Transcriptional signaling pathways inversely regulated in Alzheimer s disease and glioblastoma multiform

Μέγεθος: px

Εμφάνιση ξεκινά από τη σελίδα:

Download "Transcriptional signaling pathways inversely regulated in Alzheimer s disease and glioblastoma multiform"

Πορφύριος Σκλαβούνος
5 χρόνια πριν
Προβολές:

1 Transcriptional signaling pathways inversely regulated in Alzheimer s disease and glioblastoma multiform Timothy Liu, Ding Ren, Xiaoping Zhu, Zheng Yin, Guangxu Jin, Zhen Zhao, Daniel Robinson, Xuping Li, Kelvin Wong, Kemi Cui, Hong Zhao, Stephen TC Wong

2 A Supp Fig 1. Aβ plaque formation in AD mouse model Stains indicate Aβ plaques that have formed in the brains of 12-month old APPswe transgenic mice

3 Transcriptional signaling pathways inversely regulated in Alzheimer s disease and glioblastoma multiform Timothy Liu, Ding Ren, Xiaoping Zhu, Zheng Yin, Guangxu Jin, Zhen Zhao, Daniel Robinson, Xuping Li, Kelvin Wong, Kemi Cui, Hong Zhao, Stephen TC Supplementary Table 1. Differentially expressed genes enriched in GBM and AD+ group GBM p value (GBM) AD p value (AD) [AD] [GBM] Gene Symbol Description E CXCR4 chemokine (C X C motif) receptor E CDKN2C cyclin dependent kinase inhibitor 2C (p18, inhibits CDK4) E E NES nestin E E ID3 inhibitor of DNA binding 3, dominant negative helix loop helix protein E E C21orf62 chromosome 21 open reading frame E E TCF7L1 transcription factor 7 like 1 (T cell specific, HMG box) E E SPP1 secreted phosphoprotein E E ANGPT2 angiopoietin E E AEBP1 AE binding protein E E PTBP1 polypyrimidine tract binding protein E E DENND2A DENN/MADD domain containing 2A E E GBP2 guanylate binding protein 2, interferon inducible E E EFNA1 ephrin A E E DDR1 discoidin domain receptor tyrosine kinase E E CALD1 caldesmon E E DTYMK deoxythymidylate kinase (thymidylate kinase) E E TNFRSF1A tumor necrosis factor receptor superfamily, member 1A E E ZBTB20 zinc finger and BTB domain containing E E SYK spleen tyrosine kinase E E VEZF1 vascular endothelial zinc finger E E BAZ1A bromodomain adjacent to zinc finger domain, 1A E E HEATR2 HEAT repeat containing E E TIMELESS timeless homolog (Drosophila) E E ERBB2IP erbb2 interacting protein E E LAMB2 laminin, beta 2 (laminin S) E E MSX1 msh homeobox E E TNPO1 transportin E E NECAP2 NECAP endocytosis associated E E SERPINB6 serpin peptidase inhibitor, clade B (ovalbumin), member E E LAMP2 lysosomal associated membrane protein E E SMAD1 SMAD family member E E BGN biglycan E E CEBPD CCAAT/enhancer binding protein (C/EBP), delta E E CHD1 chromodomain helicase DNA binding protein E E PKN2 protein kinase N E E G3BP1 GTPase activating protein (SH3 domain) binding protein E E C6orf145 PX domain containing 1 (Previous name: chromosome 6 open reading frame 145 ) E E GOLIM4 golgi integral membrane protein E E HLA E major histocompatibility complex, class I, E E E SDCCAG3 serologically defined colon cancer antigen E E STAT3 signal transducer and activator of transcription 3 (acute phase response factor) E E FAM63A family with sequence similarity 63, member A E E SLC39A1 solute carrier family 39 (zinc transporter), member E E ELF1 E74 like factor 1 (ets domain transcription factor)

4 E E VGLL4 vestigial like 4 (Drosophila) E E SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member E E NIPBL Nipped B homolog (Drosophila) E E CTDSP1 CTD (carboxy terminal domain, RNA polymerase II, polypeptide A) small phosphatase E E RBM38 RNA binding motif protein E E RAF1 v raf 1 murine leukemia viral oncogene homolog E E ABHD4 abhydrolase domain containing E E TGIF2 TGFB induced factor homeobox E E KLF6 Kruppel like factor E E TROVE2 TROVE domain family, member E E C1orf144 SUZ RNA binding domain containing 1 (Previous name: chromosome 1 open reading frame 144 ) E E MYO1F myosin IF E E DDAH2 dimethylarginine dimethylaminohydrolase E E MCL1 myeloid cell leukemia sequence 1 (BCL2 related) E E LSM14A LSM14A, SCD6 homolog A (S. cerevisiae) E E TCF3 transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47) E E CDK2AP1 cyclin dependent kinase 2 associated protein E E EEF1D eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) E E C7orf26 chromosome 7 open reading frame E E IKBKB inhibitor of kappa light polypeptide gene enhancer in B cells, kinase beta E E INPPL1 inositol polyphosphate phosphatase like E E FTSJ3 FtsJ homolog 3 (E. coli) E E DOCK6 dedicator of cytokinesis E E MAML1 mastermind like 1 (Drosophila) E E NUP214 nucleoporin 214kDa

5 Transcriptional signaling pathways inversely regulated in Alzheimer s disease and glioblastoma multiform Timothy Liu, Ding Ren, Xiaoping Zhu, Zheng Yin, Guangxu Jin, Zhen Zhao, Daniel Robinson, Xuping Li, Kelvin Wong, Kemi supplementary Table 2. Differentially expressed genes enriched in GBM+ and AD group GBM p value (GBM) AD p value (AD) [GBM] [AD] Gene Symbol Description E E VSNL1 visinin like E E SLC17A7 solute carrier family 17 (sodium dependent inorganic phosphate cotransporter), member E E SYT1 synaptotagmin I E E SNAP91 synaptosomal associated protein, 91kDa homolog (mouse) E CACNG3 calcium channel, voltage dependent, gamma subunit E E SNAP25 synaptosomal associated protein, 25kDa E E CRYM crystallin, mu E E NRGN neurogranin (protein kinase C substrate, RC3) E E AK5 adenylate kinase E E RGS4 regulator of G protein signaling E RIMBP2 RIMS binding protein E E SYNGR3 synaptogyrin E STYK1 serine/threonine/tyrosine kinase E E FGF13 fibroblast growth factor E E NMNAT2 nicotinamide nucleotide adenylyltransferase E E SERPINI1 serpin peptidase inhibitor, clade I (neuroserpin), member E GABRG2 gamma aminobutyric acid (GABA) A receptor, gamma E E SNCA synuclein, alpha (non A4 component of amyloid precursor) E E DYNC1I1 dynein, cytoplasmic 1, intermediate chain E SYN2 synapsin II E E KIAA0513 KIAA0513 (uncharacterized protein KIAA051) E CPNE6 copine VI (neuronal) E E CACNA2D3 calcium channel, voltage dependent, alpha 2/delta subunit E E HSPB3 heat shock 27kDa protein E E STXBP1 syntaxin binding protein E E MAST3 microtubule associated serine/threonine kinase E CCKBR cholecystokinin B receptor E CNKSR2 connector enhancer of kinase suppressor of Ras E E C6orf105 (nowandrogen dependent TFPI regulating protein (Previous name: chromosome 6 open reading frame 105 ) E E NAV3 neuron navigator E SLC30A3 solute carrier family 30 (zinc transporter), member 3

6 E E FXYD7 FXYD domain containing ion transport regulator E E ST6GALNAC5 ST6 (alpha N acetyl neuraminyl 2,3 beta galactosyl 1,3) N acetylgalactosaminide alpha 2,6 sialyltransferase E E ENC1 ectodermal neural cortex 1 (with BTB like domain) E E SULT4A1 sulfotransferase family 4A, member E GPR22 G protein coupled receptor E E GUCY1B3 guanylate cyclase 1, soluble, beta E E GOT1 glutamic oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1) E E EHD3 EH domain containing E E SLITRK5 SLIT and NTRK like family, member E E BASP1 brain abundant, membrane attached signal protein E E PI4KA phosphatidylinositol 4 kinase, catalytic, alpha E E YWHAH tyrosine 3 monooxygenase/tryptophan 5 monooxygenase activation protein, eta polypeptide E E PDE1A phosphodiesterase 1A, calmodulin dependent E E BSCL2 Berardinelli Seip congenital lipodystrophy 2 (seipin) E E ATP1A3 ATPase, Na+/K+ transporting, alpha 3 polypeptide E E PTPN3 protein tyrosine phosphatase, non receptor type E TRHDE thyrotropin releasing hormone degrading enzyme E E TUBA4A tubulin, alpha 4a E E GABRA5 gamma aminobutyric acid (GABA) A receptor, alpha E E UCHL1 ubiquitin carboxyl terminal esterase L1 (ubiquitin thiolesterase) E E HPRT1 hypoxanthine phosphoribosyltransferase E KCNV1 potassium channel, subfamily V, member E E STAT4 signal transducer and activator of transcription E E SYP synaptophysin E E SCG5 secretogranin V (7B2 protein) E E ATP6V1H ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H E E SLC9A6 solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member E NEUROD6 neuronal differentiation E E GREM2 gremlin E E XK X linked Kx blood group (McLeod syndrome) E E KIAA1324 KIAA1324 (Estrogen induced gene 121 protein) E E GLS glutaminase E E CALM3 calmodulin 3 (phosphorylase kinase, delta) E E ZNF215 zinc finger protein E E ACOT7 acyl CoA thioesterase 7

7 E E MOAP1 modulator of apoptosis E E STAR steroidogenic acute regulatory protein E E ATP6V1B2 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B E CAMK1G calcium/calmodulin dependent protein kinase IG E E MDH1 malate dehydrogenase 1, NAD (soluble) E E WDR7 WD repeat domain E E RGS7 regulator of G protein signaling E E LDOC1 leucine zipper, down regulated in cancer E E PPP3CA protein phosphatase 3, catalytic subunit, alpha isozyme E E NRN1 neuritin E E PLK2 polo like kinase E E NECAP1 NECAP endocytosis associated E E CRH corticotropin releasing hormone E E KIAA0319 KIAA0319(dyslexia associated protein KIAA0319) E E AP3M2 adaptor related protein complex 3, mu 2 subunit E E CABYR calcium binding tyrosine (Y) phosphorylation regulated E E CDKN2D cyclin dependent kinase inhibitor 2D (p19, inhibits CDK4) E E YWHAZ tyrosine 3 monooxygenase/tryptophan 5 monooxygenase activation protein, zeta polypeptide E E TRIM37 tripartite motif containing E E KALRN kalirin, RhoGEF kinase E E RTN3 reticulon E E SSX2IP synovial sarcoma, X breakpoint 2 interacting protein E E PAK1 p21 protein (Cdc42/Rac) activated kinase E E B3GNT1 UDP GlcNAc:betaGal beta 1,3 N acetylglucosaminyltransferase E E CDH9 cadherin 9, type 2 (T1 cadherin) E E C1orf216 chromosome 1 open reading frame E E SLC1A1 solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member E E GLRB glycine receptor, beta E E ATP6V1E1 ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E E E MAP2K4 mitogen activated protein kinase kinase E PRMT8 protein arginine methyltransferase E E PPL periplakin E E LARGE like glycosyltransferase E E ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) E E FABP3 fatty acid binding protein 3, muscle and heart (mammary derived growth inhibitor)

8 E E RAP1GDS1 RAP1, GTP GDP dissociation stimulator E E ARF3 ADP ribosylation factor E E B4GALT6 UDP Gal:betaGlcNAc beta 1,4 galactosyltransferase, polypeptide E E ATP5C1 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide E KCNAB1 potassium voltage gated channel, shaker related subfamily, beta member E E GABARAPL1 GABA(A) receptor associated protein like E E PPP3CB protein phosphatase 3, catalytic subunit, beta isozyme E E CDH12 cadherin 12, type 2 (N cadherin 2) E E CARTPT CART prepropeptide E E MAP2K1 mitogen activated protein kinase kinase E E OXCT1 3 oxoacid CoA transferase E E PPP3R1 protein phosphatase 3, regulatory subunit B, alpha E E TERF2IP telomeric repeat binding factor 2, interacting protein E E VAMP2 vesicle associated membrane protein 2 (synaptobrevin 2) E E CDK5 cyclin dependent kinase E E SOSTDC1 sclerostin domain containing E E C16orf45 chromosome 16 open reading frame E E SEC61A2 Sec61 alpha 2 subunit (S. cerevisiae) E E PCMT1 protein L isoaspartate (D aspartate) O methyltransferase E E RBP4 retinol binding protein 4, plasma E E PTPRM protein tyrosine phosphatase, receptor type, M E E ATP6V1A ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A E E GHITM growth hormone inducible transmembrane protein E E FIG4 FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae) E E FKBP1B FK506 binding protein 1B, 12.6 kda E E PTPRN2 protein tyrosine phosphatase, receptor type, N polypeptide E E KIAA1279 KIAA1279 (KIF1 binding protein) E E EPHA5 EPH receptor A E E FBXO34 F box protein E E HERC1 HECT and RLD domain containing E3 ubiquitin protein ligase family member E E ATP6V0A1 ATPase, H+ transporting, lysosomal V0 subunit a E E MAPK1 mitogen activated protein kinase E DLGAP2 discs, large (Drosophila) homolog associated protein E E CISD1 CDGSH iron sulfur domain E E SERINC3 serine incorporator 3

9 E E AP2M1 adaptor related protein complex 2, mu 1 subunit E E DMXL2 Dmx like E E PGRMC1 progesterone receptor membrane component E E IDS iduronate 2 sulfatase E E ATP6V1D ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D E E TM2D3 TM2 domain containing E E GOT2 glutamic oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2) E E DDX24 DEAD (Asp Glu Ala Asp) box polypeptide E E FAM49A family with sequence similarity 49, member A E E ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch E E PPME1 protein phosphatase methylesterase E E RRAGA Ras related GTP binding A E E ATPIF1 ATPase inhibitory factor E E ANKMY2 ankyrin repeat and MYND domain containing E E SARS seryl trna synthetase E E LANCL1 LanC lantibiotic synthetase component C like 1 (bacterial) E E MGST3 microsomal glutathione S transferase E E NDUFA8 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8, 19kDa E E AUH AU RNA binding protein/enoyl CoA hydratase E E R3HDM1 R3H domain containing E E CHP calcineurin like EF hand protein E E ATP6V1C1 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C E E STOML1 stomatin (EPB72) like E E TUBG2 tubulin, gamma E E PRKAR1B protein kinase, camp dependent, regulatory, type I, beta E E C14orf2 chromosome 14 open reading frame E E PEX11B peroxisomal biogenesis factor 11 beta E E STS steroid sulfatase (microsomal), isozyme S E E ARPC5L actin related protein 2/3 complex, subunit 5 like E E SYT5 synaptotagmin V E E NDUFV1 NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa E E SLC25A14 solute carrier family 25 (mitochondrial carrier, brain), member E E ACTR10 actin related protein 10 homolog (S. cerevisiae) E E KCNB2 potassium voltage gated channel, Shab related subfamily, member E E LCMT1 leucine carboxyl methyltransferase 1

10 E E TPM3 tropomyosin E E ADAM23 ADAM metallopeptidase domain E E DTNB dystrobrevin, beta E E RBM9 (now RBRNA binding protein, fox 1 homolog (C. elegans) 2 / (Previous name: RNA binding motif protein 9 ) E E PIN1 peptidylprolyl cis/trans isomerase, NIMA interacting E E REEP5 receptor accessory protein E E PITPNB phosphatidylinositol transfer protein, beta E E ARL8B ADP ribosylation factor like 8B E E VPS35 vacuolar protein sorting 35 homolog (S. cerevisiae) E E KATNB1 katanin p80 (WD repeat containing) subunit B E E LMTK2 lemur tyrosine kinase E E SLC41A3 solute carrier family 41, member E E ALOX12B arachidonate 12 lipoxygenase, 12R type

Σχετικά έγγραφα

Supplemental Table 1. Oligonucleotides used to identify H-RAS, K-RAS and N-RAS mutations and PTEN gene expression.

Supplemental Table 1. Oligonucleotides used to identify H-RAS, K-RAS and N-RAS mutations and PTEN gene expression. Gene Exon Forward primer Reverse primer Temp ( C) HRAS 2-3 ATGACGGAATATAAGCTGGT ATGGCAAACACACACAGGAA