تاثیر اسیدسالیسیلیک و فنیلآالنین روی بیان ژنهای کلیدی مسیر بیوسنتز سزامین در کنجد

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "تاثیر اسیدسالیسیلیک و فنیلآالنین روی بیان ژنهای کلیدی مسیر بیوسنتز سزامین در کنجد"

Transcript

1 مهندسی ژنتيک و ایمنی زیستی دوره 5 شماره 2 پایيز و زمستان 1395 صفحه تاثیر اسیدسالیسیلیک و فنیلآالنین روی بیان ژنهای کلیدی مسیر بیوسنتز سزامین در کنجد Effect of salicylic acid and phenylalanine on expression of key genes involved in the sesamin biosynthesis pathway in sesame چکیده شهره امانالهی 1 فاطمه دهقان نیری 2 * میترا محمدی بازرگانی 3 Shohreh Amanelahy 1, Fatemeh Dehghan Nayeri 2*, Mitra Mohammadi Bazrgani 3 1- کارشناسارشد 2- استادیار گروه بیوتکنولوژی کشاورزی دانشکده کشاورزی و منابع طبیعی دانشگاه بینالمللی امام خمینی)ره( قزوین ایران 3- استادیار پژوهشکده کشاورزی سازمان پژوهشهای علمی و صنعتی ایران 1. M.Sc. 2. Assistant Professor, Agricultural Biotechnology, Faculty of Agriculture and Natural Resources, Imam Khomeini International University, Qazvin, Iran 3. Assistant Professor of Agriculture Institute, Iranian Research Organization for Science and Technology, Tehran, Iran الکترونیکی: * نویسنده مسئول مکاتبات پست )تاریخ دریافت: - 95/9/15 تاریخ پذیرش: 95/10/19( واژههای کليدی کنجد سزامین اسیدسالیسیلیک فنیلآالنین.qRT-PCR گياه کنجد (.L (Sesamum indicum منبع منگنز مس و سرشار از کلسيم منيزیم آهن فسفر ویتامين B1 روی و فيبرهای غذایی است. همچنين حاوی دو ترکيب منحصر به فرد از فيبرهای ویژه مفيد گروه ليگنانها با نامهای سزامين و سزامولين میباشد که باعث کاهش کلسترول در بدن انسان میشوند. دراین تحقيق تاثير اليسيتور اسيدساليسيليک و پيش ماده فنيلآالنين بر ميزان بيان دو ژن کليدی دخيل در بيوسنتز سزامين ( و ) در کشت سوسپانسيون سلولی کنجد بررسی گردید. تيمارهای اسيدساليسيليک و فنيلآالنين به ترتيب در غلظتهای )0/1 0/5 و 1( و 0/1 ميلیگرم در ليتر استفاده گردید و در زمانهای و 72 ساعت پس از تيمار نمونهبرداری انجام شد. بيان ژنها با روش qrt-pcr بررسی شد. نتایج نشان داد ميزان بيان ژنهای دخيل در سنتز سزامين در همه نمونههای تيمار شده با اسيدساليسيليک و فنيلآالنين افزایش یافت. در مورد ژن بيشترین افزایش بيان مربوط به غلظت 1 ميلیگرم در ليتر اسيدساليسيليک در بازه زمانی 72 ساعت و 0/1 ميلیگرم در ليتر فنيلآالنين در بازه زمانی 72 ساعت بود. بيشترین افزایش بيان ژن مربوط به غلظت 0/1 ميلیگرم در ليتر اسيدساليسيليک در بازه زمانی 24 ساعت و 0/1 ميلیگرم در ليتر فنيلآالنين در بازه زمانی 72 ساعت بود.

2 ش/ تاثیر اسیدسالیسیلیک و فنیلآالنین روی بیان ژنهای کلیدی ) al., Kang et به مقدمه گیاهان دارویی از منابع قابل توجه در تهیه داروهای گیاهی و مصنوعی هستند و شرکتهای داروسازی از بیش از گیاه برای تهیه داروها استفاده میکنند. متابولیتهای ثانویه مسئول خاصیت دارویی گیاهان هستند. اغلب متابولیتهای ثانویه با قرار گرفتن گیاهان در معرض تنشهای گوناگون تولید میشوند. کشت سوسپانسیون سلولی شامل تودههای سلولی پراکنده و در حال رشد در محیط کشت مایع در حال تکان خوردن است. شروع این کشت معموال با انتقال قطعات کوچکی از کالوس ترد و تمایز نیافته به محیط کشت مایع است. ارلنهای حاوی ریزنمونه یا کالوس روی یک شیکر به طور یکنواخت و مداوم تکان داده میشوند. تکان دادن محیط کشت با استفاده از شیکر با اعمال فشار مالیمی بر تودههای سلولی آنها را به تودههای کوچکتر و سلول- های انفرادی میشکند و پراکنش یکنواختی از سلولها در محیط کشت ایجاد میشود. همچنین در اثر این حرکت تبادل گازی مطلوبی بین محیط کشت و هوا برقرار می- شود. از کشت سوسپانسیون سلولی برای بررسی ژنها و مسیرهای متابولیکی و نیز به عنوان منبعی برای تولید متابولیتهای ثانویه با ارزش استفاده میشود. کنجد احتماال قدیمیترین دانه روغنی است که توسط انسان شناخته و به عنوان یک منبع غذایی استفاده شده است کنجد سرشار از منگنز مس کلسیم منیزیم آهن فسفر ویتامین B1 روی و فیبرهای غذایی است. به جز این مواد مغذی مهم کنجد حاوی دو ترکیب منحصر به فرد از فیبرهای ویژه مفید به نام لیگنانها شامل سزامین و سزامولین است که باعث کاهش کلسترول در بدن انسان میشوند از فشار خون باال جلوگیری میکنند و مشتقات E ویتامین را در حیوانات افزایش میدهند. روغن کنجد در بین روغنهای خوراکی به ملکه روغنها مشهور است 2006( al.,.)wahid, 2007; Moazzami et روغن کنجد حاوی آنتیاکسیدانهای طبیعی است و تاثیر چشمگیری در پیشگیری از بیماریهای مختلف دارد ;1991 (Hirose, دلیل کاربرد آن در درمان بیماریها به خصوص سرطانها در دهه گذشته تالشهای زیادی در راستای شناخت بیشتر فواید سزامین ژنهای دخیل در مسیر بیوسنتز سزامین و افزایش میزان بیان ژن- های دخیل در مسیر بیوسنتز آن انجام شده است. یکی از ژنهای کلیدی در مسیر تولید سزامین ژن است که با افزایش بیان آن در مراحل تشکیل دانه کنجد محتوای سزامین دانه افزایش مییابد. بطورکلی ترکیبی از انتقال ژن نور و الیسیتور یک استراتژی امیدوار کننده برای بهبود بیشتر تولید و بهره وری لیگنان ها از جمله سزامین می باشد (2015 al., (Satake et که از سه عامل نام برده شده تا کنون فقط اثر دوره روشنایی بر رشد گیاهان و محتوای سزامین و بیان ژن کنجد بررسی شده است سزامین از پینورزینول توسط ژن مرحله صورت میگیرد.(Hata et al., 2012) درگیاه سنتز طی دو Hata et al., Ono et al., 2006( روش ;2010(. RT-PCR کمی از معتبرترین روشهای اندازهگیری بیان ژن میباشد. اساس این روش بر پایه نسبت بیان ژن موردنظر به بیان ژن خانهدار است. یکی از روشهای نمایش دادههای RT-PCR مقایسهای است که به عنوان روش شود. در این روش کمی روش CT 2 - CT 2 - CT به عنوان شناخته می- Fold Change (FC) است یعنی ژن موردنظر چند برابر ژن خانهدار بیان شده است. از این روش برای بررسی بیان ژن در نمونههای مختلف نسبت به نمونه شاهد استفاده میشود. طی دهه- های اخیر تحقیق روی آنتیاکسیدانها اهمیت زیادی پیدا کرده و مطالعه آنتیاکسیدانهای طبیعی در غذا و فواید سالمتی بالقوه آنها مورد توجه زیادی قرار گرفته است.)Qusti et al., 2010( هدف از این مطالعه بررسی تاثیر اسیدسالیسیلیک و فنیلآالنین روی میزان بیان دو ژن دخیل در سنتز سزامین ( و کشت سوسپانسیون سلولی کنجد است. ) در محیط مهندسی ژنتیک و ایمنی زیستی/ دوره 5 ماره 2/ پاییز و زمستان

3 تاثیر اسیدسالیسیلیک و فنیلآالنین روی بیان ژنهای کلیدی... مواد و روشها کشت سوسپانسيون سلولی دانه کنجد رقم کرج 1 از موسسه تحقیقات اصالح و تهیه نهال و بذر کرج تهیه شد. در این مطالعه از محیط کشت موراشیگ و اسکوگ )MS( به عنوان محیط کشت پایه جهت کشت دانه و تولید گیاهچه درون شیشهای کالوسزایی و تهیه سوسپانسیون سلولی استفاده شد. برای این منظور دانههای کنجد ابتدا به مدت دو دقیقه در الکل اتانول 70 درصد ضدعفونی و سپس به مدت 30 دقیقه در هیپوکلریتسدیم 20 درصد غوطهور شدند و در نهایت با آب مقطر اتوکالو شده 3 مرتبه و هر بار به مدت دو دقیقه شستشو شدند. تمام مراحل ضدعفونی زیر هود المینار و در ظروف استریل انجام گرفت. پس از ضدعفونی دانهها در ظروف کشت حاوی محیط MS لیتر ساکارز کشت شدند. فاقد هورمون و حاوی 30 گرم در ph محیطهای کشت روی 5/8 تنظیم شد. دانهها به منظور جوانهزنی 3 روز در تاریکی نگهداری و سپس به اتاق کشت با درجه حرارت 25 درجه سانتیگراد و دورهی نوری 16 ساعت روشنایی و 8 ساعت تاریکی منتقل شدند. در این پژوهش از هیپوکوتیل گیاهچههای 18 روزه رقم کرج 1 به عنوان ریزنمونه استفاده شد. هیپوکوتیل به قطعات یک سانتیمتری برش داده شد و به حالت افقی و به صورت جداگانه روی محیط کشت قرار گرفت. پس از کشت ریزنمونهها در محیطهای کالوسزایی پتریهای حاوی کشت در شرایط تاریکی در اتاقک رشد با درجه حرارت 25 درجه سانتیگراد نگهداری شدند. هر دو هفته یک بار واکشت ریزنمونهها انجام شد. برای تهیه سوسپانسیون سلولی در یک ارلن متناسب با حجم تیمارها ساکارز با غلظت 30 گرم در لیتر به عنوان منبع کربن در آب مقطر به وسیله همزن مغناطیسی حل شد. سپس نمکهای محیط MS به محلول اضافه و با آب مقطر به حجم نهایی رسانده شد. پس از اضافه کردن هورمونها با استفاده از آب مقطر حجم نهایی هر ارلن ph تعیین و محیطهای کشت روی 5/8 تنظیم شد و برای ضدعفونی اتوکالو گردید. سپس از محیطهای به دست آمده به میزان 30 میلیلیتر به ارلنهای 100 میلی- لیتری منتقل شد. به ارلنها 0/5 گرم کالوس انتقال داده شد. ارلنهای حاوی سوسپانسیون سلولی روی شیکر با سرعت 130 دور در دقیقه و دمای 27 درجه سانتیگراد در تاریکی قرار گرفتند. اعمال محرک )اليسيتور( جهت افزایش تولید سزامین از الیسیتور اسیدسالیسیلیک و پیش ماده فنیلآالنین در محیط کشت سوسپانسیون سلولی استفاده شد. برای این منظور تیمارهای اسیدسالیسیلیک با غلظتهای )0/1 0/5 و 1 میلیگرم در لیتر( و فنیلآالنین با غلظت 0/1 میلیگرم در لیتر در روز هجدهم در کشت سوسپانسیون سلولی اعمال شدند. نمونهبرداری در 3 بازه زمانی و 72 ساعت انجام شد. آزمایش تیمار سوسپانسیون سلولی کنجد با الیسیتورها در سه تکرار مجزا صورت گرفت. استخراج RNA و سنتز cdna نمونهبرداری از کشتهای سلولی در زمانهای و 72 ساعت بعد از اعمال الیسیتور انجام شد. نمونهها در ازت مایع منجمد و تا زمان استخراج RNA کل در دمای 80- درجه سانتیگراد نگهداری شدند. استخراج RNA با استفاده از کیت انجام شد. قبل از ساخت احتمالی RNX-PLUS )ساخت شرکت سیناکلون( cdna RNA با DNA جهت حذف آلودگی ژنومی از آنزیم DNaseI )شرکت سیناکلون( استفاده شد. کمیت RNA با استفاده از ژ ل الکتروفورز و دستگاه اسپکتروفتومتر بررسی گردید. در این روش میزان جذب نمونه RNA در طول موجهای 260 و 280 نانومتر به منظور بررسی کیفیت RNA اندازه- گیری شد. این نسبت برای نمونههای استخراج RNA شده از سلولها بین 1/8 تا 2 بود که نشانگر کیفیت مطلوب RNA استخراج شده است. cdna طبق دستورالعمل کیت سنتز cdna )شرکت سیناکلون( سنتز مهندسی ژنتیک و ایمنی زیستی/ دوره 5 ش/ ماره 2/ پاییز و زمستان

4 ش/ تاثیر اسیدسالیسیلیک و فنیلآالنین روی بیان ژنهای کلیدی... شد. جهت اطمینان از سنتز آغازگر ژن cdna 18S rrna )ژن خانهدار( واکنش ها با استفاده از انجام PCR شد و درستی ساخت آنها مورد تایید قرار گرفت. با استفاده از توالی ژنهای موجود در بانک اطالعاتی و نرمافزار NCBI Oligo5 آغازگرهای موردنظر طراحی شدند. آغازگرهای طراحی شده از لحاظ عدم اتصال غیر اختصاصی و تشکیل دایمر با استفاده از Primer blast مورد بررسی و تایید قرار گرفتند. اطالعات مربوط به آغازگرهای هر ژن در جدول 1 مشاهده میشود. اندازه محصول جدول 1- طراحی آغازگرهای واکنش qrt-pcr Table 1. Primer design for qrt-pcr % GC PCR دمای ذوب توالی آغازگر نام آغازگر شماره دسترسی ژن accession number Primer name Primer sequence Tm ( ) PCR product size KP F 5'-TCTCGCTCTCACCTTCGCC-3' bp R 5'-CTGGGAGAAGTCGTATAGTG -3' AY F 5'- GCCCCCACTATGTTAAGGTC -3' bp R 5'- GTATTCACGCAACACCAAAG -3' AJ SrRNA F 5- TCTTAGTTGGTGGAGCGATT bp 18SrRNA R 5- GAACATCTAAGGGCATCACA واکنش qrt-pcr میزان بیان دو ژن دخیل در مسیر سنتز سزامین شامل و در حجم نهایی 20 میکرولیتر با روش در میکروپلیتهای 72 چاهکی qrt-pcr بررسی شد. برای اطمینان از آلوده نبودن ترکیبات بکار رفته در این واکنش از کنترل منفی استفاده شد. در این روش از معرف سایکلر SYBR Green Rotor Gene Q برنامه PCR در 40 چرخه انجام شد. نتایج استخراج RNA و سنتز cdna استخراج RNA PLUS یافتن از کیفیت 9 )شرکت 8 امینسان( و 7 دستگاه 6 ترمال 4 5 واکنش 1 2 qrt-pcr 3 )شرکت کیاژن( استفاده شد. از نمونه های تیمار شده با کیت- RNX )شرکت سیناکلون( انجام شد. به منظور اطمینان RNAها مقدار 3 میکرولیتر از استخراج شده روی ژل اگارز %1/5 )w/v( RNAهای الکتروفورز شد. وجود دو باند مربوط به 18S rrna و 28S rrna عدم کشیدگی باندها نشاندهنده کیفیت مطلوب بود. از این در و RNA برای سنتز RNA cdna و بررسی بیان ژن استفاده شد. تمام cdnaهای سنتز شده )با غلظت 1 میکروگرم در میکرولیتر( به میزان 15 برابر رقیق شدند و واکنش qrt-pcr مورد استفاده قرار گرفتند. برای بررسی میزان بیان دو ژن دخیل در مسیر سنتز سزامین از روش qrt-pcr استفاده شد. جهت اطمینان برای هر نمونه سه تکرار تکنیکی در نظر گرفته شد. برای انجام این آزمایش از معرف SYBR Green 2 میکروپلیتهای 72 چاهکی و در حجم نهایی در 20 میکرولیتر استفاده گردید. نتایج به دست آمده از آنالیز منحنی ذوب نشان داد که تکثیر تمام ژنها به صورت اختصاصی و بدون محصوالت غیراختصاصی مثل دایمر آغازگر بود. در این آزمایش جهت اطمینان از عدم وجود آلودگی در ترکیبات مورد استفاده در واکنش از کنترل مهندسی ژنتیک و ایمنی زیستی/ دوره 5 ماره 2/ پاییز و زمستان

5 تاثیر اسیدسالیسیلیک و فنیلآالنین روی بیان ژنهای کلیدی... منفی استفاده شد که نتایج غیرآلوده بودن ترکیبات مورد استفاده را نشان دادند. نرمالسازی دادههای CT نمونههای مختلف و نمونه شاهد با استفاده از روش مربوط به CT ژن مرجع و صورت گرفت. بیان ژنها در نمونههای مختلف تیمار شده با الیسیتورها به صورت شد. مقایسه ميانگين بيان ژنها گزارش FC تاثير اليسيتور اسيدساليسيليک بر ميزان بيان ژن در تیمارهای مختلف زمانی الیسیتور اسیدسالیسیلیک نسبت به شاهد نشان میدهد که بدون در نظر گرفتن غلظت الیسیتور زمانهای مختلف و 24 بین ساعت اعمال الیسیتور اسیدسالیسیلیک تفاوت معنیداری وجود دارد. بیشترین میزان بیان ژن نسبت به شاهد در زمان 72 ساعت بعد از اعمال الیسیتور و کمترین بیان ژن نسبت به شاهد در زمان 48 ساعت بعد از اعمال الیسیتور اسیدسالیسیلیک به دست آمد )شکل 1 - الف(. در غلظتهای مختلف الیسیتور اسیدسالیسیلیک نسبت به شاهد نشان میدهد که بین غلظتهای مختلف الیسیتور اسیدسالیسیلیک تفاوت معنیداری وجود دارد. بیشترین بیان ژن نسبت به شاهد در غلظت 0/5 میلی- گرم در لیتر اسیدسالیسیلیک و کمترین بیان ژن نسبت به شاهد در غلظت 0/1 میلیگرم در لیتر اسیدسالیسیلیک مشاهده شد. نتایج مقایسه میانگین اثر غلظت الیسیتور اسیدسالیسیلیک بر بیان ژن نشان داد که افزایش غلظت تا حدی باعث افزایش بیان ژن نسبت به شاهد شده است و هرچه غلظت از مقدار مشخصی بیشتر شده است بیان ژن به همان نسبت افزایش پیدا نکرده بلکه به مقدار کمی کاهش یافته است که این نشان میدهد همیشه افزایش غلظت الیسیتور باعث افزایش بیان ژن به همان نسبت نمیشود بلکه ممکن است تاثیرات منفی نیز داشته باشد. به عبارتی رابطه مستقیم بین غلظت اسیدسالیسیلیک و میزان بیان ژن وجود ندارد )شکل 1 -ب(. نتایج مقایسه میانگین اثر متقابل غلظت در زمان الیسیتور اسیدسالیسیک بر بیان ژن نسبت به شاهد نشان میدهد بیشترین تغییر در بیان ژن در بازه زمانی 72 ساعت بعد از اعمال الیسیتور اسیدسالیسیلیک در غلظت 0/5 و 1 میلیگرم در لیتر الیسیتور اسیدسالیسیلیک حاصل شد بهطوریکه این دو تیمار تفاوت معنیداری باهم نداشتند و کمترین تغییر در بیان ژن در دو بازه زمانی 24 و 48 ساعت به ترتیب در غلظت های 1 و 0/1 میلیگرم در لیتر و 72 ساعت بعد از اعمال الیسیتور اسیدسالیسیلیک در غلظت 0/1 میلیگرم در لیتر حاصل شد به طوری که این تیمارها تفاوت معنیداری با هم نداشتند. همانطور که در شکل 1 مشاهده میشود اعمال الیسیتور در غلظتها و زمانهای مختلف باعث افزایش بیان ژن نسبت به شاهد شده است )شکل 1 -ج(. مهندسی ژنتیک و ایمنی زیستی/ دوره 5 ش/ ماره 2/ پاییز و زمستان

6 ش/ تاثیر اسیدسالیسیلیک و فنیلآالنین روی بیان ژنهای کلیدی شکل بیان ژن الف( تیمارهای زمانی مختلف بعد از تیمار با اسیدسالیسیلیک. ب( غلظتهای مختلف اسیدسالیسیلیک. ج( اثر متقابل غلظت اسیدسالیسیلیک در زمان. دادهها 2 ΔΔCT ± SD هستند و حروف اختالف آماری در سطح 0/05 را نشان میدهند تاثير اليسيتور اسيدساليسيليک بر ميزان بيان ژن در تیمار های مختلف زمانی اسیدسالیسیلیک نسبت به شاهد نشان می دهد که بدون در نظر گرفتن غلظت الیسیتور بین زمان های مختلف و 24 ساعت اعمال اسیدسالیسیلیک تفاوت معنیداری وجود دارد ولی زمان 24 و 72 ساعت بعد از اعمال اسیدسالیسیلیک تفاوت معنیداری با هم نداشتند بطوریکه بیشترین میزان بیان ژن نسبت به شاهد در زمان 24 و 72 ساعت و کمترین میزان بیان ژن نسبت به شاهد در زمان 48 ساعت بعد از اعمال اسیدسالیسیلیک به دست آمد )شکل 2 ا- لف(. در غلظتهای مختلف اسیدسالیسیلیک نسبت به شاهد نشان میدهد که بین غلظتهای مختلف اسیدسالیسیلیک تفاوت معنیداری وجود دارد. بیشترین میزان بیان ژن نسبت به شاهد در غلظت 0/1 میلیگرم در لیتر و کمترین میزان بیان ژن نسبت به شاهد در غلظت 1 میلیگرم در لیتر بدست آمد. نتایج مقایسه میانگین اثر غلظت اسیدسالیسیلیک بر بیان ژن نشان داد که افزایش غلظت اسیدسالیسیلیک باعث کاهش بیان این ژن نسبت به شاهد شده است. در نتیجه همیشه افزایش غلظت الیسیتور باعث افزایش بیان یک ژن به همان نسبت نمی شود و رابطه مستقیم بین آنها وجود ندارد )شکل 2 -ب(. نتایج مقایسه میانگین اثر متقابل غلظت در زمان الیسیتور اسیدسالیسیلیک بر بیان ژن نسبت به شاهد نشان میدهد که بیشترین تغییر در میزان بیان ژن بعد از اعمال 0/1 میلیگرم در لیتر اسیدسالیسیلیک در بازه زمانی 24 ساعت حاصل شد و کمترین تغییر در میزان بیان ژن در 72 بازه زمانی ساعت بعد از اعمال اسیدسالیسیلیک در غلظت 1 میلیگرم در لیتر حاصل شد. همانطور که در 2 شکل مشاهده میشود اعمال الیسیتور در غلظتها و زمانهای مختلف باعث افزایش بیان ژن نسبت به شاهد شده است و تیمارها تفاوت معنیدار با هم داشتند )شکل 2 -ج(. Figure 1. gene expression at A) Different times after treatment with salicylic acid. B) Different concentrations of salicylic acid. C) Interaction of salicylic acid concentrations and time. Data represent the means of 2 ΔΔCT ± SD. Letters represent statistical difference at P مهندسی ژنتیک و ایمنی زیستی/ دوره 5 ماره 2/ پاییز و زمستان

7 تاثیر اسیدسالیسیلیک و فنیلآالنین روی بیان ژنهای کلیدی... شکل 3 - بیان ژنهای )الف( )ب( در و تیمارهای زمانی مختلف بعد از تیمار با فنیلآالنین. دادهها 2 ΔΔCT ± SD 0/05 را نشان میدهند. هستند و حروف اختالف آماری در سطح Figure 3. and genes expression at different times after treatment with phenylalanine. Data represent the means of 2 ΔΔCT ± SD. Letters represent statistical difference at P 0.05 شکل 2 - بیان ژن در الف( تیمارهای زمانی مختلف بعد از تیمار با اسیدسالیسیلیک. ب( غلظتهای مختلف اسیدسالیسیلیک. ج( اثر متقابل غلظت اسیدسالیسیلیک در زمان. دادهها 2 ΔΔCT ± SD آماری در سطح 0/05 را نشان میدهند. هستند و حروف اختالف تاثير فنيلآالنين بر ميزان بيان ژنهای و آنالیز دادههای تاثیر فنیلآالنین در زمانهای مختلف در غلظت 0/1 میلیگرم در لیتر بر میزان بیان ژن به صورت آزمایش فاکتوریل در قالب طرح کامل تصادفی انجام شد. نتایج حاصل از جدول تجزیه واریانس تاثیر فنیلآالنین در زمانهای مختلف بر میزان بیان ژن نشان از معنیدار بودن اثر زمان در سطح یک درصد داشت. براساس نتایج حاصل دو تیمار زمانی با هم اختالف معنیدار بر بیان ژن دارند. Figure 2. gene expression at A) Different times after treatment with salicylic acid. B) Different concentrations of salicylic acid. C) Interaction of salicylic acid concentrations and time. Data represent the means of 2 ΔΔCT ± SD. Letters represent statistical difference at P 0.05 مهندسی ژنتیک و ایمنی زیستی/ دوره 5 ش/ ماره 2/ پاییز و زمستان

8 ش/ ب- ب- تاثیر اسیدسالیسیلیک و فنیلآالنین روی بیان ژنهای کلیدی... در تیمارهای مختلف زمانی فنیلآالنین نسبت به شاهد نشان میدهد که بین زمانهای مختلف و 72 ساعت بعد از اعمال 0/1 میلیگرم در لیتر فنیلآالنین تفاوت معنیداری وجود دارد. بیشترین بیان ژن نسبت به شاهد در زمان 72 ساعت بعد از اعمال فنیلآالنین و به ترتیب بعد 24 و 48 از آن زمان ساعت بعد از اعمال فنیلآالنین بیشترین تاثیر را داشتند. بعبارت دیگر هرچه زمان بیشتری از اعمال فنیلآالنین میگذرد بیان ژن بیشتری پیدا کرده است. میانگین بیان ژن غلظت افزایش 0/1 نشان میدهد که بیان ژن در میلیگرم در لیتر فنیلآالنین نسبت به شاهد در غلظت 0/1 میلی گرم در لیتر فنیلآالنین نسبت به شاهد افزایش پیدا کرده و تفاوت معنیداری با آن دارد. )شکل 3 ا- لف(. در تیمارهای مختلف زمانی فنیلآالنین نسبت به شاهد نشان میدهد که در غلظت مختلف 0/1 24 میلیگرم در لیتر فنیلآالنین بین زمانهای 72 و 48 ساعت بعد از اعمال فنیلآالنین تفاوت معنیداری وجود دارد ولی زمان 24 و 48 ساعت بعد از اعمال فنیلآالنین تفاوتی معنیداری با هم نداشتند. بیشترین بیان ژن نسبت به شاهد در زمان 72 ساعت بعد از اعمال فنیلآالنین و کمترین بیان ژن نسبت به شاهد در زمان 24 دست آمد. بیان ژن ساعت بعد از اعمال فنیلآالنین به تحت تاثیر فنیلآالنین روند تصاعدی نشان داد بطوریکه هرچه از زمان اعمال فنیل- آالنین میگذرد بیان ژن است. میانگین بیان ژن افزایش بیشتری پیدا کرده در غلظت 0/1 میلیگرم در لیتر فنیلآالنین نسبت به شاهد نشان میدهد که بیان ژن در غلظت مورد استفاده نسبت به شاهد افزایش پیدا کرده است و تفاوت معنیداری با آن دارد )شکل 3 تاثير اسيدساليسيليک و فنيلآالنين در غلظت در زمان بر ميزان بيان ژنهای و نتایج مقایسه میانگین اثر اسیدسالیسیلیک و فنیلآالنین در غلظت در زمان بر بیان ژن نسبت به شاهد نشان میدهد بیشترین میزان بیان ژن در تیمار اسیدسالیسیلیک در غلظت 1 و 0/5 میلیگرم در لیتر در بازه زمانی 72 ساعت بعد از اعمال تیمار بدست آمد به- طوریکه این دو تیمار تفاوت معنیداری با هم نداشتند. کمترین میزان بیان ژن در تیمار فنیلآالنین در غلظت 0/1 میلیگرم در لیتر در بازه زمانی 24 ساعت بعد از اعمال آن حاصل شد. همانطور که در نمودار زیر مشاهده میشود اعمال اسیدسالیسیلیک و فنیلآالنین باعث افزایش بیان ژن نسبت به شاهد شده است. معنیدار شدن اثر الیسیتور در غلظت در زمان نشاندهنده تاثیر متفاوت غلظتها و زمانهای مختلف تیمار با اسیدسالیسیلیک و فنیلآالنین بر بیان ژن میباشد )شکل 4 -الف(. نتایج مقایسه میانگین اثرهای اسیدسالیسیلیک و فنیلآالنین در غلظت در زمان بر بیان ژن نسبت به شاهد نشان میدهد که بیشترین میزان بیان ژن در تیمار اسیدسالیسیلیک در غلظت 0/1 و پس از آن در غلظت 0/5 میلیگرم در لیتر به ترتیب در دو بازه زمانی 24 و 72 ساعت بعد از اعمال تیمار بدست آمد بهطوریکه این دو تیمار تفاوت معنیداری داشتند. کمترین میزان بیان ژن در تیمار اسیدسالیسیلیک در غلظت 1 و 0/5 میلیگرم در لیتر به ترتیب در دو بازه زمانی 72 و 48 ساعت بعد از اعمال الیسیتور حاصل شد بهطوریکه این دو تیمار تفاوت معنی داری با هم داشتند. همانطور که در شکل 5 مشاهده می- شود اعمال اسیدسالیسیلیک و فنیلآالنین باعث افزایش بیان ژن نسبت به شاهد شده است. معنیدار شدن اثرهای الیسیتور در غلظت در زمان نشاندهنده تاثیر متفاوت اسیدسالیسیلیک و فنیلآالنین با غلظتها و زمان- های مختلف بر بیان ژن میباشد )شکل 4.).) مهندسی ژنتیک و ایمنی زیستی/ دوره 5 ماره 2/ پاییز و زمستان

9 تاثیر اسیدسالیسیلیک و فنیلآالنین روی بیان ژنهای کلیدی... شکل 4 - تغییر بیان ژنهای 2 ΔΔCT ± SD )الف( و )ب( در اثر متقابل زمان و غلظت اسیدسالیسیلیک و فنیلآالنین. دادهها هستند و حروف اختالف آماری در سطح 0/05 را نشان میدهند. Figure 4. Changes in and genes expression at the interaction of time and concentration of salicylic acid and phenylalanine elicitors. Data represent the means of 2 ΔΔCT ± SD. Letters represent statistical difference at P 0.05 شکل 5- تغییر بیان ژنهای )الف( و )ب( در غلظتهای مختلف اسیدسالیسیلیک و فنیلآالنین. دادهها 2 ΔΔCT ± SD هستند و حروف اختالف آماری در سطح 0/05 را نشان میدهند. Figure 5. Changes in and genes expression at different concentrations of salicylic acid and phenylalanine elicitors. Data represent the means of 2 ΔΔCT ± SD. Letters represent statistical difference at P 0.05 تاثير اسيدساليسيليک و فنيلآالنين در غلظتهای مختلف بر ميزان بيان ژنهای و در غلظتهای مختلف اسیدسالیسیلیک و فنیلآالنین نسبت به شاهد نشان میدهد که بین غلظتهای مختلف اسیدسالیسیلیک و فنیلآالنین تفاوت معنیداری وجود دارد. بیشترین بیان ژن نسبت به شاهد در غلظت 0/5 و 1 میلی- گرم در لیتر اسیدسالیسیلیک رخ داده است بهطوریکه این دو تیمار تفاوت معنیداری با هم نداشتند و کمترین میزان بیان ژن نسبت به شاهد در غلظت 0/1 میلی- گرم در لیتر اسیدسالیسیلیک و فنیلآالنین به دست آمد به- مهندسی ژنتیک و ایمنی زیستی/ دوره 5 ش/ ماره 2/ پاییز و زمستان

10 ش/ تاثیر اسیدسالیسیلیک و فنیلآالنین روی بیان ژنهای کلیدی... طوری که این دو تیمار تفاوت معنیداری با هم نداشتند )شکل 5 -الف(. در غلظتهای مختلف اسیدسالیسیلیک و فنیلآالنین نسبت به شاهد نشان میدهد که بین غلظتهای مختلف اسیدسالیسیلیک و فنیلآالنین تفاوت معنیداری وجود دارد. بیشترین میزان بیان ژن نسبت به شاهد در غلظت 0/1 میلیگرم در لیتر اسیدسالیسیلیک و کمترین بیان ژن نسبت به شاهد به ترتیب در غلظت 1 و 0/1 میلیگرم در لیتر بود )شکل 5 -ب(. بحث بررسی بيان ژن در تيمارهای اسيدساليسيليک و فنيلآالنين در مطالعه تیمارهای مختلف اسیدسالیسیلیک و فنیلآالنین در غلظتهای مختلف و بازههای زمانی مختلف به طور جداگانه افزایش بیان ژن ژن نسبت به نمونه شاهد مشاهده گردید. با توجه به نتاج حاصل از مقایسه میانگین اسیدسالیسیلیک و فنیلآالنین باعث افزایش بیان میشوند در نتیجه به دلیل افزایش بیان این ژن در اثر اعمال الیسیتور افزایش احتمالی لیگنان سزامین مورد انتظار است زیرا ژن ژن از ژنهای اصلی مسیر سنتز سزامین میباشد. نتایج مقایسه میانگین اثر متقابل غلظت در زمان الیسیتور اسیدسالیسیلیک بر بیان نسبت به شاهد نشان میدهد که بیشترین تغییر در بیان ژن در بازه زمانی 72 ساعت بعد از اعمال الیسیتور اسیدسالیسیلیک در غلظت 0/5 و 1 میلیگرم در لیتر اسیدسالیسیلیک حاصل شد بهطوری که این دو تیمار تفاوت معنیداری با هم نداشتند. نتایج مقایسه میانگین بیان ژن در تیمارهای مختلف زمانی فنیل- آالنین نسبت به شاهد نشان میدهد که در غلظت 0/1 میلیگرم در لیتر فنیلآالنین بین زمانهای مختلف و 72 ساعت بعد از اعمال فنیلآالنین تفاوت معنیداری وجود دارد و بیشترین بیان ژن نسبت به شاهد در زمان 72 ساعت بعد از اعمال آن مشاهده گردید. هرچه زمان اعمال فنیلآالنین بیشتر شده است بیان ژن افزایش پیدا کرده است. از آنجایی که فنیل آالنین پیش ماده تولید سزامین است میتوان اینگونه نتیجهگیری کرد که افزایش پیش ماده )فنیلآالنین( در محیط سبب القای بیان ژن و تولید آنزیم الزم () برای تبدیل آن به ماده نهایی )سزامین( می- شود. با توجه به منحنی رشد سلولها در بازه زمانی روزهای 18 تا 22 سلولها در مرحله رشد لگاریتمی هستند و سپس وارد فاز سکون میشوند ( Heidarifar Nayeri, 2015.)and Dehghan همچنین طبق تحقیقات به عمل آمده اسیدسالیسیلیک باعث افزایش تقسیم سلولی میشود 2011( Plasencia,.)Rivas-San Vicente and بر اساس منحنی رشد سلولهای کنجد تکثیر سلولها بهطور طبیعی تا حدود روز 22 ادامه دارد که در حضور اسیدسالیسیلیک افزایش مییابد و در نتیجه نسخههای بیشتری از ژن در محیط کشت تولید میشوند و از سوی دیگر تأثیر مثبت الیسیتور روی القای احتمالی بیان ژن طی 72 ساعت که میتوانند دالیل افزایش بیان ژن طی این مدت باشند. تحقیقات کمی در مورد تأثیر اسیدسالیسیلیک بر عملکرد نهایی گیاهان صورت گرفته است از جمله در آزمایشی محلولپاشی برگهای گیاهان 30 روزه Brassica junce با غلظت 0/01 میلیموالر این ماده موجب افزایش غالفها )13/78 درصد( و افزایش عملکرد دانه )8/4 درصد( گردید که نشان دهنده این واقعیت است که ترکیبات فنلی در انتقال دادن مواد فتوسنتزی به سمت مقصد دخالت میکنند. ضمن اینکه افزایش ماده خشک نیز از طریق افزایش در میزان فتوسنتز خالص بازده کربوکسیالسیون و افزایش در فعالیت نیتراتردوکتاز و کربنیکآنهیدراز در مقایسه با گیاهان شاهد در این گیاه گزارش شده است. فعالیت باالتر آنزیم کربنیکآنهیدراز به طور معنیداری با فتوسنتز خالص همبستگی نشان داده است. فتوسنتز خالص باالتر کسب شده از کاربرد غلظتهای پایین اسیدسالیسیلیک به طور مهندسی ژنتیک و ایمنی زیستی/ دوره 5 ماره 2/ پاییز و زمستان

11 تاثیر اسیدسالیسیلیک و فنیلآالنین روی بیان ژنهای کلیدی... طبیعی در رشد بهتر گیاهان و افزایش تولید ماده خشک منعکس گردیده است. از طرفی ترکیبات فنلی و از جمله سالیسیالتها مانع اکسیداسیون اکسین میگردند. به این ترتیب کاهش در محتوای اکسین اکسید شده نیز دلیل دیگری است که منجر به افزایش فتوسنتز خالص میگردد.)Fariduddin et al., 2003( بررسی بيان ژن فنيلآالنين در تيمارهای اسيدساليسيليک و نتایج مقایسه میانگین اثر متقابل غلظت در زمان الیسیتور اسیدسالیسیلیک بر بیان ژن نسبت به شاهد نشان میدهد که بیشترین تغییر در بیان ژن در بازه زمانی 24 و 72 ساعت پس از افزودن 0/1 و 0/5 میلیگرم در لیتر این الیسیتور به محیط کشت سلولی کنجد حاصل شد به طوریکه این دو تیمار تفاوت معنیداری با هم نداشتند. الیسیتورهای زیستی و غیرزیستی تولید متابولیتهای ثانویه گیاهی را از طریق تنظیم سرعت بیوسنتز آنها ذخیره و انتقال واکوئلی تجزیه و یا تغییر و تبدیل آنها تحت تأثیر قرار میدهند.)Jeong and Park, 2006) براساس تحقیقات انجام شده ترشح جنیستئین از ریشه- های گیاه لوپن زرد توسط اسیدسالیسیلیک کیتوزان و سیانیدپتاسیم افزایش مییابد. به عبارتی پیشمادههای مسیرهای بیوسنتزی میتوانند جهت افزایش تولید متابولیتهای ثانویه در کشت سوسپانسیون گیاه مورد استفاده قرار گیرند )2006 al.,.)zhang et در این رابطه در این تحقیق در تیمارهای مختلف زمانی فنیلآالنین نسبت به شاهد نشان داد که در غلظت 0/1 میلیگرم در لیتر فنیلآالنین بین زمانهای مختلف و 72 ساعت بعد از عمال فنیل- آالنین تفاوت معنیداری وجود دارد ولی زمان 24 و 48 ساعت بعد از اعمال فنیلآالنین تفاوتی معنیداری با هم نداشتند. بیشترین بیان ژن 72 نسبت به شاهد در زمان ساعت بعد از اعمال فنیلآالنین به دست آمد. با افزایش زمان اعمال فنیلآالنین بیان ژن پیدا کرده است. ژن نیز افزایش از ژنهای کلیدی در مسیر فنیلپروپانوئید است که کافئیلشیکیمات را به -P کوماریلشیکیمات تبدیل میکند. این ترکیب در ادامهی مسیر به لیگنانهای گروه S و G تبدیل میشود Ralph et (.)al., 2006 بنابراین میتوان گفت که احتماال با افزایش بیان ژن تحت تاثیر الیسیتور میتوان تولید سزامین و دیگر لیگنانها را افزایش داد. براساس نتایج حاصل از این تحقیق بنظر میرسد که وجود پیش ماده فنیلآالنین در غلظت بکار رفته برای کشت سوسپانسیون سلولی کنجد سمی نبوده است و براحتی در اختیار سلولها قرار گرفته وسبب القای بیان دو ژن کلیدی در مسیر تولید سزامین شده است. از اینرو احتماال میتوان از این ماده برای افزایش سزامین استفاده کرد که برای اثبات این موضوع باید مقدار سزامین در محیط کشت سوسپانسیون سلولی تیمار شده و شاهد اندازهگیری شود. تشکر و قدردانی نمونه از همکاری کارشناسان محترم آزمایشگاههای کشت بافت و بیولوژی مولکولی گروه بیوتکنولوژی دانشگاه بینالمللی امام خمینی )ره( و گروه بیوتکنولوژی پردیس کشاورزی و منابع طبیعی دانشگاه تهران تشکر و قدردانی میشود. منابع Fariduddin Q, Hayat S, Ahmad A Salicylic acid influences net photosynthetic rate, carboxylation efficiency, nitrate reductase activity, and seed yield in Brassica juncea. Photosynthetica 41: Hata N, Hayashi Y, Okazawa A, Ono E, Satake H, Kobayashi A Effect of photoperiod on growth of the plants, and sesamin content and gene expression in the leaves of sesame (Sesamum indicum L.). Environmental and experimental botany 75: مهندسی ژنتیک و ایمنی زیستی/ دوره 5 ش/ ماره 2/ پاییز و زمستان

12 ش/ تاثیر اسیدسالیسیلیک و فنیلآالنین روی بیان ژنهای کلیدی... Hata N, Hayashi Y, Okazawa A, Ono E., Satake H, Kobayashi A Comparison of sesamin contents and gene expressions in aboveground vegetative organs between two Japanese sesame (Sesamum indicum L.) varieties differing in seed sesamin contents. Plant Science 178: Heidarifar M, Dehghan Nayeri F Establishment of callus and suspension culture in Sesamum indicum L. Inte tional Jou l of Pharmacy and Pharmaceutical Sciences 7(4): Hirose NIT, Nishihara K, Sugano M, Akimoto K, Shimizu S,Yamada H Inhibition of cholesterol absorption and synthesis in rats by sesamin. Jou l of Lipid Research 32: Jeong GT, Park DH Enhanced secondary metabolite biosynthesis by elicitation in transformed plant root system: effect of abiotic elicitors. Applied biochemistry and biotechnology 29(132): Kang MH, Kawai Y, Naito M, Osawa T Dietary defatted sesame flour decreases susceptibility to oxidative stress in hypercholesterolemic rabbits. The Jou l of Nutrition 129: Moazzami AA, Andersson RE, Kamal Eldin A HPLC analysis of sesaminol glucosides in sesame seeds. Jou l of Agricultural and Food Chemistry 54: Ono E, Nakai M, Fukui Y, Tomimori N., Fukuchi Mizutani M, Saito M, Satake H, Tanaka T, Katsuta M, Umezawa T Formation of two methylenedioxy bridges by a Sesamum CYP81Q protein yielding a furofuran lignan,(+)-sesamin. Proceedings of the National Academy of Sciences 103: Qusti S, Abo Khatwa A, Lahwa M Screening of antioxidant activity and phenolic content of selected food items cited in the Holly Quran. Jou l Biological Sciences 2: Ralph J, Akiyama T, Kim H, LU F, Schatz PF, Marita JM, Ralph SA, Reddy MS, Chen F, Dixon RA Effects of coumarate 3- hydroxylase down-regulation on lignin structure. Jou l of Biological Chemistry 281: Rivas San Vicente M, Plasencia J Salicylic acid beyond defence: its role in plant growth and development. Jou l of Experimental Botany 62(10): Satake H, Koyama T, Bahabadi SE, Matsumoto E, Ono E, Murata J Essences in metabolic engineering of lignan biosynthesis. Metabolites. 5(2): Wahid OARA El-Bramawy, Resistance of some sesame (Sesamum indicum L.) collections against root rot disease (Rhizoctonia solani Kühn) under field conditions. Jou l of Plant Protection Research 47: Zhang B, Hettiarachchy N, Chen P, Horax R, Cornelious B, Zhu D Influence of the application of three different elicitors on soybean plants on the concentrations of several isoflavones in soybean seeds. Jou l of Agricultural and Food Chemistry 54 (15): مهندسی ژنتیک و ایمنی زیستی/ دوره 5 ماره 2/ پاییز و زمستان