Experimental and Clinical Studies on Fluoroquinoloneinsusceptible Escherichia coli Isolated from Patients with Urinary Tract Infections from 1994 to

HTML
DOWNLOAD

Μέγεθος: px

Εμφάνιση ξεκινά από τη σελίδα:

Download "Experimental and Clinical Studies on Fluoroquinoloneinsusceptible Escherichia coli Isolated from Patients with Urinary Tract Infections from 1994 to"

Περικλῆς Αγγελοπούλου
6 χρόνια πριν
Προβολές:

1 Experimental and Clinical Studies on Fluoroquinoloneinsusceptible Escherichia coli Isolated from Patients with Urinary Tract Infections from 1994 to 2007 a a* a a a a,b a a b

2 ʼ

3 PCR primers and conditions used in the direct sequence method Primer specificity Primer sequences Product length bp Initial denaturation PCR conditions Cycling Cycle Final extension DNA gyrase A gene (gyra) Topoisomerase IV gene (parc) F: 5ʼ GAGGAAGAGCTGAAGAGCTCC 3ʼ 1st PCR min, 94 ; 1 min, 55 ; 1 min, min, 72 R: 5ʼ CGAGATCGGCCATCAGTTC 3ʼ 5 min, 94 2nd PCR F: 5ʼ GAGGAAGAGCTGAAGAGCTCC 3ʼ 30 sec, 95 ; 4 min, F: 5ʼ AAACCTGTTCAGCGCCGCATT 3ʼ 1st PCR min, 94 ; 1 min, 55 ; 1 min, min, 72 R: 5ʼ GTGGTGCCGTTAAGCAAA 3ʼ 5 min, 95 2nd PCR F: 5ʼ AAACCTGTTCAGCGCCGCATT 3ʼ 30 sec, 95 ; 4 min, Number of patients (%) (year) Annual changes in the incidence of UTI due to fluoroqui nolone insusceptible E. coli. lines: Number of patients with UTI due to fluoroquinolone insusceptible E. coli. Percentage of fluoroquinolone insuscep tible E. coli among the total isolated E. coli.

4 Cumulative percentages of fluoroquinolone insusceptible E. coli strains at MICs (µg ml) of several antibiotics except fluoro quinolones. The MIC 90 values of ampicillin, cefazoline, cefozo pran, imipenem, minocycline and gentamycin were 64, 8, 0.5, 0.5, 32 and 32µg ml, respectively. lines: ampicillin cefazolin cefozopran imipenem minocycline gentamycin A D Correlations between MICs (μg ml) of ofloxacin (horizontal) and other fluoroquinolones (vertical) for fluoroquinolone insusceptible E. coli strains (n 79). A, norfloxacin; B, levofloxacin; C, sparfloxacin; D, ciprofloxacin; E, tosufloxacin; F, sitafloxacin. MICs of tosufloxacin ( 64 µg ml) could not be measured due to insolubility. B E C F

5 Backgrounds of the patients with UTI due to fluoroqui nolone insusceptible E. coli (n 89) Sex: male female Age: median SD (range) (8 to 86) Outpatient Inpatient Catheterization (29.2%) Self catheterization (15.7%) Repeated UTI: yes no (unclear: 1) Underlying diseases of the patients with complicated UTI (n 82) Neurogenic bladder 32 (39.0%) Malignancy 22 (26.8%) Fistula (vagina, rectum) 11 (13.4%) Others 17 (20.7%) Administration of the antimicrobial agent before bacterial isolation Prescribed for the last 2 years (76.4%) Prescription of fluoroquinolones (70.6%) Just before isolation (for last 2 weeks) (29.2%) Prescription of fluoroquinolones (76.9%) No prescription (23.6%) Number of patients A B C D E F G H I Decisive treatments and outcomes. A, cephems; B, fluoroquinolones; C, penicillins; D, penems; E, carbapenems; F, minocycline; G, sulfamethoxazole trimethoprim; H, aminoglyco sides; I; none. bars: cure, light symptom, no change, naturally disappeared, unclear.

6 Backgrounds of the patients with UTI due to fluoroquinolone insusceptible E. coli Year Sex Age Underlying diseases Biofilm OD570 Major amino acid replacements MIC (µg ml) GyrA ParC Ofloxacin Sitafloxacin Levofloxacin A 2002 F 77 Neurogenic bladder 0 S83L, D87G S80R F 71 None S83L, D87N S80I B 1998 F 18 Urethral stricture S83L M 70 Bladder stone S83L, D87N S80I, E84V A: Two strains of E. coli which MIC of sitafloxacin was 2µg ml. B: Two strains of E. coli with strong capabilities of biofilm formation.

7 Correlations between amino acid replacements and MICs of ofloxacin GyrA (83, 87) ParC (80, 84) MICs of ofloxacin (μg ml) Susceptible Insusceptible (, ) (, ) (, ) (, ) (, ) (, ) (, ) (, ) (, ) (, ) (, ) (, ) (, ) (, ) Total number of strain Biofilm forming capabilities of E. coli strains. A, Group I is fluoroquinolone insusceptible E. coli (mean SD: ). Group II is fluoroquinolone susceptible E. coli (mean SD: ). The p value was 0.19; B, Group III is fluoroquinolone insus ceptible E. coli strains for which the MICs of sitafloxacin were 0.5µg ml (mean SD: ). Group IV is fluoroquinolone insus ceptible E. coli strains for which the MICs of sitafloxacin were over 1µg ml (mean SD: ). The p value was 0.93.

9 Eom JS, Hwang BY, Sohn JW, Kim WJ, Kim MJ, Park SC and Cheong HJ: Clinical and molecular epidemiology of quinolone insusceptible Escherichia coli isolated from urinary tract infection. Microb Drug Resist (2002) 8: Kahlmeter G: Prevalence and antimicrobial susceptibility of patho gens in uncomplicated cystitis in Europe. The ECO.SENS study. Int J Antimicrob Agents (2003) Suppl 2: The WHO Western Pacific Gonococcal Antimicrobial Surveillance Programme: Surveillance of antibiotic resistance in Neisseria gon orrhoeae in the WHO Western Pacific Region, Commun Dis Intell (2006) 30: Japanese Journal of Sexual Transmitted Diseases: Diagnosis and treatment guidelines Nippon Seikansenshou Gakkaishi (Jpn J STD) (2008) 19: Suppl (in Japanese). 5. Hooper DC: Emerging mechanisms of fluoroquinolone resistance. Emerg Infect Dis (2001) 7: Hopkins KL, Davies RH and EJ Threlfall EJ: Mechanisms of qui nolone resistance in Escherichia coli and Salmonella: recent developments. Int J Antimicrob Agents (2005) 25: Clinical and Laboratory Standards Institute: Methods for dilution antimicrobial susceptibility tests for bacteria that grow aero bically; approved standard seventh edition Document M7 A7. Clinical and Laboratory Standards Institute, Wayne (2006). 8. Clinical and Laboratory Standards Institute: Performance stan dards for antimicrobial susceptibility testing; seventeenth informa tional supplement M100 S17. Clinical and Laboratory Standards Institute, Wayne (2007) pp Minuth JN, Musher DM and Thorsteinsson SB: Inhibition of the antibacterial activity of gentamicin by urine. J Infect Dis (1976) 133: Engberg J, Aarestrup FM, Taylor DE, Gerner Smidt P and Nachamkin I: Quinolone and macrolide resistance in Campylo bacter jejuni and C. coli: resistance mechanisms and trends in human isolates. Emerg Infect Dis (2001) 7: Ginsburg AS, Grosset JH and Bishai WR: Fluoroquinolones, tuberculosis, and resistance. Lancet Infect Dis (2003) 3: Hooper DC and Wolfson JS: Mechanisms of fluoroquinolone action and bacterial killing. In Quinolone Antimicrobial Agents, 2nd Ed. Hooper DC, Wolfson JS eds, American Society for Microbiology, Washington DC (1993) pp Wang JC: DNA topoisomerases. Annu Rev Biochem (1996) 65: Adams DE, Shekhtman EM, Zechiedrich EL, Schmid MB and Cozzarelli NR: The role of topoisomerase IV in partitioning bacte rial replicons and the structure of catenated intermediates in DNA replication. Cell (1992) 71: Heisig P: Genetic evidence for a role of parc mutations in devel opment of high level fluoroquinolone resistance in Escherichia coli. Antimicrob Agents Chemother (1996) 40: Bagel S, Hüllen V, Wiedemann B and Heisig P: Impact of gyra and parc mutations on quinolone resistance, doubling time, and supercoiling degree of Escherichia coli. Antimicrob Agents Che mother (1999) 43: Komp Lindgren P, Karlsson A and Hughes D: Mutation rate and

10 evolution of fluoroquinolone resistance in Escherichia coli isolates from patients with urinary tract infections. Antimicrob Agents Chemother (2003) 47: Fralick JA: Evidence that TolC is required for functioning of the Mar AcrAB efflux pump of Escherichia coli. J Bacteriol (1996) 178: Okusu H, Ma D and Nikaido H: AcrAB efflux pump plays a major role in the antibiotic resistance phenotype of Escherichia coli mul tiple antibiotic resistance (Mar) mutants. J Bacteriol (1996) 178: Alekshun MN and Levy SB: Regulation of chromosomally medi ated multiple antibiotic resistance: the mar regulon. Antimicrob Agents Chemother (1997) 41: Robicsek A, Jacoby GA and Hooper DC: The worldwide emer gence of plasmid mediated quinolone resistance. Lancet Infect Dis (2006) 6: Yamane K, Wachino J, Suzuki S, Kimura K, Shibata N, Kato H, Shibayama K, Konda T and Arakawa Y: New plasmid mediated fluoroquinolone efflux pump, QepA, found in an Escherichia coli clinical isolate. Antimicrob Agents Chemother (2007) 51: Wang A, Yang Y, Lu Q, Wang Y, Chen Y, Deng L, Ding H, Deng Q, Zhang H, Wang C, Liu L, Xu X, Wang L and Shen X: Presence of qnr gene in Escherichia coli and Klebsiella pneu moniae insusceptible to ciprofloxacin isolated from pediatric patients in China. BMC Infect Dis (2008) 8: Onodera Y, Okuda J, Tanaka M and Sato K: Inhibitory activities of quinolones against DNA gyrase and topoisomerase IV of Enterococcus faecalis. Antimicrob Agents Chemother (2002) 46: Nakashima M, Uematsu T, Kosuge K, Umemura K, Hakusui H and Tanaka M: Pharmacokinetics and tolerance of DU 6859a, a new fluoroquinolone, after single and multiple oral doses in healthy volunteers. Antimicrob Agents Chemother (1995) 39: Kumon H: Management of biofilm infection in the urinary tract. World J Surg (2000) 24:

Σχετικά έγγραφα

V G III MIC. Table 1. Methods and reporting values of antimicrobial susceptibility testing and their interpretations

V G III MIC. Table 1. Methods and reporting values of antimicrobial susceptibility testing and their interpretations Key words in vitro I II Table 1. Methods and reporting values of antimicrobial susceptibility testing and their interpretations Method Report Interpretation Difusion method Disk method Sensitive (S), Intermediate