Association study of Calpain-10 gene polymorphisms and essential hypertension *

Μέγεθος: px

Εμφάνιση ξεκινά από τη σελίδα:

Download "Association study of Calpain-10 gene polymorphisms and essential hypertension *"

Μιλτιάδης Κοσμόπουλος
5 χρόνια πριν
Προβολές:

1 19 10 Vol. 19 No China Journal of Modern Medicine May * SNPs PCR - R FLP - 10 SNP- 43 SNP- 19 SNP- 63 SNP - 43G/ G SNP- 63 C C- 111/ SNP- 43 SNP- 19 SNP SNP R A Association study of Calpain-10 gene polymorphisms and essential hypertension * ZHAO Hong, FU Xiaohua, YUAN Shishan, ZHANG Na, ZHANG Yong, LV Yuan, HE Quanfeng, ZHANG Jing (College of Medicine, Hunan Normal University, Changsha, Hunan , P.R.China) Abstract: Objective The aim of this study was to analyze the association of calpain-10 gene single nucleotide polymorphisms (SNPs) with essential hypertension and the related traits in sample in Changsha region. Methods The SNP-43, SNP-19 and SNP-63 of calpain-10 gene were genotyped by using PCR-RFLP. Results The SNPs and their major haplotype combinations were not significantly associated with essential hypertension. However, SNP- 43 G/G haplotype was associated with lower values of total-cholesterol and the C allele of SNP-63 was associated with higher values of C-peptide in normal controls. In addition, haplotype combination 111/121 was associated with higher values of fasting glucose in study cases and lower values of LDL- cholesterol in normal controls. Conclusions SNP-43, SNP-19, SNP-63 and their major haplotype combinations of calpain-10 gene may not play a major role in the genetic susceptibility to essential hypertension in population of Changsha region, but may involve in fat and glucose metabolisms and influence insulin sensitivity. Key words: calpain-10 gene; essential hypertension; single-nucleotide polymorphism (SNP); insulin sensitivity - 10 [1~5] SNP- 43 SNP- 19 SNP * 2004CCA003AA- 1 03JJY6010 [ ] fuxh1@126.com 1479

2 ~ BMI WHR 1999 C- A1c ~71 56 mmol/l pmol/l 53 / t P < t P < BMI / kg/m 2 WHR mmol/l C- pmol/l ng/ml % n = ± / ± ± ± ± ± ± ±1.14 n = ± / ± ± ± ± ± ± ± mmhg 1 mmhg 2 mmol/l mmol/l mmol/l mmol/l n =40 150±15 97±16 5.0± ± ± ± ±0.54 n =53 110±15 73±10 4.6± ± ± ± ± DNA 5'- GCTGGCTGGTGACATCAGTGC- 3' 5'- AC 2 ml CAAGTCAAGGCTTAGCCTCACCTTCATA- 3' - DNA PCR PCR DNA PCR SNP- 19 CAPN10- g. 7920inde l32 bp 5'- GTTTG- GTTCTCTTCAGCGTGGAG- 3' 5'- CATGAACC bp CTGGCAGGGTCTAAG- 3' 155 bp PCR 25μL DNA 187 bp ng 10 mmol/ltris- HCL ph mmol/l KCL SNP- 63 PCR 6 IU HhaI 2.5 mmol/l MgCl 2 200μl/L dntp 400 NEB 37 SNP- 63 PCR pmol/l 1.25 IUTaq PCR 1 C 162 bp 30 bp min s s s 35, min SNP- 63 CAPN10- g.16378c/t, 5'- AAGGGGGGCCAGGGCCTGACGGGGGTGG CG- 3' 5'- AGCACTCCCAGCTCCTGATC- 3' SNP- 43 PCR 10 IU NdeI PCR NEB 37 3% SNP- 19 PCR 94 12, min s s s 35, 1 G 2 A min 1480 SNP- 43 CAPN10- g.4852g/a SNP SNP- 19 PCR 3% DNA 2 T 192 bp DNA 3% 2 bp 208 bp DNA 3

10-10 1 20 bp DNA Marker 2 5 2/2 3 1/1 4 6 1/2 1 SNP- 19 1.3 SPSS 13.0 ± x±s t χ 2 Hardy- Weinberg χ 2 ANOVA LSD P 0.05 7 50 bp DNA Marker 1 3 6 C/C 2 4 T/T 5 C/T 2 SNP- 63 P =0.

3 bp DNA Marker 2 5 2/2 3 1/ /2 1 SNP SPSS 13.0 ± x±s t χ 2 Hardy- Weinberg χ 2 ANOVA LSD P bp DNA Marker C/C 2 4 T/T 5 C/T 2 SNP- 63 P = bp DNA Marker 1 4 G/A G/G SNP SNP % Hardy- Weinberg / / / % 12.5% 32.5% 22.6% 17.0% 30.2% SNP G/G G/A SNP- 43 SNP- 43 SNP- 19 SNP- 19SNP- 63 SNP- 63 GG GA+AA G A 1/1 1/2 2/2 1 2 C/C C/T T/T C T P BMI kg/m 2 WHR C- SNP- 43 (mmhg) (mmhg) mmol/l (mmol/l (mmol/l) (mmol/l) (mmol/l) GG ± ± ± ± ± ± ± ±13 96±14 4.9± ± ± ± ±0.49 GA+AA ± ± ± ± ± ± ± ±19 101±24 5.1± ± ± ± ±0.73 P NS NS NS NS NS NS NS NS NS NS NS NS NS NS GG ± ± ± ± ± ± ± ±15 72±10 4.4± ± ± ± ±0.50 GA+AA ± ± ± ± ± ± ± ±17 75±10 5.6± ± ± ± ±0.29 P NS NS NS NS NS NS NS NS NS NS NS NS NS NS 1481

4 19 SNP / /121 C/C T/T C- P =0.020 P = SNP ANOVA LSD CC TT P =0.044 NS 111/ / BMI kg/m 2 WHR 5 3 C- (mmhg) (mmhg) mmol/l (mmol/l(mmol/l) (mmol/l) (mmol/l) 121/ ± ± ± ± ± ± ± ±11 95±9 5.0± ± ± ± ±0.46 P NS NS a NS NS NS NS NS NS NS NS NS NS NS 111/ /122 3 P =0.007 BMI kg/m 2 WHR CC CT C ± ± ± ± ± ± ± ±16 95±16 5.0± ± ± ± ± ± ± ± ± ±16 97±18 4.9± ± ± ± ± ± ± ± ± ±6 89±6 5.2± ± ± ± ± ± ± ± ± ±21104±26 4.7± ± ± ± ± ± ± ± ± ±13 71±9 4.0± ± ± ± ± ± ± ± ± ±12 75±9 4.5± ± / / /121 (mmhg) (mmhg) mmol/l (mmol/l (mmol/l) (mmol/l) (mmol/l) TT ± ± ± ± ± ± ± ±4 108±14 4.4± ± ± ± ±0.05 P NS VS NS NS NS NS NS NS NS NS NS NS NS NS CC CT ± ± ± ± ± ± ± ±15 73±10 4.6± ± ± ± ± ± ± ± ± ±13 74±9 4.5± ± ± ± ± ±0.5 TT ± ± ± ± ± ± ± ±14 68±10 4.5± ± ± ± ±0.13 P NS VS NS NS NS NS NS NS NS NS NS NS NS 1.4± ± ± ± ± ± ± ± ± ± ± ± / ± ± ± ± ± ± ± ±17 73±11 4.9± ± ± ± ±0.20 P NS NS NS NS NS NS NS NS NS NS NS NS b NS 0.81± ± ± ± ± ± ± ± a ANOVA LSD 111/ /122 P = / /121 P = b ANOVA LSD 111/ /121 P =0.007 NS 3 BAIER - 10 [7] - 10 SNP- 43 SNP- 43 SNP- 19 SNP- 63 G - 10 mrna - 10 LOPEZ- ORDUNA [8] 2 [6] SNP- 43 G - 10 SNP- 43G/G - 10 mrna SNP- 43 G 111/

5 10-10 [1] SOWERS JR. Insulin resistance and hypertension[j]. Am J Phys- iol Heart Circ Physiol, 2004, 286(5): H HORIKAWA [9] [4] SONI AM, PINGITORE A, GHIONE S, et al. Early hyperten- insulin resistance, epicardial, and visceral fat[j]. Hypertension, 2008, SNP- 43 SNP- 19 SNP /121 2 KANG [J]. Lancet, 2007, 370(9587): [10] 111/121 2 KANG [11] 2 sion is associated with reduced regional cardiac function, 111/121 (2): [12 13] - 10 Chinese Journal of Medicine, 2002, 41(6): SNP - 43 G/G 111/121 ORHO- MELANDER [14] SNP- 43 G/G CARLSSON [15] Biochem Biophys Res Commun, 2007, 358(3): SNP- 43 G/G WU [16] 112/121 mellitus[j]. Nat Genet, 2000, 26(2): Hum Genet, 2006, 51(7): SNP- 63C/C T/T C- C/C 73(3): SNP- 63C/C T/T C- C , 89(4): (8): SNP- 43 SNP- 19 SNP- 63 expression in obese Swedish subjects [J]. Metab, 2004, 89(7): [2] REAVEN GM. Insulin resistance, the insulin resistance syndrome, and cardiovascular disease[j]. Panminerva Med,2005,47(4): [3] MESSERLI FH, WILLIAMS B, RITZ E. Essential hypertension [5] ZHANG Y, RONG J. Relationship of hemorheology changes, insulin resistance and macroangiopaothy in type 2 diabetes[j]. China Journal of Modern Medicine, 2008, 18(14): Chinese [6] HONG J, LI GW, LI CM, et al. Relationship between calpain- 10 gene polymorphism, hypertension and plasma glucose[j]. [7] BAIER LJ, PERMANA PA, YANG X, et al. A calpain- 10 gene polymorphism is associated with reduced muscle mrna levels and insulin resistance[j]. J Clin Invest, 2000, 106(7): R [8] LOPEZ- ORDUNA E, GARCíA- MENA J, GARCíA- MACEDO R, et al. CAPN10 mrna splicing and decay is not affected by a SNP associated with susceptibility to type 2 diabetes [J]. [9] HORIKAWA Y, ODA N, COX NJ, et al. Genetic variation in the gene encoding calpain- 10 is associated with type 2 diabetes [10] KANG ES, KIM HJ, NAM M, et al. A novel 111/121 diplotype in the Calpain- 10 gene is associated with type 2 diabetes[j]. J [11] KANG ES, NAM M, KIM HJ, et al. Haplotype combination of Calpain- 10 gene polymorphism is associated with metabolic syndrome in type 2 diabetes[j]. Diabetes Res Clin Pract, 2006, [12] HEGELE RA, HARRIS SB, ZINMAN B, et al. Absence of association of type 2 diabetes with CAPN10 and PC- 1 polymorphisms in Oji- Cree[J]. Diabetes Care, 2001, 24(8): [13] JENSEN DP, URHAMMER SA, EIBERG H, et al.variation in CAPN10 in relation to type 2 diabetes, obesity and quantitative metabolic traits: studies in 6018 whites [J]. Mol Genet Metab, [14] ORHO- MELANDER M, KLANNEMARK M, SVENSSON MK, et al. Variants in the calpain- 10 gene predispose to insulin resistance and elevated free fatty acid levels[j]. Diabetes, 2002, [15] CARLSSON E, FREDRIKSSON J, GROOP L, et al. Variation in the calpain- 10 gene is associated with elevated triglyceride levels and reduced adipose tissue messenger ribonucleic acid J Clin Endocrinol [16] WU B, TAKAHASHI J, FU M, et al. Variants of calpain- 10 gene and its association with type 2 diabetes mellitus in a Chinese population[j]. Diabetes Res Clin Pract,2005,68(2):

Σχετικά έγγραφα

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2 344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.