ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ ΕΙΣΑΓΩΓΗ ΤΑΞΙΝΟΜΗΣΗ ΓΕΝΕΤΙΚΗ ΚΛΙΝΙΚΗ ΕΙΚΟΝΑ ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΕΡΕΥΝΗΣΗ ΘΕΡΑΠΕΙΑ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ ΕΙΣΑΓΩΓΗ ΤΑΞΙΝΟΜΗΣΗ ΓΕΝΕΤΙΚΗ ΚΛΙΝΙΚΗ ΕΙΚΟΝΑ ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΕΡΕΥΝΗΣΗ ΘΕΡΑΠΕΙΑ"

Transcript

1 ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ ΕΙΣΑΓΩΓΗ ΤΑΞΙΝΟΜΗΣΗ ΓΕΝΕΤΙΚΗ ΚΛΙΝΙΚΗ ΕΙΚΟΝΑ ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΕΡΕΥΝΗΣΗ ΘΕΡΑΠΕΙΑ ΖΩΗ ΡΕΠΑΠΙΝΟΥ - ΝΕΡΑΝΤΖΟΥΛΑΚΗ ΒΙΟΠΑΘΟΛΟΓΟΣ - ΔΙΕΥΘΥΝΤΡΙΑ ΥΠΕΥΘΥΝΗ ΤΜΗΜΑΤΟΣ ΑΙΜΟΛΥΤΙΚΟΥ ΕΛΕΓΧΟΥ - ΜΕΣΟΓΕΙΑΚΗΣ ΑΝΑΙΜΙΑΣ & ΜΟΡΙΑΚΟΥ ΕΛΕΓΧΟΥ ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΩΝ - ΠΗΞΗΣ ΑΙΜΑΤΟΛΟΓΙΚΟ ΕΡΓΑΣΤΗΡΙΟ ΠΑΝΕΠΙΣΤΗΜΙΑΚΟ ΝΟΣΟΚΟΜΕΙΟ ΗΡΑΚΛΕΙΟΥ

2 ΕΙΣΑΓΩΓΗ ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ Διαταραχές της αιμοσφαιρίνης Διαταραχές του μεταβολισμού της αίμης (πορφυρίες) Διαταραχές της σφαιρίνης δηλ των πολυπεπτιδικών αλυσίδων

3 ΤΑΞΙΝΟΜΗΣΗ 1) Με βάση την έκφραση της γονιδιακής διαταραχής Ποσοτικές Αιμοσφαιρινοπάθειες έλλειψη ή ελάττωση της παραγωγής μιας πολυπεπτιδικής αλυσίδας -Θαλασσαιμίες α-θαλασσαιμίες β- θαλασσαιμίες γ- θαλασσαιμίες δ- θαλασσαιμίες δβ- θαλασσαιμίες γδβ- θαλασσαιμίες Ποιοτικές Αιμοσφαιρινοπάθειες διαταραχή στη δομή της αιμοσφαιρίνης Δρεπανοκυτταρικά σύνδρομα HbS (β 6Glu Val) Θαλασσαιμικές Αιμοσφαιρινοπάθειες δημιουργία παθολογικής αιμοσφαιρίνης και ελαττωμένη σύνθεση αλυσίδων Hb Constant Spring (α2 142 Gln) HbE (β 26Glu Lys)

4 2) Με βάση τον τρόπο εκδήλωσης της διαταραχής Ασταθείς αιμοσφαιρίνες >100 1/3 de novo μεταλλάξεις Hb Setif (α2 94Asp Tyr) Hb Agrinio (α2 29 Le Pro) Hb Heraklion (α1cd36/37pro 0) Hb Ferrara (β 57Asn Lys) Hb Köln (β 98Val Met) Zürich (β 63His Arg) Αιμοσφαιρίνες που προκαλούν κυάνωση με χαμηλή δεσμευτική ικανότητα οξυγόνου (Hb Kansas β 102Asp Thr) με μετατροπή της αιμοσφαιρίνης σε μεθαιμοσφαιρίνη [Hbs Μ- Hb Boston (α2 58His Tyr), Hb Saskatoon (β 63His Tyr)] Αιμοσφαιρίνες που εκδηλώνονται με ερυθροκυττάρωση με αυξημένη δεσμευτική ικανότητα οξυγόνου >120 Hb San Diego (β 109Val Met) Hb Crete (β 129Ala Pro ) Hb Olympia (β 20Val Met)

5 3) Με βάση τον αριθμό και το είδος των γονιδίων που διαταράσσονται Ετερόζυγες (βο/β, α+/α, βs/β) Ομόζυγες (βο/βο, α+/α+) Διπλές ετεροζυγωτίες (μικροδρεπανοκυτταρική αναιμία - βs/βο, β+/βο,)

6 Κληρονομικές Επίκτητες Επίκτητη Hb/πάθεια H (συχνότερη) Σε μυελοδυσπλαστικά σύνδρομα και άλλα αιματολογικά νεοπλάσματα ATR (Alpha Thalassemia mental Retardation) θαλασσαιμικός φαινότυπος, δυσμορφίες και διανοητική καθυστέρηση Σύνδρομο ATR-16 μεγάλες ελλείψεις τμημάτων άλλων γονιδίων στο χρωμόσωμα γνωστές ελλείψεις Σύνδρομο ATR-X διαταραχή στο χρωμόσωμα Χ (πιθανόν ΧΗ2 Locus) που κωδικοποιεί μια DNA ελικάση η οποία επηρεάζει την έκφραση των α-γονιδίων.

7 ΓΕΝΕΤΙΚΗ Διαταραχή στη σύνθεση αιμοσφαιρινικών αλυσίδων Γονιδιακές μεταλλάξεις = αλλαγές στην αλληλουχία των βάσεων μέσα ή έξω από το γονίδιο νέος γονότυπος - νέος φαινόπυτος Αντικαταστάσεις βάσεων (1 βάση σημειακή μετάλλαξη) Σημειακές μεταλλάξεις (HbS, HbC, HbE, HbCS) Ελλείψεις ενός ή περισσοτέρων γονιδίων (οι περισσότερες α-θαλασσαιμίες και η HPFH ελλειπτικού τύπου) Διπλασιασμοί ενός ή περισσοτέρων γονιδίων (ααα/αα) Παθολογικός επιχιασμός κατά τη μείωση που οδηγεί σε σύντηξη γονιδίων (HbLepore) Έλλειψη νουκλεοτιδίων χωρίς αλλαγή του πλαισίου ανάγνωσης (HbGun Hill) β -5 nt Προσθήκη νουκλεοτιδίων χωρίς αλλαγή του πλαισίου ανάγνωσης (HbKoriyama) β -5 nt Μεταλλάξεις που οδηγούν σε αλλαγή του πλαισίου ανάγνωσης (frameshift mutations) Μεταθέσεις χρωμοσωμάτων

8 Μεταλλάξεις έξω από τα γονίδια των αιμοσφαιρινικών αλυσίδων μπορεί να οδηγήσουν σε ανώμαλη σύνθεση αλυσίδων όπως π.χ. σε: Ορισμένες μορφές της δβο-θαλασσαιμίας (έλλειψη στην περιοχή LCR-Locus Control Region του β-γονιδίου) Ορισμένες μορφές της HPFH (μετάλλαξη στο χρωμόσωμα Χ και 6) Το σύνδρομο ATR-X (μετάλλαξη του πιθανολογούμενου γονιδίου XH2 στο χρωμόσωμα Χ)

9 Σημειακές μεταλλάξεις μπορεί να προκύψουν αν κωδικοποιείται το ίδιο αμινοξύ καμμιά συνέπεια (same sense mutation) αν κωδικοποιείται άλλο αμινοξύ νέος φαινότυπος (missense mutation) HbS, HbC, HbE αν δεν κωδικοποιείται κανένα αμινοξύ κωδίκιο περάτωσης -βραχύτερη αλυσίδα (non-sense mutation) HbMcKees Rocks αν ένα κωδίκιο περάτωσης μετατρέπεται σε κωδίκιο αμινοξέος - επιμηκυσμένη αλυσίδα (new sense mutation) HbConstant Spring, HbIcaria

10 ΚΛΙΝΙΚΗ ΕΙΚΟΝΑ Ασυμπτωματικές (β+- θαλασσαιμία, δβ- θαλασσαιμία, HPFH, ετερόζυγη δρεπανοκυτταρική, α+- θαλασσαιμία, α0- θαλασσαιμία, δ-θαλασσαιμία ) Με ήπια κλινική εικόνα (β0- θαλασσαιμία, α0-θαλασσαιμία) Με ενδιάμεσης βαρύτητας κλινική εικόνα - ευρεία διακύμανση - (β+- θαλασσαιμία/ β+- θαλασσαιμία, δβθαλασσαιμία/ δβ- θαλασσαιμία, Hb/πάθεια H) Με βαρειά κλινική εικόνα (μείζων β-θαλασσαιμία, ομόζυγη δρεπανοκυτταρική μετά τον 6ο μήνα, εμβρυϊκός ύδρωπας με HbBart s, κλινικά σοβαρή αιμοσφαιρινοπάθεια H)

11 Ετερόζυγη β-θαλασσαιμία Αναιμία σε κύηση ή σε υποτροπιάζουσες λοιμώξεις Σπάνια σπληνομεγαλία Ενδιάμεση β-θαλασσαιμία Μέτρια αναιμία χωρίς ανάγκη μετάγγισης Πιθανός υπερσπληνισμός Μακρά επιβίωση Μείζων β-θαλασσαιμία Από τον 3ο-6ο μήνα

12 Χρόνια αιμολυτική αναιμία Έντονη ωχρότητα με λεμονοειδή απόχρωση λόγω αναιμίας και ικτέρου - αξιόλογη ηπατοσπληνομεγαλία Υπερσπληνισμός (αναιμία, λευκοπενία, θρομβοπενία) Καθυστέρηση ανάπτυξης λόγω της χρόνιας ιστικής υποξίας Εναπόθεση σιδήρου σε ευαίσθητα όργανα (καρδιά, ήπαρ) Υπογοναδισμός, καθυστέρηση εφηβείας, υποθυρεοειδισμός, μυοκαρδιοπάθεια, σακχαρώδης διαβήτης Χολολιθίαση συχνά Αυξημένη ερυθροποίηση στο Μ.Ο - παραμόρφωση οστών προσώπου Οστικά άλγη

13 Ετερόζυγη δρεπανοκυτταρική ασυμπτωματική αιματουρία - υποσθενουρία λόγω νεφρικών εμφράκτων κάτω από συνθήκες υποξίας ή αφυδάτωσης Ομόζυγη δρεπανοκυτταρική αναιμία χολολιθίαση λοιμώξεις κρίσεις (οξεία απλαστική, κρίση εγκλωβισμού, αγγειοαποφρακτική ή επώδυνη) άσηπτη νέκρωση της κεφαλής του μηριαίου αμφιβληστροειδοπάθεια έλκη κνημών πριαπισμός αγγειακά εγκεφαλικά επεισόδια οξύ πνευμονικό σύνδρομο

14 ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΕΡΕΥΝΗΣΗ α) Δείγμα : περιφερικό αίμα Διερεύνηση αναιμίας Για διαγνωστικούς λόγους Διάγνωση φορέων Για την ελάττωση της συχνότητας της νόσου Γενική αίματος (RBC, Hb, MCV, MCH, RDW, ΔΕΚ, μορφολογία ερυθροκυττάρων) - Φυσιολογικοί ερυθροκυτταρικοί δείκτες δεν αποκλείουν την παρουσία αιμοσφαιρινοπάθειας Έλεγχος για σιδηροπενία (Σίδηρος και φερριτίνη ορού) Ανάλυση των αιμοσφαιρινικών κλασμάτων με Ηλεκτροφόρηση αιμοσφαιρίνης ή Υγρή χρωματογραφία υψηλής απόδοσης (HPLC) Ποσοτικός προσδιορισμός της HbA2, HbF Δοκιμασία διαλυτότητας και δοκιμασία δρεπάνωσης Ενδοερυθροκυτταρικά έγκλειστα (έγκλειστα α-αλυσίδων, έγκλειστα HbH, σωμάτια Heinz) διάγνωση στο μεγαλύτερο ποσοστό των εξεταζομένων

15 Ωσμωτική αντίσταση ερυθροκυττάρων Δοκιμασίες ασταθούς αιμοσφαιρίνης (θέρμανση, ισοπροπανόλη) Προσδιορισμός HbM (φασματοφωτομετρία) Προσδιορισμός Hb με αυξημένη ή μειωμένη συγγένεια με το οξυγόνο (καμπύλη κορεσμού της αιμοσφαιρίνης) Ηλεκτροφόρηση αλυσίδων Ισοηλεκτρική εστίαση (IEF- Iso-Electric Focusing) Ανοσολογικές μέθοδοι (μονοκλωνικά αντισώματα) Βιοσύνθεση αλυσίδων Γονιδιακή ανάλυση η εφαρμογή τους κατά περίπτωση είναι απαραίτητη για τη διαγνωστική προσπέλαση και των σπάνιων μορφών αιμοσφαιρινοπαθειών

16 β) Δείγμα : κύτταρα του εμβρύου Προγεννητική διάγνωση Για την αποφυγή απόκτησης παιδιού με κλινικά σοβαρή αιμοσφαιρινοπάθεια σε ζευγάρι που διατρέχει σημαντικό κίνδυνο DNA από κύτταρα του εμβρύου Τρόποι λήψης του δείγματος Βιοψία τροφοβλάστης (CVS-Chorionic Villous Sampling) 10η -11η εβδομάδα συχνότητα επιπλοκών <1,5% Λήψη εμβρυϊκών κυττάρων με αμνιοπαρακέντηση 15η - 20η εβδομάδα Λήψη εμβρυϊκών κυττάρων από εμβρυϊκό αίμα με ομφαλιδοπαρακέντηση 18η-20η εβδομάδα Προσπάθεια για ανίχνευση εμβρυϊκών ερυθροβλαστών στο περιφερικό αίμα της εγκύου με κυτταρομετρία ροής Προεμφυτευτική γενετική διάγνωση ανάλυση του βλαστομεριδίου πριν από την εμφύτευση η γενετική καθοδήγηση πρέπει να γίνεται πρόσωπο με πρόσωπο και σε καμιά περίπτωση με τη μορφή γραπτής οδηγίας

17 Συνδυασμός εργαστηριακών ευρημάτων, κλινικών πληροφοριών και ιστορικού Γονιδιακή ανάλυση PCR (Polymerase Chain Reaction) Πολλαπλασιασμός / ενίσχυση (amplification) του γονιδίου που ερευνάται Διερεύνηση του PCR προϊόντος με : Probes (ανιχνευτές) και σταθερό υβριδισμό με σεσημασμένα ολιγονουκλεοτίδια συμπληρωματικά για τη φυσιολογική και την παθολογική αλληλουχία (dot blot hybridization) Περιοριστικά ένζυμα αναγνωρίζουν στο PCR προϊόν με συγκεκριμένη σημειακή μετάλλαξη Gap PCR παραλλαγή της PCR με δυνατότητα ανίχνευσης κενού στην αλληλουχία ARMS (Amplification Refractory Mutation System) παραλλαγή της PCR με δυνατότητα αξιολόγησης του αποτελέσματος αμέσως μετά την αντίδραση χωρίς την ανάγκη υβριδισμού set εκκινητών (primers) για φυσιολογική και παθολογική αλληλουχία DGGE (Denaturing Gradient Gel Electrophoresis) Ηλεκτροφόρηση του PCR προϊόντος σε αποδιατακτική γέλη ακρυλαμίδης με κλίση πυκνότητας όταν η σημειακή μετάλλαξη είναι άγνωστη DNA sequencing μελέτη της νουκλεοτιδικής αλληλουχίας

18 ΘΕΡΑΠΕΙΑ Ετερόζυγη β-θαλασσαιμία Χωρίς θεραπεία Χορήγηση καθημερινά 0,5mg φυλλικού οξέος Μείζων θαλασσαιμία Μετάγγιση - αποσιδήρωση Δρεπανοκυτταρική νόσος α) Προληπτική αντιμετώπηση Πενικιλλίνη, φυλλικό, εμβολιασμός Αποφυγή ψύχους, σωματικής κόπωσης, έκθεσης σε λοιμώξεις, λήψης οινοπνεύματος β) Αντιμετώπηση των επιπλοκών (δρεπανοκυτταρική κρίση, πριαπισμός, οξύ πνευμονικό οίδημα, εγκεφαλικό επεισόδιο) Παυσίπονα, ενυδάτωση, μετάγγιση γ) Αντιμετώπηση της νόσου υδροξυουρία Μικροδρεπανοκυτταρική νόσος Θεραπεία ανάλογη με αυτή της ομόζυγης δρεπανοκυτταρικής

19 Μεταμόσχευση αρχέγονων αιμοποιητικών κυττάρων Καταστολή των κυττάρων του μυελού των οστών και αντικατάστασή του με αρχέγονα αιμοποιητικά κύτταρα από συμβατό υγιή δότη BMT (Bone Marrow Transplantation) από μυελό των οστών SCT (Stem Cell Transplantation) από περιφερικό αίμα ή αίμα ομφαλίου λώρου Γονιδιακή θεραπεία Θεραπευτική διόρθωση β-θαλασσαιμίας και δρεπανοκυτταρικής αναιμίας Συλλογή και έγχυση αρχέγονων αιμοποιητικών κυττάρων από τον ίδιο τον ασθενή αφού προηγηθεί εισαγωγή διορθωμένου γονιδίου με τη βοήθεια ιϊκών φορέων

20 Η πρώτη επιτυχής γονιδιακή θεραπεία Έγινε σε άνδρα 18 ετών - σήμερα είναι 21 ετών Δημοσιεύθηκε στο περιοδικό Nature τον Σεπτέμβριο του 2010 και μετά από ένα μήνα η εφημερίδα «το Βήμα της Κυριακής» δημοσίευσε σχετικό άρθρο βο/βε γονείς από Ταϋλάνδη και Βιετνάμ διαμονή στη Γαλλία δεν υπήρχε συμβατός δότης για μεταμόσχευση μυελού Φιλίπ Λεμπούλς καθηγητής στο Εθνικό Ινστιτούτο Υγείας και Ιατρικής Έρευνας και επισκέπτης καθηγητής στο Πανεπιστήμιο του Χάρβαντ 30 χρόνια έρευνα για τη γονιδιακή θεραπεία Τα πρώτα χρόνια παρατηρήθηκαν σοβαρές παρενέργειες και θάνατος ασθενούς λόγω έντονης ανοσολογικής αντίδρασης στον αδενοϊό-φορέα του γονιδίου Πριν 10 χρόνια ο ίδιος και η ομάδα του εφάρμοσαν επιτυχημένη γονιδιακή θεραπεία σε ποντίκια με δρεπανοκυτταρική αναιμία Η προσπάθεια εστιάστηκε στην επιλογή κατάλληλου ιού-φορέα και τελευταία χρησιμοποιείται ο ιός HIV σε αδρανοποιημένη μορφή επειδή μπορεί να μεταφέρει μεγάλα τμήματα DNA

21 ΔΙΑΔΙΚΑΣΙΑ Το φυσιολογικό γονίδιο της β-σφαιρίνης τροποποιείται ελαφρά (1 αμινοξύ του) για να υπάρχει εικόνα της έκφρασής του Λσμβάνεται Μ.Ο και απομονώνονται σε τρυβλίο κύτταρα (CD34+, ο πληθυσμός τους περιέχει πολυδύναμα αιμοποιητικά βλαστικά κύτταρα από τα οποία προέρχονται τα κύτταρα του αίματος) Μεταφέρεται το υγιές γονίδιο στα αιμοποιητικά κύτταρα του ασθενούς στο τρυβλίο (καλλιέργεια) με όχημα μεταφοράς αδρανοποιημένη μορφή του ιού HIV. Τα κύτταρα στη συνέχεια καταψύχονται Υποβολή του ασθενούς σε χημειοθεραπεία για να απαλλαγεί ο οργανισμός του από τα «ελαττωματικά» κύτταρα πριν τη μεταμόσχευση Απόψυξη των κυττάρων και έγχυσή τους στην κυκλοφορία του αίματος Τα θέματα που προκύπτουν είναι Τα δεδομένα αφορούν ένα μόνο ασθενή Είναι αρκετά τα 3 χρόνια για να αποκλεισθεί ενδεχόμενο παρενεργειών? Στόχος είναι να γίνει γονιδιακή θεραπεία σε συνολικά 10 άτομα με θαλασσαιμία και δρεπανοκυτταρική αναιμία

Νικολακοπούλου Κωνσταντίνα Κάτσα Ελένη-Μαρία Δάσκου Μαρία. β-θαλασσαιμία

Νικολακοπούλου Κωνσταντίνα Κάτσα Ελένη-Μαρία Δάσκου Μαρία. β-θαλασσαιμία Νικολακοπούλου Κωνσταντίνα Κάτσα Ελένη-Μαρία Δάσκου Μαρία β-θαλασσαιμία Θάλασσα + αίμα = θαλασσαιμία Εισαγωγή Η πιο κοινή γενετική νόσος που κληρονομείται Mενδελικά ~ 1 : 100.000 παγκοσμίως ~ 1 : 10.000

Διαβάστε περισσότερα

ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΑΓΝΩΣΗ

ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΑΓΝΩΣΗ ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΑΓΝΩΣΗ ΔΩΡΙΖΑ ΖΑΜΠΕΤΑ Επιμελήτρια Β Αιματολογικού Εργαστηρίου Γ.Ν.Α. «Ο ΕΥΑΓΓΕΛΙΣΜΟΣ» Οι αιμοσφαιρινοπάθειες αποτελούν τις πιο κοινές μονογονιδιακές ασθένειες παγκοσμίως.

Διαβάστε περισσότερα

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας»

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Εργαστήριο Κυτταρογενετικής ΕΚΕΦΕ «Δημόκριτος» «β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Ζαχάκη Σοφία - Ουρανία Βιολόγος, MSc, PhD β μεσογειακή αναιμία Η θαλασσαιμία ή νόσος

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία των νουκλεοτιδίων που συμβαίνουν στο γενετικό υλικό ενός οργανισμού τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις)

Διαβάστε περισσότερα

ΤΑΞΙΝΟΜΗΣΗ-ΔΙΕΡΕΥΝΗΣΗ ΑΝΑΙΜΙΑΣ

ΤΑΞΙΝΟΜΗΣΗ-ΔΙΕΡΕΥΝΗΣΗ ΑΝΑΙΜΙΑΣ ΤΑΞΙΝΟΜΗΣΗ-ΔΙΕΡΕΥΝΗΣΗ ΑΝΑΙΜΙΑΣ ΑΠΑΡΤΙΩΜΕΝΗ ΔΙΔΑΣΚΑΛΙΑ ΣΤΗΝ ΑΙΜΑΤΟΛΟΓΙΑ ΦΕΒΡΟΥΑΡΙΟΣ-ΜΑΡΤΙΟΣ 2015 Αλ. Κουράκλη-Συμεωνίδου ΕΡΓΑΣΤΗΡΙΑΚΗ ΠΡΟΣΕΓΓΙΣΗ ΑΣΘΕΝΟΥΣ ΜΕ ΑΝΑΙΜΙΑ Βαρύτητα αναιμίας Μικρή (Ηb >10 gr/dl)

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. β 2. γ 3. α 4. γ 5. δ ΘΕΜΑ 2ο 1. Σχολικό

Διαβάστε περισσότερα

Μαθαίνω για τη Δρεπανοκυτταρική Αναιμία- Αιμοσφαιρίνη S (HbS)

Μαθαίνω για τη Δρεπανοκυτταρική Αναιμία- Αιμοσφαιρίνη S (HbS) κυτταρική Μαθαίνω για τη Δρεπανοκυτταρική Αναιμία- Αιμοσφαιρίνη S (HbS) ΚΥΠΡΙΑΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΙΕΘΝΗΣ ΟΜΟΣΠΟΝ ΙΑ ΘΑΛΑΣΣΑΙΜΙΑΣ Γ.Τ.Π. 138/2013-5.000 Εκδόθηκε από το Γραφείο Τύπου και Πληροφοριών

Διαβάστε περισσότερα

ΟΡΘΟΧΡΩΜΕΣΟΡΘΟΚΥΤΤΑΡΙΚΕΣ ΑΝΑΙΜΙΕΣ. ΑΗΔΟΝΟΠΟΥΛΟΣ ΣΤΥΛΙΑΝΟΣ Διευθυντής Αιματολογικού Εργαστηρίου Γ.Ν.Α. «Ο Ευαγγελισμός»

ΟΡΘΟΧΡΩΜΕΣΟΡΘΟΚΥΤΤΑΡΙΚΕΣ ΑΝΑΙΜΙΕΣ. ΑΗΔΟΝΟΠΟΥΛΟΣ ΣΤΥΛΙΑΝΟΣ Διευθυντής Αιματολογικού Εργαστηρίου Γ.Ν.Α. «Ο Ευαγγελισμός» ΟΡΘΟΧΡΩΜΕΣΟΡΘΟΚΥΤΤΑΡΙΚΕΣ ΑΝΑΙΜΙΕΣ ΑΗΔΟΝΟΠΟΥΛΟΣ ΣΤΥΛΙΑΝΟΣ Διευθυντής Αιματολογικού Εργαστηρίου Γ.Ν.Α. «Ο Ευαγγελισμός» ΤΑΞΙΝΟΜΗΣΗ ΑΝΑΙΜΙΩΝ ΣΥΣΤΗΜΑΤΑ ΤΑΞΙΝΟΜΗΣΗΣ ΚΛΙΝΙΚΗ ΤΑΞΙΝΟΜΗΣΗ ΑΙΤΙΟΛΟΓΙΚΗ ΤΑΞΙΝΟΜΗΣΗ

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. H β- θαλασσαιμία είναι

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Β' Προπαιδευτική Παθολογική Κλινική

Β' Προπαιδευτική Παθολογική Κλινική Β' Προπαιδευτική Παθολογική Κλινική Παρουσίαση Αιματολογικών Περιστατικών Κολλάρη Εριέτα Ειδικευόμενη Παθολογίας Αιτία Εισαγωγής Γυναίκα 31 ετών με ομόζυγη δρεπανοκυτταρική αναιμία προσήλθε στην εφημερία

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Μπορούν τα γονίδια που ελέγχουν τη σύνθεση της α-αλυσίδας της αιμοσφαιρίνης να χαρακτηριστούν ως πολλαπλά αλληλόμορφα; Τα γονίδια που ελέγχουν την α-αλυσίδα της αιμοσφαιρίνης

Διαβάστε περισσότερα

Νεογνικές και παιδιατρικές μεταγγίσεις. Ελισάβετ Γεωργίου Αιματολόγος, Επίμ. Β Αιματολογικό Τμήμα Γ. Ν. Παπαγεωργίου

Νεογνικές και παιδιατρικές μεταγγίσεις. Ελισάβετ Γεωργίου Αιματολόγος, Επίμ. Β Αιματολογικό Τμήμα Γ. Ν. Παπαγεωργίου Νεογνικές και παιδιατρικές μεταγγίσεις Ελισάβετ Γεωργίου Αιματολόγος, Επίμ. Β Αιματολογικό Τμήμα Γ. Ν. Παπαγεωργίου Μεταγγίσεις σε νεογνά και παιδιά Μεταγγίσεις στον νεογνικό πληθυσμό Μεταγγίσεις στον

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. 1. β 2. β 3. γ 4. β Β. Ζύμωση: Διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες Υβριδοποίηση:

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΘΕΜΑ 1 Ο Α. 1 β, 2 α, 3 δ, 4 δ, 5 γ Β. 1 Λ, 2 Σ, 3 Λ, 4 Λ, 5 Λ ΘΕΜΑ 2 Ο Α. 1) α- θαλασσαιμία Σελ 93 σχολικού βιβλίου: ʽʽΤα γονίδια

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

Θαλασσαιμικά σύνδρομα: Γονίδια αλύσων, Δομή αιμοσφαιρίνης, Μεταλλάξεις. Θεραπεία

Θαλασσαιμικά σύνδρομα: Γονίδια αλύσων, Δομή αιμοσφαιρίνης, Μεταλλάξεις. Θεραπεία Θαλασσαιμικά σύνδρομα: Γονίδια αλύσων, Δομή αιμοσφαιρίνης, Μεταλλάξεις Θεραπεία Α.Αθανασιάδου 21.2.2012 Εκπαιδευτικοί Στόχοι: Να γνωρίζετε 1.ποιά γονίδια κωδικοποιούν τις αιμοσφαιρινικές αλύσους ( γενετικοί

Διαβάστε περισσότερα

ΣΥΓΓΕΝΕΙΣ ΑΙΜΟΛΥΤΙΚΕΣ ΑΝΑΙΜΙΕΣ

ΣΥΓΓΕΝΕΙΣ ΑΙΜΟΛΥΤΙΚΕΣ ΑΝΑΙΜΙΕΣ Γ ΠΑΙ ΙΑΤΡΙΚΗ ΚΛΙΝΙΚΗ ΙΕΥΘΥΝΤΗΣ: ΚΑΘΗΓΗΤΗΣ κ. ΙΩΑΝΝΗΣ Ν. ΤΣΑΝΑΚΑΣ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: κ. ΚΑΡΑΤΖΑ ΕΛΙΖΑ ΣΥΓΓΕΝΕΙΣ ΑΙΜΟΛΥΤΙΚΕΣ ΑΝΑΙΜΙΕΣ Τσαβδαρίδου Ιωάννα Τούλια Ηλέκτρα ΣΥΓΓΕΝΕΙΣ ΑΙΜΟΛΥΤΙΚΕΣ ΑΝΑΙΜΙΕΣ Οφείλονται

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

Οξεία μυελογενής λευχαιμία

Οξεία μυελογενής λευχαιμία Οξεία μυελογενής λευχαιμία Γενικά στοιχεία Ταξινόμηση και τύποι Ενδείξεις και συμπτώματα Αίτια πρόκλησης Διάγνωση Παρουσίαση και επαναστόχευση από Βικιπαίδεια Οξεία μυελογενής λευχαιμία : Ζήσου Ιωάννης

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΛΑΡΙΣΑΣ ΣΧΟΛΗ:ΣΕΥΠ ΤΜΗΜΑ:ΝΟΣΗΛΕΥΤΙΚΗ ΚΑΘΗΓΗΤΗΣ:κ.ΚΥΠΑΡΙΣΣΗ ΓΕΩΡΓΙΑ ΜΑΘΗΜΑ:ΚΟΙΝΟΤΙΚΗ ΝΟΣΗΛΕΥΤΙΚΗ II

ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΛΑΡΙΣΑΣ ΣΧΟΛΗ:ΣΕΥΠ ΤΜΗΜΑ:ΝΟΣΗΛΕΥΤΙΚΗ ΚΑΘΗΓΗΤΗΣ:κ.ΚΥΠΑΡΙΣΣΗ ΓΕΩΡΓΙΑ ΜΑΘΗΜΑ:ΚΟΙΝΟΤΙΚΗ ΝΟΣΗΛΕΥΤΙΚΗ II ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΛΑΡΙΣΑΣ ΣΧΟΛΗ:ΣΕΥΠ ΤΜΗΜΑ:ΝΟΣΗΛΕΥΤΙΚΗ ΚΑΘΗΓΗΤΗΣ:κ.ΚΥΠΑΡΙΣΣΗ ΓΕΩΡΓΙΑ ΜΑΘΗΜΑ:ΚΟΙΝΟΤΙΚΗ ΝΟΣΗΛΕΥΤΙΚΗ II ΘΕΜΑ:ΑΓΩΓΗ ΥΓΕΙΑΣ ΚΑΙ ΜΕΣΟΓΕΙΑΚΗ ΑΝΑΙΜΙΑ ΜΠΑΡΟΥΤΑ ΣΠΥΡΙΔΟΥΛΑ 2008 ΠΕΡΙΕΧΟΜΕΝΑ:

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Νεογνικές και παιδιατρικές μεταγγίσεις

Νεογνικές και παιδιατρικές μεταγγίσεις Νεογνικές και παιδιατρικές μεταγγίσεις Ελισάβετ Γεωργίου Αιματολόγος Αιματολογικό Τμήμα Γ. Ν. Παπαγεωργίου Ακαδημία Αιμοδοσίας, Ιούνιος 2014 Μεταγγίσεις σε νεογνά και παιδιά Μεταγγίσεις στον νεογνικό πληθυσμό

Διαβάστε περισσότερα

Προγεννητικός Μοριακός Καρυότυπος. Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά

Προγεννητικός Μοριακός Καρυότυπος. Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά Προγεννητικός Μοριακός Καρυότυπος Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά Η νέα εποχή στον Προγεννητικό Έλεγχο: Μοριακός Καρυότυπος - array CGH - Συγκριτικός γενωμικός υβριδισμός με μικροσυστοιχίες

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α)

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα

ΣΥΝΟΨΗ ΠΕΡΙ ΤΗΣ ΑΝΑΙΜΙΑΣ. Αργύρης Σ. Συμεωνίδης Αναπλ. Καθηγητής Αιματολογίας Πανεπιστημίου Πατρών

ΣΥΝΟΨΗ ΠΕΡΙ ΤΗΣ ΑΝΑΙΜΙΑΣ. Αργύρης Σ. Συμεωνίδης Αναπλ. Καθηγητής Αιματολογίας Πανεπιστημίου Πατρών ΣΥΝΟΨΗ ΠΕΡΙ ΤΗΣ ΑΝΑΙΜΙΑΣ Αργύρης Σ. Συμεωνίδης Αναπλ. Καθηγητής Αιματολογίας Πανεπιστημίου Πατρών Βασικό γνωσιολογικό υπόστρωμα Το αίμα αποτελείται από: ερυθρά και λευκά αιμοσφαίρια, αιμοπετάλια και πλάσμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

Προβλήματα σχετιζόμενα με την τυποποίηση αντιγόνων Ι

Προβλήματα σχετιζόμενα με την τυποποίηση αντιγόνων Ι Β Προβλήματα Φαινότυπος Β(Α): ασθενής αντίδραση με αντι-α, έντονη αντίδραση με αντι-β, και ο ορός αντιδρά με ερυθρά Α₁. Ο αντιορός Α περιέχει τον κλώνο ΜΗΟ4? Επίκτητος Β φαινότυπος: έντονη αντίδραση με

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

25. RHESUS (Rh) ANOΣΟΠΟΙΗΣΗ

25. RHESUS (Rh) ANOΣΟΠΟΙΗΣΗ Η Rh ανοσοποίηση οφείλεται σε εμβρυο-μητρική μετάγγιση (ΕΜΜ), όπου ποσότητα Rh θετικού εμβρυϊκού αίματος εισέρχεται στη μητρική κυκλοφορία Rh αρνητικής εγκύου και δημιουργούνται αντισώματα κατά του παράγοντα

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΕΞΕΤΑΣΤΕΑ ΥΛΗ Γενετική, σελ. 339 369 (εκτός ύλης: 16.7 Χιασματυπία ή διασκελισμός, σελ. 365-368)

ΕΞΕΤΑΣΤΕΑ ΥΛΗ Γενετική, σελ. 339 369 (εκτός ύλης: 16.7 Χιασματυπία ή διασκελισμός, σελ. 365-368) ΓΕΝΕΤΙΚΗ: Από τον Gregor Mendel. στους Watson and Crick. Γενετική είναι ο κλάδος της βιολογίας που μελετά επιστημονικά τους κληρονομικούς χαρακτήρες. Χαρακτηριστικά που δεν κληρονομούνται αλλά αναπτύσσονται

Διαβάστε περισσότερα

Λέξεις κλειδιά στη γενετική

Λέξεις κλειδιά στη γενετική ΓΕΝΕΤΙΚΗ: Από τον Gregor Mendel. στους Watson and Crick. Γενετική είναι ο κλάδος της βιολογίας που μελετά επιστημονικά τους κληρονομικούς χαρακτήρες. Χαρακτηριστικά που δεν κληρονομούνται αλλά αναπτύσσονται

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 6 ΚΕΦΑΛΑΙΟ 6 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ B B1. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β- θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής

Διαβάστε περισσότερα

Απλαστική κρίση από λοίμωξη Parvovirus B19 ως πρώτη κλινική εκδήλωση σε κορίτσι με ενδιάμεση Μεσογειακή Αναιμία

Απλαστική κρίση από λοίμωξη Parvovirus B19 ως πρώτη κλινική εκδήλωση σε κορίτσι με ενδιάμεση Μεσογειακή Αναιμία ΠΑΡΟΥΣΙΑΣΕΙΣ ΠΑΙΔΙΑΤΡΙΚΩΝ ΠΕΡΙΠΤΩΣΕΩΝ 12 Απλαστική κρίση από λοίμωξη Parvovirus B19 ως πρώτη κλινική εκδήλωση σε κορίτσι με ενδιάμεση Μεσογειακή Αναιμία Χατζηδημητρίου Βενιζέλος Οικονόμου Μαρίνα Εισαγωγή

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ο µέγιστος αριθµός διαφορετικών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Βλαστοκύτταρα κλειδί στη θεραπεία ασθενειών.

Βλαστοκύτταρα κλειδί στη θεραπεία ασθενειών. Βλαστοκύτταρα κλειδί στη θεραπεία ασθενειών. Η πρώτη και ασφαλής πηγή λήψης βλαστοκυττάρων στη ζωή του ανθρώπου είναι το ομφαλοπλακουντιακό αίμα το οποίο παραμένει στον πλακούντα μετά τη γέννηση. Το υπόλοιπο

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι λανθασμένη.

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

ΠΩΣ «ΔΙΑΒAΖΕΤΑΙ» Η ΓΕΝΙΚH AIΜΑΤΟΣ. Φυσιολογικές τιμές αιματολογικών παραμέτρων

ΠΩΣ «ΔΙΑΒAΖΕΤΑΙ» Η ΓΕΝΙΚH AIΜΑΤΟΣ. Φυσιολογικές τιμές αιματολογικών παραμέτρων ΠΩΣ «ΔΙΑΒAΖΕΤΑΙ» Η ΓΕΝΙΚH AIΜΑΤΟΣ Μ. Οικονόμου Εισαγωγή Η «γενική αίματος» αποτελεί τη συνηθέστερα χρησιμοποιούμενη εξέταση στην παιδιατρική κλινική πράξη. Ο προσδιορισμός των αιματολογικών παραμέτρων

Διαβάστε περισσότερα

ΚΑΤΣΑΤΟΥ ΜΑΡΙΑΝΝΑ ΑΙΜΑΤΟΛΟΓΟΣ ΑΙΜΑΤΟΛΟΓΙΚΟ ΕΡΓΑΣΤΗΡΙΟ Ν.Υ. ΑΙΜΟΔΟΣΙΑΣ Π.Γ.Ν. «ΑΤΤΙΚΟΝ»

ΚΑΤΣΑΤΟΥ ΜΑΡΙΑΝΝΑ ΑΙΜΑΤΟΛΟΓΟΣ ΑΙΜΑΤΟΛΟΓΙΚΟ ΕΡΓΑΣΤΗΡΙΟ Ν.Υ. ΑΙΜΟΔΟΣΙΑΣ Π.Γ.Ν. «ΑΤΤΙΚΟΝ» ΚΑΤΣΑΤΟΥ ΜΑΡΙΑΝΝΑ ΑΙΜΑΤΟΛΟΓΟΣ ΑΙΜΑΤΟΛΟΓΙΚΟ ΕΡΓΑΣΤΗΡΙΟ Ν.Υ. ΑΙΜΟΔΟΣΙΑΣ Π.Γ.Ν. «ΑΤΤΙΚΟΝ» 1 η ΚΛΙΝΙΚΗ ΠΕΡΙΠΤΩΣΗ ΑΣΥΜΦΩΝΙΑ ΜΕΤΑΞΥ ΟΡΟΛΟΓΙΚΟΥ ΚΑΙ ΕΡΥΘΡΟΚΥΤΤΑΡΙΚΟΥ ΠΡΟΣΔΙΟΡΙΣΜΟΥ ΤΗΣ ΑΒΟ ΟΜΑΔΑΣ Επίτοκος 36 ετών

Διαβάστε περισσότερα

ΣΥΓΧΡΟΝΕΣ ΑΠΟΨΕΙΣ ΓΙΑ ΤΗΝ ΘΕΡΑΠΕΙΑ ΤΩΝ ΕΠΑΝΕΙΛΗΜΜΕΝΩΝ ΑΠΟΒΟΛΩΝ

ΣΥΓΧΡΟΝΕΣ ΑΠΟΨΕΙΣ ΓΙΑ ΤΗΝ ΘΕΡΑΠΕΙΑ ΤΩΝ ΕΠΑΝΕΙΛΗΜΜΕΝΩΝ ΑΠΟΒΟΛΩΝ ΣΥΓΧΡΟΝΕΣ ΑΠΟΨΕΙΣ ΓΙΑ ΤΗΝ ΘΕΡΑΠΕΙΑ ΤΩΝ ΕΠΑΝΕΙΛΗΜΜΕΝΩΝ ΑΠΟΒΟΛΩΝ Σ. ΔΕΝΔΡΙΝΟΣ ΑΝ. ΚΑΘΗΓΗΤΗΣ Β ΜΑΙΕΥΤΙΚΗΣ-ΓΥΝΑΙΚΟΛΟΓΙΚΗΣ ΚΛΙΝΙΚΗΣ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ ΟΡΙΣΜΟΣ 2 ή 3 αποβολές προ των 20 wks ΠΟΣΟΣΤΟ ΕΜΦΑΝΙΣΗΣ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ

ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Παθοφυσιολογία ΙΙ Αιματολογία Υπεύθυνος μαθήματος: Καθηγητής Αλέξανδρος Α. Δρόσος Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες χρήσης

Διαβάστε περισσότερα

Παρουσίαση περιστατικού

Παρουσίαση περιστατικού Παρουσίαση περιστατικού 1 Τζήμου Μαρία, Ειδικευόμενη Παθολογίας Β Προπαιδευτική Παθολογική Κλινική Καθηγητής: Αστέριος Καραγιάννης Ιπποκράτειο Νοσοκομείο Θεσσαλονίκης Παρουσίαση περιστατικού 2 Ασθενής,

Διαβάστε περισσότερα

Παναγιώτα Κουτσογιάννη Αιµατολόγος ΝΥ Αιµοδοσίας Γ.Ν.Α. «Ο Ευαγγελισµός»

Παναγιώτα Κουτσογιάννη Αιµατολόγος ΝΥ Αιµοδοσίας Γ.Ν.Α. «Ο Ευαγγελισµός» ΑΙΜΟΘΕΡΑΠΕΙΑ ΣΕ ΜΑΚ ΜΕ ΜΙΚΤΗ ΑΣΥΜΒΑΤΟΤΗΤΑ ΑΒΟ Παναγιώτα Κουτσογιάννη Αιµατολόγος ΝΥ Αιµοδοσίας Γ.Ν.Α. «Ο Ευαγγελισµός» ΜΕΤΑΜΟΣΧΕΥΣΗ ΑΙΜΟΠΟΙΗΤΙΚΩΝ ΚΥΤΤΑΡΩΝ (ΜΑΚ) Αποδεκτή θεραπεία για ασθενείς µε: συγγενείς

Διαβάστε περισσότερα

Αξιολόγηση και θεραπεία Από τα πρωτόκολλα των SOS Ιατρών Επιμέλεια Γεώργιος Θεοχάρης

Αξιολόγηση και θεραπεία Από τα πρωτόκολλα των SOS Ιατρών Επιμέλεια Γεώργιος Θεοχάρης Αξιολόγηση και θεραπεία Από τα πρωτόκολλα των SOS Ιατρών Επιμέλεια Γεώργιος Θεοχάρης Παθολόγος Αξιολόγηση βαρύτητας περιστατικού - Από την βαρύτητα των κλινικών σημείων (αναπνευστική συχνότητα >35, ταχυκαρδία,

Διαβάστε περισσότερα

Κληρονοµικά νοσήµατα και καταστάσεις που οφείλονται σε γονιδιακές µεταλλάξεις

Κληρονοµικά νοσήµατα και καταστάσεις που οφείλονται σε γονιδιακές µεταλλάξεις Κληρονοµικά νοσήµατα και καταστάσεις που οφείλονται σε γονιδιακές µεταλλάξεις ΤΡΟΠΟΣ ΚΛΗΡΟΝΟΜΗΣΗΣ ΤΩΝ ΚΥΡΙΟΤΕΡΩΝ ΚΛΗΡΟΝΟΜΙΚΩΝ ΝΟΣΩΝ ΑΥΤΟΣΩΜΙΚΗ ΕΠΙΚΡΑΤΗΣ ΑΥΤΟΣΩΜΙΚΗ ΥΠΟΛΕΙΠΟΜΕΝΗ ΦΥΛΟΣΥΝ ΕΤΗ ΥΠΟΛΕΙΠΟΜΕΝΗ

Διαβάστε περισσότερα

Παιδιά και νέοι με χρόνια προβλήματα υγείας και ειδικές ανάγκες. Σύγχρονες ιατρικές θεωρήσεις και ελληνική πραγματικότητα.

Παιδιά και νέοι με χρόνια προβλήματα υγείας και ειδικές ανάγκες. Σύγχρονες ιατρικές θεωρήσεις και ελληνική πραγματικότητα. Παιδιά και νέοι με χρόνια προβλήματα υγείας και ειδικές ανάγκες. Σύγχρονες ιατρικές θεωρήσεις και ελληνική πραγματικότητα. Μαρία Φωτουλάκη Επίκουρη καθηγήτρια Παιδιατρικής-Παιδιατρικής Γαστρεντερολογίας

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) DNA

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 8 ΚΕΦΑΛΑΙΟ 8 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 Α1- δ, Α2-α, Α3-γ, Α4-δ, Α5-β ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ Β1. Η διπλή έλικα του DN συνδέεται µε τις ιστόνες

Διαβάστε περισσότερα

Η Κυτταρογενετική στις αιματολογικές κακοήθειες

Η Κυτταρογενετική στις αιματολογικές κακοήθειες Εργαστήριο Υγειοφυσικής & Περιβαλλοντικής Υγείας, ΙΠΤ-Α, Ε.Κ.Ε.Φ.Ε. «Δημόκριτος» Η Κυτταρογενετική στις αιματολογικές κακοήθειες Μανωλά Καλλιόπη, Ph.D Ερευνήτρια Γ Κυτταρογενετική Κλάδος της Γενετικής

Διαβάστε περισσότερα

Ποικιλίες RhD - Σύγχρονη προσέγγιση κατά τις μεταγγίσεις. M. Ξημέρη, ειδικ. Αιματολογίας

Ποικιλίες RhD - Σύγχρονη προσέγγιση κατά τις μεταγγίσεις. M. Ξημέρη, ειδικ. Αιματολογίας Ποικιλίες RhD - Σύγχρονη προσέγγιση κατά τις μεταγγίσεις M. Ξημέρη, ειδικ. Αιματολογίας Εισαγωγή Σύστημα RhD : - αναγνωρίστηκε το 1939 - το πιο σημαντικό κλινικά σύστημα μετά το ΑΒΟ - προκαλεί αιμολυτικές

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΕΚΦΩΝΗΣΕΙΣ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΕΚΦΩΝΗΣΕΙΣ Ε_3.Βλ3Θ(ε) ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ : - ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΘΕΜΑ A Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ B Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA

Διαβάστε περισσότερα

ΔΟΜΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ

ΔΟΜΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ ΔΟΜΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ 2) ΑΝΩΜΑΛΙΕΣ ΣΤΗ ΔΟΜΗ ΤΩΝ ΧΡΩΜΟΣΩΜΑΤΩΝ Αποτέλεσμα θραύσης και ανώμαλης ανασύστασης χρωμοσωμάτων Αφορούν ή ένα χρωμόσωμα περισσότερα χρωμοσώματα Είναι ή Ισοζυγισμένες (διατηρείται

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ ΔΕΙΓΜΑ ΑΠΟ ΤΗΝ ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ ΤΩΝ ΕΚΑΤΟΝΤΑΔΩΝ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ ΠΟΥ ΔΙΑΘΕΤΟΥΜΕ ΚΑΙ ΠΟΥ ΑΝΟΙΓΟΥΝ ΤΟ ΔΡΟΜΟ ΓΙΑ ΤΟΝ ΔΙΟΡΙΣΜΟ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΜΑΣ ΣΤΟ ΔΗΜΟΣΙΟ ΓΕΝΕΤΙΚΗ 1) Γονιδιακές μεταλλάξεις, χρωμοσωμικές

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

ΑΝΙΧΝΕΥΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ- ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Δρ. Ε.Τρακάκης

ΑΝΙΧΝΕΥΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ- ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Δρ. Ε.Τρακάκης ΑΝΙΧΝΕΥΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ- ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Δρ. Ε.Τρακάκης Οι ανιχνευτικές εξετάσεις (screening test) έχουν ευρεία εφαρμογή και μεγάλη πρακτική χρησιμότητα στον προγεννητικό έλεγχο. Ο προγεννητικός έλεγχος

Διαβάστε περισσότερα

Επίλυση προβλημάτων ασυμβατότητας. Νίκη Βγόντζα

Επίλυση προβλημάτων ασυμβατότητας. Νίκη Βγόντζα Επίλυση προβλημάτων ασυμβατότητας Νίκη Βγόντζα Βασικά στάδια ελέγχου συμβατότητας του αίματος μεταξύ δότη και λήπτη 1.Αίτηση αίματος (παραπεμπτικό) και δείγμα ασθενή 2.Ομάδα ABO,RhD στο δείγμα του ασθενή

Διαβάστε περισσότερα

ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ

ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ Η συµβολή της µοριακής ανάλυσης Eλισάβετ Οικονοµάκη Βιολόγος Αιµοπαθολογοανατοµικό Εργαστήριο ΠΓΝΑ > ΜΟΡΙΑΚΕΣ ΜΕΘΟ ΟΙ (Μη µορφολογικές) Αλυσιδωτή Αντίδραση Πολυµεράσης

Διαβάστε περισσότερα

Εργαστηριακή Διάγνωση της HIV λοίμωξης. Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ

Εργαστηριακή Διάγνωση της HIV λοίμωξης. Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ Εργαστηριακή Διάγνωση της HIV λοίμωξης Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ Διάγνωση της HIV λοίμωξης Από το 1985 και μέχρι σήμερα η διαγνωστική διαδικασία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

ΔΙΑΓΝΩΣΤΙΚΗ ΑΘΗΝΩΝ ΒΑΣ. ΣΙΔΕΡΗΣ, ΜΕΣΟΓΕΙΩΝ 6, ΑΜΠΕΛΟΚΗΠΟΙ 115 27, ΑΘΗΝΑ, ΤΗΛ: 210 7777.654, FAX

ΔΙΑΓΝΩΣΤΙΚΗ ΑΘΗΝΩΝ ΒΑΣ. ΣΙΔΕΡΗΣ, ΜΕΣΟΓΕΙΩΝ 6, ΑΜΠΕΛΟΚΗΠΟΙ 115 27, ΑΘΗΝΑ, ΤΗΛ: 210 7777.654, FAX ΔΙΑΓΝΩΣΤΙΚΗ ΑΘΗΝΩΝ Μικροβιολογικό & Ερευνητικό Εργαστήριο Καθ έξιν Αποβολές Οι καθ 'έξιν αποβολές είναι μια ασθένεια σαφώς διακριτή από τη στειρότητα, και που ορίζεται ως δύο ή περισσότερες αποτυχημένες

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΘΕΜΑ Α Ο Ερωτήσεις πολλαπλής επιλογής: Α1 Στην αντιγραφή του DN το σπάσιμο των υδρογονικών δεσμών μεταξύ των δύο συμπληρωματικών αλυσίδων γίνεται με τη βοήθεια

Διαβάστε περισσότερα

Eρυθροκυτταρική μεμβράνη

Eρυθροκυτταρική μεμβράνη Eρυθροκυτταρική μεμβράνη Είναι η καλύτερα μελετημένη βιολογική μεμβράνη Αν και αντιπροσωπεύει μόνο το 1% του βάρους του ερυθρού Σημαντικό ρόλο στη διατήρηση της ακεραιότητας του κυττάρου Αποτελεί άριστο

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΘΕΜΑ 1ο Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι

Διαβάστε περισσότερα