ανάπτυξη του πρώιμου εμβρύου

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ανάπτυξη του πρώιμου εμβρύου"

Transcript

1 ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ, ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ TΟΜΕΑΣ ΓΕΝΕΤΙΚΗΣ, ΒΙΟΛΟΓΙΑΣ ΚΥΤΤΑΡΟΥ ΚΑΙ ΑΝΑΠΤΥΞΗΣ ΕΡΓΑΣΤΗΡΙΟ ΑΝΑΠΤΥΞΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ ΣΤΑΥΡΙΔΗΣ ΒΑΣΙΛΕΙΟΣ Έκφραση της λαμινίνης και της εντακτίνης κατά την ανάπτυξη του πρώιμου εμβρύου ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ ΠΑΤΡΑ, ΙΟΥΛΙΟΣ

2 Περιεχόμενα Περιεχόμενα ΣΥΝΤΜΗΣΕΙΣ 5 ΕΙΣΑΓΩΓΗ 7 1. ΕΞΩΚΥΤΤΑΡΙΕΣ ΟΥΣΙΕΣ... 7 Α. Πρωτεογλυκάνες α. Περλεκάνη Β. Κολλαγόνα Γ. Γλυκοπρωτεΐνες α. Ινονεκτίνη [Fibronectin / Fibra (ίνα) - nectere (συνδέω)] β. Οστεονεκτίνη (Osteonectin / SPARC Secreted Protein Acidic and Rich in Cysteines) γ. Λαμινίνη (Laminin) ι. Ιντεγκρίνες 22 ii. Μη ιντεγκρινικοί υποδοχείς

3 Περιεχόμενα iii. Λεκτίνες δ. Εντακτίνη (entactin) i. Βιοσύνθεση και ρύθμιση έκφρασης εντακτίνης 31 ii. Εντακτίνη και συγκρότηση βασικής μεμβράνης 32 iii. Εντακτίνη και κυτταρική προσκόλληση.38 iv. Εντακτίνη και μορφογένεση ΠΡΩΙΜΟ ΕΜΒΡΥΟ ΟΡΝΙΘΑΣ α. Βλαστίδιο β. Γαστρίδιο γ. Νευρίδιο ΣΚΟΠΟΣ ΤΗΣ ΔΙΑΤΡΙΒΗΣ ΥΛΙΚΑ ΚΑΙ ΜΕΘΟΔΟΙ Α. Καλλιέργεια εμβρύων όρνιθας Β. Μονιμοποίηση εμβρύων Γ. Ανίχνευση πολυπεπτιδίου εντακτίνης με αντισώματα Δ. In situ υβριδοποίηση α. Μετατροπή του DNA - πλασμιδίου από κυκλικό σε ευθύγραμμο μόριο.59 i Πέψη με ένζυμα περιορισμού ii Ηλεκτροφόρηση νουκλεϊνικών οξέων σε μικροπήκτωμα αγαρόζης.61 β. Απομόνωση νουκλεϊνικών οξέων (εκχύλιση με φαινόλη / χλωροφόρμιο) 63 γ. In vitro μεταγραφή ι. Δημιουργία του ανιχνευτή (probe) ιι. Απομάκρυνση του DNA (ολοκλήρωση της αντίδρασης) δ. Υπολογισμός του ποσοστού ενσωμάτωσης ραδιενέργειας ε. Απομάκρυνση πρωτεϊνών και μη ενσωματωμένων νουκλεοτιδίων ι. Απομάκρυνση πρωτεϊνών ιι. Απομάκρυνση μη ενσωματωμένων νουκλεοτιδίων

4 Περιεχόμενα στ. Αλκαλική υδρόλυση του crna (probe) ζ. Προϋβριδοποίηση (προετοιμασία των τομών) η. Υβριδοποίηση θ. Επεξεργασία αντικειμενοφόρων μετά την υβριδοποίηση ι. Έκθεση σε αυτοραδιογραφία κ. Εμφάνιση αυτοραδιογραφιών Ε. Καλλιέργεια εμβρύων και σήμανση με ραδιενέργεια ΣΤ. Κατακρήμνιση πρωτεϊνών με τριχλωροξικό οξύ (TCA) Μέτρηση ενσωματωμένης ραδιενέργειας Ζ. Ηλεκτροφόρηση μιας διάστασης πρωτεϊνών σε πήκτωμα πολυακριλαμιδιου Η Χρώση πηκτώματος πολυακρυλαμιδίου με τη χρωστική Coomassie Blue.95 Θ Ανoσοκατακρήμνιση εντακτίνης με την Protein A Sepharose Ι. Φθοριογραφία (autoradiography) K. Φωτογράφηση ΑΠΟΤΕΛΕΣΜΑΤΑ 105 ΣΥΖΗΤΗΣΗ ΠΕΡΙΛΗΨΗ ABSTRACT.167 ΒΙΒΛΙΟΓΡΑΦΙΑ ΔΗΜΟΣΙΕΥΣΕΙΣ

5 Περιεχόμενα 4

6 Συντμήσεις Συντμήσεις: α-dg, β-dg BSA Depc DTT DMSO EHS GAG IGSS IKVAV LDL ΜΜΤ PBS PMSF PPO PVP PYS RGD α-dystroglycan, β-dystroglycan Bovine Serum Albumen Diethylpyrocarbonate Dithiothreitol Dimethylsulfoxide Engelbreth - Holm Swarm γλυκοζαμινογλυκάνη / (Glycosaminoglycan) Immuno Gold Silver Staining IIe - Lys - Val - Ala Val Low density lipoprotein Mouse Mammary Tumor Phosphate buffer saline Phenylmethylsulfonylflouride 2,5 diphenyloxatole Polyvinylpyrolidone Parietal Yolk Sac Arg Gly Asp 5

7 Συντμήσεις SDS SSC TBE TCA YIGSR YWTD Sodium Dodecyl Sulfate Saline Sodium Citrate Tris Borate, Ethylenedinitrilo tetraacetic acid Trichloroacetic acid Tyr - IIe - Gly - Ser Arg Tyr Trp Thr Asp 6

8 Εισαγωγή Εισαγωγή 1. ΕΞΩΚΥΤΤΑΡΙΕΣ ΟΥΣΙΕΣ Οι εξωκυττάριες ουσίες είναι ένα σύνθετο υλικό που παράγεται από τα κύτταρα με τη μορφή μακρομορίων, τα οποία στη συνέχεια εκκρίνονται εξωκυτταρικά όπου αλληλεπιδρούν και δημιουργούν ένα πολύπλοκο δίκτυο. Όταν παρατηρήθηκε για πρώτη φορά το δίκτυο κολλαγόνου σε παρασκευάσματα συνδετικού ιστού (Gross et al., 1954) εκτιμήθηκε ότι επρόκειτο για αδρανές δομικό και στηρικτικό υλικό. Εκτεταμένες μελέτες έχουν σήμερα αποδείξει ότι οι εξωκυττάριες ουσίες αλληλεπιδρούν με τα κύτταρα που περιβάλλουν και ρυθμίζουν τη συμπεριφορά των κυττάρων. Είναι τώρα γνωστό ότι οι εξωκυττάριες ουσίες ελέγχουν τη κυτταρική μετανάστευση και προσκόλληση (Bronner - Frazer, 1986 Perris et al., 1989, 1991 Hayoshi et al., 1992 Yamada and Kleinman, 1992 Yelian et al., 1993 De Simone, 1994 Chakravarti et al., 1995 Lee et al., 2000 Zagris et al., 2000 Zagris, 2001 Chan et al., 2004 Hay, 2005 ), μορφογένεση (Edelman, 1986, 1988, 1992 Zagris and Matthopoulos, 1987 Zagris et al., 7

9 Εισαγωγή 1989 Zagris and Panagopoulou, 1991 Ekblom et al., 1994 Wakatsuki and Elson, 2003 Czirok et al., 2004 Kominami and Takata, 2004 Zagris et al., 2004), πολλαπλασιασμό κυττάρων (Armstrong and Armstrong, 2003) και διαφοροποίηση (Adams and Watt, 1993 Lin and Bissell, 1993 Roskelly et al., 1995 Tavella et al., 1997 Edwards et al., 1998 Li et al., 2004 Tahinci and Lee, 2004 Yurchenco et al., 2004). Οι πρώτες εξωκυττάριες ουσίες εμφανίζονται νωρίς κατά την ανάπτυξη, όπως για παράδειγμα στο έμβρυο ποντικού όπου ανιχνεύεται η λαμινίνη από το στάδιο των 2-βλαστομεριδίων (Wu et al., 1983). Αποτελούν γνώρισμα όλων των κυτταρικών τύπων παρ' όλο που η σύστασή τους καθώς και η αλληλεπίδρασή τους με τα κύτταρα διαφέρει ανάλογα με τον ιστό. Τα κύτταρα μπορεί να περιβάλλονται από τις εξωκυττάριες ουσίες όπως στα χονδροκύτταρα ή να έρχονται σε επαφή με αυτές μόνο με μια επιφάνειά τους όπως συμβαίνει με τα επιθήλια και τα ενδοθήλια. Η πρόσδεση των κυττάρων στις εξωκυττάριες ουσίες ρυθμίζεται από υποδοχείς της κυτταρικής επιφάνειας. Κυρίαρχη κλάση αυτών των υποδοχέων είναι οι ιντεγκρίνες, μια οικογένεια ετεροδιμερών διαμεμβρανικών γλυκοπρωτεϊνών (Hay, 1991 Hynes, 1992 Haas and Plow, 1994 Fässleretal et al., 1996 Humphries, 1996 Ruoslahti, 1996 Howe et al., 1998 Bokel and Brown 2002 Tucker, 2004). Οι ιντεγκρίνες συνδέονται με τις πρωτεΐνες των εξωκυττάριων ουσιών σε συγκεκριμένες θέσεις των μορίων αυτών όπως για παράδειγμα το τριπεπτίδιο RGD (Arg - Gly - Asp) αν και ορισμένα μέλη της οικογένειας των ιντεγκρινών εμφανίζουν θέσεις δέσμευσης στις εξωκυττάριες ουσίες διάφορες του RGD όπως για παράδειγμα το IKVAV (Altieri et al., 1993 Scarborough et al., 1993 Underwood et al., 1995). Δομικά οι ιντεγκρίνες είναι α/β ετεροδιμερή (ΣΧΗΜΑ 1) και έχουν αναγνωριστεί 18α και 9β υπομονάδες. Είναι γνωστό ότι οι α και β υπομονάδες συνδυάζονται και σχηματίζουν 22 ιντεγκρίνες αν και θεωρητικά θα μπορούσαν να προκύψουν άνω των 100 διαφορετικών ετεροδιμερών (Hay, 1991 Hynes, 1992). Η 8

10 Εισαγωγή δημιουργία αλυσίδων που προέρχονται από εναλλακτική ωρίμανση mrnas των α και β αλυσίδων αυξάνει τον αριθμό των γνωστών ιντεγκρινών (Susuki and Naitoh, 1990 Tamura et al., 1991). ΣΧΗΜΑ 1. Δομή ιντεργκρινών. Οι κυτταροπλασματικές περιοχές των ιντεγκρινών, αλληλεπιδρούν με πρωτεΐνες του κυτταροσκελετού όπως η φιμπιουλίνη (Fibulin), η ταλίνη (talin) και η α-ακτινίνη (Horwitz et al., 1986 Argraves et al., 1989 Burridge et al., 1990). Οι ιντεγκρίνες έχουν την ικανότητα είτε να δρουν ως σύνδεσμος μεταξύ του κυτταροσκελετού και των εξωκυττάριων ουσιών (Ruoslahti and Pierschbacher, 1987 Larouche et al., 2000 Mayernick and Armant, 2002) είτε να προάγουν απευθείας τη διακυτταρική προσκόλληση (Larjava et al., 1990 Deluca et al., 1990 Martin-Bermudo and Brown,2000 Rout et al., 2004). Επίσης αλληλεπιδρούν άμεσα ή έμμεσα με μόρια σηματοδότες (π.χ. καλρετικουλίνη, κινάσες τυροσίνης, κινάσες σερίνης / θρεονίνης και φωσφατάσες, μέλη της οικογένειας των GTPάσων R RAS (Rho κινάσων) τα οποία είναι σημαντικά στη μεταβίβαση σημάτων στον πυρήνα (Humphries, 1996 Zhang et al.,

11 Εισαγωγή Coppolino et al., 1997 Defilippi et al., 1997 Hughes et al., 1997 Tapon and Hall, 1997 Howe et al., 1998). Έτσι γίνεται φανερό ότι υπάρχει δομική και λειτουργική συνέχεια μεταξύ του εσωτερικού του κυττάρου, της κυτταρικής μεμβράνης και των εξωκυττάριων ουσιών (Burridge et al., 1988 Howe et al., 1998). Οι εξωκυττάριες ουσίες ανήκουν σε τρεις κύριες κατηγορίες (Timpl, 1996) : Α) Πρωτεογλυκάνες, Β) Κολλαγόνο και Γ) Γλυκοπρωτεΐνες όπως για παράδειγμα η λαμινίνη και η εντακτίνη (ΠΙΝΑΚΑΣ 1). ΠΙΝΑΚΑΣ 1. Πρωτεΐνες των εξωκυττάριων ουσιών Α. Πρωτεογλυκάνες Οι πρωτεογλυκάνες είναι σύμπλοκα μακρομόρια που αποτελούνται από πρωτεϊνικό κορμό που μεταφέρει μια ή περισσότερες πλευρικές αλυσίδες υδατανθράκων. Κάθε τέτοια αλυσίδα είναι γραμμικό πολυμερές ενός δισακχαρίτη που 10

12 Εισαγωγή συνήθως περιέχει μια εξοζαμίνη γι' αυτό και η επαναλαμβανόμενη αυτή μονάδα ονομάζεται γλυκοζαμινογλυκάνη (glycosaminoglycan / GAG). Η μεγάλη ποικιλότητα των πρωτεογλυκανών οφείλεται είτε σε διαφορές στο πρωτεϊνικό κορμό, είτε στη κατηγορία της γλυκοζαμινογλυκάνης που έχει προσδεθεί σε αυτόν (διαφορετικές γλυκοζαμινογλυκάνες μπορεί να είναι προσδεδεμένες στον ίδιο πρωτεϊνικό κορμό), είτε σε διαφορές στο μήκος του μορίου της γλυκοζαμινογλυκάνης (Neame et al., 1989 Roden et al., 1985), ή στο βαθμό σουλφιλίωσης της γλυκοζαμινογλυκάνης. Υπάρχουν οι εξής τύποι γλυκοζαμινογλυκανών: Ηπαρίνης / θειικής ηπαράνης, θειικής χονδροϊτίνης, θειικής δερματάνης, θειικής κερατάνης και υαλουρονικό οξύ. Σε όλα αυτά τα μόρια τα σάκχαρα είναι σουλφιλιωμένα και οι αλυσίδες βρίσκονται συνδεδεμένες στο πρωτεϊνικό κορμό εκτός από το υαλουρονικό οξύ στο οποίο τα σάκχαρα δεν είναι σουλφιλιωμένα ούτε προσδένονται πάνω σε πρωτεΐνη αλλά υπάρχει ως ελεύθερη γλυκοζαμινογλυκάνη (Roden et al., 1985 Hay 1991). Το υαλουρονικό οξύ μέσω γλυκοπρωτεϊνών - συνδέσμων (linker - glycoproteins) δεσμεύεται στις γλυκοζαμινογλυκάνες πρωτεογλυκανών φέρνοντάς τες σε στενή επαφή ώστε από απλά μονομερή να δημιουργηθεί ένα πολύπλοκο δίκτυο πρωτεογλυκανών. Η πρόσδεση των πρωτεογλυκανών σε άλλες εξωκυττάριες ουσίες, στα μόρια προσκόλλησης και στους αυξηντικούς παράγοντες είναι ιοντικής φύσεως και η ένταση της πρόσδεσης εξαρτάται από το βαθμό σουλφιλίωσης της γλυκοζαμινογλυκάνης (Ruoslahti, 1988). Οι πρωτεογλυκάνες(ιozzo, 1998 Zagris and Panagopoulou, 1991) εμπλέκονται στη συνάθροιση εξωκυττάριων ουσιών (Ruoslahti et al., 1987 Battaglia et al., 1992), αλληλεπιδρούν με τους αυξηντικούς παράγοντες (Larrain et al., 1997), μπορεί να αναστέλλουν τη προσκόλληση κυττάρων και εξωκυττάριων ουσιών (Brennan et al., 1983 Rosenberg et al., 1986), και παίζουν σημαντικό ρόλο στη διαφοροποίηση, στο πολλαπλασιασμό κυττάρων (Kinoshita et al., 1979 Yamaguchi and Ruoslahti, 1988 Fedarko et al., 1989) καθώς και στη μορφογένεση (Thesleff et al., 1988 Skandalis et al., 2003). 11

13 Εισαγωγή α. Περλεκάνη H περλεκάνη (~450 KDa) είναι η πρωτεογλυκάνη που εντοπίζεται σε όλες τις βασικές μεμβράνες και στον περικυτταρικό χώρο (Iozzo et al., 1994 Brown et al., 1997). Μόρια περλεκάνης που προέρχονται από εναλλακτική ωρίμανση του mrna της έχουν διαπιστωθεί τόσο στον άνθρωπο όσο και στον ποντικό (Noonan et al., 1991 Kallunki and Tryggvason, 1992). Η πρωτείνη αποτελείται από 5 ενεργές περιοχές (domains). Το αμινοτελικό της άκρο (domain I) είναι το μοναδικό που εμφανίζεται αποκλειστικά στη περλεκάνη και κατέχει 3 θέσεις με ενεργότητα δέσμευσης για αλυσίδες θεϊικής ηπαράνης (Dolan et al., 1997). Η περιοχή II εμφανίζει ομολογία με την περιοχή του low density lipoprotein (LDL) υποδοχέα πάνω στη οποία προσδένεται η LDL λιποπρωτεΐνη. Η περιοχή III αποτελείται από 3 υπομονάδες ομόλογες με το αμινοτελικό άκρο της α1 αλυσίδας της λαμινίνης (Schulze et al., 1995). Η περιοχή IV εμφανίζει ομοιότητα με τμήμα του μορίου κυτταρικής προσκόλλησης N-CAM. Η περιοχή V στο καρβοξυτελικό άκρο της περλεκάνης εμφανίζει ομολογία με το καρβοξυτελικό άκρο της agrin (Iozzo, 1994 Brown et al., 1997). Η περλεκάνη αλληλεπιδρά μέσω των υδατανθρακικών αλυσίδων της (θειική ηπαράνη) με τη λαμινίνη, το κολλαγόνο IV και την ινονεκτίνη και μέσω του πρωτεϊνικού της κορμού με τη G 2 ενεργή περιοχή της εντακτίνης (Battaglia at al, 1992). Επίσης και το πρωτεϊνικό και το υδατανθρακικό κομμάτι της περλεκάνης μπορεί να δεσμεύει αυξηντικούς παράγοντες (Larrain et al.l, 1997). H περλεκάνη φαίνεται να εμπλέκεται και στην προσκόλληση κυττάρων. Για παράδειγμα η προσκόλληση ενδοθηλιακών κυττάρων στο πρωτεϊνικό κορμό της περλεκάνης αναστέλλεται μερικώς από RGD συνθετικά πεπτίδια και αντισώματα των β 1 και β 3 αλυσίδων ιντεγκρινών (Hayoshi et al., 1992). Η χρησιμοποίηση ανασυνδυασμένης της περιοχής III χωρίς να πειραχτεί η RGD αλληλουχία της περλεκάνης ήταν αρκετή για να μιμηθεί τη δράση της ακέραιας perlecan στη προαγωγή της κυτταρικής προσκόλλησης νεοπλαστικών κυττάρων σε καλλιέργεια (Noonan et al., 1991 Chakravarti et al., 1995). 12

14 Εισαγωγή Β. Κολλαγόνα Η δομή του μορίου είναι η τριπλή έλικα που σχηματίζεται όταν οι 3 α αλυσίδες με μορφή αριστερόστροφης έλικας τυλιχθούν η μία γύρω από την άλλη. Αυτή η δομή σταθεροποιείται με δεσμούς υδρογόνου μεταξύ των αλυσίδων (Hay, 1991). Οι πιο καλά μελετημένοι τύποι κολλαγόνου είναι οι Ι, ΙΙ, ΙΙΙ και IV. Οι τρεις πρώτοι είναι ινιδιακής μορφής και βρίσκονται σε όλους τους συνδετικούς ιστούς. Αντίθετα στις βασικές μεμβράνες εντοπίστηκε ένα είδος κολλαγόνου το πρώτο που συντίθεται στο πρώιμο έμβρυο το οποίο σε αντίθεση με τα υπόλοιπα μπορούσε να συνθέσει από απλά μονομερή ένα τρισδιάστατο πλέγμα, το δίκτυο του κολλαγόνου IV που μαζί με τη λαμινίνη αποτελεί και το σκελετό των βασικών μεμβρανών (Hudson et al., 1993 Hay, 1991 Brauer and Keller, 1989). Το κολλαγόνο IV αποτελεί μία οικογένεια πρωτεϊνών καθώς έχουν βρεθεί 6 διαφορετικές αλυσίδες, η α 1(IV), η α 2(IV), η α 3(IV), α 4(IV), α 5(IV), α 6(IV) να συμμετέχουν στη δομή της. Κάθε αλυσίδα αποτελείται από μια μεγάλη περιοχή 1400 αμινοξέων όπου επαναλαμβάνεται το πρότυπο GI y - X aa - Y aa με το Χ και Υ συχνά να αντιπροσωπεύουν προλίνη και υδροξυπρολίνη, αντίστοιχα. Σε πολλά σημεία αυτό το πρότυπο διακόπτεται από μη κολλαγονικές αλληλουχίες (Hudson et al., 1993). Στα δυο άκρα του μορίου συναντάμε το μη κολλαγονικό αμινοτελικό άκρο με περίπου 15 αμινοξέα και το επίσης μη κολλαγονικό καρβοξυτελικό άκρο που αποτελείται από 230 περίπου αμινοξέα και ονομάζεται NC1 ενεργός περιοχή (Ries et al., 1995). Έχουν διαπιστωθεί οι εξής τρόποι με τους οποίους μονομερή μόρια κολλαγόνου IV συμπλέκονται για την δημιουργία πλέγματος. Από την αλληλεπίδραση δυο NC1 περιοχών δημιουργείται ένα διμερές, ενώ τετραμερή μόρια σχηματίζονται από την σύνδεση των αμινοτελικών άκρων των μονομερών. Πλευρικές συνδέσεις μεταξύ της τριπλής έλικας ενός μορίου και της NC1 περιοχής ενός άλλου καταλήγουν στη δημιουργία ενός τρισδιάστατου δικτύου (Yurchenco and O' Rear, 1993 Kühn, 1994 ). 13

15 Εισαγωγή Το κολλαγόνο IV δεν αποτελεί απλά δομικό υλικό των βασικών μεμβρανών αλλά συμμετέχει και στην αλληλεπίδραση κυττάρων με τις βασικές μεμβράνες. Η θέση δέσμευσης των κυττάρων έχει εντοπιστεί περίπου 100 nm μακριά από το αμινοτελικό άκρο του κολλαγόνου και σχηματίζεται από τα αμινοξέα Arg της α 2(IV) αλυσίδας και Asp από τις δυο α 1(IV) αλυσίδες, επεξηγώντας γιατί η αλληλεπίδραση των α 1 β 1 και α 2 β 1 ιντεγκρινών με το κολλαγόνο IV εξαρτιόταν από την διαμόρφωση του μορίου (Eble et al., 1993). Στο καρβοξυτελικό άκρο του κολλαγόνου IV υπάρχει και το RGD πρότυπο που αναγνωρίζεται από τις ιντεγκρίνες το οποίο όμως in vivo δεν φαίνεται να συμμετέχει στην αναγνώριση των κυττάρων. Μόνο όταν ξεδιπλωθεί η διπλή έλικα, π.χ. με μετουσίωση, μπορεί να ενεργοποιηθεί η RGD θέση αναγνώρισης (Pfaff et al., 1993). Το καρβοξυτελικό άκρο του κολλαγόνου γνωρίζουμε ότι συμμετέχει κυρίως στη δημιουργία πλευρικών συνδέσεων μορίων κολλαγόνου, γι' αυτό και δεν είναι διαθέσιμο in vivo για κυτταρική αναγνώριση (Siebold et al., 1987). 14

16 Εισαγωγή Γ. Γλυκοπρωτεΐνες Οι γλυκοπρωτεΐνες όπως και οι πρωτεογλυκάνες, αποτελούν σύμπλοκα μόρια πρωτεϊνών με υδατάνθρακες, διαφέρουν όμως από τις πρωτεογλυκάνες ως προς το είδος, την ποσότητα και τη διαμόρφωση των πλευρικών αλυσίδων. Οι πρωτεογλυκάνες περιέχουν υδατάνθρακες σε ποσοστό 95% κατά βάρος, οι σακχαρικές τους αλυσίδες είναι μη διακλαδισμένες (γραμμικές), περίπου 80 σάκχαρα η κάθε μία, χωρίς σιαλικό οξύ και το μοριακό τους βάρος φτάνει τα 3X10 6 daltons. Αντίθετα οι γλυκοπρωτεΐνες περιέχουν υδατάνθρακες σε ποσοστό 1-60% κατά βάρος, οι αλυσίδες των ολιγοσακχαριτών είναι διακλαδισμένες, περίπου 15 σάκχαρα η κάθε μία και συχνά τελειώνουν με σιαλικό οξύ. Το μοριακό βάρος φτάνει μέχρι 3X10 5 daltons. Γλυκοπρωτεΐνες που συμμετέχουν στο πλέγμα των εξωκυττάριων ουσιών είναι η ινονεκτίνη, η οστεονεκτίνη, η εντακτίνη και η λαμινίνη. α. Ινονεκτίνη [Fibronectin / Fibra (ίνα) - nectere (συνδέω)] Η ινονεκτίνη είναι καλά μελετημένη πολυλειτουργική γλυκοπρωτεΐνη των εξωκυττάριων ουσιών, που συντίθεται από ποικιλία κυτταρικών τύπων όπως οι ινοβλάστες, τα χονδροκύτταρα, ενδοθηλιακά κύτταρα και μακροφάγα (Hynes, 1987 Chothia and Jones, 1997 Sun et al., 2005). To μόριο εκκρίνεται ως ομοδιμερές με τις δυο αλυσίδες του ( KDa) σε αντιπαράλληλη διάταξη να ενώνονται με δυο δισουλφιδικούς δεσμούς κοντά στο καρβοξυτελικό άκρο (An et al., 1992 Kar et al., 1993). Η ύπαρξη ενεργών περιοχών, χαρακτηριστικό των γλυκοπρωτεϊνών των εξωκυτταρικών ουσιών έχει αποδειχθεί και στην ινονεκτίνη (Engel, 1991). Οι λειτουργικές περιοχές του μορίου κατέχουν θέσεις δέσμευσης α) για άλλες πρωτεΐνες της εξωκυττάριας ουσίας όπως το κολλαγόνο (Ingham et al., 1989) και η εντακτίνη (Hsieh et al., 1994), β) για υποδοχείς της κυτταρικής επιφάνειας 15

17 Εισαγωγή όπως οι ιντεγκρίνες (Main et al., 1992 Dickinson et al., 1994 Carcia et al., 1998), γ) για πρωτεΐνες από την κυκλοφορία του αίματος όπως το ινώδες (Fibrin) (Matsuka et al., 1994) και δ) για γλυκοζαμινογλυκάνες όπως η ηπαρίνη και η θεϊική χονδροϊτίνη (Ingham et al., 1993 Barkalow and Schwarzbauer, 1994). Παρόλο που η ύπαρξη ενός RGD πεπτιδίου στην 10 FN 3 ενεργή περιοχή της ινονεκτίνης δικαιολογεί τις προσκολλητικές ιδιότητες του μορίου (Xie et al., 1998), η ενεργότητα του τριπεπτιδίου αντιπροσωπεύει μόνο ένα μικρό κλάσμα της ενεργότητας μεγαλύτερων τμημάτων ινονεκτίνης που περιέχουν το τριπεπτίδιο, υποδηλώνοντας την συνεργιστική δράση των γειτονικών αμινοξέων (Aorta et al., 1991 Bowditch et al., 1994). Η ινονεκτίνη μπορεί να δημιουργήσει ινίδια μέσω του αμινοτελικού άκρου του μορίου, να οργανώσει τις εξωκυτταρικές ουσίες και να τις συνδέσει με διάφορους κυτταρικούς τύπους (Mc Donald, 1988). Σημαντικός είναι ο ρόλος της στη κυτταρική μετανάστευση όπου φαίνεται να συμμετέχει στον καθορισμό "των μονοπατιών" που πρέπει να ακολουθήσουν τα κύτταρα που μεταναστεύουν για να φτάσουν ως τον τελικό προορισμό τους (Davidson and DeSimone, 2004). Έτσι στον εχίνο στο στάδιο του γαστριδίου, όταν τα μεσεγχυματικά κύτταρα διεισδύουν μέσα στο βλαστόκοιλο εκτείνοντας τα φυλλοπόδια τους, καθοδηγούνται από την ινονεκτίνη προς την οποία εμφανίζουν μια δραματική αύξηση της συγγένειάς τους (Fink and McClay, 1985). Στα αμφίβια στο στάδιο του βλαστιδίου η ινονεκτίνη εντοπίζεται στη οροφή του βλαστόκοιλου (Lee et al., 1984 Danker et al., 1993) προς την οποία μεταναστεύουν μεσοδερμικά κύτταρα με την έναρξη των μορφογενετικών κινήσεων στο στάδιο του γαστριδίου (Nakatsuji et al., 1985). Αυτή η κίνηση αναστελλόταν με τη χρήση ενός δεκαπεπτιδίου του Arg-Gly-Asp-Ser-Pro-Ala-Ser-Ser-Lys-Pro που περιείχε την RGD θέση αναγνώρισης κυττάρων και ανταγωνιζόταν την προσκόλληση της ινονεκτίνης στα κύτταρα που θα μετανάστευαν (Boucaut et al., 1984). Στο έμβρυο των πτηνών 16

18 Εισαγωγή η ινονεκτίνη εντοπίζεται στο στάδιο του βλαστιδίου στη βασική μεμβράνη της επιβλάστης (Harrison et al., 1984). Κατά τη γαστριδίωση, όπως και στους άλλους οργανισμούς κατευθύνει την μετανάστευση των μεσοδερμικών κυττάρων ενώ στο στάδιο του νευριδίου φαίνεται να κατευθύνει και τη μετανάστευση των κυττάρων των νευρικών κρηπίδων (Dufour et al., 1988). Αργότερα κατά την ανάπτυξη κατευθύνει μέσω μιας κλίσης συγκέντρωσης την κίνηση των προκαρδιακών κυττάρων προς την ακριβή θέση όπου θα σχηματιστεί η καρδιά (Linask and Lash, 1988). Είναι γνωστές διαφορετικές ισομορφές της ινονεκτίνης που προκύπτουν από εναλλακτική ωρίμανση του ίδιου μεταγράφου στις θέσεις EDA, EDB και IIICS (Pots and Campbell, 1994). Αυτές οι ισομορφές πιθανόν να καθορίζουν διαφορετικά μονοπάτια μετανάστευσης και να αναγνωρίζονται από διαφορετικά κύτταρα. β. Οστεονεκτίνη (Osteonectin / SPARC Secreted Protein Acidic and Rich in Cysteines) Η οστεονεκτίνη (43Kda) είναι ένα όξινο μόριο των εξωκυττάριων ουσιών πλούσιο σε κυστεΐνες που εμφανίζει μεγάλη συντηρητικότητα μεταξύ των ειδών (Engel et al., 1987 Bolander et al., 1988 Tracy et al., 1988). Πρωτοταγής ανάλυση των 302 αμινοξέων της φανέρωσε τέσσερις ενεργές περιοχές. Η πρώτη (αμινοξέα 1 17) αποτελεί το μήνυμα ότι η πρωτεΐνη πρέπει να εκκριθεί. Η δεύτερη (αμινοξέα 23 68) είναι πλούσια σε όξινα αμινοξέα, κυρίως γλουταμινικά (τα 15 από τα συνολικά 46) και παίρνει τη διαμόρφωση της α-έλικας. Η τρίτη ενεργός περιοχή (αμινοξέα ) περιέχει 11 κυστεΐνες, ενώ η τελευταία (αμινοξέα ) περιέχει από 21 όξινα και βασικά αμινοξέα και 3 ακόμη κυστεΐνες κοντά στο καρβοξυτελικό άκρο (Mason et al., 1986). 17

19 Εισαγωγή Η οστεονεκτίνη έχει βρεθεί σε περιορισμένες θέσεις εμβρυϊκών και ενήλικων ιστών. Σε έμβρυα έχει εντοπιστεί στους σωμίτες, στις καταβολές άκρων και σε κύτταρα εξωεμβρυϊκών ιστών (Holland et al., 1987). Σε ενήλικους ιστούς η οστεονεκτίνη εμφανιζόταν μόνο στις περιπτώσεις όπου υπήρχε έντονος πολλαπλασιασμός κυττάρων και ανάπλαση της περιοχής. Η ικανότητα του μορίου να αναστέλλει την εξάπλωση ενδοθηλιακών κυττάρων, λείων μυϊκών κυττάρων και ινοβλαστών in vitro, φανέρωσε τη συμμετοχή της στην αλληλεπίδραση κυττάρων με εξωκυττάριες ουσίες κατά την ανάπτυξη του εμβρύου ή την κυτταρική συμπεριφορά την επούλωση τραυμάτων (Lane and Sage, 1990). Η πιθανότητα αυτή ενισχύθηκε από τη διαπίστωση ότι η οστεονεκτίνη δεσμεύει Ca 2+ και προσδένεται στη τριπλή έλικα του κολλαγόνου IV (Mauer et al., 1995 Sasaki et al., 1998). Πιστεύεται ότι η οστεονεκτίνη αλληλεπιδρά με πρωτεΐνες της κυτταρικής επιφάνειας και επάγει τέτοιες αλλαγές στη μορφολογία των κυττάρων ώστε να καταστρέφεται η σύνδεσή τους με τις εξωκυττάριες ουσίες και να ελευθερώνονται (Sage et al., 1989 Sage and Bornstein, 1991 Lane and Sage, 1994 Vial and Castellazzi, 2000). γ. Λαμινίνη (Laminin) Οι λαμινίνες αποτελούν μια οικογένεια πολυλειτουργικών γλυκοπρωτεϊνών, οι οποίες συνιστούν ουσιώδη συστατικά των βασικών μεμβρανών. Το μόριο δημιουργείται όταν οι τρεις πολυπεπτιδικές του αλυσίδες (α, β, γ) συνδεθούν με ενδοσουλφιδικούς δεσμούς σε μια διαμόρφωση σε σχήμα σταυρού (Engel, 1992) (ΣΧΗΜΑ 2). Η σύνθεση του ετεροτριμερούς πιθανά πραγματοποιείται μέσω ενός ενδιάμεσου σταδίου. Αρχικά η β και η γ αλυσίδα σχηματίζουν ένα διμερές όπως διαπιστώθηκε στον ποντικό και στο έντομο Drosophila (Hunter et al., 1990 Kumagai et al., 1997 Niimi and Kitagawa, 1997). Η προσθήκη της α αλυσίδας πιστεύεται ότι απαιτείται για να εκκριθεί το ολοκληρωμένο πλέον μόριο στον εξωκυττάριο χώρο (Peters et al., 1985 Frenette et al., 1989 Nomizu et al., 1996 Yurchenco et al., 1997). 18

20 Εισαγωγή ΣΧΗΜΑ 2. Δομή λαμινίνης (Timpl and Brown,1994) ΣΧΗΜΑ 3. Δομή λαμινίνης με έμφαση στα σημεία πρόσδεσης κυτταρικών υποδοχέων 19

21 Εισαγωγή Η λαμινίνη απομονώθηκε για πρώτη φορά από καρκινωματική σειρά εμβρυϊκών κυττάρων του λεκιθικού ασκού ποντικού Parietal Yolk Sac ( PYS) (Chung et al., 1979) και από Engelbreth - Holm - Swarm (EHS) όγκο ποντικού (Timpl et al., 1979). Το πρωτότυπο μόριο της λαμινίνης και στις δύο περιπτώσεις είχε τη δομή α β γ και ονομάζεται λαμινίνη 1 (α1β1γ1). Στη συνέχεια το μόριο της λαμινίνης περιγράφηκε στον ανθρώπινο πλακούντα (Wewer et al., 1983), στον ποντικό (Engel et al., 1981 Kikkawaa et al., 2005), στο βάτραχο (Darribere et al., 1986), στην όρνιθα (Bortier et al., 1989 Zagris and Chung, 1990 Zagris et al., 2000 Dixelius et al., 2004), στη Drosophila (Fessler et al., 1987), στον εχίνο (Mc Carthy et al., 1987), στο σαλιγκάρι (Miller et al., 1991) και στη βδέλλα (Chiquet et al., 1988). Η υψηλού βαθμού συντηρητικότητα σε όλους αυτούς τους οργανισμούς υπογραμμίζει τον σημαντικό ρόλο της λαμινίνης. Στη βιβλιογραφία αναφέρεται ότι η λαμινίνη είναι η πρώτη πρωτεΐνη που ανιχνεύεται στις εξωκυττάριες ουσίες και έχει περιγραφεί σε έμβρυα πολλών οργανισμών (Leivo et al., 1980 Copper and MacQueen, 1983 Dziadek and Timpl, 1985 ανασκόπηση Zagris and Stavridis, 1995 Zagris, 2001). Στον αχινό εντοπίζεται για πρώτη φορά στη βασική μεμβράνη κυττάρων στο στάδιο βλαστιδίου (Spiegel et al., 1983 Mc Carthy et al., 1987). Στο Drosophila melanogaster μέχρι το τέλος της γαστριδίωσης δεν ανιχνεύεται η παρουσία ούτε της πρωτεΐνης, ούτε των μεταγραφημάτων της μετά από 8-9 ώρες ανάπτυξης η πρωτεΐνη ανιχνεύεται στις βασικές μεμβράνες μυών και στο νευρικό σύστημα (Fessler et al., 1987), και αυτή η έκφραση συνεχίζεται στο στάδιο της προνύμφης καθώς και στο ενήλικο άτομο. Στο έμβρυο του αμφιβίου Pleurodeles πολυπεπτίδια που μοιάζουν με την λαμινίνη εντοπίζονται σε εξωκυττάριες ουσίες που ανιχνεύονται στην οροφή του βλαστόκοιλου στο στάδιο του βλαστιδίου (Darribere et al., 1986). Στο έμβρυο του Xenopus με in situ υβριδοποίηση πρωτοανιχνεύτηκε η συσσώρευση μεταγραφημάτων λαμινίνης στα μέσα του σταδίου του γαστριδίου (στάδιο 11 κατά 20

22 Εισαγωγή Nieuwkoop), ενώ αμέσως μετά στο στάδιο 12 ανιχνεύτηκε και η ίδια η λαμινίνη στο ραχιαίο μεσόδερμα με ανοσολογικές μεθόδους (Fey and Hausen, 1990). Στο έμβρυο ποντικού φαίνεται να υπάρχει αναπτυξιακή ρύθμιση της έκφρασης της λαμινίνης( Gerstdorff et al., 2005). Στο αγονιμοποίητο ή γονιμοποιημένο ωάριο έχει ανιχνευθεί μόνο η β1 αλυσίδα. Στα στάδια των 4 και 8 βλαστομεριδίων ανιχνεύονται και οι β1 και γ1 αλυσίδες που εντοπίζονται στην κυτταρική επιφάνεια. Η α1 αλυσίδα πρωτοανιχνεύεται στο στάδιο των 16 βλαστομεριδίων οπότε εντοπίζεται και η λαμινίνη για πρώτη φορά στις εξωκυττάριες ουσίες (Cooper and McQueen, 1983). Στο έμβρυο της όρνιθας με την χρήση αντισωμάτων για το β1 / γ1 σύμπλοκο της λαμινίνης πρωτοανιχνεύτηκε η παρουσία του μορίου αυτού στο στάδιο του βλαστιδίου στην εσωτερική επιφάνεια της επιβλάστης και σε ολόκληρη την υποβλάστη (Bortier et al., 1989 Zagris and Chung, 1990). Στο στάδιο του γαστριδίου, τα κύτταρα που μεταναστεύουν μέσω της πρωτογενούς αύλακας για τη δημιουργία του μεσοδέρματος και ενδοδέρματος εκφράζουν τη λαμινίνη (ανασκόπηση Ζagris, 2001). Η λαμινίνη εμφανίζει εκτεταμένη γλυκοζυλίωση με 15-30% του βάρους της να αποτελείται από υδατάνθρακες (Fujiwara et al., 1988). Υπάρχουν τουλάχιστον 46 δυνητικές θέσεις για Ν - γλυκοζυλίωση στην α1 αλυσίδα και 13 και 14 θέσεις για Ν - γλυκοζυλίωση στην β1 και γ1 αλυσίδες αντίστοιχα. Οι πιο πολλές από αυτές τις θέσεις εντοπίζονται στο μεγάλο βραχίονα προς το καρβοξυτελικό άκρο του μορίου (Knibbs et al., 1989). Μελέτη της λαμινίνης-1 έχει αποκαλύψει την ύπαρξη ενεργών περιοχών που περιέχουν σημαντικές αλληλουχίες αμινοξέων (ΣΧΗΜΑ 2) όπως: α) YIGSR (Tyr - IIe - Gly - Ser - Arg) πενταπεπτίδιο στη περιοχή ΙΙΙ της β1 αλυσίδας που είναι σημαντική στη μετανάστευση, χημειοτακτισμό και την προσκόλληση νεοπλαστικών κυττάρων (Graft et al., 1987 Iwamoto et al., 1987 Yamada and Kleinman, 1992 Nelson et al., 1996) β) RGD (Arg - Gly - Asp) που εντοπίζεται στο μικρό βραχίονα της α1 αλυσίδας στο ποντικό και στο μεγάλο βραχίονα κοντά στο καρβοξυτελικό άκρο της ίδιας αλυσίδας στον άνθρωπο (Aumailley et al., 1990). 21

23 Εισαγωγή Το RGD αναγνωρίζεται από υποδοχείς της κυτταρικής μεμβράνης όπως οι ιντεγκρίνες (Grant et al., 1989b Timpl and Brown, 1994) γ) IKVAV πενταπεπτίδιο (IIe - Lys - Val - Ala - Val) που βρίσκεται στην Ε 8 περιοχή του μεγάλου βραχίονα της λαμινίνης στην α1 αλυσίδα της και παίζει ρόλο στη κυτταρική προσκόλληση, στη προέκταση νευριτών, στην αγγειογέννεση και στη χημειοτακτική κίνηση των ενδοθηλιακών κυττάρων (Deutzman et al., 1990 Yamada and Kleinman, 1992 Matter and Laurie, 1994). Αυτές οι διακριτές θέσεις στο μόριο της λαμινίνης, αναγνωρίζονται από διαφορετικές οικογένειες κυτταρικών υποδοχέων όπως: α) ιντεγκρίνες, β) μη ιντεγκρινικοί υποδοχείς και γ) λεκτίνες (Mecham, 1991 Ekblom, 1996). i. Ιντεγκρίνες Τουλάχιστον 7 διαφορετικές ιντεγκρίνες αναγνωρίζουν συγκεκριμένες θέσεις δέσμευσης πάνω στο μόριο της λαμινίνης όπως φαίνεται και στον παρακάτω ΠΙΝΑΚΑ 2 : Ιντεγκρίνη Δέσμευση στη λαμινίνη 1 ' α 1 β 1 ( περιοχή στο μικρό βραχίονα της α1) E 1 ' α 2 β 1 ( περιοχή στο μικρό βραχίονα της α1) E 1 α 3 β 1 α 6 β 1 / α 7 β 1 ( Ε 3 περιοχή στο μεγάλο βραχίονα στο καρβοξυτελικό άκρο της α1) ( IKVAV αλληλουχία στο μεγάλο βραχίονα της α1) ' α 6 β 4 ( περιοχή στο καρβοξυτελικό άκρο της α1) E 8 ' ( RGD αλληλουχία στη P 1 περιοχή στο μικρό α v β 3 βραχίονα της α1) ΠΙΝΑΚΑΣ 2 Ιντεγκρίνες που προσδένονται στο μόριο της λαμινίνης 22

24 Εισαγωγή Στη περίπτωση των α 1 β 1,α 2 β 1,α v β 3 ιντεγκρινών οι θέσεις δέσμευσης φαίνεται να ενεργοποιούνται σε πρωτεολυτικά τεμάχια του μορίου και όχι όταν το μόριο της λαμινίνης είναι ακέραιο, υποδηλώνοντας ότι οι θέσεις αναγνώρισης είναι "καλυμμένες" (Aumailley et al., 1990 Clement et al., 1990 Timpl and Brown, 1994). Αντίθετα, οι α 3 β 1, α 6 β 1, α 7 β 1 ιντεγκρίνες δεσμεύουν εξ' ίσου ισχυρά τόσο ακέραια τη λαμινίνη όσο και τα πρωτεολυτικά της τεμάχια (Deutzmann et al., 1990 Sonnenberg et al., 1990 Tomaselli et al., 1990 Engel, 1992 Lee et al., 1992 De Simone, 1994 Haas and Plow, 1994 Niessen et al., 1994 Pattaramalai et al., 1996 Ardini et al., 1997 Rabinovits and Mercurio, 1997 Zolkiewska et al., 1998). Οι ιντεγκρίνες αλληλεπιδρούν με την ακτίνη του κυτταρικού σκελετού μέσω της ταλίνης (talin), βινκουλίνης (vinculin) και α- ακτινίνης (a- actinin), πρωτεϊνών του κυτταροπλάσματος και έχει αρχίσει να αναγνωρίζεται η αλληλεπίδραση των ιντεγκρινών με μόρια που είναι σημαντικά στη μεταβίβαση σημάτων στο πυρήνα. ii. Μη ιντεγκρινικοί υποδοχείς Ο πρώτος υποδοχέας της λαμινίνης απομονώθηκε με χρωματογραφία συγγένειας σε στήλη Sepharose - λαμινίνη (Malinoff and Wicha, 1983) και ονομάστηκε 67 KDa υποδοχέας της λαμινίνης (67 LR) λόγω του μοριακού του βάρους. Διαπιστώθηκε ότι επρόκειτο για μια απλή πολυπεπτιδική αλυσίδα που προσδένεται στην αλληλουχία YIGSR της β1 αλυσίδας της λαμινίνης (Mecham, 1991 Ardini et al., 1997). Έκτοτε ο 67 LR εντοπίστηκε σε μυϊκά κύτταρα, μακροφάγα, ουδετερόφιλα, επιθηλιακά και ενδοθηλιακά κύτταρα (ανασκόπηση Mecham, 1991). Ένα συνθετικό 20πεπτίδιο κατασκευασμένο από το πρόδρομο μόριο του 67 LR, το οποίο περιέχει τη θέση δέσμευσης της λαμινίνης προκαλεί αύξηση στην έκφραση λαμινίνης σε καρκινικά κύτταρα και επίσης σταθεροποιεί την πρόσδεση εξωγενούς λαμινίνης στα κύτταρα αυτά (Magnifico et al., 1996). Στην εκδήλωση αυτών των αποτελεσμάτων συμμετέχουν και ορισμένες ιντεγκρίνες όπως η α 6 β 4 (Magnifico et al., 1996 Ardini et al., 1997). 23

25 Εισαγωγή Άλλη κατηγορία υποδοχέα λαμινίνης αποτελεί η α-dystroglycan (αdg) η οποία δημιουργεί σύμπλοκο με τη β-dystroglycan (βdg) σε πολλούς ιστούς και έχει κυρίως μελετηθεί στους σκελετικούς μύες (Deyst et al., 1995). Η αdg είναι γλυκοπρωτεΐνη 156 KDa που συνδέεται ειδικά με τη λαμινίνη στην E 3 περιοχή στο καρβοξυτελικό άκρο της α1 αλυσίδας της (Yamada et al., 1996). Η διαμεμβρανική γλυκοπρωτεΐνη β-dystroglycan (βdg) δεσμεύει μια κυτταροπλασματική πρωτεΐνη την dystrophin η οποία με τη σειρά της αλληλεπιδρά με την ακτίνη (Ervasti and Campell, 1993 Jung et al., 1995 Hemmings et al., 1992 Henry and Campbell, 1996 Cohen et al., 1997). Με αυτό τον τρόπο δημιουργείται μια σύνδεση των εξωκυττάριων ουσιών όπως η λαμινίνη με τον κυτταρικό σκελετό. iii. Λεκτίνες Λεκτίνες μπορούν να δεσμεύονται πάνω στο υδατανθρακικό τμήμα της λαμινίνης (Mecham, 1991). Τέτοιες αλληλεπιδράσεις φαίνεται να μην αναστέλλουν την προσκόλληση κυττάρων στη λαμινίνη, όμως υπάρχουν ενδείξεις ότι επηρεάζουν άλλες ιδιότητες του μορίου όπως το ρόλο του στην κυτταρική μετανάστευση και στην επέκταση των νευριτών (Dean et al., 1990). Είναι γνωστό ότι η λαμινίνη αλληλεπιδρά με αρκετά από τα υπόλοιπα μόρια που απαρτίζουν τη βασική μεμβράνη. H πιο χαρακτηριστική σύνδεση είναι το σύμπλοκο που σχηματίζει με την εντακτίνη (Fox et al., 1991 Mayer et al., Poschl et al., 1996). Επίσης η λαμινίνη μπορεί να δεσμεύει την ηπαρίνη (Sung et al., 1993 Timpl and Brown, 1994 Colognato et al., 1995), τις πρωτεογλυκάνες perlecan (Battaglia et al., 1992) και agrin (Denzer et al., ) και τη fibulin (Brown et al., 1994 Utani et al., 1997). Η λαμινίνη μπορεί να αυτοπολυμεριστεί και να σχηματίσει ένα αντιστρεπτό πολυμερές που δημιουργεί ένα ανεξάρτητο δίκτυο απουσία του κολλαγόνου IV μέσα στις βασικές μεμβράνες (Yurchenco et al., 1992 Timpl and Brown,

26 Εισαγωγή Cheng et al., 1997). Η σύνδεση γίνεται μεταξύ των αμινοτελικών άκρων της λαμινίνης και σταθεροποιείται με τη πρόσδεση ιόντων ασβεστίου στη γ1 αλυσίδα (Schittny and Yurchenco, 1990 Yurchenco and Cheng, 1993 Colognato - Pyke et al., 1995 Yurchenco and Wadsworth, 2004). Οι κυριότερες διεργασίες στις οποίες φαίνεται να συμμετέχει ενεργά η λαμινίνη είναι η κατευθυνόμενη κυτταρική μετανάστευση (Tashiro et al., 1989 Zagris and Chung 1990 Calof and Lander 1991 Lallier et al., 1994 Perris et al., 1996 Crawley et al., 1997 Desban and Duband, 1997 Gianelli et al., 1997), η κυτταρική προσκόλληση (Clement et al., 1990 Yamada and Kleinmann, 1992 Brown et al., 1994 De Simone, 1994 Yao et al., 1996 Hall et al., 1997), η οργάνωση του κυτταροσκελετού (Ervasti and Campbell, 1993 Sastry and Horwitz, 1993 Campbell, 1995 Cohen et al., 1997), η επιβίωση των νευρικών κυττάρων (Edgar et al., 1984 Schmidt and Kater, 1995), η προαγωγή της προέκτασης των νευριτών (Tashiro et al., 1989 Tomaselli et al., 1990 Hynes and Lander, 1992 Richard et al., 1996 Takagi et al., 1996), η προαγωγή του πολλαπλασιασμού των κυττάρων (Drago et al., 1991 Kubota et al., 1992 Yurchenco and O' Rear, 1994), η κυτταρική διαφοροποίηση (Grant et al., 1989b Adams and Watt, 1993 Lin and Bissell, 1993 Kroll et al., 1994 De Archangelis et al., 1996 Tavella et al., 1997 Chamoux et al., 2002 Shaohua et al., 2002), η μορφογένεση (Dong and Chung, 1991 Schuger et al., 1991 Henchcliffe et al., 1993 Thomas et al., 1994 Kadoya et al., 1995 Shaohua et al., 2002 Miner et al., 2004). Μέχρι σήμερα έχουν αναγνωριστεί περισσότερες από τουλάχιστον 10 (5α, 3β, 2γ) γενετικά διακριτές αλυσίδες που συνδυάζονται ανά τρεις (πάντα στο πρότυπο α β γ) για τον σχηματισμό των ισομορφών της λαμινίνης (ΣΧΗΜΑ 4). Για να αντιμετωπιστεί η σύγχυση σχετικά με την ονομασία τόσο των διαφορετικών αλυσίδων όσο και των μορίων λαμινίνης που δημιουργούνται έχει προταθεί πρόσφατα μια καινούργια ονοματολογία (Burgeson et al., 1994). Εκτός από το πρωτότυπο μόριο της λαμινίνης (α1β1γ1), έχουν αρχίσει να συγκεντρώνονται 25

27 Εισαγωγή πληροφορίες και για ορισμένες από τις υπόλοιπες ισομορφές της λαμινίνης: η λαμινίνη 2 ή merosin (α2β1γ1) εντοπίστηκε στη βασική μεμβράνη νευρικών Laminin isoforms Isoform Chain composition Mediates cell adhesion Entactin binding Laminin-1 α1β1γ1 + + Laminin-2 α2β1γ1 + + Laminin-3 α1β2γ1 nt nt Laminin-4 α2β2γ1 + + Laminin-5 α3β3γ2 + - Laminin-6 α3β1γ1 nt nt Laminin-7 α3β2γ1 nt + Laminin-8 α4β1γ1 nt nt Laminin-9 α4β2γ1 nt nt Laminin-10 α5β1γ1 nt nt Laminin-11 α5β2γ1 nt nt ΣΧΗΜΑ 4. Ισομορφές της λαμινίνης 26

28 Εισαγωγή κυττάρων στα κύτταρα Schwann, γραμμωτών μυών, στην καρδιά και στον πλακούντα (Leivo and Engvall, 1988 Ehrig et al., 1990 Engel, 1992 Bernier et al., 1994 Yamada et al., 1996). Στον ποντικό η λαμινίνη 2 ανιχνεύεται μετά τη γέννηση και έχει παρατηρηθεί ότι ζώα που παρήγαγαν μειωμένες ποσότητες από την α2 αλυσίδα υπέφεραν από νευρομυϊκή δυστροφία λόγω διαταραχής της φυσιολογικής επικοινωνίας των εξωκυττάριων ουσιών με τον κυτταροσκελετό του μυός ή του νεύρου (Sunada et al., 1994 Miyagoe et al., 1997). Σε μυοβλαστικές κυτταρικές σειρές από άνθρωπο και ποντικό, κατά τη δημιουργία των πολυπύρηνων μυοσωλήνων παρατηρείται έξαρση στην έκφραση της λαμινίνης-2 η οποία σταθεροποιεί και αυξάνει την επιβίωση αυτών των δομών (Vachon et al., 1996). Η α2 αλυσίδα της λαμινίνης 2 αναγνωρίζεται από τις ίδιες ακριβώς ιντεγκρίνες που αναγνωρίζουν και την α1 αλυσίδα του προτύπου μορίου λαμινίνης 1 (Colognato et al., 1997). Η λαμινίνη 3 ή s Iaminin (α1β2γ1) έχει ανιχνευθεί σε περιοχές νευρομυϊκής σύναψης και φαίνεται να συμμετέχει στη σύνδεση των γραμμωτών μυών με τα κινητικά νεύρα (Hunter et al., 1989 Martin et al., 1995 Noakes et al., 1995). Το τριπεπτίδιο Leu Arg Glu (LRE) της β2 αλυσίδας της λαμινίνης-3 προάγει την αύξηση αξόνων κινητικών νεύρων in vitro (Brandenberger et al., 1996). Η λαμινίνη-5 ή Kalinin / nicein (α3β3γ2) αποτελεί το μικρότερο μέλος της οικογένειας των λαμινινών. Συγκρινόμενη με το πρωτότυπο μόριο λαμινίνης-1 παρατηρούμε ότι στην α3 αλυσίδα λείπει τελείως ο μικρός βραχίονας, ενώ οι β3 και γ2 αλυσίδες στερούνται τμήμα των μικρών βραχιόνων τους (Timpl and Brown, 1994).Η λαμινίνη-5 έχει ανιχνευθεί στη βασική μεμβράνη μεταξύ της επιδερμίδας και της δερμίδας (O Toole et al., 1997 Stahl et al., 1997). Αλληλεπιδρώντας με άλλες πρωτεΐνες όπως η λαμινίνη 1, η fibulin 2 και το κολλαγόνο IV στα ημιδεσμοσώματα συντελεί στη διατήρηση της δομικής σταθερότητας στη σύνδεση της δερμίδας με την επιδερμίδα (Baker et al., 1996 Utani et al., 1997). Διαπιστώθηκε ότι υπάρχει μειωμένη παραγωγή της λαμινίνης-5 σε άτομα που πάσχουν από την ασθένεια Herlitz s junctional epidermolysis bullosa που χαρακτηρίζεται από τη δημιουργία εκδορών και πληγών στο δέρμα (Aberdam et al., 1994 Pulkkinen et al., 1994). Από τη μελέτη της δομής της λαμινίνης 5 συμπε- 27

29 Εισαγωγή ραίνεται ότι η γ2 αλυσίδα δεν μπορεί να δεσμεύσει την εντακτίνη (Mayer et al., 1995) και έτσι η λαμινίνη 5 δεν μπορεί να συνδεθεί με την perlecan ή το πλέγμα κολλαγόνου IV. Επίσης η λαμινίνη 5 στερείται περιοχές στους μικρούς της βραχίονες που συμμετέχουν στον αυτοπολυμερισμό του μορίου και έτσι πιθανά να μην μπορεί να πολυμεριστεί.(yurchenco et al., 1992). Η ενσωμάτωση της λαμινίνης 5 στη βασική μεμβράνη επιτυγχάνεται μέσω ενός μοναδικού μηχανισμού σταυρωτής σύνδεσης με τη λαμινίνη 6 (α3β1γ1) και τη λαμινίνη 7 (α3β2γ1) (Champliaud at al, 1996 Cheng et al., 1997). δ. Εντακτίνη (entactin / nidogen) Η εντακτίνη πρωτοαναγνωρίστηκε από τον Chung και συνεργάτες του (1977) ως ένα γλυκοπρωτεϊνικό συστατικό των εξωκυττάριων ουσιών από τη νεοπλαστική κυτταρική σειρά M 1536 B 3 από ποντικό. Αργότερα απομονώθηκε από την ίδια πηγή, χαρακτηρίστηκε ως μια θειούχος γλυκοπρωτεΐνη μοριακού βάρους περίπου 158 KDa και ονομάστηκε εντακτίνη (Carlin et al., 1981). Αντισώματα που κατασκευάστηκαν εναντίον της αναγνώρισαν επιτόπους σε πλήθος βασικών μεμβρανών, φανερώνοντας ότι αποτελούσε βασικό συστατικό τους. (Bender et al., 1981 Martinez Hernandez and Chung, 1984). Παράλληλα άλλη ερευνητική ομάδα απομόνωσε από τη βασική μεμβράνη του Englebreth Holm Swarm (EHS) όγκου ποντικού ένα συστατικό μοριακού βάρους 80 KDa το οποίο ονόμασαν nidogen (Timpl et al., 1983). Στη συνέχεια όμως αποδείχθηκε ότι το nidogen ήταν απλά ένα πρωτεολυτικό κομμάτι της εντακτίνης (Durkin et al., 1988 Mann et al., 1989). Μετά την αρχική αναγνώριση της εντακτίνης σε καρκινικούς όγκους, το μόριο μελετήθηκε σε πολλούς οργανισμούς όπως στο ποντικό (Mann et al., 1989 Miosge et al., 2000 Schymeinsky et al., 2002), στον αρουραίο (Durkin et al., 1987), στον άνθρωπο (Nagayoshi et al., 1989) και στα θαλάσσια χιτινοφόρα (ascidians) (Nakae et al., 1993). 28

30 Εισαγωγή Παρατήρηση του μορίου της εντακτίνης κάτω από ηλεκτρονικό μικροσκόπιο, φανέρωσε μια δομή με δύο ανόμοια σφαιρικά άκρα που ενώνονται μέσω ενός ραβδόμορφου τμήματος, θυμίζοντας την μπάρα της άρσης βαρών (Fox et al., 1991). Η σύνθεση ανασυνδυασμένης εντακτίνης και η απομόνωσή της σε ευκαρυωτικό σύστημα έκφρασης χωρίς τη χρήση αποδιατακτικών παραγόντων, αποκάλυψε ότι το μεγάλο σφαιρικό άκρο, που αντιστοιχεί στην αμινοτελική περιοχή της εντακτίνης αποτελείται από δύο σφαιρικές περιοχές που ονομάστηκαν G 1 και G 2 (Fox et al., 1991). Αυτό το άκρο που αντιστοιχεί στα αμινοξέα συνδέεται, μέσω της ραβδόμορφης περιοχής Ε που είναι πλούσια σε κυστεΐνες και αντιστοιχεί στα αμινοξέα , με τη G 3 ενεργή περιοχή προς το καρβοξυτελικό άκρο (Durkin et al., 1988) (ΣΧΗΜΑ 5). G1 G2 G3 ΣΧΗΜΑ 5. Δομή εντακτίνης 29

31 Εισαγωγή Στο μόριο της εντακτίνης υπάρχουν έξι περιοχές (οι πέντε στο Ε τμήμα της πρωτεΐνης) μιας καθορισμένης επανάληψης αμινοξέων που υπάρχει και στον Epidermal Growth Factor (EGF). Κάθε επανάληψη αποτελείται από 40 αμινοξέα, εκ των οποίων τα έξι είναι κυστεΐνες, ενώ δώδεκα ακόμη είναι συντηρητικά. Η θέση αυτών των επαναλήψεων φαίνεται να καθορίζει τις περιοχές του μορίου που είναι ευαίσθητες στις πρωτεάσες (Mayer et al., 1993α). Μέσα στη δεύτερη από αυτές τις επαναλήψεις στην Ε περιοχή της εντακτίνης, βρίσκεται η αλληλουχία RGD που αναγνωρίζεται από ιντεγκρίνες και συμμετέχει στην κυτταρική προσκόλληση (Dong et al., 1995). Στη G 3 ενεργό περιοχή κοντά στο καρβοξυτελικό άκρο της εντακτίνης περιέχονται πέντε διαδοχικά αντίγραφα ενός σταθερού προτύπου από τέσσερα συντηρητικά αμινοξέα YWTD (Tyr Trp Thr Asp), που περιέχει. Αυτό το πρότυπο συναντάται και σε άλλα μόρια όπως το πρόδρομο του EGF και ο υποδοχέας της LDL (Low Density Lipoprotein) (Chung and Durkin, 1990). Η G 1 ενεργός περιοχή της εντακτίνης περιέχει δύο αλληλουχίες στα αμινοξέα μεταξύ και που δεσμεύουν ασβέστιο. Η πρώτη, τρίτη, πέμπτη, ένατη και δωδέκατη θέση έχουν αμινοξέα που περιέχουν οξυγόνο και μπορούν να συνδυασθούν με ιόντα Ca 2+, αλλά δεν βρίσκονται στη helix loop helix διαμόρφωση όπως συμβαίνει σε άλλες πρωτεΐνες που δεσμεύουν ασβέστιο, όπως για παράδειγμα η καλμοδιουλίνη (calmodulin) (Chakravarti et al., 1990). Η ευαισθησία της εντακτίνης στις πρωτεάσες είχε διαγνωστεί από την αρχική δυσκολία να απομονωθεί ακέραια από τον EHS όγκο. Η ενδογενής αποικοδόμηση του μορίου παράγει κομμάτια συγκεκριμένου μοριακού βάρους, με πιο σταθερά τα Mr 130 και Mr 100. Μια από τις πιο ευαίσθητες περιοχές είναι ένα υδροφιλικό τμήμα περίπου 110 αμινοξέων, που εντοπίζεται στο μικρό τμήμα που συνδέει τη G 1 με τη G 2 ενεργή περιοχή (Mayer et al., 1993a). Ευαισθησία σε πρωτεάσες εντοπίστηκε και στη G 3 περιοχή, ενώ αντίθετα η G 1 και η G 2 εμ- 30

32 Εισαγωγή φανίζουν πολύ μεγάλη ανθεκτικότητα. Αυτό πιθανά οφείλεται στην ύπαρξη μιας θέσης για N γλυκοζυλίωση σε κάθε μια από τις G 1 και G 2 αλλά καμία στη G 3 περιοχή (Mayer et al., 1993a 1995b). Η πλήρης πολυπεπτιδική ακολουθία της εντακτίνης στο ποντικό έχει προσδιοριστεί με cdna κλωνοποίηση (Durkin et al., 1988 Mann et al., 1989). Διαπιστώθηκε η ύπαρξη επτά θέσεων για Ο γλυκοζυλίωση, εκ των οποίων οι πέντε εντοπίζονται στο σύνδεσμο μεταξύ G 1 και G 2 περιοχής στα αμινοξέα , και οι υπόλοιπες δύο στην αρχή της G 3 περιοχής στα αμινοξέα (Fujiwara et al., 1993). Έχει ήδη αναφερθεί η ύπαρξη μεγάλου βαθμού συντηρητικότητας για την εντακτίνη μεταξύ των ειδών. Η εντακτίνη ανθρώπου εμφανίζει 85% αμινοξική ομολογία και διατηρεί όλα τα βασικά χαρακτηριστικά με την εντακτίνη ποντικού, εκτός του ότι περιέχει δύο πρόσθετα αμινοξέα και ότι οι δύο θέσεις για Ν γλυκοζυλίωση έχουν αντικατασταθεί από μία μόνο κοντά στο καρβοξυτελικό άκρο (Nagayoshi et al., 1989 Mayer et al., 1995b). Ανάλυση ενός κλώνου εντακτίνης αρουραίου έχει δείξει 93% ομολογία με την εντακτίνη ποντικού (Durkin et al., 1987). Η εντακτίνη στα Ασκίδια (Ascidians) διαφέρει από αυτή των θηλαστικών στον αριθμό και τη διάταξη των πλούσιων σε κυστεΐνη επαναλήψεων καθώς διαθέτει μόνο δύο τέτοια αντίγραφα που εντοπίζονται από ένα στη G 2 και G 3 περιοχή της εντακτίνης (Nakae et al., 1993). Μέχρι σήμερα δεν έχει αναφερθεί η ύπαρξη ισομορφών εντακτίνης. i. Βιοσύνθεση και ρύθμιση έκφρασης εντακτίνης Η βιοσύνθεση της εντακτίνης έχει μελετηθεί στη Μ 1536 Β 3 ενδοδερμική καρκινωματική σειρά ποντικού. Εκεί το μόριο συντίθεται στα πολυσώματα σε συνάφεια με το αδρό ενδοπλασματικό δίκτυο και στον ίδιο χώρο πραγματοποιούνται οι μεταμεταφραστικές τροποποιήσεις και η Ν γλυκοζυλίωση της εντακτίνης, που μπορεί να ανασταλεί με τη χρήση του αντιβιοτικού tunicamycin (Chung et 31

33 Εισαγωγή al., 1977 Cooper et al., 1981). Η 0 γλυκοζυλίωση καθώς και η 0 σουλφούρωση στη τυροσίνη συμβαίνουν καθώς το μόριο κατευθύνεται προς το σύμπλεγμα Golgi (Aratani and Kitagawa, 1988). Φαίνεται να υπάρχει μια συσχέτιση μεταξύ της σύνθεσης της εντακτίνης και της συγκέντρωσης των εξωκυττάριων ουσιών, καθώς σε έμβρυα ποντικού λίγο πριν από την εμφύτευσή τους, η εντακτίνη ανιχνεύεται αργότερα από τη λαμινίνη, συμπίπτοντας χρονικά με τη πρώτη εμφάνιση των εξωκυττάριων ουσιών. (Wu et al., 1983 Dziadek and Timpl, 1985). Η ρύθμιση της βιοσύνθεσης της εντακτίνης έχει μελετηθεί και στα F 9 εμβρυϊκά καρκινωματικά κύτταρα ποντικού που εκτέθηκαν σε ρετινοϊκό οξύ και dibutiryl AMP (Carlin et al., 1983). Διαπιστώθηκε επαγωγή της διαφοροποίησης των κυττάρων αυτών σε ενδοδερμικά κύτταρα και αύξηση της σύνθεσης λαμινίνης φορές και εντακτίνης 2 5 φορές σε σχέση με τη σύνθεση αυτών των μορίων στα F 9 κύτταρα που δεν εκτέθηκαν σε ρετινοϊκό οξύ και dibutiryl AMP (Dziadek and Timpl, 1985). Εκτός από ποσοτικές διαφορές στη ρύθμιση της έκφρασης της εντακτίνης και της λαμινίνης, προέκυψαν και διαφορές αναφορικά με το χρόνο που απαιτείται για την ενεργοποίηση αυτής της ρύθμισης. Τα επίπεδα των mrna για τις α1, β1 και γ1 αλυσίδες της λαμινίνης αυξάνουν μεταξύ 48 και 72 ωρών από την αρχή της έκθεσης σε ρετινοϊκό οξύ και db AMP (Durkin et al., 1986). Η αύξηση των επιπέδων του mrna της εντακτίνης γίνεται μεταξύ 72 και 96 ωρών αντίστοιχα (Durkin et al., 1987). ii. Εντακτίνη και συγκρότηση βασικής μεμβράνης Ο ρόλος της εντακτίνης είναι βασικός στη συγκρότηση αλλά και την άμεση αποικοδόμηση των βασικών μεμβρανών, καθώς η εντακτίνη μπορεί να συνδέεται ισχυρά, τόσο με την λαμινίνη όσο και με το κολλαγόνο IV, φέρνοντας έτσι σε στενή επαφή αυτά τα δύο μόρια που από μόνα τους εμφανίζουν μικρού βαθμού 32

34 Εισαγωγή συγγένεια. Επίσης η αυξημένη ευαισθησία της εντακτίνης σε πρωτεάσες συντελεί στη γρήγορη αποικοδόμηση των βασικών μεμβρανών, όποτε αυτό είναι αναγκαίο. Η εντακτίνη δημιουργεί ένα ισχυρό μη ομοιοπολικό σύμπλοκο με τη λαμινίνη, που μπορεί να διασπαστεί μόνο με τη χρήση ισχυρών αποδιατακτικών παραγόντων όπως η ουρία, το SDS (Sodium Dodecyl Sulfate) και η υδροχλωρική γουανιδίνη (Carlin et al., 1983 Dziadek et al., 1985). Εξέταση του συμπλόκου λαμινίνης εντακτίνης με ηλεκτρονική μικροσκοπία έδειξε ότι ένα μόριο εντακτίνης προσδένεται δια μέσου της G 3 περιοχής του καρβοξυτελικού του άκρου (Paulsson et al., 1987 Mann et al., 1989) πάνω στην τέταρτη EGF όμοια αλληλουχία της ενεργής περιοχής ΙΙΙ της γ1 αλυσίδας της λαμινίνης (Gerl et al., 1991 Mayer et al., 1993b Pöschl et al., 1994 Tungall et al., 2003). Η συγκρότηση του συμπλόκου λαμινίνης εντακτίνης φαίνεται να πραγματοποιείται εξωκυτταρικά, όπως για παράδειγμα κατά τη μορφογένεση του οφθαλμού στη περίπτωση του ποντικού, όπου διαφορετικοί κυτταρικοί πληθυσμοί είναι υπεύθυνοι για τη σύνθεση της εντακτίνης και της λαμινίνης και συνεργούν στη δημιουργία της βασικής μεμβράνης του χρωματοφόρου επιθηλίου (Dong and Chung, 1991). Απουσία κολλαγόνου IV το απομονωμένο σύμπλοκο λαμινίνης εντακτίνης μπορεί να αυτοσυγκροτηθεί και να δημιουργήσει συσσωματώματα που σε καλλιέργειες κυττάρων δημιουργούν δομές που μοιάζουν με τη βασική μεμβράνη (Brauer and Keller, 1989). Πολλές από τις ιδιότητες της λαμινίνης φαίνεται να τροποποιούνται όταν αυτή συνδεθεί με την εντακτίνη. Για παράδειγμα το σύμπλοκο λαμινίνης εντακτίνης φαίνεται να είναι πολύ πιο αποτελεσματικό από την ίδια την λαμινίνη στη προαγωγή της διασποράς μετανάστευσης των κυττάρων των νευρικών κρηπίδων (neural crest) ( Perris et al., 1989). Επίσης η σύνδεση της λαμινίνης με το κολλαγόνο IV γίνεται πολύ πιο αποτελεσματικά δια μέσω του συμπλόκου λαμινίνης εντακτίνης παρά με την απομονωμένη λαμινίνη (Aumailley et al., 1989). Είναι γνωστό ότι η εντακτίνη αναστέλλει την ενεργότητα της λαμινίνης για προαγωγή 33

35 Εισαγωγή της προέκτασης αξόνων και την επιβίωση των νευρικών κυττάρων (Muir et al., 1989). Παρόλο που γνωρίζουμε ότι τα μεσεγχυματικά κύτταρα εκφράζουν το mrna της εντακτίνης, αλλά και συνθέτουν την ίδια την πρωτεΐνη, η ανίχνευση της εντακτίνης με πειράματα ανοσοφθορισμού σ αυτούς τους κυτταρικούς πληθυσμούς παρουσίαζε μεγάλες δυσκολίες πιθανά λόγω της αυξημένης ευαισθησίας της στις πρωτεάσες (Thomas and Dziadek, 1993 Ekblom et al., 1994 Senior et al., 1996 Kadoya et al., 1997). Η συμμετοχή όμως της εντακτίνης σε σύμπλοκο με τη λαμινίνη μειώνει τη πρωτεολυτική της ευαισθησία γι αυτό και ανιχνεύεται πλέον πιο εύκολα στις βασικές μεμβράνες επιθηλίων (Mayer et al., 1993a 1995b). Η σύνδεση της εντακτίνης στη γ1 αλυσίδα της λαμινίνης και οι πολύ σημαντικές συνέπειες στη λειτουργία και των δυο γλυκοπρωτεϊνών, προκάλεσε το εύλογο ενδιαφέρον για τη δημιουργία ή όχι του συμπλόκου στη λαμινίνη 5 (nicein / kalinin), όπου η γ1 αλυσίδα της έχει αντικατασταθεί από τη γ2. Πρωτοταγής ανάλυση της γ2 αλυσίδας έδειξε ότι το EGF - όμοιο πρότυπο γ2iii 4 ήταν κατά 77% ταυτόσημο με το πρότυπο γ1iii 4 της γ1 αλυσίδας στο οποίο προσδενόταν η εντακτίνη. Λεπτομερής εξέταση της θέσης δέσμευσης φανέρωσε ότι στο κρίσιμο επταπεπτίδιο (Asn Iie Asp Pro Asn Ala Val) του γ1iii 4 προτύπου είχαν αντικατασταθεί μια Asn και μια Val με δύο Ser στο γ2iii 4 πρότυπο (Pöschl et al., 1994). Η ενεργότητα δέσμευσης της εντακτίνης από τη γ2 αλυσίδα ήταν φορές μικρότερη από την ενεργότητα της γ1 αλυσίδας. Όταν όμως επανατοποθετήθηκαν η Asn και η Val αντί των δύο Ser στο γ2iii 4 πρότυπο, η ενεργότητά του για δέσμευση της εντακτίνης ήταν μόνο πέντε φορές μικρότερη από την αντίστοιχη ενεργότητα της γ1iii 4 (Mayer et al., 1995a). Η παρουσία των ιόντων ασβεστίου είναι απαραίτητη για τη συγκρότηση του συμπλόκου λαμινίνης εντακτίνης σε υπερμοριακές δομές. Έτσι ο κρίσιμος παράγοντας ήταν ότι τα διαλύματα περιείχαν τα δισθενή κατιόντα Mg 2+ και Ca 2+ κατά 34

36 Εισαγωγή την απομόνωση των εξωκυττάριων ουσιών από τη M 1536 B 3 σειρά από ποντικό, καθώς επίσης και η παρουσία χυλικών παραγόντων που βελτίωνε σημαντικά την απομόνωση του συμπλόκου λαμινίνης εντακτίνης σε άθικτη μορφή κατά την εκχύλιση των EHS όγκων (Paulsson et al.,1987 Chung and Durkin, 1990). In vitro πειράματα πολυμερισμού της λαμινίνης, ανασυνδυασμένης (recombinant) εντακτίνης και του συμπλόκου τους, έδειξαν σε όλες τις περιπτώσεις ότι η δημιουργία των συσσωμάτων εξαρτώταν από τη θερμοκρασία όπου στους ο C η πλειοψηφία των μονομερών είχε μετατραπεί σε πολυμερή και από τη συγκέντρωση των ιόντων Ca 2+ όπου συγκέντρωση 15 μμ προκαλούσε επαγωγή πολυμερισμού της λαμινίνης. Καθορισμός της σταθεράς σύνδεσης για το ασβέστιο στο σύμπλοκο λαμινίνης εντακτίνης φανέρωσε δεκαέξι θέσεις δέσμευσης εκ των οποίων πιστεύεται ότι δυο με τρεις με τη μεγαλύτερη συγγένεια εμπλέκονται στο φαινόμενο πολυμερισμού (Paulsson, 1988). Η κινητική πολυμερισμού της λαμινίνης είναι ίδια με αυτή του πολυμερισμού της λαμινίνης που είναι σε σύμπλοκο με την εντακτίνη, οδηγώντας στο συμπέρασμα ότι η εντακτίνη δεν επηρεάζει αυτό το φαινόμενο. Τα σύμπλοκα λαμινίνης εντακτίνης ενώνονται σταυρωτά μεταξύ τους με τη βοήθεια διαγλουταμινασών (Aeshlimann and Paulsson, 1991). Η εντακτίνη εκτός από το σύμπλοκο με τη λαμινίνη μπορεί να δεσμεύει ισχυρά και το κολλαγόνο IV (Mann et al., 1988). Η σύνδεση αυτή πραγματοποιείται με τη συμμετοχή της G 2 ενεργής περιοχής της εντακτίνης και μιας θέσης στη τριπλή έλικα του κολλαγόνου, περίπου 80 nm από το καρβοξυτελικό του άκρο (Aumailley et al., 1989 Chung et Durkin, 1990 Reinhard et al., 1993). Με αυτό τον τρόπο δημιουργείται το τριπλό σύμπλοκο λαμινίνης εντακτίνης και κολλαγόνου IV (Yurchenco and O Rear, 1994). Βλέπετε τις αλληλεπιδράσεις μεταξύ των μορίων αυτών στο Σχήμα 6. 35

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013)

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013) Kυτταρική Bιολογία ΔIAΛEΞΗ 4 (6/3/2013) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές Φωσφολιπιδική μεμβράνη

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών Χηµική Μεταβίβαση Σήµατος Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών 1 Η Επικοινωνία στα Ζωϊκά Κύτταρα 1. Δίκτυα εξωκυτταρικών και ενδοκυτταρικών

Διαβάστε περισσότερα

Η κυτταρική µετατόπιση των πρωτεϊνών

Η κυτταρική µετατόπιση των πρωτεϊνών 9-1 Κεφάλαιο 9 Η κυτταρική µετατόπιση των πρωτεϊνών Εισαγωγή Στο κύτταρο η έκφραση των πρωτεϊνών γίνεται από µόνο ένα τύπο ριβοσώµατος (εκτός των µιτοχονδριακών και των χλωροπλαστικών που µοιάζουν µε αυτά

Διαβάστε περισσότερα

Στηρικτικά Κύτταρα και Εξωκυττάρια Ουσία. Κοτσίνας Αθανάσιος Επικ. Καθηγητής Εργ. Ιστολογίας-Εμβρυολογίας Ιατρική Σχολή - ΕΚΠΑ

Στηρικτικά Κύτταρα και Εξωκυττάρια Ουσία. Κοτσίνας Αθανάσιος Επικ. Καθηγητής Εργ. Ιστολογίας-Εμβρυολογίας Ιατρική Σχολή - ΕΚΠΑ Στηρικτικά Κύτταρα και Εξωκυττάρια Ουσία Κοτσίνας Αθανάσιος Επικ. Καθηγητής Εργ. Ιστολογίας-Εμβρυολογίας Ιατρική Σχολή - ΕΚΠΑ Συνδετικός Ιστός - Ορισμός Παρέχει το: Υποστηρικτικό και Συνδετικό πλαίσιο

Διαβάστε περισσότερα

Kυτταρική$Bιολογία$ Πολυκυτταρική+οργάνωση+και+ καρκίνος+ ΔIAΛEΞΕΙΣ*15*&*16! (18!&!21/5/2012)! Δρ.$Xρήστος$Παναγιωτίδης,$Τμήμα$Φαρμακευτικής$Α.Π.Θ.

Kυτταρική$Bιολογία$ Πολυκυτταρική+οργάνωση+και+ καρκίνος+ ΔIAΛEΞΕΙΣ*15*&*16! (18!&!21/5/2012)! Δρ.$Xρήστος$Παναγιωτίδης,$Τμήμα$Φαρμακευτικής$Α.Π.Θ. Kυτταρική$Bιολογία$ ΔIAΛEΞΕΙΣ*15*&*16! (18!&!21/5/2012)! Πολυκυτταρική+οργάνωση+και+ καρκίνος+ Ας+ξαναθυμηθούμε+για+λίγο+ τη+κυτταρική+θεωρία+ Η*κυτταρική*θεωρία*! OΛOI!OI!ZΩNTANOI!OPΓANIΣMOI! AΠOTEΛOYNTAI!AΠO!KYTTAPA!H!AΠO!

Διαβάστε περισσότερα

οµή και Αναδίπλωση πρωτεϊνών

οµή και Αναδίπλωση πρωτεϊνών οµή και Αναδίπλωση πρωτεϊνών Νηφόρου Κατερίνα Μεταδιδακτορική Ερευνήτρια, Οµάδα Μοριακής Καρκινογένεσης, Εργ/ριο Ιστολογίας-Εµβρυολογίας, Ιατρική Σχολή Αθηνών Σηµασία των πρωτεϊνών Ενζυµική κατάλυση Μεταφορά

Διαβάστε περισσότερα

Kυτταρική$Bιολογία$ Πολυκυτταρική+οργάνωση+και+ καρκίνος+ ΔIAΛEΞΕΙΣ*19*&*20! (21!&!28/5/2014)! Δρ.$Xρήστος$Παναγιωτίδης,$Τμήμα$Φαρμακευτικής$Α.Π.Θ.

Kυτταρική$Bιολογία$ Πολυκυτταρική+οργάνωση+και+ καρκίνος+ ΔIAΛEΞΕΙΣ*19*&*20! (21!&!28/5/2014)! Δρ.$Xρήστος$Παναγιωτίδης,$Τμήμα$Φαρμακευτικής$Α.Π.Θ. Kυτταρική$Bιολογία$ ΔIAΛEΞΕΙΣ*19*&*20! (21!&!28/5/2014)! Πολυκυτταρική+οργάνωση+και+ καρκίνος+ Ας+ξαναθυμηθούμε+για+λίγο+ τη+κυτταρική+θεωρία+ Η*κυτταρική*θεωρία*! OΛOI!OI!ZΩNTANOI!OPΓANIΣMOI! AΠOTEΛOYNTAI!AΠO!KYTTAPA!H!AΠO!

Διαβάστε περισσότερα

Δομικές κατηγορίες πρωτεϊνών

Δομικές κατηγορίες πρωτεϊνών 3-1 Κεφάλαι ο Δομικές κατηγορίες πρωτεϊνών 3.1. α-δομές πρωτεϊνών Οι α-έλικες είναι δομικά στοιχεία που μπορούν να σχηματίσουν πολλές κατηγορίες στερεοδομών και με πολλές διαφορετικές λειτουργίες. Εκτός

Διαβάστε περισσότερα

ΜΕΣΟΘΕΡΑΠΕΙΑ ΕΝΕΣΙΜΗ ΤΟΠΙΚΗ ΘΕΡΑΠΕΙΑ

ΜΕΣΟΘΕΡΑΠΕΙΑ ΕΝΕΣΙΜΗ ΤΟΠΙΚΗ ΘΕΡΑΠΕΙΑ ΜΕΣΟΘΕΡΑΠΕΙΑ ΕΝΕΣΙΜΗ ΤΟΠΙΚΗ ΘΕΡΑΠΕΙΑ ΜΕΣΟΘΕΡΑΠΕΙΑ Αυτό σημαίνει ότι χρησιμοποιούμε μόνο ενέσιμα φάρμακα και μόνο στο σημείο που πάσχει. ΜΕΣΟΘΕΡΑΠΕΙΑ Ξεκίνησε στη λογική του γιατί να μη χορηγήσω ένα αντιφλεγμονώδες

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα

ΑΥΤΟΣΥΓΚΡΟΤΗΣΗ ΥΠΕΡΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΚΑΨΙΔΙΑ ΙΩΝ ΚΑΙ ΦΑΓΩΝ ΒΑΚΤΗΡΙΑΚΕΣ ΜΑΣΤΗΓΙΝΕΣ ΦΥΣΙΟΛΟΓΙΚΗ ΚΑΙ ΜΗ-ΦΥΣΙΟΛΟΓΙΚΗ ΣΥΣΣΩΜΑΤΩΣΗ

ΑΥΤΟΣΥΓΚΡΟΤΗΣΗ ΥΠΕΡΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΚΑΨΙΔΙΑ ΙΩΝ ΚΑΙ ΦΑΓΩΝ ΒΑΚΤΗΡΙΑΚΕΣ ΜΑΣΤΗΓΙΝΕΣ ΦΥΣΙΟΛΟΓΙΚΗ ΚΑΙ ΜΗ-ΦΥΣΙΟΛΟΓΙΚΗ ΣΥΣΣΩΜΑΤΩΣΗ ΑΥΤΟΣΥΓΚΡΟΤΗΣΗ ΥΠΕΡΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΚΑΨΙΔΙΑ ΙΩΝ ΚΑΙ ΦΑΓΩΝ ΒΑΚΤΗΡΙΑΚΕΣ ΜΑΣΤΗΓΙΝΕΣ ΦΥΣΙΟΛΟΓΙΚΗ ΚΑΙ ΜΗ-ΦΥΣΙΟΛΟΓΙΚΗ ΣΥΣΣΩΜΑΤΩΣΗ Αυτοσυγκρότηση υπερμοριακων δομών Υπενθύμιση: κολλαγονο ΚΑΨΙΔΙΑ (ΚΕΛΥΦΗ) ΙΩΝ ΚΑΙ

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ Θέμα: ΜΕΤΟΥΣΙΩΣΗ ΠΡΩΤΕΪΝΩΝ (άσκηση 7 του εργαστηριακού οδηγού) Μέσος χρόνος πειράματος: 45 λεπτά Α. ΑΝΑΛΩΣΙΜΑ Εργαλεία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 1 Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται

Διαβάστε περισσότερα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα Κύτταρο Το κύτταρο αποτελείται από μέρη τα οποία έχουν συγκεκριμένη δομή και επιτελούν μία συγκεκριμένη λειτουργία στην όλη οργάνωση του κυττάρου. Δομή κυτταροπλασματικής μεμβράνης Συστήματα επικοινωνίας

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Athens 2010 Μαρία Α. Καρδάση

Athens 2010 Μαρία Α. Καρδάση Athens 2010 Γλυκοζυλίωση Τα τελευταία χρόνια όληηπροσπάθειατης αισθητικής αποκατάστασης του γηρασμένου δέρματος αφορούσε κυρίως την αποκατάσταση της εξωγενούς γήρανσης φωτογήρανσης. Τι γίνεται όμως με

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΜΟΡΙΑΚΑ ΜΟΝΤΕΛΑ 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING) 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΜΑΤΑ 1.Πώς οι κινητικές παράμετροι Κ m και K cat χρησιμεύουν για να συγκριθεί η ανακύκλωση διαφορετικών

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΜΟΡΙΑΚΑ ΜΟΝΤΕΛΑ 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING) 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING)

Διαβάστε περισσότερα

Oδοί και μηχανισμοί ευκαρυωτικής μεταγωγής σήματος

Oδοί και μηχανισμοί ευκαρυωτικής μεταγωγής σήματος MOPIAKH BIOΛOΓIA ΦAPMAKEYTIKHΣ ΔIAΛEΞΕΙΣ 10-12 Oδοί και μηχανισμοί ευκαρυωτικής μεταγωγής σήματος (Πως γίνονται αντιληπτά τα μηνύματα και πως δίδονται οι απαντήσεις) Δρ. Xρήστος Παναγιωτίδης, Tµήµα Φαρµακευτικής

Διαβάστε περισσότερα

ΜΑΘΗΜΑ 3ο ΜΕΡΟΣ Β ΔΙΑΒΙΒΑΣΗ ΣΤΗ ΝΕΥΡΟΜΥΪΚΗ ΣΥΝΑΨΗ

ΜΑΘΗΜΑ 3ο ΜΕΡΟΣ Β ΔΙΑΒΙΒΑΣΗ ΣΤΗ ΝΕΥΡΟΜΥΪΚΗ ΣΥΝΑΨΗ ΜΑΘΗΜΑ 3ο ΜΕΡΟΣ Β ΔΙΑΒΙΒΑΣΗ ΣΤΗ ΝΕΥΡΟΜΥΪΚΗ ΣΥΝΑΨΗ Η νευρομυϊκή σύναψη αποτελεί ιδιαίτερη μορφή σύναψης μεταξύ του κινητικού νευρώνα και της σκελετικής μυϊκής ίνας Είναι ορατή με το οπτικό μικροσκόπιο Στην

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ.

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ. Kυτταρική Bιολογία ΔIAΛEΞΗ 3 (7/3/2012) ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ AΣ ΘYMHΘOYME Στην προηγούμενη διάλεξη μιλήσαμε για τη χημική σύσταση των κυττάρων και για τα βιολογικά πολυμερή που αποτελούν

Διαβάστε περισσότερα

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ φ φ Ccarbonyl n Ccarbonyl n N Cα n Ccarbonyl n-1 Cα n N φ Ccarbonyl n-1 ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ ψ φ ψ Ccarbonyl n N (Ca

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών

Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών Βασίλης Προμπονάς, PhD Ερευνητικό Εργαστήριο Βιοπληροφορικής Τμήμα Βιολογικών Επιστημών Νέα Παν/πολη, Γραφείο B161 Πανεπιστήμιο Κύπρου Ταχ.Κιβ. 20537 1678,

Διαβάστε περισσότερα

Έκφραση και ρόλος της aggrecan και perlecan στο πρώιµο έµβρυο

Έκφραση και ρόλος της aggrecan και perlecan στο πρώιµο έµβρυο ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ, ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΤΟΜΕΑΣ ΓΕΝΕΤΙΚΗΣ ΒΙΟΛΟΓΙΑΣ ΚΥΤΤΑΡΟΥ ΚΑΙ ΑΝΑΠΤΥΞΗΣ ΕΡΓΑΣΤΗΡΙΟ ΑΝΑΠΤΥΞΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ Έκφραση και ρόλος της aggrecan και perlecan στο πρώιµο έµβρυο ΝΙΚΟΛΙΤΣΑ ΣΟΥΛΙΝΤΖΗ

Διαβάστε περισσότερα

Από. Από. κατά την πορεία της μεταγραφής. την αποδοτικότητα της Μεταμεταγραφικής ωρίμανσης. Από

Από. Από. κατά την πορεία της μεταγραφής. την αποδοτικότητα της Μεταμεταγραφικής ωρίμανσης. Από Τα επίπεδα του mrna πού είναι διαθέσιμα για την μετάφραση προσδιορίζονται Από την ταχύτητα σύνθεσης του μηνύματος κατά την πορεία της μεταγραφής Από την αποδοτικότητα της Μεταμεταγραφικής ωρίμανσης Από

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

Γονιμοποίηση αναγνώριση και συνένωση ωαρίου-σπερματοζωαρίου φραγμός στην πολυσπερμία μετα μετ βολική ενεργο ενεργο ο π ίηση

Γονιμοποίηση αναγνώριση και συνένωση ωαρίου-σπερματοζωαρίου φραγμός στην πολυσπερμία μετα μετ βολική ενεργο ενεργο ο π ίηση Γονιμοποίηση αναγνώριση και συνένωση ωαρίου-σπερματοζωαρίου φραγμός στην πολυσπερμία μεταβολική ενεργοποίηση του αυγού ανακατατάξεις στα συστατικά του αυγού σχηματισμός του διπλοειδή πυρήνα του ζυγωτού

Διαβάστε περισσότερα

ΠΡΟΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΥΔΩΝ ΤΕΦΑΑ/ΔΠΘ ΜΑΘΗΜΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΠΟΝΗΤΙΚΗΣ. Φατούρος Γ. Ιωάννης, Επίκουρος Καθηγητής

ΠΡΟΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΥΔΩΝ ΤΕΦΑΑ/ΔΠΘ ΜΑΘΗΜΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΠΟΝΗΤΙΚΗΣ. Φατούρος Γ. Ιωάννης, Επίκουρος Καθηγητής ΠΡΟΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΥΔΩΝ ΤΕΦΑΑ/ΔΠΘ ΜΑΘΗΜΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΠΟΝΗΤΙΚΗΣ ΒΙΟΧΗΜΕΙΑ ΤΗΣ ΑΣΚΗΣΗΣ Φατούρος Γ. Ιωάννης, Επίκουρος Καθηγητής ΔΙΑΛΕΞΗ 1 - ΓΡΗΓΟΡΗ ΑΝΑΣΚΟΠΗΣΗ ΒΑΣΙΚΩΝ ΓΝΩΣΕΩΝ A. Το Περιβάλλον του

Διαβάστε περισσότερα

οµή και λειτουργία των µεγάλων βιολογικών µορίων

οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων κατηγορίες υδατάνθρακες πρωτεΐνες νουκλεϊνικά οξέα λιπίδια Οι πρωτεΐνες, υδατάνθρακες, νουκλεϊνικά οξέα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Πέμπτη, 12 ΙΟΥΝΙΟΥ 2008 07:30 10:30

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 15 ΣΕΠΤΕΜΒΡΙΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

MAΘΗΜΑ 4 ο AMINOΞΕΑ-ΠΕΠΤΙ ΙΑ-ΠΡΩΤΕΪΝΕΣ

MAΘΗΜΑ 4 ο AMINOΞΕΑ-ΠΕΠΤΙ ΙΑ-ΠΡΩΤΕΪΝΕΣ MAΘΗΜΑ 4 ο AMIΞΕΑ-ΠΕΠΤΙ ΙΑ-ΠΡΩΤΕΪΝΕΣ Αλανίνη (Αla) Αλανυλοσερίνη (Αla-Ser) Αλβουµίνη ρα. Κουκουλίτσα Αικατερίνη Χηµικός Εργαστηριακός Συνεργάτης Τ.Ε.Ι Αθήνας ckoukoul@teiath.gr AMIΞΕΑ 2 λειτουργικές οµάδες

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Κεφάλαιο 1 ΒΑΣΙΚΕΣ ΑΡΧΕΣ ΝΕΥΡΟΦΥΣΙΟΛΟΓΙΑΣ

Κεφάλαιο 1 ΒΑΣΙΚΕΣ ΑΡΧΕΣ ΝΕΥΡΟΦΥΣΙΟΛΟΓΙΑΣ Κεφάλαιο 1 ΒΑΣΙΚΕΣ ΑΡΧΕΣ ΝΕΥΡΟΦΥΣΙΟΛΟΓΙΑΣ 1.1. Εισαγωγή Ο ζωντανός οργανισµός έχει την ικανότητα να αντιδρά σε µεταβολές που συµβαίνουν στο περιβάλλον και στο εσωτερικό του. Οι µεταβολές αυτές ονοµάζονται

Διαβάστε περισσότερα

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Μαντώ Κυριακού 2015

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Μαντώ Κυριακού 2015 ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Μαντώ Κυριακού 2015 Ενεργειακό Στα βιολογικά συστήματα η διατήρηση της ενέργειας συμπεριλαμβάνει οξειδοαναγωγικές αντιδράσεις παραγωγή ATP Οξείδωση: απομάκρυνση e από ένα υπόστρωμα

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

Τεχνολογία του ανασυνδυασμένου DNA

Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία του ανασυνδυασμένου DNA Ε Ι Σ Α Γ Ω Γ Η Φώτης Καρβέλης Ιστορική αναδρομή Ανακάλυψη του DNA Μελέτη αντιγραφής Απομόνωση ενζύμων Μελέτη της δράσης τους Αποκάλυψη των περιοριστικών ενδονουκλεασών

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες;

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες; 1 ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ Το κύτταρο αποτελείται από χηµικές ενώσεις, στις οποίες περιλαµβάνονται τα µικρά βιολογικά µόρια και τα βιολογικά µακροµόρια. Στα µικρά βιολογικά µόρια ανήκουν, τα ανόργανα στοιχεία

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. H β- θαλασσαιμία είναι

Διαβάστε περισσότερα

Η Εξωκυττάρια Μήτρα: Δομή & Λειτουργία

Η Εξωκυττάρια Μήτρα: Δομή & Λειτουργία Η Εξωκυττάρια Μήτρα: Δομή & Λειτουργία Δημήτριος Τζεράνης, Ph.D. Εμβιομηχανική και Βιοϊατρική Τεχνολογία Τμήμα Μηχανολόγων Μηχανικών Ε.Μ.Π. Χειμερινό Εξάμηνο 2015 Περιεχόμενα Σύσταση των Ιστών Κύτταρα

Διαβάστε περισσότερα

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών Διαχείριση ορμονικών μορίων Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών 3 ου Εξαμήνου Δ. Μπουράνης, Σ. Χωριανοπούλου 1 Φυσιολογία Φυτών Διαχείριση ορμονικών

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. 1. β 2. β 3. γ 4. β Β. Ζύμωση: Διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες Υβριδοποίηση:

Διαβάστε περισσότερα

Σήμερα η hyaluronan αναφέρεται ως υαλουρονικό οξύ.

Σήμερα η hyaluronan αναφέρεται ως υαλουρονικό οξύ. Μαρία Καρδάση Το 1934 ο Κάρλ Μάγιερ απομόνωσε από το υαλώδες υγρό του βόειου οφθαλμού μια άγνωστη μέχρι τότε μη θεϊκή γλυκοζαμινογλυκάνη και την ονόμασε hyaluronan. Σήμερα η hyaluronan αναφέρεται ως υαλουρονικό

Διαβάστε περισσότερα

1. Εισαγωγή στο Κύτταρο

1. Εισαγωγή στο Κύτταρο 1. Εισαγωγή στο Κύτταρο 1.1. Ορισμός του κυττάρου. Το κύτταρο είναι η δομική και λειτουργική μονάδα της ζωής (σχήμα 1). Το κύτταρο αποτελεί τη βάση της δομικής και λειτουργικής οργάνωσης ενός οργανισμού.

Διαβάστε περισσότερα

Σύσταση του αυγού Λευκό Κρόκος Βάρος 38 g 17 g Πρωτείνη 3,9 g 2,7 g Υδατάνθρακες 0,3 g 0,3 g Λίπος 0 6 g Χοληστερόλη 0 213 mg

Σύσταση του αυγού Λευκό Κρόκος Βάρος 38 g 17 g Πρωτείνη 3,9 g 2,7 g Υδατάνθρακες 0,3 g 0,3 g Λίπος 0 6 g Χοληστερόλη 0 213 mg Αυγό Τα αυγά αποτελούνται από το κέλυφος (10 %), το ασπράδι ή λευκό (50-60 %), τον κρόκο ή κίτρινο (30 %). Το κέλυφος αποτελείται κατά 95 % από ανόργανα συστατικά όπως ανθρακικό ασβέστιο, ανθρακικό μαγνήσιο

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΜΑΘΗΜΑ 3ο ΜΕΡΟΣ Α ΣΥΝΑΠΤΙΚΗ ΟΛΟΚΛΗΡΩΣΗ

ΜΑΘΗΜΑ 3ο ΜΕΡΟΣ Α ΣΥΝΑΠΤΙΚΗ ΟΛΟΚΛΗΡΩΣΗ ΜΑΘΗΜΑ 3ο ΜΕΡΟΣ Α ΣΥΝΑΠΤΙΚΗ ΟΛΟΚΛΗΡΩΣΗ Όπως συμβαίνει με τη συναπτική διαβίβαση στη νευρομυϊκή σύναψη, σε πολλές μορφές επικοινωνίας μεταξύ νευρώνων στο κεντρικό νευρικό σύστημα παρεμβαίνουν άμεσα ελεγχόμενοι

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ Θέµατα ιάλεξης οµή, αριθµός και διαχωρισµός των αµινοξέων Ένωση αµινοξέων µε τον πεπτιδικό δεσµό

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΚΕΦΑΛΑΙΟ 8: ΕΝΖΥΜΑ: ΒΑΣΙΚΕΣ ΑΡΧΕΣ ΚΑΙ ΚΙΝΗΤΙΚΗ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΚΕΦΑΛΑΙΟ 8: ΕΝΖΥΜΑ: ΒΑΣΙΚΕΣ ΑΡΧΕΣ ΚΑΙ ΚΙΝΗΤΙΚΗ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΚΕΦΑΛΑΙΟ 8: ΕΝΖΥΜΑ: ΒΑΣΙΚΕΣ ΑΡΧΕΣ ΚΑΙ ΚΙΝΗΤΙΚΗ Η ΕΝΝΟΙΑ ΤΗΣ ΚΑΤΑΛΥΣΗΣ ΣΤΗΝ ΧΗΜΕΙΑ ΚΑΙ ΤΗΝ ΒΙΟΛΟΓΙΑ Παράδειγμα: η αναγωγή του αζώτου σε αμμωνία Ν 2 + 3Η

Διαβάστε περισσότερα

Ατυπία Υπερπλασία- Δυσπλασία. Κίττυ Παυλάκη

Ατυπία Υπερπλασία- Δυσπλασία. Κίττυ Παυλάκη Ατυπία Υπερπλασία- Δυσπλασία Κίττυ Παυλάκη Jeanne Calment Κάπνιζε µέχρι τα 117 Πέθανε στα 122 Η σωστή λειτουργία των οργανισµών απαιτεί τη δυνατότητα προσαρµογής των κυττάρων και κατά συνέπεια και των

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΥ ΓΕΝΙΚΥ ΛΥΚΕΙΥ ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΥ 2013 ΕΞΕΤΑΖΜΕΝ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ-ΒΙΧΗΜΕΙΑ ΤΕΧΝΛΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΣ ΤΕΧΝΛΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΛ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

ΓΕΝΙΚΑ ΣΤΟΙΧΕΙΑ ΓΙΑ ΤΗΝ ΚΥΚΛΟΦΟΡΙΑ. Σχηµατική απεικόνιση της µεγάλης και της µικρής κυκλοφορίας

ΓΕΝΙΚΑ ΣΤΟΙΧΕΙΑ ΓΙΑ ΤΗΝ ΚΥΚΛΟΦΟΡΙΑ. Σχηµατική απεικόνιση της µεγάλης και της µικρής κυκλοφορίας ΤΕΙ ΠΑΤΡΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΑΝΑΤΟΜΙΑ Ι ΥΠΕΥΘΥΝΟΣ ΚΑΘΗΓΗΤΗΣ : Γεράσιµος Π. Βανδώρος ΑΙΜΟΦΟΡΑ ΑΓΓΕΙΑ ΑΡΤΗΡΙΕΣ - ΦΛΕΒΕΣ - ΤΡΙΧΟΕΙ Η 1 ΓΕΝΙΚΑ ΣΤΟΙΧΕΙΑ ΓΙΑ ΤΗΝ ΚΥΚΛΟΦΟΡΙΑ Μεγάλη και µικρή κυκλοφορία Σχηµατική

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ. Χημεία της ζωής 1

ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ. Χημεία της ζωής 1 ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημεία της ζωής 1 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ Η Βιολογία μπορεί να μελετηθεί μέσα από πολλά και διαφορετικά επίπεδα. Οι βιοχημικοί, για παράδειγμα, ενδιαφέρονται περισσότερο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΕΝΝΟΙΑ ΤΗΣ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Η κυτταρική μεμβράνη ή πλασματική μεμβράνη είναι η εξωτερική μεμβράνη που περιβάλλει το κύτταρο

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ Η τροφή αποτελείται και από ουσίες μεγάλου μοριακού βάρους (πρωτεΐνες, υδατάνθρακες, λιπίδια, νουκλεϊνικά οξέα). Οι ουσίες αυτές διασπώνται (πέψη) σε απλούστερες (αμινοξέα, απλά σάκχαρα,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ

ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ ΤΕΙ ΠΑΤΡΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΑΝΑΤΟΜΙΑ I ΥΠΕΥΘΥΝΟΣ ΚΑΘΗΓΗΤΗΣ : Γεράσιμος Π. Βανδώρος ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ Οι βασικές δομές που εξετάζουμε στην ανατομία μπορούν ιεραρχικά να ταξινομηθούν ως εξής:

Διαβάστε περισσότερα