SSR. : SSR ( Simp le sequence repeat) 29 ( ), 6 SSR (BGA35 KU10 BGT23b NH004a NH011b NH015a) NH004a, 3, 6

Transcript

1 2007, 34 (1) : Acta Horticulturae Sinica SS 1, 23, 13, 2, 1, 3 ( 1,, ; 2, ; 3, ) : SS ( Simp le sequence repeat) 29( ), 6 SS (BGA35 KU10 BGT23b NH004a NH011b NH015a) NH004a, 3, 6 29() 4, 2,,,,, : ; SS; ; : S 66112: A : X (2007) S im ple Sequence epea t Ana lysis on Genetic A ssessm en t of Ch inese ed Sk inned Sand Pear Cultivars ZHANG Dong 1, SHU Qun 23, TENG Yuan2wen 13, Q IU M ing2hua 2, BAO Lu 1, and HU Hong2ju 3 ( 1 D epartm ent of Horticulture, Zhejiang U niversity, the S tate A gricultural M inistry Laboratory of Horticultural P lant Grow th, D evelopm ent & B iotechnology, Hangzhou , China; Kunm ing , China; : ; : : ( ) ; (2003NG13) 2 Institute of Horticulture, Yunnan A cadem y of A gricultural Sciences, 3 Institute of F riut and Tea, Hubei A cadem y of A gricultural Sciences, W uhan , China) Abstract: A total of 29 sand pear germp lasm (mainly red skinned) native to southwest of China were subjected to simp le sequence repeat ( SS ) analysis. Six pairs of SS p rimers (B GA35, KU10, B GT23b, NH004a, NH011b and NH015a) could generate a large number of alleles. The p rimer NH004a, which p ro2 duced the highest allele numbers and the most effective alleles, and high heterozygosity and Shannon informa2 tion index, showed the best identification power. U sing six pairs of SS p rimers, all accessions or types could be distinguished excep t for three pairs of cultivars, which m ight belong to the synonymy cases or bud mutants. Twenty nine pear accessions could be divided into four major group s obviously based on the UPGMA cluster a2 nalysis. Group consisted of cultivars all native to Yunnan p rovince, including two green and nine red skinned sand pears, inferring a near genetic relationship between the red and green skinned pears. In group s and, the red skinned pears from Huili County of Sichuan Province and from Yunnan Province m ingled to2 gether, which m ight suggest cultivar movement from Yuannan to Sichuan. In group, not only were Xiangsu2 li and Zaiyangli from Huili County of Sichuan Province, M idu Xiangsuli and Changshui Huobali native to Yun2 nan Province not closely clustered, but also were far from other group s. Huobali pear types distributed in Yun2 nan and Sichuan p rovinces m ight have different origins. The results above indicates large genetic diversity of germp lasm resources of red skinned sand pear cultivars in China. Key words: Sand pear; SS; Cultivar identification; Genetic relationship 3 Author for correspondence ( E2mail: ywteng@ zju1edu1cn; shuqun@public1km1vn1cn)

2 48 34 ( Kajiura, 1978), (, 1993, 1997) (, 2004) (1997) 14,,, SS ( Sim2 p le sequence repeat) ( Powell et al., 1996 ), ( Kimura et al., 2002; Yamamoto et al., 2002) SS,, (H IFT) (CPG) ( YNH I) ( ZZF I) No. Cultivars or lines ( 1) 1 Table 1 Accession s used in th is study O rigin ed skin 1 ()Mantianhong ( Kousui Huobali) Zhengzhou, Henan Yes YNH I 2 ()Meirensu ( Kousui Huobali) Zhengzhou, Henan Yes YNH I 3 1 Xionggu Huobali 1 L ijiang, Yunnan Yes H IFT 4 2 Huili 2 Huili, Sichuan Yes YNH I 5 Suomei L ijiang, Yunnan No ZZF I 6 Baozhuli Chenggong, Yunnan No CPG 7 1 Huili 1 Huili, Sichuan Yes YNH I 8 Changshui Huobali L ijiang, Yunnan Yes H IFT 9 L ijiangm ianli L ijiang, Yunnan Yes H IFT 10 2 Xionggu Huobali 2 L ijiang, Yunnan Yes H IFT 11 Yanshan Hongli Yanshan, Yunnan Yes YNH I 12 2 Yunhongli 2 W enshan, Yunnan Yes H IFT 13 W enshan Hongli W enshan, Yunnan Yes H IFT 14 L ijiang Baili L ijiang, Yunnan No ZZF I 15 1 Yunhongli 1 Yanshan, Yunnan Yes ZZF I 16 M idu Huobali M idu, Yunnan Yes H IFT 17 M idu Xiangsuli M idu, Yunnan Yes H IFT 18 Piaoxing Huobali Huili, Sichuan Yes YNH I 19 M idu Xiaohongli M idu, Yunnan Yes H IFT 20 Laoyali Huili, Sichuan Yes YNH I 21 W enshan Hongxueli W enshan, Yunnan Yes ZZF I 22 Caim ian Yali Huili, Sichuan Yes YNH I 23 Xiangsuli Huili, Sichuan Yes YNH I 24 Dali Huobali Dali, Yunnan Yes H IFT 25 Zaiyangli Huili, Sichuan Yes YNH I 26 Dali Yanzhili Dali, Yunnan Yes H IFT 27 Changba Huobali Huili, Sichuan Yes YNH I 28 Huobali W uding, Yunnan Yes H IFT 29 W eishan Hongxueli W eishan, Yunnan Yes YNH I Sampling source

3 1 : SS DNA SDS DNA,, (Beckman DU800, USA ) DNA 10 ng/ L BGA35 NH011b BGT23b NH0 15a KU10 NH004a ( 2) Yamamoto (2002) SS ( Kimura et al., 2002), Invitrogen TM PC 20 L, 110 L (10 ng/ L) DNA 210 L 10 buffer (MgCl mmol/l ) 210 L 215 mmol/l dntps 110 L p rimer (10 pmoles) Primers 2 SS Table 2 SS pr im er sequences and a llele size ranges Sequences BGA35 F AGAGGGAGAAAGGCGATT GCTTCATCACCGTCTGCT KU10 F AGTATGTGACCACCCCGATGTT AGAGTCGGTTGGGAAATGATTG BGT23b F CACATTCAAAGATTAAGAT ACTCAGCCTTTTTTTCCCAC Allele size ranges(bp) NH004a F AGGATGGGACGAGTT TAGAG NH011b F CCACATCTCTCAACCTACCA TGGTTCACATAGAGAGAGAGAGAGA TTTGCCGTTGGACCGAGC NH015a F TTGTGCCCTTTTTCCTACC CTTTGATGTTACCCCTTGCTG 012 L Taq polymerase ( Takara B iotechnology Company, Japan) 1318 L ddh 2 O, NH011b NH015a NH004a 3 SS: 94 2 m in, 94 1 m in, 55 1 m in 72 2 m in, 35 BGA35 BGT23b KU10 : 94 2 m in, 94 1 m in, 60 1 m in 72 2 m in, 10, 015, 94 2 m in, 94 5 m in, 2 m in, 35 ( Kimura et al., 2002) 55 1 m in 72, PC 110%, bp,, ( 1 mg, 1 mg, 015 mol/l EDTA, ), 94 5 m in (Vos et al., 1995), L 6% 110 h (75 W ), Bassam (1991) ( 1 0), Nei L i (1979) D ice,, NTSYS2pc, (UPGMA ) SS( ), POPGENE version 1131 SS( n o ) SS ( n e ) (H o ) (H e ) ( I) 2 6 SS( ), NH004a, KU10 BGA35a 7( 3) NH004a, 1 2( 1) 3, 6, H e , H o , I , ( 3) Locus 3 SS Table 3 The character iza tion of polym orph ic SS loci of red sk inned sand pears n o n e H o H e I BGT23b NH011b BGA35a KU NH015a NH004a Mean

4 NH011b 610% A: ; B: 1 F ig % PAGE gel electrophoresis of am plif ica tion products w ith NH011b pr im er A rrow A: The specific band of Changba Huobali; A rrow B: The specific band of Zaiyangli. Numbers refer to the cultivars listed in Table 1. D ice, UPGMA ( 2) 4 11,, 3 1 ( ) 0193, 2, 1,, 0192 SS, 1 6 SS, 2 1 2,, , 0176, 2 UPGM A29 F ig. 2 The phylogenetic tree of 29 sand pear cultivars ( ma in ly red sk inned) ba sed on UPGM A cluster ana lysis 0185, 2 1,,, 0186,

5 1 : SS 51, 8, ( 2) 1, ( 2 ) ( 1 2 ) ( 4) 4 8 D ice Table 4 D iceπs sim ilarity coeff icien ts for 8 Huoba li pear cultivars from d ifferent places No SS ( Zhebentyayeta et al., 2003) SS9, Kimura (2002) 1418, (H o ) 0168, Kimura (2002) 0163, 6 SS,, NH004a Kimura (2002) 9SS660, 3,, 1 2 ( 2) , (, 2003) SS, SS 2,,,,,,, 1 2 ( 4), ( 4) ( 2),,, (, ), ( 2), (, 1993), 0193,, 1, ( 2),,,

6 ,, (eimer, 1951; Kajiura, 1978;, 1999),, (Vos et al., 1995), 0186,, 0150,,,,,, SS, 3 eferences Bassam B J, Caetano2Anolles G, Gresshoff P M Fast and sensitive silver staining of DNA in polyacrylamide gels. Analytical B iochemistry, 195: Jiao Yan2ying, Zhao Gui2m in, Chen Ji2zhong Hongnanguo - a new mutation cultivar originated from Nanguoli. China Fruits, (3) : 22. ( in Chinese),, , (3) : 22. Kajiura I ed pear. Agriculture and Horticulture, 53 (10) : ( in Japanese) Kimura T, Shi Y Z, ShodaM, Kotobuki K, Matsuta N, Hayashi T, Ban Y, Yamamoto T Identification ofa sian pear varieties by SS analysis. B reeding Science, 52: Nei M, L iw H Mathematicalmodel for studying genetic variation in terms of restriction endonucleases. Proeedings of the NationalAcademy of Sciences of United States of America, 76: PowellW, Machray G, Provan J Polymorphism revealed by simp le sequence repeats. Trends in Plant Science, 1 (7) : eimer F C A genetical bud mutation in the pear. J. Heredity, 42: Tao Pang, Shu Qun, W ang Jian2jun, ZhangW en2bing resources. Southwest China Journal of Agricultural Sciences, (47) : ( in Chinese) Present situation and p rospect of research and utilization on red pear germplasm,,, , (47) : Tao Pang, Shu Qun, ZhangWen2bing A new red pear variety with high quality, late ripening and long storage lifeyunhong 1. Acta Horticulturae Sinica, 30 (4) : 497.,,. ( in Chinese) , 30 (4) : 497. Vos P, Hogers, B leekerm, eijansm, van de Lee T, HornesM, Frijters A, Pot J, Peleman J, KuiperM, Zabeau M technique for DNA fingerp rinting. Nucleic Acids esearch, 23: AFLP: a new W u Geng2m in Pomology in temperate zone of China. Zhejiang: Zhejiang Scientific and Technological Press: ( in Chinese) : : Yamamoto T, Kimura T, Sawamura Y, Manabe T, Kotobuki K, Hayashi T, Ban Y, Matsuta N Simp le sequence repeats for genetic analysis in pear. Euphytica, 124: ZhangW en2bing, Zhang Jun2ru esources of red pear cultivars in the subtrop ical region of Yunnan Province. China Fruits, (4) : ( in Chinese), , (4) : ZhangWen2bing, Zhang Jun2ru, Li Xue2lin, Shu Qun, Zeng Ya2wen ed pear germplasm resources in Yunnan and their utilization. South China Fruits, 26 (5) : ( in Chinese),,,, , 26 (5) : Zhebentyayeva T N, eighard G L, Gorina V M, AbbottA G Simp le sequence repeat ( SS) analysis for assessment of genetic variability in ap ricot germp lasm. Theoretical and App lied Genetics, 106: