ΘΕΡΙΝΟ ΣΧΟΛΕΙΟ Ε.Κ.Ε.Φ.Ε. ΗΜΟΚΡΙΤΟΣ ΙΟΥΝΙΟΣ Κληρονοµικός καρκίνος µαστού-ωοθηκών

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΘΕΡΙΝΟ ΣΧΟΛΕΙΟ Ε.Κ.Ε.Φ.Ε. ΗΜΟΚΡΙΤΟΣ ΙΟΥΝΙΟΣ 2005. Κληρονοµικός καρκίνος µαστού-ωοθηκών"

Transcript

1 ΘΕΡΙΝΟ ΣΧΟΛΕΙΟ Ε.Κ.Ε.Φ.Ε. ΗΜΟΚΡΙΤΟΣ ΙΟΥΝΙΟΣ 2005 Κληρονοµικός καρκίνος µαστού-ωοθηκών

2 ΜΕΤΑΛΛΑΞΕΙΣ βλάβες στο DNA Αλλαγή της γενετικής πληροφορίας: Απώλεια του προγραµµατισµού του κυττάρου ΚΑΡΚΙΝΟΣ

3 Αλλαγή της γενετικής πληροφορίας: Χάσιµο του προγραµµατισµού του κυττάρου ΣΤΟΧΟΙ ΜΕΤΑΛΛΑΞΕΩΝ Γονίδια µε ρόλο-κλειδί στη διαδικασία ογκογένεσης: Γονίδια που ρυθµίζουν την κυτταρική ανάπτυξη Πρωτοογκογονίδια ρύθµιση της κυτταρικής ανάπτυξης & πολλαπλασιασµού Γονίδια ελέγχου διατηρούν άθικτο το γονιδίωµα (και τη γενετική πληροφορία) ανιχνεύοντας και διορθώνοντας λάθη Ογκοκατασταλτικά γονίδια ανάσχεση κυτταρικού πολλαπλασιασµού, ξεκινούν την απόπτωση

4 ΜΕΤΑΛΛΑΞΕΙΣ βλάβες στο DNA? ΠΕΡΙΒΑΛΛΟΝ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΤΥΧΗ

5 Κληρονοµούµενες βλάβες σε κρίσιµα γονίδια ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Σπάνια (5-10% των καρκίνων) Υψηλή πιθανότητα για καρκίνο Οικογένειες µε πολλά περιστατικά Εκδήλωση σε νεαρή ηλικία 35 κληρονοµικά σύνδροµα καρκίνου Κυρίαρχα αυτοσωµικά Αδενωµατώδης πολυποδίαση, οικογενής (περιλαµβάνεται το σύνδροµο Gardner) Σύνδροµο Gorlin (basal cell nevus syndrome) Καρκίνος µαστού & ωοθηκών, οικογενής: BRCA1 Καρκίνος µαστού & ωοθηκών, οικογενής: BRCA2 Σύνδροµο Carney Χόρδωµα, οικογενές Σύνδροµο καρκίνου παχέος εντέρου, HNPCC (σύνδροµο Lynch περιλαµβάνεται το σύνδροµο Muir-Torre) Σύνδροµο Cowden Καρκίνος οισοφάγου µε τύλωση Καρκίνος στοµάχου, οικογενής Σύνδροµο Li Fraumeni Μελάνωµα, οικογενές, µε ή χωρίς δυσπλαστικούς σπίλους Πολλαπλή ενδοκρινής νεοπλασία 1 Πολλαπλή ενδοκρινής νεοπλασία 2 Οστεοχονδροµάτωση, πολλαπλή (πολλαπλή εξόστωση) Οικογενές παραγαγγλίωµα Σύνδροµο Peutz-Jeghers Καρκίνος προστάτη Καρκίνος νεφρού, οικογενής Ρετινοβλάστωµα Οζώδης σκλήρυνση Σύνδροµο Von Hippel-Lindau Όγκος Wilm s Υποτελή αυτοσωµικά Ataxia telangiectasia Σύνδροµο Bloom Αναιµία Fanconi Σύνδροµο Rothmund-Thompson Σύνδροµο Werner Xerodema pigmentosum Αµφίβολοςτρόποςκληρονόµισης Καρκινοειδές, οικογενές Ασθένεια Hodgkin s, οικογενής Καρκίνος παγκρέατος, οικογενής Καρκίνωµα όρχεων, οικογενές

6 Σπάνια (5-10% των καρκίνων) ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Ο ΚΛΗΡΟΝΟΜΙΚΟΣ ΚΑΡΚΙΝΟΣ ΑΦΟΡΑ ΕΝΑ ΜΕΓΑΛΟ ΚΟΜΜΑΤΙ ΤΟΥ ΠΛΗΘΥΣΜΟΥ! 35 κληρονοµικά σύνδροµα καρκίνου Κυρίαρχα αυτοσωµικά Αδενωµατώδης πολυποδίαση, οικογενής (περιλαµβάνεται το σύνδροµο Gardner) Σύνδροµο Gorlin (basal cell nevus syndrome) Καρκίνος µαστού & ωοθηκών, οικογενής: BRCA1 Καρκίνος µαστού & ωοθηκών, οικογενής: BRCA2 Σύνδροµο Carney Χόρδωµα, οικογενές Σύνδροµο καρκίνου παχέος εντέρου, HNPCC (σύνδροµο Lynch περιλαµβάνεται το σύνδροµο Muir-Torre) Σύνδροµο Cowden Καρκίνος οισοφάγου µε τύλωση Καρκίνος στοµάχου, οικογενής Σύνδροµο Li Fraumeni Μελάνωµα, οικογενές, µε ή χωρίς δυσπλαστικούς σπίλους Πολλαπλή ενδοκρινής νεοπλασία 1 Πολλαπλή ενδοκρινής νεοπλασία 2 Οστεοχονδροµάτωση, πολλαπλή (πολλαπλή εξόστωση) Οικογενές παραγαγγλίωµα Σύνδροµο Peutz-Jeghers Καρκίνος προστάτη Καρκίνος νεφρού, οικογενής Ρετινοβλάστωµα Οζώδης σκλήρυνση Σύνδροµο Von Hippel-Lindau Όγκος Wilm s Υποτελή αυτοσωµικά Ataxia telangiectasia Σύνδροµο Bloom Αναιµία Fanconi Σύνδροµο Rothmund-Thompson Σύνδροµο Werner Xerodema pigmentosum Αµφίβολοςτρόποςκληρονόµισης Καρκινοειδές, οικογενές Ασθένεια Hodgkin s, οικογενής Καρκίνος παγκρέατος, οικογενής Καρκίνωµα όρχεων, οικογενές

7

8 Πώς εντοπίστηκε το γονίδιο προδιάθεσης σε καρκίνο µαστού ωοθηκών BRCA1 (1994)

9

10 Περίπου 10% των περιπτώσεων καρκίνου ωοθηκών και 7% των περιπτώσεων καρκίνου µαστού στογενικόπληθυσµό είναι φορείς µεταλλαγµένου γονιδίου. κατά κύριο λόγο τα γονίδια είναι τα BRCA1 και BRCA2 Τα άτοµα αυτά εντοπίζονται κυρίως σε οικογένειες µε πολλαπλές περιπτώσεις καρκίνων µαστού / ωοθηκών που συνήθως εκδηλώνονται σε νεαρή ηλικία.

11 Ενδείξεις για κληρονοµική προδιάθεση Πολλά περιστατικά καρκίνων στην οικογένεια Εµφανίζονται περιστατικά σε >1 γενιά Νεαρή ηλικία εκδήλωσης Όγκοι που αναπτύσσονται ανεξάρτητα (π.χ., αµφοτερόπλευρος καρκίνος στο µαστό) Συσσώρευση στην οικογένεια συγκεκριµένων τύπων καρκίνου (π.χ., µαστού, ωοθηκών, προστάτη) Ασυνήθιστη εκδήλωση (π.χ., καρκίνος µαστού σε άνδρα) Συγκεκριµένες εθνικές οµάδες (π.χ., Εβραίοι Ashkenazi)

12

13 ΜΕΤΑΛΛΑΞΗ Η µετάλλαξη αλλάζει µια γονιδιακή µορφή (αλληλόµορφο) σε µια άλλη Είναι η κύρια πηγή της γενετικής ποικιλότητας Αλλαγή στο DNA, που κληρονοµείται Αποτέλεσµα της αλλαγής στην αλληλουχία των βάσεων του DNA αλλαγή στον γενετικό κώδικα Πολλαπλές αιτίες: µεταλλαξιγόνα, λάθη στην αντιγραφή του DNA, ενσωµάτωση ξένων στοιχείων (transposons) στο χρωµόσωµα Πολλαπλές συνέπειες: Από καµία µέχρι θάνατο Μερικοί τύποι µεταλλάξεων µπορούν να διορθωθούν

14

15 ΣΥΝΕΠΕΙΕΣ ΜΕΤΑΛΛΑΞΕΩΝ ΣΤΟ ΜΟΡΙΑΚΟ ΕΠΙΠΕ Ο ΣΙΩΠΗΡΗ ΜΕΤΑΛΛΑΞΗ (Silent) αλλαγή κωδικονίου δεν συνεπάγεται αλλαγή αµινοξέος, π.χ. Phe UUU > UUC Phe ΠΑΡΑΝΟΗΜΑΤΙΚΗ ΜΕΤΑΛΛΑΞΗ (Missense) η αλλαγή κωδικονίου επιφέρει αλλαγή αµινοξέος διαφορετικές συνέπειες: συντηρητική αντικατάσταση αµινοξέος (συνώνυµη µετάλλαξη): αλλαγή σε χηµικά παρόµοιο αµινοξύ, µικρότερη πιθανότητα αλλαγής της πρωτεϊνικής λειτουργίας, π.χ. Lys AAA > AGA Arg, Ser UCU > ACU Thr µη συντηρητική αντικατάσταση αµινοξέος: αλλαγή σε χηµικά διάφορο αµινοξύ, πιο πιθανό να αλλάζει η πρωτεϊνική λειτουργία MH ΝΟΗΜΑΤΙΚΗ ΜΕΤΑΛΛΑΞΗ (Nonsense) κωδικόνιο αµινοξέος αλλάζει σε σήµα τερµατισµού MΕΤΑΛΛΑΞΗ ΑΛΛΑΓΗΣ ΠΛΑΙΣΙΟΥ ΑΝΑΓΝΩΣΗΣ (Frameshift) προσθήκη ή απαλοιφή βάσεων που δεν είναι πολλαπλάσιο του 3, κωδικοποίηση τελείως διαφορετικών αµινοξέων MΕΤΑΛΛΑΞΗ ΘEΣΗΣ ΣΥΡΡΑΦΗΣ (Splice-site) αλλαγή σήµατος συρραφής εξωνίων, παράλειψη εξωνίων ή προσθήκη ιντρονίων στην πρωτεΐνη

16 ΜΗΧΑΝΙΣΜΟΙ ΕΠΙ ΙΟΡΘΩΣΗΣ ΤΩΝ ΜΕΤΑΛΛΑΞΕΩΝ Αποφυγή λαθών, π.χ. διορθωτική δράση της DNA πολυµεράσης, του ενζύµου που αντιγράφει το DNA υπεροξειδική δισµουτάση, αποµάκρυνση ελεύθερων ριζών Επιδιόρθωση της ζηµιάς, π.χ. Φωτοεπανενεργοποίηση, αναγέννηση πυριµιδινών παρουσία φωτός Αλκυλοτρανσφεράση, Συστήµατα επιδιόρθωσης βασισµένα στην οµολογία των βάσεων των 2 αλυσίδων του DNA (π.χ. mismatch repair, recombination repair, transcription-coupled repair, base excision repair)

17 Ασθένειες που προκαλούνται από βλάβες σε γονίδια επιδιόρθωσης του DNA Xeroderma pigmentosum (XP) = προδιάθεση σε καρκίνους δέρµατος επαγόµενους από υπεριώδη ακτινοβολία Ataxia telangiectasia (AT) = πολλαπλά καρκινικά σύνδροµα, νευροεκφυλισµός, δυσλειτουργία ανοσοποιητικού, ραδιοευαισθησία, γονίδια ATM, ATR Αναιµία Fanconi (FA) = προδιάθεση σε οξεία µυελοειδή λευχαιµία και άλλους καρκίνους, γονίδια FancA, FancD, κ.ά. Σύνδροµο Bloom (BS) = προδιάθεση σε καρκίνο, ανώµαλη ανάπτυξη, φωτοευαισθησία, δυσλειτουργία ανοσοποιητικού, γονίδιο Blm Κληρονοµικός µη-πολυποδιακός καρκίνος παχέος εντέρου (HNPCC) = προδιάθεση σε καρκίνο παχέος εντέρου και ωοθηκών, γονίδια hmsh2, hmlh1, hpms1, hpms2 Κληρονοµικός καρκίνος µαστού-ωοθηκών = προδιάθεση σε καρκίνο µαστού και ωοθηκών, γονίδια BRCA1, BRCA2

18

19

20 BRCA1-συσχετιζόµενοι καρκίνοι:ισόβιο ρίσκο Καρκίνος µαστού 56%-87% (συχνά( σε νεαρή ηλικία) εύτερος πρωτοπαθής καρκίνος µαστού 64% Καρκίνος ωοθηκών 16%-44% Πιθανώς αυξηµένο ρίσκο και για άλλους καρκίνους (π.χ. προστάτη, παχέος εντέρου)

21 BRCA2-συσχετιζόµενοι καρκίνοι:ισόβιο ρίσκο καρκίνος µαστού (50%-80%) ανδρικός καρκίνος αµφοτερόπλευρος µαστού (6%) καρκίνος µαστού (50%) καρκίνος ωοθηκών (16%-21%) Αυξηµένο ρίσκο για καρκίνο προστάτη ( 10-20%) και παγκρέατος ( 3%)

22 Κληρονοµικός καρκίνος µαστού-ωοθηκών ωοθηκών: Η γενετική ανάλυση H γενετική ανάλυση για τα γονίδια BRCA1 & BRCA2 σε οικογένειες µε ιστορικό καρκίνου µαστού/ωοθηκών ξεκίνησε το σε ερευνητικά πλαίσια. Από το 2000 προσφέρεται ως εξέταση ρουτίνας σχεδόν σε όλες τις χώρες της Ευρώπης, την Αµερική, τον Καναδά, την Αυστραλία και το Ισραήλ. Ο γενετικός έλεγχος εκτιµάται ότι µπορεί να σώσει χιλιάδες ζωές. ΒRCA1 & BRCA2: 1994 and beyond, Νarod & Foulkes, Nature Review Cancer Sep 2004

23 Κληρονοµικός καρκίνος µαστού-ωοθηκών ωοθηκών: Η γενετική ανάλυση Η γενετική ανάλυση των γονιδίων BRCA1 και BRCA2 για την εύρεση µεταλλάξεων που προδιαθέτουν για καρκίνο µαστού-ωοθηκών δεν είναι µια εύκολη υπόθεση!

24 ΓΕΩΓΡΑΦΙΚΗ ΚΑΤΑΝΟΜΗ ΤΩΝ ΜΕΤΑΛΛΑΞΕΩΝ BRCA1 & 2 Το ποσοστό των οικογενειών υψηλού κινδύνου µε καρκίνο µαστού ή/και ωοθηκών που αποδίδεται σε µεταλλάξεις του BRCA1 και 2 διαφέρει πολύ από τον ένα πληθυσµό στον άλλο Ρωσία: 79% 5382insC BRCA1 Ισραήλ 47% 5382insC, 185delAG BRCA1 Ιταλία 29% διάσπαρτες/µοναδικές µεταλλάξεις Aγγλία, Γαλλία Σκανδιναβία Oυγγαρία, Ολλανδία ~20-25% Βέλγιο, Γερµανία Ιαπωνία Iσλανδία 100% 999del5 BRCA2 Ισραήλ 100% 6174delT BRCA2 ιαφορετικές µεταλλάξεις εντοπίζονται σε διαφορετικούς πληθυσµούς Oι διαγνωστικές µέθοδοι σχεδιάζονται ανάλογα µε τον πληθυσµό

25 ΕΡΓΑΣΤΗΡΙΟ ΜΟΡΙΑΚΗΣ ΙΑΓΝΩΣΤΙΚΗΣ Ε.Κ.Ε.Φ.Ε. ΗΜΟΚΡΙΤΟΣ Φθινόπωρο 1999: - Ξεκινά η γενετική ανάλυση BRCA1 και BRCA2 σε Έλληνες ασθενείς

26 ΕΡΓΑΣΤΗΡΙΟ ΜΟΡΙΑΚΗΣ ΙΑΓΝΩΣΤΙΚΗΣ Ε.Κ.Ε.Φ.Ε. ΗΜΟΚΡΙΤΟΣ Συνοπτικά αποτελέσµατα της µελέτης στον Ελληνικό Πληθυσµό Τράπεζα DNA : 320 δείγµατα (270 οικογένειες) Έχουν αναλυθεί: οικογένειες φορείς παθογόνων µεταλλάξεων

27 ΕΡΓΑΣΤΗΡΙΟ ΜΟΡΙΑΚΗΣ ΙΑΓΝΩΣΤΙΚΗΣ Ε.Κ.Ε.Φ.Ε. ΗΜΟΚΡΙΤΟΣ - Γιατί να γίνει η γενετική ανάλυση σε οικογένειες υψηλού κινδύνου; 1. Ερευνητικά οφέλη 2. Κοινωνικά (Πρακτικά) οφέλη

28 ΕΡΓΑΣΤΗΡΙΟ ΜΟΡΙΑΚΗΣ ΙΑΓΝΩΣΤΙΚΗΣ Ε.Κ.Ε.Φ.Ε. ΗΜΟΚΡΙΤΟΣ 1. Ερευνητικά οφέλη Καθορισµός του ιδιαίτερου προφίλ µεταλλάξεων για τον ελληνικό πληθυσµό Συσχέτιση µεµωνοµένων µεταλλάξεων µε τις επιπτώσεις για τους φορείς τους Μελέτη των επιπτώσεων µεµωνοµένων µεταλλάξεων στη γονιδιακή/πρωτεϊνική λειτουργία Νέα δεδοµένα ενδεχοµένως να βοηθήσουν στη γενικότερη διασαφήνιση των µηχανισµών καρκινογένεσης

29 ΕΡΓΑΣΤΗΡΙΟ ΜΟΡΙΑΚΗΣ ΙΑΓΝΩΣΤΙΚΗΣ Ε.Κ.Ε.Φ.Ε. ΗΜΟΚΡΙΤΟΣ 2. Κοινωνικά (Πρακτικά) οφέλη Φορείς: Συγκεκριµενοποίηση του παράγοντα κινδύνου (=ΜΕΤΑΛΛΑΞΗ) Κίνητρο για αλλαγή συµπεριφοράς Λήψη προληπτικών µέτρων Σε οικογένεια που βρίσκεται ότι φέρει µετάλλαξη, τα µισά µέλη της (50%) θεωρητικά δεν θα την έχουν κληρονοµήσει ΨΥΧΟΛΟΓΙΚΟ ΚΟΣΤΟΣ ΑΓΧΟΣ ΤΑΚΤΙΚΕΣ ΙΑΤΡΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΠΡΟΛΗΠΤΙΚΕΣ ΕΠΕΜΒΑΣΕΙΣ

30 ιαφορά γενετικής ανάλυσης από άλλες ιατρικές εξετάσεις Αφορά ολόκληρη την οικογένεια!

31 ΕΡΓΑΣΤΗΡΙΟ ΜΟΡΙΑΚΗΣ ΙΑΓΝΩΣΤΙΚΗΣ Ε.Κ.Ε.Φ.Ε. ΗΜΟΚΡΙΤΟΣ Λήψη οικογενειακού ιστορικού - Ι ΙΑΙΤΕΡΗ ΣΗΜΑΣΙΑ - Απαραίτητη η λήψη οικογενειακού ιστορικού των τριών τελευταίων γενεών Συµπλήρωση ερωτηµατολογίου σχετικά µε την καταγωγή, φυσικές δραστηριότητες, διατροφικές συνήθειες, το ιατρικό ιστορικό της ασθενούς Πλήρη κλινικο-παθολογικά δεδοµένα π.χ. Φορείς BRCA1 εµφανίζουν αρνητικούς υποδοχείς οιστρογόνων ενώ Φορείς BRCA2 εµφανίζουν θετικούς υποδοχείς οιστρογόνων Η παθογόνος µετάλλαξη µπορεί να κληρονοµηθεί εξ ίσου από τον πατέρα και τη µητέρα Οι άρρενες φορείς στο BRCA1 συνήθως δεν αναπτύσσουν τη νόσο ΜΕΘΟ ΟΛΟΓΙΑ Oι γυναίκες φορείς µεταλλάξεων στο BRCA1 αναπτύσσουν τη νόσο πολύ νωρίτερα από τις φορείς στο BRCA2

32 ΕΡΓΑΣΤΗΡΙΟ ΜΟΡΙΑΚΗΣ ΙΑΓΝΩΣΤΙΚΗΣ Ε.Κ.Ε.Φ.Ε. ΗΜΟΚΡΙΤΟΣ ΜΕΘΟ ΟΛΟΓΙΑ 1. Αίµα απότονασθενή 2. Αποµόνωση γονιδιωµατικού DNA P53 Tumor Suppressor protein CMT1A Charcot-Marie-Tooth Syndrome BRCA1 Breast Cancer χρωµόσωµα Ενίσχυση των κατάλληλων περιοχών των γονιδίων BRCA1/2 µε PCR 1.0 kb 0.5 kb 100 bp 4. DNA sequencing

33 ΕΡΓΑΣΤΗΡΙΟ ΜΟΡΙΑΚΗΣ ΙΑΓΝΩΣΤΙΚΗΣ Ε.Κ.Ε.Φ.Ε. ΗΜΟΚΡΙΤΟΣ ΜΕΘΟ ΟΛΟΓΙΑ

34 Ποια είναι τα πιθανά αποτελέσµατα της γενετικής ανάλυσης ; 1. Εύρεση µετάλλαξης (ΘΕΤΙΚΟ) 2. εν ανιχνεύεται µετάλλαξη (ΑΡΝΗΤΙΚΟ) 3. Εύρεση γενετικής αλλαγής άγνωστης σηµασίας (?)

35 Ποια είναι τα πιθανά αποτελέσµατα της γενετικής ανάλυσης ; 2. εν ανιχνεύεται µετάλλαξη (ΑΡΝΗΤΙΚΟ) Ευαισθησία µεθόδων που χρησιµοποιούνται σήµερα: 90-98% ιντρόνια ρυθµιστικές περιοχές - γονιδιακές ανακατατάξεις άλλα γονίδια κ.ά. Αληθινά αρνητικό αποτέλεσµα Ψευδώς αρνητικό αποτέλεσµα Ο ασθενής δεν έχει αυξηµένη πιθανότητα να πάθει καρκίνο? Ο ασθενής έχει αυξηµένη πιθανότητα να πάθει καρκίνο ΤΟ ΑΡΝΗΤΙΚΟ ΑΠΟΤΕΛΕΣΜΑ ΕΝ ΕΧΕΙ ΙΑΓΝΩΣΤΙΚΗ ΑΞΙΑ

36 Ποια είναι τα πιθανά αποτελέσµατα της γενετικής ανάλυσης ; 1. Εύρεση µετάλλαξης (ΘΕΤΙΚΟ) ΑΣΘΕΝΗΣ ΟΙΚΟΓΕΝΕΙΑ 50% 50% 50 85% πιθανότητα καρκίνου µαστού 15 40% πιθανότητα καρκίνου ωοθηκών Συστηµατική επιτήρηση διάγνωση σε αρχικά στάδια Μέτρα πρόληψης (αλλαγή τρόπου ζωής, χηµειοπροφύλαξη, επεµβάσεις) ΘΕΤΙΚΟ ΑΡΝΗΤΙΚΟ ΙΑΓΝΩΣΤΙΚΗ ΑΞΙΑ! Ο ασθενής δεν έχει αυξηµένη πιθανότητα να πάθει καρκίνο

37 Ποια είναι τα πιθανά αποτελέσµατα της γενετικής ανάλυσης ; 3. Εύρεση γενετικής αλλαγής άγνωστης σηµασίας (?) Συµβαίνει στο 15% των περιπτώσεων Συλλογή περισσότερων δεδοµένων: Μελέτες συσχέτισης της αλλαγής µε τα άρρωστα ή τα υγιή µέλη της οικογένειας Έρευνα δοµικές & λειτουργικές µελέτες Οασθενήςπαραµένει στην κατηγορία υψηλού κινδύνου µέχρι να υπάρξουν νεότερα δεδοµένα

38 ΕΡΓΑΣΤΗΡΙΟ ΜΟΡΙΑΚΗΣ ΙΑΓΝΩΣΤΙΚΗΣ Ε.Κ.Ε.Φ.Ε. ΗΜΟΚΡΙΤΟΣ 5382insC - BRCA1 Βρέθηκε σε 13 µη συγγενικές οικογένειες brca? I:1 I:2 GCGAGCAAGAGAATCCCAGGACAGAAAGGTAAAGC GCGAGCAAGAGAATCCCAGGACAGAAAGGTAAAGC II:1 lung75 II:3 II:2 brca wt III:3 III:1 III:1 III:2 brca47 Vitiligo III:4 GCGAGCAAGAGAATCCCAGGACAGAAAGGTAAAGC GCGAGCAAGAGAATCCCCAGGACAGAAAGGTAAAG mut IV:1 5382insC IV:2 brca insC Vitiligo IV:3 IV:4 IV:5 bil. brca insC 5382insC

39 ΕΡΓΑΣΤΗΡΙΟ ΜΟΡΙΑΚΗΣ ΙΑΓΝΩΣΤΙΚΗΣ Ε.Κ.Ε.Φ.Ε. ΗΜΟΚΡΙΤΟΣ 3099delT - BRCA1 I:1 I:2 OvCa OvCa BrCa wt mut TCATTTGTTAAAACTAAATGTAAGAAAAATCTGCTAGAGGAAAAC TCATTTGTTAAAACTAAATGTAAGAAAAATCTGCTAGAGGAAAAC II:2 II:1 II:1 TCATTTGTTAAAACTAAAGTAAGAAAAATCTGCTAGAGGAAAACT wt III:1 ΟvCa III:1 Ovca del TCATTTGTTAAAACTAAATGTAAGAAAAATCTGCTAGAGGAAAAC mut delT 3125

40

41 ΕΡΓΑΣΤΗΡΙΟ ΜΟΡΙΑΚΗΣ ΙΑΓΝΩΣΤΙΚΗΣ Ε.Κ.Ε.Φ.Ε. ΗΜΟΚΡΙΤΟΣ 2024del5 BRCA2 σε περίπτωση ανδρικού brca ATG CTATACATGAT GAAACAT AAAGGAAAAAAAATACCGAAAG ATG CTATACATGAT GAAACAT CTTATAAAGG AAAAAAAATAC wt mut mut I:1 prostate ca brca33 I:4 II:2 II:1 brca66 III:1 2024del5 brca34 I:2 II:3 III:1 brca del5 AT GCTATACAT GAT GAAACATCT TATAAAGG AAAAAAAATACC AT GCTATACAT GAT GAAACATCT TATAAAGG AAAAAAAATACC wt

42 Παράγοντες που επηρεάζουν τη διεισδυτικότητα µιας µετάλλαξης Modifier genes Carcinogens Response to DNA damage Hormonal/ reproductive factors εν αναπτύσσουν καρκίνο όλοι οι φορείς µεταλλάξεων

43 Παρανοηµατική µετάλλαξη στα όρια εξωνίου: αποδείχθηκε µετάλλαξη συρραφής απαλείφει το εξώνιο 23 Βρέθηκε σε 2 ελληνικές οικογένειες ΕΡΓΑΣΤΗΡΙΟ ΜΟΡΙΑΚΗΣ ΙΑΓΝΩΣΤΙΚΗΣ Ε.Κ.Ε.Φ.Ε. ΗΜΟΚΡΙΤΟΣ

44 ΕΡΓΑΣΤΗΡΙΟ ΜΟΡΙΑΚΗΣ ΙΑΓΝΩΣΤΙΚΗΣ Ε.Κ.Ε.Φ.Ε. ΗΜΟΚΡΙΤΟΣ Μεταλλάξεις του γονιδίου BRCA1 που οδηγούν σε απώλεια της λειτουργίας του και βρέθηκαν στον Ελληνικό Πληθυσµό exon R1203X 11 περιοδικώς επαναλαµβανόµενη 1623del5 11 περιοδικώς επαναλαµβανόµενη στην Ευρώπη 3099delT 11 νέα, µοναδική 3277insG 11 νέα, µοναδική 3741insA 11 περιοδικώς επαναλαµβανόµενη 3896delT 11 περιοδικώς επαναλαµβανόµενη 5382insC 20 ιδρυτική, βρέθηκε σε 13 οικογένειες G1738R 20 ιδρυτική, βρέθηκε σε 8 οικογένειες R1751X 20 περιοδικώς επαναλαµβανόµενη (σε 3 οικογένειες) 5586G>A 23 περιοδικώς επαναλαµβανόµενη (σε 2 οικογένειες) del_exon24 24 ΓΟΝΙ ΙΑΚΗ ΑΝΑΚΑΤΑΤΑΞΗ del_exon20 20 ΓΟΝΙ ΙΑΚΗ ΑΝΑΚΑΤΑΤΑΞΗ

45 ΕΡΓΑΣΤΗΡΙΟ ΜΟΡΙΑΚΗΣ ΙΑΓΝΩΣΤΙΚΗΣ Ε.Κ.Ε.Φ.Ε. ΗΜΟΚΡΙΤΟΣ Μεταλλάξεις του γονιδίου BRCA2 που οδηγούν σε απώλεια της λειτουργίας του και βρέθηκαν στον Ελληνικό Πληθυσµό exon G4X 2 νέα, µοναδική 2024del5 10 περιοδικώς επαναλαµβανόµενη (σε 2 οικογένειες) 3034del4 11 περιοδικώς επαναλαµβανόµενη 3058delA 11 νέα, µοναδική 4147delG 11 περιοδικώς επαναλαµβανόµενη (σε 2 οικογένειες) 6024delTA 11 νέα, µοναδική 6633del5 11 περιοδικώς επαναλαµβανόµενη

46 Κατανοµή κατά µήκος των γονιδίων BRCA1 και BRCA2 των κληρονοµούµενων µεταλλάξεων που βρέθηκαν σε ελληνικές οικογένειες BRCA1 BRCA2 Κάθε κύκλος αντιπροσωπεύει µία οικογένεια: Oι µαύροι οικογένειες µε περιστατικά καρκίνου µαστού Oι γκρίζοιµε περιστατικά καρκίνου µαστού και ωοθηκών ΕΡΓΑΣΤΗΡΙΟ ΜΟΡΙΑΚΗΣ ΙΑΓΝΩΣΤΙΚΗΣ Ε.Κ.Ε.Φ.Ε. ΗΜΟΚΡΙΤΟΣ

47 Άλλες παραλλαγές στην ακολουθία των BRCA1 & BRCA2 (πολυµορφισµοί και άγνωστης σηµασίας αλλαγές) Exon Exon 5 IVS4-19 C>Α 2 203G>A (5' UTR) 8 IVS7-34 C>T 2 R282R 9 IVS8-7delT 10 N289H 9 D189D 11 N991D 9 C197C 11 V1269V 11 Q356R 17 IVS17-12 Τ>C 11 D693N 11 S694S 11 L771L 11 P871L 11 E1038G No sequence variation in some exons (2, 5) 11 K1183R Important variation in exons 11,16, S1436S 16 S1613G Smaller variation in BRCA2 than in BRCA1 16 A1615T 16 S1631S 16 M1652I 16 IVS16-68 G>A 16 IVS16-92 G>A 18 IVS18+65 G>A 20 G1738R 20 A1752A 23 A1823T 24 V1833M

48 ΕΡΓΑΣΤΗΡΙΟ ΜΟΡΙΑΚΗΣ ΙΑΓΝΩΣΤΙΚΗΣ Ε.Κ.Ε.Φ.Ε. ΗΜΟΚΡΙΤΟΣ Crystal structure of the BRCT repeat region from the breast cancer-associated associated protein BRCA1

49 ΕΡΓΑΣΤΗΡΙΟ ΜΟΡΙΑΚΗΣ ΙΑΓΝΩΣΤΙΚΗΣ Ε.Κ.Ε.Φ.Ε. ΗΜΟΚΡΙΤΟΣ country-specific founder mutations 3452del4 3875del4 Cys61Gly 5382insC 185delAG 4446CtoT others 4184del4 Modified from Szabo & King, Am J Hum Genet 1997 Israel BRCA1

50 Ποιος θα απευθυνθεί σε εργαστήριο για γενετικό έλεγχο BRCA1-2 2 ; Άτοµο µε προσωπικό ιστορικό καρκίνου µαστού ή/και ωοθηκων Άτοµο µε οικογενειακό ιστορικό καρκίνου µαστού ή/και ωοθηκων (συνήθως στενοί συγγενείς έχουν νοσήσει) Άτοµο που έχει ήδη βρεθεί µετάλλαξη σε άλλο µέλος της οικογένειας

51 Οικογενειακό ιστορικό Κληρονοµικός καρκίνος Σποραδικός καρκίνος ύοήπερισσότερεςγυναίκεςµε καρκίνο µαστού πριν τα 50 ή καρκίνο ωοθηκών Καµία περίπτωση καρκίνου µαστού πριν τα 60 Καµία περίπτωση καρκίνου ωοθηκών εν φαίνεται καθαρά εάν ευθύνεται η πλευρά του πατέρα ή της µητέρας

52 Οικογενειακό ιστορικό Εσφαλµένες αντιλήψεις Ο καρκίνοςµαστού από την πλευρά του πατέρα δεν µετράει Ο καρκίνος ωοθηκών στην οικογένεια δεν σηµαίνει αυξηµένο κίνδυνο για καρκίνο µαστού Οι µισές γυναίκες που φέρουν παθογόνο µετάλλαξη την έχουν κληρονοµήσει από τον πατέρα τους Ο καρκίνος ωοθηκων είναι σηµαντική ένδειξη για προδιάθεση σε καρκίνο µαστού Το πιο σηµαντικό στο οικογενειακό ιστορικό είναι ο αριθµός των γυναικών µε καρκίνο µαστού Ηηλικίαεκδήλωσηςτου καρκίνου µαστού είναι πολύ πιο σηµαντική ένδειξη από τον αριθµό των περιστατικών όσον αφορά την προδιάθεση της οικογένειας

53 Στρατηγική γενετικής ανάλυσης

54 Στρατηγική γενετικής ανάλυσης Η πλήρης ανάλυση πρέπει να γίνει στο άτοµο που είναι πιο πιθανό να φέρει µετάλλαξη!!! ήδη εµφάνισε καρκίνο µαστού ή/και ωοθηκών εµφάνισε τον καρκίνο µαστού ή/και ωοθηκών στη µικρότερη ηλικία αµφοτερόπλευρη εκδήλωση Το πιο κατάλληλο άτοµο δεν είναι πάντα διαθέσιµο!

55 Στρατηγική γενετικής ανάλυσης ΜΕΤΑΛΛΑΞΗ ΜΕΤΑΛΛΑΞΗ Το αρνητικό αποτέλεσµα δεν έχει διαγνωστική αξία 50% 50% 50% 50% 50% Το αρνητικό αποτέλεσµα έχει διαγνωστική αξία ΜΟΝΟ όταν έχει προηγουµένως βρεθεί µετάλλαξη στην οικογένεια

56 Στρατηγική γενετικής ανάλυσης - Τι γίνεται αν δεν βρεθεί µετάλλαξη; (ΑΡΝΗΤΙΚΟ ΑΠΟΤΕΛΕΣΜΑ) Η αποτίµηση του αποτελέσµατος θέλει ιδιαίτερη προσοχή Εάν δεν βρέθηκε µετάλλαξη στην οικογένεια: Η µετάλλαξη υπάρχει, αλλά βρίσκεται σε περιοχή έξω από τα διαγνωστικά όρια του τεστ. Ευθύνεται άλλο γονίδιο για τον καρκίνο στη συγκεκριµένη οικογένεια. Ο καρκίνος στην οικογένεια έχει µη κληρονοµικά αίτια. Ελέχθηκε λάθος άτοµο.

57 Στρατηγική γενετικής ανάλυσης - Τι γίνεται αν δεν βρεθεί µετάλλαξη; (ΑΡΝΗΤΙΚΟ ΑΠΟΤΕΛΕΣΜΑ) Γνωρίζουµε ήδη ότι στην οικογένεια έχει βρεθεί συγκεκριµένη µετάλλαξη: ΚΑΛΑ ΝΕΑ!!! Υπάρχει βεβαιότητα ότι το συγκεκριµένο άτοµο δεν έχει κληρονοµήσει τη µετάλλαξη. ΠΡΟΣΟΧΗ: εν αποκλείεται να νοσήσει το άτοµο αυτό έχει τις ίδιες πιθανότητες µε τον γενικό πληθυσµό συνιστάται η επητήρηση που ισχύει για όλους!

58 η Γνώση είναι ύναµη... και Ελπίδα

59 Ερωτήσεις?

ΕΛΛΗΝΙΚΗ ΕΤΑΙΡΕΙΑ ΜΑΣΤΟΛΟΓΙΑΣ

ΕΛΛΗΝΙΚΗ ΕΤΑΙΡΕΙΑ ΜΑΣΤΟΛΟΓΙΑΣ ΕΛΛΗΝΙΚΗ ΕΤΑΙΡΕΙΑ ΜΑΣΤΟΛΟΓΙΑΣ Κληρονοµείται ο καρκίνος του µαστού; Γενετική προδιάθεση για καρκίνο του µαστού Στην Ελλάδα 1 στις 12 γυναίκες έχει πιθανότητα να αναπτύξει καρκίνο του µαστού στη διάρκεια

Διαβάστε περισσότερα

Λίγα λόγια για τους καρκίνους, τη γενετική τους βάση και διερεύνηση

Λίγα λόγια για τους καρκίνους, τη γενετική τους βάση και διερεύνηση Λίγα λόγια για τους καρκίνους, τη γενετική τους βάση και διερεύνηση Ο καρκίνος είναι μια ιδιαίτερα ετερογενής νόσος, που προκύπτει από συσσώρευση μεταλλάξεων του DNA. Η αιτιολογία του καρκίνου είναι πολυπαραγοντική,

Διαβάστε περισσότερα

Γενικά. Τί είναι ο κληρονομικός καρκίνος; κληρονομικός και σποραδικός καρκίνος. Κληρονομικός καρκίνος - Site Ε.Ο.Π.Ε. - Μ.Σ.

Γενικά. Τί είναι ο κληρονομικός καρκίνος; κληρονομικός και σποραδικός καρκίνος. Κληρονομικός καρκίνος - Site Ε.Ο.Π.Ε. - Μ.Σ. 1 Γενικά Ο καρκίνος προκαλείται από αλλαγές στα υλικά του σώματος μας που ονομάζονται «γονίδια». Πρόκειται για τις μονάδες πληροφοριών σε κάθε κύτταρο του σώματός μας. Τα γονίδια υπαγορεύουν στπν οργανισμό

Διαβάστε περισσότερα

H αξιοποίηση των ερευνητικών αποτελεσµάτων στην παροχή νέων υπηρεσιών υγείας

H αξιοποίηση των ερευνητικών αποτελεσµάτων στην παροχή νέων υπηρεσιών υγείας H αξιοποίηση των ερευνητικών αποτελεσµάτων στην παροχή νέων υπηρεσιών υγείας Kούλης Γιαννουκάκος Eρευνητής Β Υπεύθυνος Εργαστηρίου Μοριακής ιαγνωστικής Εθνικό Κέντρο Έρευνας Φυσικών Επιστηµών «ηµόκριτος»

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΠΡΟ ΙΑΘΕΣΗ ΓΙΑ ΚΑΡΚΙΝΟ ΜΑΣΤΟΥ/ΩΟΘΗΚΩΝ. Στο δυτικό κόσµο 1 στις 8 γυναίκες θα αναπτύξει καρκίνο του µαστού κατά τη διάρκεια

ΓΕΝΕΤΙΚΗ ΠΡΟ ΙΑΘΕΣΗ ΓΙΑ ΚΑΡΚΙΝΟ ΜΑΣΤΟΥ/ΩΟΘΗΚΩΝ. Στο δυτικό κόσµο 1 στις 8 γυναίκες θα αναπτύξει καρκίνο του µαστού κατά τη διάρκεια ΓΕΝΕΤΙΚΗ ΠΡΟ ΙΑΘΕΣΗ ΓΙΑ ΚΑΡΚΙΝΟ ΜΑΣΤΟΥ/ΩΟΘΗΚΩΝ ρ. Ελένη Κοντογιάννη, Ph.D Γενετίστρια ιευθύντρια IVF & Genetics Στο δυτικό κόσµο 1 στις 8 γυναίκες θα αναπτύξει καρκίνο του µαστού κατά τη διάρκεια της ζωής

Διαβάστε περισσότερα

Σύμφωνα με τον παγκόσμιο οργανισμό υγείας, κάθε χρόνο υπάρχουν 1.38 εκατομμύρια καινούρια περιστατικά και περίπου 458 000 θάνατοι από τον καρκίνο του

Σύμφωνα με τον παγκόσμιο οργανισμό υγείας, κάθε χρόνο υπάρχουν 1.38 εκατομμύρια καινούρια περιστατικά και περίπου 458 000 θάνατοι από τον καρκίνο του 1 Σύμφωνα με τον παγκόσμιο οργανισμό υγείας, κάθε χρόνο υπάρχουν 1.38 εκατομμύρια καινούρια περιστατικά και περίπου 458 000 θάνατοι από τον καρκίνο του μαστού. Ο καρκίνος του μαστού είναι με μεγάλη διαφορά

Διαβάστε περισσότερα

Καρκίνος και κληρονομικότητα: η εμπειρία στην Κύπρο

Καρκίνος και κληρονομικότητα: η εμπειρία στην Κύπρο Καρκίνος και κληρονομικότητα: η εμπειρία στην Κύπρο Κ. Κυριάκου, PhD Βιοχημικός Κυτταροβιολόγος Υπεύθυνος του Τμήματος ΗΜ/Μοριακής Παθολογίας Ινστιτούτο Νευρολογίας και Γενετικής Κύπρου Ανοικτή Συζήτηση

Διαβάστε περισσότερα

Παράγοντες κινδύνου για τον καρκίνο του Παγκρέατος. Στέργιος Δελακίδης Γαστρεντερολόγος

Παράγοντες κινδύνου για τον καρκίνο του Παγκρέατος. Στέργιος Δελακίδης Γαστρεντερολόγος Παράγοντες κινδύνου για τον καρκίνο του Παγκρέατος Στέργιος Δελακίδης Γαστρεντερολόγος Καρκίνος Παγκρέατος: πρόγνωση Κακή πρόγνωση Συνολική πενταετής επιβίωση 6%.

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

Περιβαλλοντικά Καρκινογόνα Κυρίως τρεις τύποι: Χηµικά (µόλυνση, κάπνισµα, αµίαντος) Φυσικά (ιονίζουσα ακτινοβολία, µή- ιονίζουσα???) Βιολογικά (ιοί π.χ.. HPV) Καρκίνος παχέος εντέρου ΓΕΝΕΤΙΚΟΣ

Διαβάστε περισσότερα

Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ. Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη

Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ. Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη 2013 ΠΕΡΙΕΧΟΜΕΝΑ : Ορολογία και λίγα λόγια για τον καρκίνο Χαρακτηριστικά του καρκίνου Μεταλλάξεις Μεταλλάξεις και καρκίνος

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα

αμινοξύ. Η αλλαγή αυτή έχει ελάχιστη επίδραση στη στερεοδιάταξη και τη λειτουργικότητα της πρωτεϊνης. Επιβλαβής

αμινοξύ. Η αλλαγή αυτή έχει ελάχιστη επίδραση στη στερεοδιάταξη και τη λειτουργικότητα της πρωτεϊνης. Επιβλαβής Κεφάλαιο 6: ΜΕΤΑΛΛΑΞΕΙΣ -ΘΕΩΡΙΑ- Μεταλλάξεις είναι οι αλλαγές που συμβαίνουν στο γενετικό υλικό ενός οργανισμού, τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις) όσο και σε χρωμοσωμικό επίπεδο (χρωμοσωμικές

Διαβάστε περισσότερα

Aπό το γονίδιο στη διάγνωση του κληρονοµικού καρκίνου

Aπό το γονίδιο στη διάγνωση του κληρονοµικού καρκίνου Aπό το γονίδιο στη διάγνωση του κληρονοµικού καρκίνου Κούλης Γιαννουκάκος Ερευνητής Β Υπεύθυνος Εργαστηρίου Μοριακής ιαγνωστικής Ινστιτούτο Ραδιοϊσοτόπων & Ραδιοδιαγνωστικών Προϊόντων Εθνικό Κέντρο Έρευνας

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΣΧΕΣΗ: Το 3%-5% των καρκίνων μαστού έχουν κληρονομική βάση.

ΓΕΝΕΤΙΚΗ ΣΧΕΣΗ: Το 3%-5% των καρκίνων μαστού έχουν κληρονομική βάση. Από: ΤΑ ΝΕΑ Ένθετο Υγεία Ρεπορτάζ: Μαίρη Κατσανοπούλου Η υγεία των γυναικών από ορισμένους καρκίνους έως την οστεοπόρωση και τη νόσο Αλτσχάιμερ συχνά κληρονομείται από τις μητέρες τους, είτε μέσω γονιδίων

Διαβάστε περισσότερα

Κλινικές επιλογές σε μεταλλάξεις των BRCA 1/2 γονιδίων. Ιωάννης Θ. Νατσιόπουλος Χειρουργός Μαστού

Κλινικές επιλογές σε μεταλλάξεις των BRCA 1/2 γονιδίων. Ιωάννης Θ. Νατσιόπουλος Χειρουργός Μαστού Κλινικές επιλογές σε μεταλλάξεις των BRCA 1/2 γονιδίων Ιωάννης Θ. Νατσιόπουλος Χειρουργός Μαστού Η ανίχνευση BRCA μετάλλαξης δεν αποτελεί διάγνωση νόσου αλλά γενετική πληροφορία και εκτίμηση κινδύνου Ενδείξεις

Διαβάστε περισσότερα

ΚΑΤΑΛΟΓΟΣ ΑΣΘΕΝΕΙΩΝ ΠΟΥ ΑΝΑΦΕΡΟΝΤΑΙ ΣΤΟ ΣΧΟΛΙΚΟ ΕΓΧΕΙΡΙΔΙΟ

ΚΑΤΑΛΟΓΟΣ ΑΣΘΕΝΕΙΩΝ ΠΟΥ ΑΝΑΦΕΡΟΝΤΑΙ ΣΤΟ ΣΧΟΛΙΚΟ ΕΓΧΕΙΡΙΔΙΟ ΑΣΘΕΝΕΙΕΣ ΚΑΤΑΛΟΓΟΣ ΑΣΘΕΝΕΙΩΝ ΠΟΥ ΑΝΑΦΕΡΟΝΤΑΙ ΣΤΟ ΣΧΟΛΙΚΟ ΕΓΧΕΙΡΙΔΙΟ ΤΡΟΠΟΣ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑΣ ΣΥΝΕΠΕΙΕΣ ΕΙΔΟΣ ΜΕΤΑΛΛΑΞΗΣ Οικογενή υπερχοληστερολαιμία Αυτοσωμική επικρατής κληρονομικότητα Σχετίζεται με αυξημένο

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

Σήμερα η παγκόσμια ημέρα κατά του καρκίνου: Στατιστικά-πρόληψη

Σήμερα η παγκόσμια ημέρα κατά του καρκίνου: Στατιστικά-πρόληψη Σήμερα η παγκόσμια ημέρα κατά του καρκίνου: Στατιστικά-πρόληψη Η Παγκόσμια Ημέρα κατά του Καρκίνου καθιερώθηκε με πρωτοβουλία της Διεθνούς Ένωσης κατά του Καρκίνου και πραγματοποιείται κάθε χρόνο στις

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία των νουκλεοτιδίων που συμβαίνουν στο γενετικό υλικό ενός οργανισμού τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις)

Διαβάστε περισσότερα

ΕΚΤΟ ΚΕΦΑΛΑΙΟ ΜΕΤΑΛΛΑΞΕΙΣ

ΕΚΤΟ ΚΕΦΑΛΑΙΟ ΜΕΤΑΛΛΑΞΕΙΣ ΕΚΤΟ ΚΕΦΑΛΑΙΟ ΜΕΤΑΛΛΑΞΕΙΣ ΜΕΤΑΛΛΑΞΕΙΣ Γίνονται μόνο στο γενετικό υλικό των κυττάρων, δηλαδή στο DNA και έχουν μόνιμο χαρακτήρα. Δεν θεωρούνται μεταλλάξεις, μεταβολές των προϊόντων της έκφρασης του γενετικού

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 30 ΜΑΪΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

Κεφάλαιο 6: Μεταλλάξεις

Κεφάλαιο 6: Μεταλλάξεις Κεφάλαιο 6: Μεταλλάξεις ΕΛΕΓΧΟΣ ΓΝΩΣΕΩΝ 1. Τι ονομάζονται μεταλλάξεις και ποια τα κυριότερα είδη τους; 2. Ποιες οι διαφορές μεταξύ γονιδιακών και χρωμοσωμικών μεταλλάξεων; 3. Οι μεταλλάξεις στα σωματικά

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΘΕΜΑ 1 Ο Α. 1 β, 2 α, 3 δ, 4 δ, 5 γ Β. 1 Λ, 2 Σ, 3 Λ, 4 Λ, 5 Λ ΘΕΜΑ 2 Ο Α. 1) α- θαλασσαιμία Σελ 93 σχολικού βιβλίου: ʽʽΤα γονίδια

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

ΥΓΕΙΑ. Ασπίδα στον καρκίνο η μεσογειακή διατροφή

ΥΓΕΙΑ. Ασπίδα στον καρκίνο η μεσογειακή διατροφή ΥΓΕΙΑ Ασπίδα στον καρκίνο η μεσογειακή διατροφή Κυρ, 12 Μάιος 2013, p.1 24 ΥΓΕΙΑ Ο φιλελεύθερος ΤΗΙ ΚΥΡΙΑΚΗΣ Με την Κίκα Κασινίδου I β Y Μεσογειακή διατροφή ασπίδα για καρκίνο μαστού Σημαντικό επίτευγμα

Διαβάστε περισσότερα

Μεταλλάξεις. Π. Πάσχου, PhD, DABMG

Μεταλλάξεις. Π. Πάσχου, PhD, DABMG Μεταλλάξεις Π. Πάσχου, PhD, DABMG Ο γενετικός κώδικας Οι γενετικές οδηγίες είναι γραµµένες µε «λέξεις» τριών νουκλεοτιδίων Ένα κωδικόνιο = ένα αµινοξύ Έλεγχος για λάθη Αν και οι βάσεις ζευγαρώνουν κατα

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό Θέμα 1 ο 1. α 2. γ 3. γ 4.β 5. δ Θέμα 2 ο Α. Οι νόμοι του Mendel δεν ισχύουν σε πολυγονιδιακούς χαρακτήρες και σε συνδεδεμένα γονίδια (μη ανεξάρτητα), ενώ οι αναλογίες δεν είναι οι αναμενόμενες σε φυλοσύνδετα

Διαβάστε περισσότερα

ΜΟΡΙΑΚΗ ΒΙΟΛΟΓΙΑ ΚΑΙ ΓΕΝΕΤΙΚΗ ΤΟΥ ΝΕΦΡΟΒΛΑΣΤΩΜΑΤΟΣ (ΟΓΚΟΥ ΤΟΥ WILMS) Σπυριδάκης Ιωάννης 2, Καζάκης Ι 2, Δογραματζής Κωνσταντίνος 1, Κοσμάς Νικόλαος 1,

ΜΟΡΙΑΚΗ ΒΙΟΛΟΓΙΑ ΚΑΙ ΓΕΝΕΤΙΚΗ ΤΟΥ ΝΕΦΡΟΒΛΑΣΤΩΜΑΤΟΣ (ΟΓΚΟΥ ΤΟΥ WILMS) Σπυριδάκης Ιωάννης 2, Καζάκης Ι 2, Δογραματζής Κωνσταντίνος 1, Κοσμάς Νικόλαος 1, 1 Ιατρική Σχολή ΑΠΘ, Στρατιωτική Σχολή Αξιωματικών Σωμάτων, 2Β Πανεπιστημιακή Κλινική Χειρουργικής Παίδων ΑΠΘ, Γ.Ν Παπαγεωργίου (Διευθυντής: Καθηγητής Αντώνιος Φιλιππόπουλος) Εισαγωγή Ο όγκος του Wilms

Διαβάστε περισσότερα

Πρόληψη κληρονομικού καρκίνου παχέος εντέρου. Μιχάλης Οικονόμου Γαστρεντερολόγος

Πρόληψη κληρονομικού καρκίνου παχέος εντέρου. Μιχάλης Οικονόμου Γαστρεντερολόγος Πρόληψη κληρονομικού καρκίνου παχέος εντέρου Μιχάλης Οικονόμου Γαστρεντερολόγος Καρκίνος Παχέος Εντέρου (ΚΠΕ) ΚΠΕ είναι ο 3 ος συχνότερος καρκίνος ΚΠΕ είναι η 2 η αιτία θανάτου από καρκίνο Μείωση αριθμών

Διαβάστε περισσότερα

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Μπορούν τα γονίδια που ελέγχουν τη σύνθεση της α-αλυσίδας της αιμοσφαιρίνης να χαρακτηριστούν ως πολλαπλά αλληλόμορφα; Τα γονίδια που ελέγχουν την α-αλυσίδα της αιμοσφαιρίνης

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orionidef.gr ΘΕΜΑ A Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014

ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 Ονοματεπώνυμο εξεταζόμενου:. ΘΕΜΑ 1 Ο Να απαντήσετε στις ερωτήσεις πολλαπλής επιλογής: 1. Η ανευπλοειδία είναι είδος μετάλλαξης που οφείλεται:

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) DNA

Διαβάστε περισσότερα

Συνέντευξη με τον Παθολόγο - Ογκολόγο, Στυλιανό Γιασσά

Συνέντευξη με τον Παθολόγο - Ογκολόγο, Στυλιανό Γιασσά Συνέντευξη με τον Παθολόγο - Ογκολόγο, Στυλιανό Γιασσά Ο καρκίνος του παχέος εντέρου ορθού αποτελεί το δεύτερο πιο συχνό καρκίνο σε γυναίκες και άνδρες και αντιπροσωπεύει το 13% όλων των καρκίνων. Στην

Διαβάστε περισσότερα

Μεταλλάξεις DNA. Επιδιόρθωση DNA. Μοριακή βάση µεταλλαξεων και επιδιόρθωσης του DNA

Μεταλλάξεις DNA. Επιδιόρθωση DNA. Μοριακή βάση µεταλλαξεων και επιδιόρθωσης του DNA Μεταλλάξεις DNA Επιδιόρθωση DNA Μοριακή βάση µεταλλαξεων και επιδιόρθωσης του DNA 1 Tι είναι µετάλλαξη Τι προκαλεί τις µεταλλάξεις Τύποι των µεταλλάξεων Tύποι των µεταλλαξογόνων Μεταλλάξεις και ασθένειες

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα γονίδια Ι Α και i που καθορίζουν τις ομάδες αίματος: Α. είναι ατελώς επικρατή Β. είναι συνεπικρατή

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. δ A2. γ A3.

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ/Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 05/01/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ο µέγιστος αριθµός διαφορετικών

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ : - ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΘΕΜΑ A Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ B Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ. Βιοτεχνολογία. Μεταλλαξιγένεση Διδάσκουσα: Αναπλ. Καθ. Άννα Ειρήνη Κούκκου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ. Βιοτεχνολογία. Μεταλλαξιγένεση Διδάσκουσα: Αναπλ. Καθ. Άννα Ειρήνη Κούκκου ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Βιοτεχνολογία Μεταλλαξιγένεση Διδάσκουσα: Αναπλ. Καθ. Άννα Ειρήνη Κούκκου Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες χρήσης Creative

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. H β- θαλασσαιμία είναι

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 Α1- δ, Α2-α, Α3-γ, Α4-δ, Α5-β ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ Β1. Η διπλή έλικα του DN συνδέεται µε τις ιστόνες

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Οικογενησ Μεσογειακοσ Πυρετοσ

Οικογενησ Μεσογειακοσ Πυρετοσ www.printo.it/pediatric-rheumatology/gr/intro Οικογενησ Μεσογειακοσ Πυρετοσ Έκδοση από 2016 1. ΤΙ ΕΙΝΑΙ Ο ΟΙΚΟΓΕΝΗΣ ΜΕΣΟΓΕΙΑΚΟΣ ΠΥΡΕΤΟΣ 1.1 Τι είναι; Ο Οικογενής Μεσογειακός Πυρετός (ΟΜΠ) είναι ένα γενετικά

Διαβάστε περισσότερα

Προσυµπτωµατικός έλεγχος για κληρονοµικές µορφές καρκίνου

Προσυµπτωµατικός έλεγχος για κληρονοµικές µορφές καρκίνου 16 Orphanet Ιστοσελίδα ελεύθερης πρόσβασης που παρέχει πληροφορίες για τις σπάνιες παθήσεις, τα κλινικά πειράµατα, τα φάρµακα και συνδέσµους για οµάδες υποστήριξης σε ολόκληρη την Ευρώπη. Ιστοσελίδα: www.orpha.net

Διαβάστε περισσότερα

BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος σχολ. βιβλίο σελ. 24: «Κάθε φυσιολογικός καρυότυπος». Συμπεράσματα: - Φύλο ατόμου

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) ΘΕΜΑ Α Α1=β,

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 Πανελλήνιες 2016 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΘΕΜΑ Α Α1- β Α2- β Α3- δ Α4- γ Α- γ ΘΕΜΑ Β Β1. 1- Α 2- Γ 3- Α 4- Β - Α 6- Α 7- Γ Β2. Ορισμός καρυότυπου (σελ. 24):

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 Ο Α. Στις ερωτήσεις 1-3, να γράψετε στο τετράδιό σας τον αριθµό της

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις 2016

Πανελλαδικές εξετάσεις 2016 Θέμα Α Α1: β Α2: β Α3: δ Α4: γ Α5: γ Θέμα Β Πανελλαδικές εξετάσεις 2016 Ενδεικτικές απαντήσεις στο μάθημα «ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ» Β1. 1:Α, 2:Γ, 3:Α, 4:Β, 5:Α, 6:Α, 7:Γ Β2. Σχολ. Βιβλ. Κεφ.1, σελ. 24

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΚΛΗΡΟΝΟΜΟΥΜΕΝΟΥ ΚΑΡΚΙΝΟΥ

ΓΕΝΕΤΙΚΗ ΚΛΗΡΟΝΟΜΟΥΜΕΝΟΥ ΚΑΡΚΙΝΟΥ ΓΕΝΕΤΙΚΗ ΚΛΗΡΟΝΟΜΟΥΜΕΝΟΥ ΚΑΡΚΙΝΟΥ Εφαρμογή στον κληρονομούμενο καρκίνο μαστού και ωοθηκών: γονίδια BRCA1/2 Χρήστος Κρούπης Λέκτορας Ιατρικής Σχολής Πανεπιστημίου Αθηνών Εργαστήριο Κλινικής Βιοχημείας Μετά

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι λανθασμένη.

Διαβάστε περισσότερα

igenetics Mια Μεντελική προσέγγιση

igenetics Mια Μεντελική προσέγγιση igenetics Mια Μεντελική προσέγγιση Κεφάλαιο 22 (+κεφ. 17 Hartwell) Γενετική του καρκίνου Η πρωτεΐνη p53 προσδένεται στο DNA. 2 ΕΙΚΟΝΑ 22.1 Μαστογραφία που απεικονίζει έναν όγκο. Όγκος 3 Κύρια σημεία: Καρκίνος

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 27 ΜΑΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Γ Γ.1 Ο χαρακτήρας της ομάδας αίματος στον άνθρωπο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία)

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Βιοτεχνολογία Φυτών ΔΠΘ / Τμήμα Αγροτικής Ανάπτυξης ΠΜΣ Αειφορικά Συστήματα Παραγωγής και Περιβάλλον στη Γεωργία Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Αριστοτέλης Χ. Παπαγεωργίου Εργαστήριο

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ 1 ο Α. Σωστό το γ ιότι ο φαινότυπος που εµφανίζεται στους απογόνους

Διαβάστε περισσότερα

Ογκογονίδια και ογκοκατασταλτικά γονίδια

Ογκογονίδια και ογκοκατασταλτικά γονίδια , Φυσικός MSc 1 Ογκογονίδια και ογκοκατασταλτικά γονίδια O καρκίνος είναι μια νόσος προκαλούμενη από ογκογονίδια, από ογκοκατασταλτικά γονίδια και από γονίδια micrοrna. Οι αλλαγές αυτές είναι συνήθως γεγονότα

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Θετικής κατεύθυνσης Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή σειρά είναι: 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελικάσες ε. RNA πολυμεράση Β3. Σχολικό

Διαβάστε περισσότερα

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 1. 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990 50.20.990 2. 25ης Μαρτίου 74 Π. ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 3. Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 8 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα 3 ο 12 Θέμα

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΣΤΗΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ' ΛΥΚΕΙΟΥ Ονοματεπώνυμο: Ημερομηνία:

ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΣΤΗΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ' ΛΥΚΕΙΟΥ Ονοματεπώνυμο: Ημερομηνία: ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΣΤΗΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ' ΛΥΚΕΙΟΥ Ονοματεπώνυμο: Ημερομηνία: ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής. 1. Ο πρώτος νόμος του Mendel περιγράφει: α. τον ελεύθερο συνδυασμό των

Διαβάστε περισσότερα

κληρονοµικότητα Πληροφορίες για Ασθενείς και Οικογένειες

κληρονοµικότητα Πληροφορίες για Ασθενείς και Οικογένειες 12 Φυλοσύνδετη στο Χ Ή την τοπική σας κλινική γενετικής διάγνωσης: κληρονοµικότητα Εργαστήριο Ιατρικής Γενετικής Πανεπιστήµιο Αθηνών Νοσοκοµείο Παίδων " Αγία Σοφία" Αθήνα Τηλ: +210 7795553 http://iatriki-genetiki.med.uoa.gr

Διαβάστε περισσότερα

Περιβάλλον και υγεία: Ορόλοςτηςβιολογικήςέρευνας στη διαμόρφωση πολιτικών προστασίας και πρόληψης

Περιβάλλον και υγεία: Ορόλοςτηςβιολογικήςέρευνας στη διαμόρφωση πολιτικών προστασίας και πρόληψης Περιβάλλον και υγεία: Ορόλοςτηςβιολογικήςέρευνας στη διαμόρφωση πολιτικών προστασίας και πρόληψης Σ. Κυρτόπουλος Ινστιτούτο Βιολογικών Ερευνών & Βιοτεχνολογίας Εθνικό Ίδρυμα Ερευνών Συμβολή περιβαλλοντικών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα

ΟΓΚΟΛΟΓΙΑ - ΡΑΔΙΟΒΙΟΛΟΓΙΑ

ΟΓΚΟΛΟΓΙΑ - ΡΑΔΙΟΒΙΟΛΟΓΙΑ ΟΓΚΟΛΟΓΙΑ - ΡΑΔΙΟΒΙΟΛΟΓΙΑ Βασικές γνώσεις I SBN 960-372-069-0 ΠΕΡΙΕΧΟΜΕΝΑ ΠΑΡΙΣ Α. ΚΟΣΜΙΔΗΣ ΓΕΩΡΓΙΟΣ ΤΣΑΚΙΡΗΣ Μ Ε Ρ Ο Σ Ι ΟΓΚΟΛΟΓΙΑ Κεφάλαιο 1 ΕΙΣΑΓΩΓΗ ΣΤΟΝ ΚΑΡΚΙΝΟ... 3 Το καρκινικό κύτταρο... 3 Κυτταρικός

Διαβάστε περισσότερα

ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΚΑΙ ΣΥΝΔΡΟΜΟ DOWN ΥΠΟ ΤΗΝ ΑΙΓΊΔΑ ΤΗΣ ΙΕΡΗΣ ΜΗΤΡΟΠΟΛΗΣ ΑΛΕΞΑΝΔΡΟΥΠΟΛΗΣ. Μαλτέζος Ιωάννης

ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΚΑΙ ΣΥΝΔΡΟΜΟ DOWN ΥΠΟ ΤΗΝ ΑΙΓΊΔΑ ΤΗΣ ΙΕΡΗΣ ΜΗΤΡΟΠΟΛΗΣ ΑΛΕΞΑΝΔΡΟΥΠΟΛΗΣ. Μαλτέζος Ιωάννης ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΚΑΙ ΣΥΝΔΡΟΜΟ DOWN ΥΠΟ ΤΗΝ ΑΙΓΊΔΑ ΤΗΣ ΙΕΡΗΣ ΜΗΤΡΟΠΟΛΗΣ ΑΛΕΞΑΝΔΡΟΥΠΟΛΗΣ Μαλτέζος Ιωάννης Κληρονομικότητα Το σώμα μας αποτελείται από εκατομμύρια κύτταρα εκ των οποίων τα περισσότερα εξ αυτών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/ Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/ Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 09/04/2014 2 Τόσο τα νεκρά (µε θερµική επεξεργασία) βακτήρια S όσο και τα ζωντανά βακτήρια R δεν µπορούν να θανατώσουν ποντικούς. Όµως, η ταυτόχρονη µόλυνση µε αυτά

Διαβάστε περισσότερα

ΣΥΓΓΕΝΕΙΣ ΑΝΩΜΑΛΙΕΣ - ΥΣΜΟΡΦΟΛΟΓΙΑ

ΣΥΓΓΕΝΕΙΣ ΑΝΩΜΑΛΙΕΣ - ΥΣΜΟΡΦΟΛΟΓΙΑ ΣΥΓΓΕΝΕΙΣ ΑΝΩΜΑΛΙΕΣ - ΥΣΜΟΡΦΟΛΟΓΙΑ ΕΛ. ΦΡΥΣΙΡΑ Επ. Καθηγήτρια Κλινικής Γενετικής ΕΡΓΑΣΤΗΡΙΟ ΙΑΤΡΙΚΗΣ ΓΕΝΕΤΙΚΗΣ ΠΑΝ/ΜΙΟΥ ΑΘΗΝΩΝ ΝΟΣΟΚΟΜΕΙΟ ΠΑΙ ΩΝ «Η ΑΓΙΑ ΣΟΦΙΑ» ΙΕΥΘΥΝΤΗΣ: ΚΑΘΗΓΗΤΗΣ κ.ε. ΚΑΝΑΒΑΚΗΣ ΣΥΓΓΕΝΕΙΣ

Διαβάστε περισσότερα

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέμα 1 ο : Να επιλέξετε τη σωστή απάντηση: 1. Το σύμπλοκο έναρξης της πρωτεϊνοσύνθεσης δεν περιλαμβάνει α. το mrna β. τη μεγάλη ριβοσωμική υπομονάδα γ.

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα