K31. Μηχανισμοί ρύθμισης της γονιδιακής έκφρασης

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "K31. Μηχανισμοί ρύθμισης της γονιδιακής έκφρασης"

Transcript

1 K31. Μηχανισμοί ρύθμισης της γονιδιακής έκφρασης Η γονιδιακή έκφραση μπορεί να ελέγχεται σε πολλά (6) επίπεδα Μεταγραφή και ιστοειδική έκφραση 1 μικροσυστοιχίες

2 Μεταγραφή και ιστοειδική έκφραση 1.α) Διαφοροποιημένα κύτταρα περιέχουν το ίδιο γονιδίωμα (DNA ), αλλά διαφέρουν στην έκφραση mrna και πρωτεΐνών (ιστο-ειδική έκφραση) β) Aνάλυση μικροσυστοιχειών αποκαλύπτει το συνολικό προφιλ έκφρασης κάθε Κυτταρικού τύπου 2 το προφίλ μπορεί να αντιστραφεί

3 2. Το προφίλ έκφρασης ενός διαφοροποιημένου πυρήνα μπορεί να ανα-προγραμματισθεί από το περιβάλλον (κυτταροπλασματικό ή/και εξωκυττάριο) 3 το προφίλ μπορεί να μεταβάλλεται

4 3. Λειτουργικά όμοια κύτταρα ενός πολυκύτταρου οργανισμού μπορεί να αλλάζουν πρότυπο έκφρασης σε διάφορετικές συνθήκες, και ανάλογα, μονοκύτταροι οργανισμοί αλλάζουν πρότυπο έκφρασης αποκρινόμενοι σε αλλαγές του περιβάλλοντος Η έκφραση των πρωτεϊνών που καταβολίζουν λακτόζη στην E.coli επάγονται όταν στο περιβάλλον υπάρχει λακτόζη (και λείπει γλυκόζη). Θα συναντήσετε πολλές εκατοντάδες τέτοια παραδείγματα ρύθμισης Άμεση και μακροσκοπική ανίχνευση της β-γαλακτοσιδάσης στο εργαστήριο Οπερόνιο 4

5 Α. Tο οπερόνιο λακτόζης Ένας καταστολέας (lac repressor) και ένας ενεργοποιητής (CAP activator) καθορίζουν τη συχνότητα μεταγραφικής έναρξης RNA pol. Cap RNA starts i p o z y a CAP Lac Repressor galactosidase permease Οπερόνιο RNA transacetylase p: promoter (θέση δέσμευσης Pol) o: lac operator (θέση θ δέσμευσης lac repressor) θέση δέσμευσης Cap lac I: γονίδιο Lac Repressor (καταστολέας) Cap: γονίδιο Catabolite Activator Protein (Ενεργοποιητής καταβολικών οδών) + lactose, -glucose -> ON - lactose -> ΟFF Τι εξυπηρετεί το οπερόνιο?? Θυμηθείτε πώς μεταφράζεται ένα πολυκιστρονικό mrna!! 5 Στερεοχημική παρεμπόδιση?

6 Aπουσία λακτόζης o καταστολέας lac (lac i) δεσμεύεται στο χειριστή (lac o) και παρεμποδίζει τη λειτουργία της RNA πολυμεράσης RNA pol. Στερεοχημική παρεμπόδιση δέσμευσης της Pol, ή της λειτουργίας της??? OFF - lactose i p o z y a Εξιδικευμένη πρόσδεση στο DNA απουσία λακτόζης Lac Repressor Παρουσία λακτόζης???? 6 DNA-aa interaction

7 Θυμηθείτε!! Η εξειδίκευση της δέσμευσης πρωτεϊνών στο DNA συνίσταται στην αναγνώριση - και ανάπτυξη δεσμών υδρογόνου- μεταξύ συγκεκριμένων βάσεων και αμινοξέων Η έλικα-στροφή-έλικα είναι ένα κοινό,, αλλά όχι το μοναδικό, μοτίβο ειδικής αναγνώρισης DNA. 7 Διμερής μορφή

8 Η ομο-διμερής μορφή μπορεί να αναγνωρίζει παλίνδρομες αλληλουχίες DNA Παλίνδρομη αλληλουχία DNA Oμο-διμερής πρωτεΐνη που αναγνωρίζει DNA 8 Lac repressor- lac operator

9 Δέσμευση του lac καταστολέα (lac i) στον lac χειριστή (lac o) Η μεγάλη C-περιοχή διμερίζει την πρωτεΐνη και η μικρή Ν-περιοχή αναγνωρίζει και δεσμεύεται στο DNA απουσία λακτόζης 5 TGTGTCGAATTGTGAGCGGATAACAATTTCACACA 3 3 ACACAGCTTAACACTCGCCTATTGTTAAAGTGTGT 5 Χ Χ Ο καταστολέας lac λειτουργεί ως μοριακός διακόπτης!! Η σταθερά διάστασης (Κd) του συμπλόκου καταστολέα-dna είναι ~10-13 Μ DNA-Pr DNA + Pr Kd = [DNA] [Pr] / [DNA-Pr] 9 Σύμπλοκο καταστ. -λακτόζης

10 Ο προσδέτης (λακτόζη/αλλολακτόζη) αποδεσμεύει τον καταστολέα από το DNA και επιτρέπει τη λειτουργία της RNA πολυμεράσης RNA pol. Στερεοχημική παρεμπόδιση? OFF - lactose i p o z y a Lac Repressor ON + lactose i p o z y a RNA Lac Repressor Σύμπλοκο καταστολλέα - λακτόζης 10 camp

11 Κυκλικά νουκλεοτίδια συντίθενται από τριφωσφορικούς νουκλεοζίτες και λειτουργούν ως αγγελιοφόρα μόρια ATP Αδένυλ-κυκλάση φωσφοδιεστεράση ΑΜΡ PPj + camp 11 Cap

12 H δέσμευση της RNA pol. διεγείρεται από αλληλεπιδράσεις με την Cap (catabolite activator protein, ενεργοποιητής καταβολικών γονιδίων) ) Cap RNA pol. +Gl Glucose p o z y a low camp CAP Cap Συνεργατική σχέση Cap και RNA pol - Glucose high camp CAP p o z y a RNA 12 Cap structure

13 Η πρωτεΐνη CAP 1 ο ) δεσμέυει camp, 2 ο )δεσμεύεται μ στο DNA, 3 ο ) αλληλεπιδρά με την RNA πολυμεράση Σε ποιες περιοχές της πρωτεΐνης θα προκαλούσατε ούσα σημειακές μεταλλάξεις με στόχο τις επιμέρους Λειτουργίες της πρωτεΐνης Cap?? 13 Συνολική εικόνα

14 Συνολική εικόνα ρύθμισης του οπερονίου λακτόζης + γλυκόζη cap p o z y a + λακτόζη OFF + γλυκόζη cap p o z y a - λακτόζη OFF - γλυκόζη cap p o z y a - λακτόζη OFF - γλυκόζη cap p o z y a + λακτόζη ON H CAP ενεργοποιεί πολλά οπερόνια καταβολισμού δευτερευόντων σακχάρων π.χ. αραβινόζη (regulon) W operon 14

15 Β. To οπερόνιο της Τρυπτοφάνης ένζυμα βιοσύνθεσης Τρυπτοφάνης Τα ένζυμα βιοσύνθεσης τρυπτοφάνης καταστέλλονται παρουσία τρυπτοφάνης, ενώ τα ένζυμα αποικοδόμησης λακτόζης καταστέλλονται απουσία λακτόζης 15 W καταστολλέας

16 Ρύθμιση του οπερονίου τρυπτοφάνης Ο προσδέτης (τρυπτοφάνη) ρ φ προκαλεί δέσμευση του καταστολλέα στο DNA - τρυπτοφάνη + τρυπτοφάνη 16 ευκαρυώτες

17 H ευκαρυωτική μεταγραφική ρύθμιση είναι πιο πολύπλοκη λ διεργασία 1. Aριθμός γονιδίων ~ E. coli ~ yeast ~ human 2. Aνάπτυξηδιαφοροποίηση Κύτταρο-ειδικότητα Ομοιόσταση Πληθώρα συνδυασμών ρυθμιστικών μεταγραφικών παραγόντων 3. Χρωματίνη Λειτουργία ρυθμιστικών συμπλόκων ομοιοπολικής τροποποίησης ιστονών και νουκλεοσωμικής ανάπλασης/αναδιάταξης 17 EMSA footprint chip

18 Ανίχνευση ειδικών αλληλεπιδράσεων πρωτεϊνών-dna στο εργαστήριο 1. EMSA (Electrophoretic Mobility Shift Assay) 2. DNase footprinting 18

19 3. Chromatin Immunoprecipitation (Chip), Ανοσοκατακρήμνιση χρωματίνης: H μέθοδος που ανιχνεύει In vivo και σε αληθινό χρόνο πρωτεΐνες που δεσμεύονται στο DNA, νουκλεοσωμικές διαμορφώσεις, ομοιοπολικές τροποποιήσεις ιστονών.. Μονιμοποίηση Α Β (cross link) γονίδιο 1 γονίδιο 2 Λύση κυττάρων Τεμαχισμός (μηχανικά ά ή ενζυμικά μέσα) ) Α Β Ανοσοκατακρήμνιση με αντισώματα ειδικά για την πρωτεΐνη Α Α Απομάκρυνση των συμπλόκων Β-DNA και του ελεύθερου DNA Β Πρωτεόλυση PCR με εκκινητές ειδικούς για τον υποκινητή του γονιδίου 1( (+) ή του γονιδίου 2() (-)!! Απομάκρυνση πρωτεϊνών 19 Μοντέλα συστήματα

20 Μοντέλα-συστήματα ρύθμισης π.χ. τα γονίδια GAL που μετατρέπουν γαλακτόζη σε γλυκόζη στη ζύμη συνέβαλαν στην ανάλυση ενισχυτών και προαγωγέων, ειδικών ρυθμιστικών πρωτεϊνών και γενικών μεταγραφικών παραγόντων/rna pol II ΤΒΡ Gal4: Συνίσταται από περιοχή (domain) δέσμευσης στο DNA και περιοχή μεταγραφικής ενεργοποίησης Εφαρμόστε την μέθοδο Chip για να ελέγξετε την δέσμευση των Gal4 και ΤΒΡ στο DNA!! Ενισχυτές 20 Συνδυαστικό μοντέλο

21 Συνδυαστικός έλεγχος: Oι ενισχυτές διεγείρουν εξειδικευμένα τη μεταγραφή γιατί αναγνωρίζονται από συγκεκριμένους συνδυασμούς ενεργοποιητών και συν-ενεργοποιητών Kυτταρικός τύπος Α TATAA 1 Kυτταρικός τύπος Β Kυτταρικός τύπος Γ TATAA 2 Χρωματίνη RNA Pol II TATAA 100 Αθροιστικό vs συνεργατικό (πολλαπλασιαστικό) αποτέλεσμα: = 100!!! Μια από τις λειτουργίες των συν-ενεργοποιητών, πέρα από αλληλεπιδράσεις με την RNA πολυμεράση, μπορεί να είναι η τροποποίηση των αμινοτελικών αμινοξέων ιστονών και η αναδιάταξη της χρωματινικής δομής 21 Histones Νουκλεόσωμα

22 Ιστόνες (histones) και νουκλεοσωμική συγκρότηση Οι αμινοτελικές ουρές ιστονών προβάλλουν από τον νουκλεοσωμικό πυρήνα Βρείτε την ομολογία (% identity, % similarity) μεταξύ της Η3 του σακχαρομύκητα και της Η3 του ανθρώπου. 22 Ακετυλίωση

23 Η χρωματινική δομή επηρεάζεται απο χημικές τροποποιήσεις (ακετυλιώσεις, μεθυλιώσεις κ.α.) ) πλευρικών ομάδων αμινοτελικών αμινοξέων ιστονών H αφόρτιστη αμιδική ομάδα, σε αντίθεση με την θετικά φορτισμένη αμινική, μπορεί να συμβάλλει στην χαλάρωση των αλληλεπιδράσεων ιστονών και DNA. Αφόρτιστη αμιδική ομάδα Αμινοτελικές ουρές ιστονών μπορεί να υφίσταται επίσης πολλαπλές μεθυλιώσεις καταλυόμενες από Μέθυλ- μεταφοράσες ιστονών και απόμεθυλιώσεις καταλυόμενες από ειδικές από- μεθυλάσες. Ποιά αντίδραση καταλύεται από μια απο-ακετυλάση ιστονών (HDAC) και ποιό το προβλεπόμενο αποτέλεσμα στη μεταγραφή?? 23 Ανάπλαση-δέσμευση πρωτείνης

24 H μεταγραφική ενεργοποίηση συχνά χρειάζεται ανάπλαση της χρωματίνης Τι δυνατότητα έχει μια ρυθμιστική πρωτεΐνη να δεσμευτεί ειδικά σε νουκλεοσωμικό DNA?? msec msec 250 msec Η ανάπλαση της χρωματίνης συντελείται με Σύμπλοκα ανάπλασης της χρωματινικής δομής που ξοδεύοντας ΑΤΡ προκαλούν είτε α) Νουκλεοσωμική ολίσθηση, είτε β) Αποσυγκρότηση και ανασυγκρότηση νουκλεοσωμάτων σε νέα θέσεις Οι ομοιοπολικές τροποποιήσεις αμινοτελικών αμινοξέων ιστονών (ακετυλίωση, μεθυλίωση κ.α.) μπορεί να προηγούνται της δράσης των συμπλόκων ανάπλασης της νουκλεοσομικής δομής. Οι «συσκευές» τροποποίησης ιστονών και ανάπλασης χρωματίνης καθοδηγούνται σε διάφορές χρωμοσωμικές θέσεις από μεταγραφικούς ενεργοποιητές στους ενισχυτές των αντιστοίχων γονιδίων 24 brahma

25 Οι «συσκευές» τροποποίησης ιστονών και ανάπλασης χρωματίνης καθοδηγούνται σε διάφορές χρωμοσωμικές θέσεις από μεταγραφικούς ενεργοποιητές στους ενισχυτές των αντιστοίχων γονιδίων Επιπλέον, ακετυλιωμένες λυσίνες μπορούν να αναγνωρισθούν από υπομονάδες των συμπλόκων αναδιάταξης χρωματίνης, αλλά και από άλλους γενικούς μεταγραφικούς παράγοντες (πχ TAF250) μέσω του μοτίβου brahma. Ενδέχεται αυτές οι αλληλεπιδράσεις να σταθεροποιούν/κατευθύνουν τα σύμπλοκα αναδιάταξης χρωματίνης στα σημεία εκείνα των υποκινητών που η νουκλεοσωμική δομή χρειάζεται αναδιάταξη!!! μοτίβο brahma Estrogen 25

26 Παραδείγματα ρύθμισης μεταγραφικών ενεργοποιητών 1. Τα οιστρογόνα (πχ η οιστρόνη), οι θυροειδικές ορμόνες, τα ρετινοειδή κλπ στεροειδή κ.α. δεσμεύονται και ενεργοποιούν μεταγραφικούς παράγοντες γνωστούς ως πυρηνικούς υποδοχείς ορμονών 26 ERE

27 Οι πυρηνικοί υποδοχείς στεροειδών ορμονών αναγνωρίζουν και δεσμεύονται σε αλληλουχίες DNA γνωστές ως «στοιχεία χ απόκρισης σε οιστρογόνα» ERE (estrogen response element) ΕRE: παλλίνδρομη αλληλουχία AGGTCANNNGACCT Οι πυρηνικοί υποδοχείς στεροειδών ορμονών συνίστανται από περισσότερες από δυο δομικά και λειτουργικά δικριτές περιοχές Zn 27 Δομικές αλλαγές

28 Η σύνδεση του προσδέματος (οιστραδιόλη) προκαλεί δομικές αλλαγές στον πυρηνικό υποδοχέα οιστρογόνου 28 SRC-1

29 Ο πυρηνικός υποδοχέας στεροειδών ορμονών- μετά τη σύνδεση του οιστρογόνου-μπορεί να «στρατολογεί» μεταγραφικούς συν-ενεργοποιητές Ανταγωνιστές και αγωνιστές Ο συν-ενεργοποιητής εργο ο SRC-1 (steroid receptor co-activator) ato συνδέεται με τον υποδοχέα στερεοειδών ορμονών μέσω επαναλήψεων L-X-X-L-L 29

30 Ανταγωνιστές και αγωνιστές πυρηνικών υποδοχέων ορμονών Ανταγωνιστές πχ αντικαρκινικά Φάρμακα, που χρησιμοποιούνται στην αντιμετώπιση του καρκίνου του μαστού Αγωνιστές πχ αναβολικά που χρησιμοποιούνται ο ού!!!! στο doping αθλητών!!! 30 ταμοξιφαίνη

31 Η δομική αλλαγή με τη σύνδεση ταμοξιφαίνης (αντί για οιστραδιόλη) αποτρέπει τη σύνδεση του συν-ενεργοποιητή και αναστέλλει (πώς?) τη μεταγραφή 31 Επινεφρίνη

32 2. Δέσμευση προσδεμάτων (πχ επινεφρίνη) σε μεμβρανικούς υποδοχείς καταλήγει σε φωσφορυλίωση φ μεταγραφικών ενεργοποιητών (πχ χ CREB) και στρατολόγηση συν-ενεργοποιητών (πχ CBP) Επινεφρίνη 7ΤΜ Πρωτείνη G Αδενυλική κυκλάση camp Ενεργοποίηση ΡΚΑ Leucine Zipper Ser 192 Φωσφορυλίωση CREB Στρατολόγηση CBP Μεταγραφική ενεργοποίηση CREB PKA: Protein Kinase A CREB: camp Response Element Binding protein CBP: CREB Binding Protein 32 CBP

33 O συνενεργοποιητής CBP, ο οποίος συνδέεται με την φωσφορυλιωμένη μορφή του CREB, φέρει ενεργότητα ακετυλ-μεταφοράσης ιστονών (HAT), αλλά και περιοχή δέσμευσης ακετυλιωμένων ιστονών (περιοχή brm) 192 Μετα-μεταγραφική Ρύθμιση attenuation 33

34 Ρύθμιση σε μετα-μεταγραφικά στάδια-σίγαση (attenuation) Δομή μη τερματισμού Δομή τερματισμού Μηχανισμός εξασθένησης (attenuation) στο οπερόνιο τρυπτοφάνης (Ε. Coli) Έλλειψη W ακινητοποιεί το ριβόσωμα δίνοντας στο mrna δομή που επιτρέπει κίνηση της RNA πολ. 34 και σε άλλα οπερόνια

35 Aνάλογοι μηχανισμοί λειτουργούν και σε άλλα οπερόνια. 35 Fe

36 Μηχανισμός μεταφραστικής ρύθμισης στην ομοιόσταση Fe στα ζώα Ο Fe μεταφέρεται στον ορό από την Τρασφερρίνη Ο υποδοχέας τρασφερρίνης είναι μεμβρανική πρωτεΐνη που εισάγει τρανσφερρίνη-fe F μέσα στα κύτταρα Η φερριτίνη αποθηκεύει ενδοκυττάρια Fe (24 μόρια φρρ φερριτίνης-2400 Fe) Ρύθμιση: Χαμηλές συγκεντρώσεις Fe ελαττώνουν τα επίπεδα φερριτίνης (και αυξάνουν τα επίπεδα του υποδοχέα τρανσφερρίνης) και, αντιστρόφως ) 36 ΙRE-Binding Protein

37 Το ΙRE (Iron Response Element - Στοιχείο απόκρισης στον σίδηρο) στην 5 UTR (5 μη μεταφράσιμη περιοχή) του mrna της φερριτίνης ευθύνεται για την μεταφραστική ρύθμιση του γονιδίου της φερριτίνης Το ΙRE έχει δομή στελέχους-θηλιάς Το ΙRE δεσμεύεται από την IRE-BP (ΙRE-Binding Protein) η οποία εμποδίζει την έναρξη της μετάφρασης του mrna της φερριτίνης. Παρεμποδίζεται η σάρωση της μη μεταφράσιμης περιοχής του mrna από την 40S ριβοσωμική υπομονάδα?? 37 ΙRE-Binding Protein

38 Σε υψηλές συγκεντρώσεις Fe, η IRE-Binding Protein δεσμεύει Fe, με τη μορφή συμπλόκου 4Fe-4S (iron-sulfur cluster). Η θέση δέσμευσης 4Fe-4S 4S επικαλύπτεται με τη θέση δέσμευσης RNA, επομένως σε υψηλές συγκεντρώσεις Fe η IRE-BP αποδεσμεύεται από το IRE και επιτρέπει τη μετάφραση του mrna φερριτίνης Η ΙRE-Binding Protein είναι ομόλογη και έχει ενζυμική ενεργότηταμιτοχονδριακής ακονιτάσης, δηλ. το ενζυμο πού συμμετέχει στον Κύκλο του Krebs καταλύοντας την ισομερίωση τουυ κιτρικού σε ισοκιτρικό μέσω ακονιτικού!!! 4Fe-4S (iron-sulfur cluster) 38

39 Stryer Σλ1005 Σελ Ερωτήσεις: 2, 3, 5, 8, 10, 12. Lehninger Kεφ. 28 1, 2, 3, 4, 9. Σκεφθείτε όλες τις δυνατές σημειακές μεταλλάξεις που θα επηρέαζαν τη φυσιολογική λειτουργία της πρωτεΐνης Cap στο οπερόνιο λακτόζης. Σκεφθείτε τι θα συνέβαινε στο οπερόνιο της τρυπτοφάνης αν απουσίαζαν από το κύτταρο τα σύμπλοκα νουκλεοσωμικής αναδιάταξης. δά Εξηγείστε τα πλεονεκτήματα που εξασφαλίζει η παρουσία ακετυλομεταφοράσης ιστονών και περιοχής brahma στο ίδιο μόριο μεταγραφικού συνενεργοποιητή. 39

Μηχανισμοί ρύθμισης της γονιδιακής έκφρασης

Μηχανισμοί ρύθμισης της γονιδιακής έκφρασης Μηχανισμοί ρύθμισης της γονιδιακής έκφρασης 1 Η γονιδιακή έκφραση μπορεί να ελέγχεται σε πολλά (6) επίπεδα 1-6 επίπεδα ελέγχου 2 Μεταγραφή και ιστοειδική έκφραση Μεταγραφή και ιστοειδική έκφραση 1. Διαφοροποιημένα

Διαβάστε περισσότερα

Κ Ε Φ Α Λ Α Ι Ο 22 : Η ενεργοποίηση της µεταγραφής

Κ Ε Φ Α Λ Α Ι Ο 22 : Η ενεργοποίηση της µεταγραφής Κ Ε Φ Α Λ Α Ι Ο 22 : Η ενεργοποίηση της µεταγραφής Εικόνα 22.1 Η γονιδιακή έκφραση ελέγχεται κυρίως κατά την έναρξη της µεταγραφής και σπάνια στα επόµενα στάδια της γονιδιακής έκφρασης, παρόλο που ο έλεγχος

Διαβάστε περισσότερα

Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς

Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς Πυρίνας ανθρώπινου μεσοφασικού κυττάρου στον οποίο παρατηρούμε, με ανοσοφθορισμό, τη διάστικτη κατανομή της απακετυλάσης των

Διαβάστε περισσότερα

regulatory mechanisms). stringency).

regulatory mechanisms). stringency). ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ Αποτελεί µια άλλη περίπτωση ρύθµισης των γονιδίωνκαιδιακρίνεται: 1) Στην αυτόνοµη καταστολή και 2) Στηναυτόνοµηεπαγωγή. ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ 1) Αυτόνοµη καταστολή: Η µεταβολική πορεία καταλήγει

Διαβάστε περισσότερα

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. (Γενετικό γονιδιακής έκφρασης) Μαντώ Κυριακού 2015

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. (Γενετικό γονιδιακής έκφρασης) Μαντώ Κυριακού 2015 ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ (Γενετικό υλικό των βακτηρίων ρύθμιση της γονιδιακής έκφρασης) Μαντώ Κυριακού 2015 Γενετικό υλικό των βακτηρίων Αποτελείται από ένα μόριο DNA σε υπερελιγμένη μορφή και τα άκρα του

Διαβάστε περισσότερα

igenetics Mια Μεντελική προσέγγιση

igenetics Mια Μεντελική προσέγγιση igenetics Mια Μεντελική προσέγγιση Κεφάλαιο 19 (+ κεφάλαιο 15 Hartwell) Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. igenetics 2

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA

Δοµή και ιδιότητες του DNA Δοµή και ιδιότητες του DNA Βακτηριακό χρωµόσωµα ευκαρυωτικό χρωµόσωµα και χρωµατίνη 28/02/2014 1 Tο βακτηριακό γονιδίωµα περιέχεται σε ένα κυκλικό DNA µήκους 1300 µm εντός του βακτηριακού κυττάρου που

Διαβάστε περισσότερα

igenetics Mια Μεντελική προσέγγιση

igenetics Mια Μεντελική προσέγγιση igenetics Mια Μεντελική προσέγγιση Κεφάλαιο 20 (+ κεφ. 16, Hartwell) Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς Πυρίνας ανθρώπινου μεσοφασικού κυττάρου στον οποίο παρατηρούμε, με

Διαβάστε περισσότερα

BIO111 Μικροβιολογια ιαλεξη 7 Κυτταρικη Ρυθµιση

BIO111 Μικροβιολογια ιαλεξη 7 Κυτταρικη Ρυθµιση BIO111 Μικροβιολογια ιαλεξη 7 Κυτταρικη Ρυθµιση Περιεχοµενα 1. Τι σηµαινει ρυθµιζω για την κυτταρικη µηχανη? 1. Η κυτταρικη ρυθµιση ειναι πολυεπιπεδη 2. Επιπεδο Μεταγραφης-Pύθµιση έκφρασης γονιδίων-tο

Διαβάστε περισσότερα

igenetics Mια Μεντελική προσέγγιση

igenetics Mια Μεντελική προσέγγιση igenetics Mια Μεντελική προσέγγιση Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. 2 Ιδιοστατικά γονίδια Ρυθμιζόμενα γονίδια

Διαβάστε περισσότερα

Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους. Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA.

Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους. Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. 1 -Ρυθμιζόμενα, ιδιοστατικά γονίδια και γονίδια κυτταρικής οικονομίας:

Διαβάστε περισσότερα

Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ )

Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ ) Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ. 387-417) Ένα ρυθμιστικό γονίδιο κωδικοποιεί μια πρωτεΐνη που δρα σε μια θέση-στόχο πάνω στο DNA και ρυθμίζει την έκφραση ενός άλλου γονιδίου. Στον αρνητικό έλεγχο, μία trans-δραστική

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών Διαχείριση ορμονικών μορίων Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών 3 ου Εξαμήνου Δ. Μπουράνης, Σ. Χωριανοπούλου 1 Φυσιολογία Φυτών Διαχείριση ορμονικών

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Α. 1 - Γ 2 - Β 3-4 - Γ 5 - Β. 1 - Σ 2 - Λ 3 - Λ 4 - Λ 5 - Σ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ 1. Κάθε είδος αντισώµατος που αναγνωρίζει έναν αντιγονικό καθοριστή παράγεται

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Βασικοί μηχανισμοί προσαρμογής

Βασικοί μηχανισμοί προσαρμογής ΣΥΓΚΡΙΤΙΚΗ ΦΥΣΙΟΛΟΓΙΑ ΖΩΩΝ 23-24, 18/4/2016 Π.Παπαζαφείρη Βασικοί μηχανισμοί προσαρμογής Προσαρμογή σε μοριακό και γονιδιακό επίπεδο Επίπεδα ελέγχου 1. Πρωτεïνική δράση 2. Πρωτεïνοσύνθεση 3. Ρύθμιση της

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Γ Γ.1 Ο χαρακτήρας της ομάδας αίματος στον άνθρωπο

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών Χηµική Μεταβίβαση Σήµατος Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών 1 Η Επικοινωνία στα Ζωϊκά Κύτταρα 1. Δίκτυα εξωκυτταρικών και ενδοκυτταρικών

Διαβάστε περισσότερα

ΜΟΝΟΠΑΤΙΑ ΕΝΔΟΚΥΤΤΑΡΙΚΗΣ ΜΕΤΑΓΩΓΗΣ ΣΗΜΑΤΟΣ

ΜΟΝΟΠΑΤΙΑ ΕΝΔΟΚΥΤΤΑΡΙΚΗΣ ΜΕΤΑΓΩΓΗΣ ΣΗΜΑΤΟΣ ΜΟΝΟΠΑΤΙΑ ΕΝΔΟΚΥΤΤΑΡΙΚΗΣ ΜΕΤΑΓΩΓΗΣ ΣΗΜΑΤΟΣ Το ένζυμο Αδενυλική κυκλάση, υπεύθυνο για τη βιοσύνθεση του camp. Το camp είναι ένα παράδειγμα μορίου «αγγελιοφόρου» καθοδικά των G πρωτεινών Αύξηση του camp

Διαβάστε περισσότερα

Κ Ε Φ Α Λ Α Ι Ο 21 : Υποκινητές και Ενισχυτές

Κ Ε Φ Α Λ Α Ι Ο 21 : Υποκινητές και Ενισχυτές Κ Ε Φ Α Λ Α Ι Ο 21 : Υποκινητές και Ενισχυτές Εικόνα 21.1 Ένα τυπικό γονίδιο που µεταγράφεται από την RNA πολυµεράση ΙΙ έχει έναν υποκινητή ο οποίος εκτείνεται ανοδικά από τη θέση έναρξης της µεταγραφής.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

Ρύθµιση κυτταρικής λειτουργίας. Μεταγωγή σήµατος

Ρύθµιση κυτταρικής λειτουργίας. Μεταγωγή σήµατος Ρύθµιση κυτταρικής λειτουργίας Μεταγωγή σήµατος 1 Εισαγωγή Η διαδικασία εξέλιξης των πολυκύτταρων οργανισµών (πρίν 2.5 δις χρόνια) άρχισε πολύ πιο αργά από την ύπαρξη των µονοκύτταρων οργανισµών (πρίν

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α Α1. Β, Α2. Β, Α3. Δ, Α4. Γ, Α5. γ ΘΕΜΑ Β Β1. 1 Α, 2 Γ, 3 Α,4 Β, 5 Α, 6 Α, 7 Γ Β2. Βλ. σχολικό βιβλίο, σελ.24(έκδοση 2014-15)

Διαβάστε περισσότερα

επαχθούν θετική αρνητική αρνητική ρύθµιση καταστολέα χειριστή επάγεται επαγωγέα

επαχθούν θετική αρνητική αρνητική ρύθµιση καταστολέα χειριστή επάγεται επαγωγέα Kάθε γονιδίωµα αποτελείται από χιλιάδες γονίδια, αν εξαιρέσουµε τα µικρογονιδιώµατα των ιών. Eνώ ένας αριθµός από αυτά είναι απαραίτητα ανά πάσα στιγµή για τις βασικές λειτουργίες του κυττάρου, η πλειοψηφία

Διαβάστε περισσότερα

Eυκαρυωτικές RNA πολυµεράσες

Eυκαρυωτικές RNA πολυµεράσες Eυκαρυωτικές RNA πολυµεράσες Tρείς διαφορετικές RNA πολυµεράσες αναλαµβάνουν την µεταγραφή των ευκαρυωτικών γονιδίων. Θα ασχοληθούµε αποκλειστικά µε τους ρυθµιστικούς µηχανισµούς που είναι υπεύθυνοι για

Διαβάστε περισσότερα

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)]

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] Μεταβίβαση γενετικής πληροφορίας Η Γενετική πληροφορία βρίσκεται στο DNA (Λεία) (Αδρά) Αντικείμενα του μαθήματος Διαιώνιση/ Εξέλιξη της πληροφορίας

Διαβάστε περισσότερα

Oδοί και μηχανισμοί ευκαρυωτικής μεταγωγής σήματος

Oδοί και μηχανισμοί ευκαρυωτικής μεταγωγής σήματος MOPIAKH BIOΛOΓIA ΦAPMAKEYTIKHΣ ΔIAΛEΞΕΙΣ 10-12 Oδοί και μηχανισμοί ευκαρυωτικής μεταγωγής σήματος (Πως γίνονται αντιληπτά τα μηνύματα και πως δίδονται οι απαντήσεις) Δρ. Xρήστος Παναγιωτίδης, Tµήµα Φαρµακευτικής

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. ΘΕΜΑ Α Α1: δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. Β2. α. DNA πολυµεράση β. πριµόσωµα.

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ ΒΙΟΛΟΓΙΑΣ Ι

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ ΒΙΟΛΟΓΙΑΣ Ι ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ ΒΙΟΛΟΓΙΑΣ Ι ΛΕΙΤΟΥΡΓΙΚΗ ΓΟΝΙΔΙΩΜΑΤΙΚΗ ΓΟΝΙΔΙΩΜΑΤΙΚΗ ΥΨΗΛΗΣ ΑΝΑΛΥΣΗΣ ΟΡΓΑΝΙΣΜΩΝ ΜΟΝΤΕΛΩΝ in vivo Δρ. Γεώργιος Μαρκόπουλος, Ph.D. Βιολόγος, Μεταδιδακτορικός Ερευνητής και Ευάγγελος Κωλέττας,

Διαβάστε περισσότερα

Ο Μεταφραστικός ελεγχος και η διερευνηση των μοντελλων που θα μελετηθούν εστιαζεται σε τεσσερα σημεία

Ο Μεταφραστικός ελεγχος και η διερευνηση των μοντελλων που θα μελετηθούν εστιαζεται σε τεσσερα σημεία Ο Μεταφραστικός ελεγχος και η διερευνηση των μοντελλων που θα μελετηθούν εστιαζεται σε τεσσερα σημεία Στην μελέτη του ριβοσώματος, των στοιχείων που το συγκροτούν αλλά και του τρόπου με τον οποίο αυτά

Διαβάστε περισσότερα

Κεφάλαιο 28 ΣΥΝΘΕΣΗ ΚΑΙ ΜΑΤΙΣΜΑ ΤΟΥ RNA

Κεφάλαιο 28 ΣΥΝΘΕΣΗ ΚΑΙ ΜΑΤΙΣΜΑ ΤΟΥ RNA Κεφάλαιο 28 ΣΥΝΘΕΣΗ ΚΑΙ ΜΑΤΙΣΜΑ ΤΟΥ RNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ) Η διαδικασία της μεταγραφής απαιτεί τη δράση του

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 27 5 2016 Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Σχολ. βιβλίο σελ. 20 με την παλιά έκδοση ή σελ. 24 με τη νέα έκδοση : «Τα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

ΜΕΡΟΣ ΙI: Η ΡΟΗ ΤΩΝ ΓΕΝΕΤΙΚΩΝ ΠΛΗΡΟΦΟΡΙΩΝ ΚΕΦΑΛΑΙΟ 7 Σύνθεση και επεξεργασία του RNA

ΜΕΡΟΣ ΙI: Η ΡΟΗ ΤΩΝ ΓΕΝΕΤΙΚΩΝ ΠΛΗΡΟΦΟΡΙΩΝ ΚΕΦΑΛΑΙΟ 7 Σύνθεση και επεξεργασία του RNA Ευάγγελος Κωλέττας, B.Sc (HONS), Ph.D.(LON) Αναπληρωτής Καθηγητής, Εργαστήριο Βιολογίας, Ιατρική Σχολή, Πανεπιστήμιο Ιωαννίνων ΜΕΡΟΣ ΙI: Η ΡΟΗ ΤΩΝ ΓΕΝΕΤΙΚΩΝ ΠΛΗΡΟΦΟΡΙΩΝ ΚΕΦΑΛΑΙΟ 7 Σύνθεση και επεξεργασία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Αναφερθείτε σε οµοιότητες και διαφορές του γενετικού υλικού µεταξύ προκαρυωτών και ευκαρυωτών. ΠΡΟΚΑΡΥΩΤΙΚΑ ΚΥΤΤΑΡΑ Μικρότερο µέγεθος Ένα µικρό κυκλικό δίκλωνο µόριο DNA στην πυρηνική

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA

Δοµή και ιδιότητες του DNA Δοµή και ιδιότητες του DNA Βακτηριακό χρωµόσωµα Ευκαρυωτικό χρωµόσωµα και χρωµατίνη 10/03/2015 1 Tο βακτηριακό γονιδίωµα περιέχεται σε ένα κυκλικό DNA µήκους 1300 µm εντός του βακτηριακού κυττάρου. Στην

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΕΠΑΛ (ΟΜΑΔΑ Β ) ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ ΗΜΕΡΟΜΗΝΙΑ ΕΞΕΤΑΣΗΣ: 27/05/2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΠ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ Θέμα Α Α1:

Διαβάστε περισσότερα

Τα γονίδια καθορίζουν τα είδη των πρωτεϊνών που συντίθενται στα κύτταρα

Τα γονίδια καθορίζουν τα είδη των πρωτεϊνών που συντίθενται στα κύτταρα Σύνθεση του RNA Δομή και σύνθεση του RNA Τα γονίδια όλων των κυττάρων αλλά και πολλών ιών αποτελούνται από DNA Τα γονίδια καθορίζουν τα είδη των πρωτεϊνών που συντίθενται στα κύτταρα Το μόριο όμως που

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

Κατα το θερµικό Σοκ µαζί µε τις αλλαγές πού επισυµβαινουν στην µεταγραφή παρατηρείται και µια επιλεκτική µετάφραση των µηνυµάτων εκείνων που

Κατα το θερµικό Σοκ µαζί µε τις αλλαγές πού επισυµβαινουν στην µεταγραφή παρατηρείται και µια επιλεκτική µετάφραση των µηνυµάτων εκείνων που Κατα το θερµικό Σοκ µαζί µε τις αλλαγές πού επισυµβαινουν στην µεταγραφή παρατηρείται και µια επιλεκτική µετάφραση των µηνυµάτων εκείνων που κωδικοποιούν για τις πρωτεϊνες που επάγονται από το θερµικό

Διαβάστε περισσότερα

5. Η EcoRI. I. Παράγεται από το βακτήριο E. coli II. Κόβει δίκλωνο DNA μεταξύ G και A όταν συναντήσει την αλληλουχία 3 GAATTC 5 5 CTTAAG 3

5. Η EcoRI. I. Παράγεται από το βακτήριο E. coli II. Κόβει δίκλωνο DNA μεταξύ G και A όταν συναντήσει την αλληλουχία 3 GAATTC 5 5 CTTAAG 3 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ζήτημα 1ο 1. Το βακτήριο Agrobacterium tumefaciens I. Παρασιτεί σε ζωικά κύτταρα II. Μετασχηματίζεται με τη μεσολάβηση του πλασμιδίου Ti III. Μολύνει φυτικά και ζωικά κύτταρα

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Γενικές αρχές µεταβίβασης του ορµονικού σήµατος ΠΑΡΑΣΚΕΥΗ ΜΟΥΤΣΑΤΣΟΥ

Γενικές αρχές µεταβίβασης του ορµονικού σήµατος ΠΑΡΑΣΚΕΥΗ ΜΟΥΤΣΑΤΣΟΥ 26 Γενικές αρχές µεταβίβασης του ορµονικού σήµατος ΠΑΡΑΣΚΕΥΗ ΜΟΥΤΣΑΤΣΟΥ Αναπληρώτρια Καθηγήτρια Εργαστήριο Βιολογικής Χημείας Ιατρική Σχολή Πανεπιστημίου Αθηνών ΕΙΣΑΓΩΓΗ Η αλµατώδης ανάπτυξη στην διελεύκανση

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 27 ΜΑΙΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΘΥΝΣΗ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) Ε Ν Δ Ε Ι Κ Τ

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών Αφού είδαμε πως το DNA αντιγράφεται και μεταγράφεται, τώρα θα εξετάσουμε τη διαδικασία με την παράγονται οι πρωτεϊνες Στην ουσία θα πρέπει να συνδυαστεί ο κώδικας δύο βιβλιοθηκών,

Διαβάστε περισσότερα

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 Πανελλήνιες 2016 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΘΕΜΑ Α Α1- β Α2- β Α3- δ Α4- γ Α- γ ΘΕΜΑ Β Β1. 1- Α 2- Γ 3- Α 4- Β - Α 6- Α 7- Γ Β2. Ορισμός καρυότυπου (σελ. 24):

Διαβάστε περισσότερα

mrna mrna). mrna mrna mrna)

mrna mrna). mrna mrna mrna) ΡΥΘΜIΣΗ ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ ΚΑI ΚΑΤ' ΕΠΕΚΤΑΣΗ ΤΗΣ ΠΡΩΤΕΪΝIΚΗΣ ΣΥΝΘΕΣΗΣ ΓΟΝΙ ΙΑΚΗ ΡΥΘΜΙΣΗ Στo DNA κάθε κυττάρoυ περιέχovται oι πληρoφoρίες για τη σύvθεση όλωv τωv πρωτεϊvώv πoυ µπoρεί vα παράγει. Κάθε στιγµή

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ

ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΤΑΞΗ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ 25/4/2016 ΘΕΜΑ Α Α1. Μέσω του καρυότυπου δεν μπορούν να ανιχνευτούν : α. οι δομικές χρωμοσωμικές ανωμαλίες β.

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 1. 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990 50.20.990 2. 25ης Μαρτίου 74 Π. ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 3. Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

Η χοληστερόλη είναι ο πρόδρομος όλων των κατηγοριών των στεροειδών ορμονών: γλυκοκορτικοειδή (για παράδειγμα κορτιζόλη), αλατοκορτικοειδή (για

Η χοληστερόλη είναι ο πρόδρομος όλων των κατηγοριών των στεροειδών ορμονών: γλυκοκορτικοειδή (για παράδειγμα κορτιζόλη), αλατοκορτικοειδή (για Η χοληστερόλη είναι ο πρόδρομος όλων των κατηγοριών των στεροειδών ορμονών: γλυκοκορτικοειδή (για παράδειγμα κορτιζόλη), αλατοκορτικοειδή (για παράδειγμα αλδοστερόνη), ορμόνες του φύλου (δηλαδή ανδρογόνα,

Διαβάστε περισσότερα

Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα

Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα ΣτονΣτον ρόλο των διαφόρων οµάδων των ριβοσωµικών πρωτεινών. Κατά πόσο δηλαδή υπάρχει ετερογένεια στις

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 1 ο Θέμα 1.α 2.β 3.δ 4.γ 5.γ 2 ο Θέμα A. Να απαντήσετε στις παρακάτω ερωτήσεις: i)τι είναι το οπερόνιο της λακτόζης και

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων.

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Αθήνα, 27/05/2016 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. δ A2. γ A3.

Διαβάστε περισσότερα

Κυτταρα ζυμομύκητα αποκρίνονται σε σήμα ζευγαρώματος

Κυτταρα ζυμομύκητα αποκρίνονται σε σήμα ζευγαρώματος Κυτταρα ζυμομύκητα αποκρίνονται σε σήμα ζευγαρώματος Στους πολυκύτταρους οργανισμούς οι θεμελιώδεις κυτταρικές λειτουργίες εξαρτώνται από σύνθετα σηματοδοτικά μονοπάτια Κυτταρική επικοινωνία Τύποι επικοινωνίας

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β. Σωστό το β

ΘΕΜΑ Α ΘΕΜΑ Β. Σωστό το β ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και, δίπλα, το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις 2016

Πανελλαδικές εξετάσεις 2016 Θέμα Α Α1: β Α2: β Α3: δ Α4: γ Α5: γ Θέμα Β Πανελλαδικές εξετάσεις 2016 Ενδεικτικές απαντήσεις στο μάθημα «ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ» Β1. 1:Α, 2:Γ, 3:Α, 4:Β, 5:Α, 6:Α, 7:Γ Β2. Σχολ. Βιβλ. Κεφ.1, σελ. 24

Διαβάστε περισσότερα

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr Τ: 2221-300524 & 6937016375 Προς: Μαθητές Α, Β & Γ Λυκείου / Κάθε ενδιαφερόμενο Αγαπητοί Φίλοι Όπως σίγουρα γνωρίζετε, από τον Ιούνιο του 2010 ένα νέο «ΔΙΑΚΡΟΤΗΜΑ» λειτουργεί και στη Χαλκίδα. Στο Φροντιστήριό

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ!

ΜΕΤΑΓΡΑΦΗ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ! ΜΕΤΑΓΡΑΦΗ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ! 14/03/2014! Καθηγητής Δρ. Κωνσταντίνος Ε. Βοργιάς! 1! 1.Ποιά είναι τα διάφορα είδη RNA 2.Ποιά είναι τα στάδια της µεταγραφής 3.Μεταγραφική ωρίµανση RNA 4.Ποιά είναι η ενζυµολογία

Διαβάστε περισσότερα

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους Για να εξασφαλιστεί η σωστή και αρμονική έκφραση των ενζύμων μέσα στο κύτταρο χρειάζεται ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. και Η εναρμόνιση αυτή επιτυγχάνεται με διάφορους τρόπους

Διαβάστε περισσότερα

EΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1,2,4,9 ΚΕΦΑΛΑΙΑ. Εξεταζόμενο μάθημα. Συκούδη Κωνσταντίνα. Διδάσκων/επιβλέπων καθηγήτρια

EΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1,2,4,9 ΚΕΦΑΛΑΙΑ. Εξεταζόμενο μάθημα. Συκούδη Κωνσταντίνα. Διδάσκων/επιβλέπων καθηγήτρια EΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1,2,4,9 ΚΕΦΑΛΑΙΑ Εξεταζόμενο μάθημα Συκούδη Κωνσταντίνα Διδάσκων/επιβλέπων καθηγήτρια 3:00 ώρες Διάρκεια εξέτασης Ονοματεπώνυμο εξεταζόμενου Όνομα:

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 05 : Η μεταγραφή του DNA και η ρύθμισή της. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ

Κυτταρική Βιολογία. Ενότητα 05 : Η μεταγραφή του DNA και η ρύθμισή της. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 05 : Η μεταγραφή του DNA και η ρύθμισή της Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1. Α, 2. Γ, 3. Α, 4. Β, 5. Α, 6. Α, 7. Γ Β2. Καρυότυπος είναι η απεικόνιση των µεταφασικών χρωµοσωµάτων ενός

Διαβάστε περισσότερα

Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη

Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη (αδρεναλίνη) ευνοούν τη β-οξείδωση και την κινητοποίηση

Διαβάστε περισσότερα