

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 Ονοματεπώνυμο εξεταζόμενου:. ΘΕΜΑ 1 Ο Να απαντήσετε στις ερωτήσεις πολλαπλής επιλογής: 1. Η ανευπλοειδία είναι είδος μετάλλαξης που οφείλεται:

Διαβάστε περισσότερα

Προβλήματα σχετιζόμενα με την τυποποίηση αντιγόνων Ι

Προβλήματα σχετιζόμενα με την τυποποίηση αντιγόνων Ι Β Προβλήματα Φαινότυπος Β(Α): ασθενής αντίδραση με αντι-α, έντονη αντίδραση με αντι-β, και ο ορός αντιδρά με ερυθρά Α₁. Ο αντιορός Α περιέχει τον κλώνο ΜΗΟ4? Επίκτητος Β φαινότυπος: έντονη αντίδραση με

Διαβάστε περισσότερα

Αιμολυτικές Αναιμίες- Κληρονομικές και Επίκτητες. Ελενα Σολωμού Επικ. Καθηγήτρια Παθολογίας-Αιματολογίας Ιατρική Σχολή Πανεπ.

Αιμολυτικές Αναιμίες- Κληρονομικές και Επίκτητες. Ελενα Σολωμού Επικ. Καθηγήτρια Παθολογίας-Αιματολογίας Ιατρική Σχολή Πανεπ. Αιμολυτικές Αναιμίες- Κληρονομικές και Επίκτητες Ελενα Σολωμού Επικ. Καθηγήτρια Παθολογίας-Αιματολογίας Ιατρική Σχολή Πανεπ. Πατρών Aίτια Αιμόλυσης Εξωαγγειακή Αιμόλυση Ενδογενή Αίτια: Διαταραχές

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

ΣΥΝΟΨΗ ΠΕΡΙ ΤΗΣ ΑΝΑΙΜΙΑΣ. Αργύρης Σ. Συμεωνίδης Αναπλ. Καθηγητής Αιματολογίας Πανεπιστημίου Πατρών

ΣΥΝΟΨΗ ΠΕΡΙ ΤΗΣ ΑΝΑΙΜΙΑΣ. Αργύρης Σ. Συμεωνίδης Αναπλ. Καθηγητής Αιματολογίας Πανεπιστημίου Πατρών ΣΥΝΟΨΗ ΠΕΡΙ ΤΗΣ ΑΝΑΙΜΙΑΣ Αργύρης Σ. Συμεωνίδης Αναπλ. Καθηγητής Αιματολογίας Πανεπιστημίου Πατρών Βασικό γνωσιολογικό υπόστρωμα Το αίμα αποτελείται από: ερυθρά και λευκά αιμοσφαίρια, αιμοπετάλια και πλάσμα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΠΑΡΟΞΥΣΜΙΚΗ ΝΥΚΤΕΡΙΝΗ ΑΙΜΟΣΦΑΙΡΙΝΟΥΡΙΑ (PNH) Αχιλλέας Θ. Καραμούτσιος Μονάδα Μοριακής Βιολογίας, Αιματολογικό Εργαστήριο ΠΓΝ Ιωαννίνων

ΠΑΡΟΞΥΣΜΙΚΗ ΝΥΚΤΕΡΙΝΗ ΑΙΜΟΣΦΑΙΡΙΝΟΥΡΙΑ (PNH) Αχιλλέας Θ. Καραμούτσιος Μονάδα Μοριακής Βιολογίας, Αιματολογικό Εργαστήριο ΠΓΝ Ιωαννίνων ΠΑΡΟΞΥΣΜΙΚΗ ΝΥΚΤΕΡΙΝΗ ΑΙΜΟΣΦΑΙΡΙΝΟΥΡΙΑ (PNH) Αχιλλέας Θ. Καραμούτσιος Μονάδα Μοριακής Βιολογίας, Αιματολογικό Εργαστήριο ΠΓΝ Ιωαννίνων Ιωάννινα, Σεπτέμβριος 2013 PNH Σπάνια διαταραχή του αρχέγονου αιμοποιητικού

Διαβάστε περισσότερα


ΠΑΝΕΛΛΗΝΙΟ ΕΠΙΣΤΗΜΟΝΙΚΟ ΣΥΝΕΔΡΙΟ ΣΥΝΔΕΣΜΟΥ ΥΓΕΙΟΝΟΜΙΚΩΝ ΤΕΧΝΟΛΟΓΩΝ ΠΑΡΑΣΚΕΥΑΣΤΩΝ ΕΛΛΑΔΟΣ. Πέμπτη 7 Απριλίου 2016 Ώρες Συνεδρίου: 13:00 20:00 Πέμπτη 7 Απριλίου 2016 Ώρες Συνεδρίου: 13:00 20:00 13:00-15:00 ΕΓΓΡΑΦΕΣ 15:00-15:30 Χαιρετισμοί Προέδρου ΔΣ Συνδέσμου Υγειονομικών Χαιρετισμοί Επίσημων Προσκεκλημένων Χαιρετισμοί Εκπροσώπων Επιστημονικών

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ 1-2-4-5-6 ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό αν η πρόταση είναι σωστή,

Διαβάστε περισσότερα

Απλαστική κρίση από λοίμωξη Parvovirus B19 ως πρώτη κλινική εκδήλωση σε κορίτσι με ενδιάμεση Μεσογειακή Αναιμία

Απλαστική κρίση από λοίμωξη Parvovirus B19 ως πρώτη κλινική εκδήλωση σε κορίτσι με ενδιάμεση Μεσογειακή Αναιμία ΠΑΡΟΥΣΙΑΣΕΙΣ ΠΑΙΔΙΑΤΡΙΚΩΝ ΠΕΡΙΠΤΩΣΕΩΝ 12 Απλαστική κρίση από λοίμωξη Parvovirus B19 ως πρώτη κλινική εκδήλωση σε κορίτσι με ενδιάμεση Μεσογειακή Αναιμία Χατζηδημητρίου Βενιζέλος Οικονόμου Μαρίνα Εισαγωγή

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα

www.printo.it/pediatric-rheumatology/gr/intro Majeed Έκδοση από 2016 1. ΤΙ ΕΙΝΑΙ ΤΟ MAJEED 1.1 Τι είναι; Το σύνδρομο Majeed είναι ένα σπάνιο γενετικό νόσημα. Τα προσβεβλημένα παιδιά πάσχουν από χρόνια

Διαβάστε περισσότερα


25. RHESUS (Rh) ANOΣΟΠΟΙΗΣΗ Η Rh ανοσοποίηση οφείλεται σε εμβρυο-μητρική μετάγγιση (ΕΜΜ), όπου ποσότητα Rh θετικού εμβρυϊκού αίματος εισέρχεται στη μητρική κυκλοφορία Rh αρνητικής εγκύου και δημιουργούνται αντισώματα κατά του παράγοντα

Διαβάστε περισσότερα

Κριτήριο αξιολόγησης-βιολογία Κατεύθυνσης

Κριτήριο αξιολόγησης-βιολογία Κατεύθυνσης ΘΕΜΑ Α. Στις παρακάτω προτάσεις από Α1 έως και Α5 να σημειώσετε το γράμμα που αντιστοιχεί στη σωστή απάντηση. Α1. Όταν ένας σύνθετος φάγος που έχει το πρωτεϊνικό κάλυμμα του φάγου Τ 2 και το DNA του φάγου

Διαβάστε περισσότερα

«Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα»

«Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» «Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» «Τι είναι Μετάλλαξη» Γενικά με τον όρο μετάλλαξη ονομάζουμε τις αλλαγές στο γενετικό υλικό, το DNA δηλαδή ενός ζωντανού οργανισμού και πρόκειται

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ 1. Η μεταφορά ανθρώπινου γονιδίου σε βακτήριο δίνει διαφορετικό προϊόν μεταγραφής και μετάφρασης, ενώ σε μύκητες μεταγράφεται κανονικά αλλά το προϊόν μετάφρασης εμφανίζει

Διαβάστε περισσότερα

ΕΞΕΤΑΣΤΕΑ ΥΛΗ Γενετική, σελ. 339 369 (εκτός ύλης: 16.7 Χιασματυπία ή διασκελισμός, σελ. 365-368)

ΕΞΕΤΑΣΤΕΑ ΥΛΗ Γενετική, σελ. 339 369 (εκτός ύλης: 16.7 Χιασματυπία ή διασκελισμός, σελ. 365-368) ΓΕΝΕΤΙΚΗ: Από τον Gregor Mendel. στους Watson and Crick. Γενετική είναι ο κλάδος της βιολογίας που μελετά επιστημονικά τους κληρονομικούς χαρακτήρες. Χαρακτηριστικά που δεν κληρονομούνται αλλά αναπτύσσονται

Διαβάστε περισσότερα

Λέξεις κλειδιά στη γενετική

Λέξεις κλειδιά στη γενετική ΓΕΝΕΤΙΚΗ: Από τον Gregor Mendel. στους Watson and Crick. Γενετική είναι ο κλάδος της βιολογίας που μελετά επιστημονικά τους κληρονομικούς χαρακτήρες. Χαρακτηριστικά που δεν κληρονομούνται αλλά αναπτύσσονται

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 6 ΚΕΦΑΛΑΙΟ 6 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ B B1. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β- θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής

Διαβάστε περισσότερα

Υποστηρίζοντας τα παιδιά με γενετικά νοσήματα - Ο Δρόμος για την Θεραπεία Πέμπτη, 16 Ιούνιος :58

Υποστηρίζοντας τα παιδιά με γενετικά νοσήματα - Ο Δρόμος για την Θεραπεία Πέμπτη, 16 Ιούνιος :58 Από: K-Life (Καθημερινή) Τα γενετικά νοσήματα είναι ιδιαίτερα σπάνιες ασθένειες που οφείλονται σε μεταλλάξεις γονιδίων. Τα παιδιά που πάσχουν από αυτά χρειάζονται φροντίδα, ψυχολογική στήριξη αλλά και

Διαβάστε περισσότερα


Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

έμμορφα στοιχεία του αίματος Κλινική σημασία

έμμορφα στοιχεία του αίματος Κλινική σημασία Είναι η πιο κοινή εργαστηριακή εξέταση στην κλινική πράξη και παρέχει πληροφορίες για τα έμμορφα στοιχεία του αίματος (αριθμός, όγκος, πυκνότητα κ.α.) Κλινική σημασία Προληπτικός έλεγχος Διάγνωση νοσημάτων

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι λανθασμένη.

Διαβάστε περισσότερα


ΑΝΑΙΜΙΕΣ. Αθ. ΖΩΜΑΣ Δ ΠΑΝ.ΠΑΘ.ΚΛΙΝΙΚΗ ΑΝΑΙΜΙΕΣ Αθ. ΖΩΜΑΣ Δ ΠΑΝ.ΠΑΘ.ΚΛΙΝΙΚΗ Ορισμός Aναιμίας Αναιμία είναι η κατάσταση κατά την οποία η τιμή της Αιμοσφαιρίνης (και ίσως των Ερυθρών αιμοσφαιρίων) βρίσκονται κατά μονάδα όγκου αίματος, κάτω από

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 8 ΚΕΦΑΛΑΙΟ 8 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Κληρονοµικά νοσήµατα και καταστάσεις που οφείλονται σε γονιδιακές µεταλλάξεις

Κληρονοµικά νοσήµατα και καταστάσεις που οφείλονται σε γονιδιακές µεταλλάξεις Κληρονοµικά νοσήµατα και καταστάσεις που οφείλονται σε γονιδιακές µεταλλάξεις ΤΡΟΠΟΣ ΚΛΗΡΟΝΟΜΗΣΗΣ ΤΩΝ ΚΥΡΙΟΤΕΡΩΝ ΚΛΗΡΟΝΟΜΙΚΩΝ ΝΟΣΩΝ ΑΥΤΟΣΩΜΙΚΗ ΕΠΙΚΡΑΤΗΣ ΑΥΤΟΣΩΜΙΚΗ ΥΠΟΛΕΙΠΟΜΕΝΗ ΦΥΛΟΣΥΝ ΕΤΗ ΥΠΟΛΕΙΠΟΜΕΝΗ

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 8 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα 3 ο 12 Θέμα

Διαβάστε περισσότερα

Παρουσίαση περιστατικού

Παρουσίαση περιστατικού Παρουσίαση περιστατικού 1 Τζήμου Μαρία, Ειδικευόμενη Παθολογίας Β Προπαιδευτική Παθολογική Κλινική Καθηγητής: Αστέριος Καραγιάννης Ιπποκράτειο Νοσοκομείο Θεσσαλονίκης Παρουσίαση περιστατικού 2 Ασθενής,

Διαβάστε περισσότερα

ΠΩΣ «ΔΙΑΒAΖΕΤΑΙ» Η ΓΕΝΙΚH AIΜΑΤΟΣ. Φυσιολογικές τιμές αιματολογικών παραμέτρων

ΠΩΣ «ΔΙΑΒAΖΕΤΑΙ» Η ΓΕΝΙΚH AIΜΑΤΟΣ. Φυσιολογικές τιμές αιματολογικών παραμέτρων ΠΩΣ «ΔΙΑΒAΖΕΤΑΙ» Η ΓΕΝΙΚH AIΜΑΤΟΣ Μ. Οικονόμου Εισαγωγή Η «γενική αίματος» αποτελεί τη συνηθέστερα χρησιμοποιούμενη εξέταση στην παιδιατρική κλινική πράξη. Ο προσδιορισμός των αιματολογικών παραμέτρων

Διαβάστε περισσότερα

Άσκηση Η-11: Δύσπνοια ταχυκαρδία οιδήματα κυάνωση. Δημήτρης Φαρμάκης Καρδιολόγος Α Παθολογική Κλινική ΕΚΠΑ

Άσκηση Η-11: Δύσπνοια ταχυκαρδία οιδήματα κυάνωση. Δημήτρης Φαρμάκης Καρδιολόγος Α Παθολογική Κλινική ΕΚΠΑ Άσκηση Η-11: Δύσπνοια ταχυκαρδία οιδήματα κυάνωση Δημήτρης Φαρμάκης Καρδιολόγος Α Παθολογική Κλινική ΕΚΠΑ Βασικά συμπτώματα καρδιαγγειακού Προκάρδιο άλγος Δύσπνοια Αίσθημα παλμών Συγκοπή Οίδημα Καταβολή,

Διαβάστε περισσότερα

Βλαστοκύτταρα κλειδί στη θεραπεία ασθενειών.

Βλαστοκύτταρα κλειδί στη θεραπεία ασθενειών. Βλαστοκύτταρα κλειδί στη θεραπεία ασθενειών. Η πρώτη και ασφαλής πηγή λήψης βλαστοκυττάρων στη ζωή του ανθρώπου είναι το ομφαλοπλακουντιακό αίμα το οποίο παραμένει στον πλακούντα μετά τη γέννηση. Το υπόλοιπο

Διαβάστε περισσότερα