(Edwardsiella tarda) (Paralichthys olivaceus)tlr1 TLR2
|
|
- Όφελος Κορομηλάς
- 6 χρόνια πριν
- Προβολές:
Transcript
1 48 4 Vol.48, No OCEANOLOGIA ET LIMNOLOGIA SINICA Jul., 2017 (Edwardsiella tarda) (Paralichthys olivaceus)tlr1 TLR2 * , 2 1 ( ; ) Toll,,, TLR1 TLR2, PCR, TLR1 TLR2 (Edwardsiella tarda), (Paralichthys olivaceus), TLR1 TLR2,, TLR1, ; TLR2,, 6h TLR1,, (P<0.01) TLR2 1h, (P<0.01), 1d 14 (P<0.01), TLR1 TLR2,, MyD88 TNF-α IL-1, TLR1 MyD88, TNF-α IL-1, TLR1; TLR2; ; ; ; PCR S917.4 doi: /hyhz (Paralichthys olivaceus),,, (, 1999),,, (, 2010), Toll (Toll-like receptor, TLRs) (pattern recognition receptor, PRR),,, (, 2006;, 2008;, 2015), TLR1, TLR,,, TLR1 4, TLR1 TLR2 TLR6 *, 14JCZDJC34200,, liqingya0914@163.com :,, skygh@mail.tjnu.edu.cn : , :
2 4 : (Edwardsiella tarda) (Paralichthys olivaceus)tlr1 TLR2 849 TLR10 (Roach et al, 2005) TLR6 TLR10,, TLR20 TLR21 TLR22 TLR23 (Gao et al, 2013) TLR1 TLR2,,, ;, ;, (Edwardsiella tarda),,,, E. tarda TLR1 cdna (Wu et al, 2012), TLR1 TLR2, PCR, TLR1 TLR , 10 12cm,, (17 18)(20±2)ºC (Wu et al, 2012;, 2015),,, 1.1.2,, 1.2 实验方法 LB (ph=7), 37ºC, 6000r/min 2min, PBS,, PBS, 10 7 CFU/mL 1.2.2, 100μL,, PBS 100μL, 0h, 1h, 3h, 6h, 12h, 1d, 3d, 6d, 3, RNA, mg,, 1mL Trizol RNA, 12000r/min, 4ºC 10min,, 5min, 200μL, 15s, 5min, 12000r/min, 4ºC, 15min,, 500 ml,, 10min, 12000r/min, 4ºC, 10min,,, 1mL 75%, 7500r/min, 4ºC, 5min,, 20μL DEPC, 55ºC, 5min, 80ºC cdna Sangon Biotech cdna,, TLR1 TLR2 cdna : RNA 2μg, (0.2μg/μL) 1μL, RNase free ddh 2 O, 5 Reaction Buffer 4μL, dntp Mix (10mmol/L) 2μL, RNase Inhibitor (20U/μL) 1μL, M-MuLV RT (200U/μL) 1μL, 20μL ABI 7500 PCR, cdna, Promega GoTaq qpcr Master Mix, cdna 4μL, (10μmol/L) 0.4μL, (10μmol/L) 0.4μL, GoTaq qpcr Master Mix 10μL, Nuclease-Free Water 9.2μL 24μL, 3, 2 ΔΔCT, Origin 8 1 表 1 Real-Time RT-PCR 所使用的各基因特异性引物 Tab.1 The specific primers of each gene used for Real-Time RT-PCR (5 3 ) TLR1-F TLR1-R TLR2-F TLR2-R MyD88-F MyD88-R TNF-F TNF-R IL-1-F IL-1-R β-actin-f β-actin-r TCCGCACTTCTCATCTTTAT' ATTTCACCACAGCCCTTC ACTTCCTTCCTGGACACTG' TCGTAGCGGCACCAATCA GTGACCCAGAGCCAACT CAACTTACCAGGACAGAGG CAGGGTATGGCTCTTCACG CCCAGGTAGATGGCATTGTA AGCAGCAACCGCAAAGT' TGTAGAACAGAAATCGCACC' AGGTTCCGTTGTCCCG TGGTTCCTCCAGATAGCAC
3 TLR1 TLR2 TLR1 TLR2 TLR1,, 1; TLR2,, 2 1h, TLR1, 90 (P<0.01), 6h,,, 290 (P<0.01), TLR1, 4, 6h, TLR1, 20 (P<0.01) 11 (P<0.01) 8.5 (P<0.01), 5 6 7,, 1h,, 4.5 (P<0.05), 3h, TLR1, 9 (P<0.01), 8 TLR2, 1 TLR1 Fig.1 Relative expression of P. olivaceus TLR1 in various tissues 3 TLR1 TLR2 E. tarda Fig.3 Relative expression of P. olivaceus TLR1 and TLR2 in the heart after infection by E. tarda 2 TLR2 Fig.2 Relative expression of P. olivaceus TLR2 in various tissues 2.2 TLR1 TLR2 TLR1, 6h, TLR1,, 6h, 5.8,, 1d, 9.8 (P<0.01) 3, (P<0.05) (P<0.01) * ** TLR1, 4 TLR1 TLR2 E. tarda Fig.4 Relative expression of P. olivaceus TLR1 and TLR2 in the spleen after infection by E. tarda
4 4 : (Edwardsiella tarda) (Paralichthys olivaceus)tlr1 TLR TLR1 TLR2 E. tarda Fig.5 Relative expression of P. olivaceus TLR1 and TLR2 in the head kidney after infection by E. tarda,, ( 9), TLR2, 1h,, 24 (P<0.01),,, TLR2 6h, 4 (P<0.05), 1d,, 14.5 (P<0.01), TLR2, 3h, TLR2, 8.5 (P<0.01),, 0 6 TLR1 TLR2 E. tarda Fig.6 Relative expression of P. Olivaceus TLR1 and TLR2 in the intestine after infection by E. tarda 8 TLR1 TLR2 E. tarda Fig.8 Relative expression of P. olivaceus TLR1 and TLR2 in the gill after infection by E. tarda 7 TLR1 TLR2 E. tarda Fig.7 Relative expression of P. Olivaceus TLR1 and TLR2 in the muscle after infection by E. tarda 9 TLR1 TLR2 E. tarda Fig.9 Relative expression of P. olivaceus TLR1 and TLR2 in the liver after infection by E. tarda
5 852 48, TLR2, 3h,, 8.5 (P<0.01),, TLR2 6h,,, E. tarda TLR1 TLR2 10 TLR1 TLR2 TLR1, TLR2 10 E. tarda TLR1(A) TLR2(B) Fig.10 Relative expression of P. olivaceus TLR1 (A) and TLR2 (B) in various tissues after infection by E. tarda in different durations 2.3 MyD88 MyD88 (myeloid differentiation factor 88), TLR, TLR (, 2010), TLR, TLR3 (Bonnert et al, 1997; Akira et al, 2006) MyD88 TLR, IRAK MyD88 TRAF6, NF-KB, MAPK JNK, TNF, MyD88, MyD88,, MyD88, 3h, 18 (P<0.01),,, MyD88 6h, 12 (P<0.01),, 1d, 6.5 (P<0.01), 3h MyD88, 10 (P<0.01); 3d,, 10.5 (P<0.01) E. tarda MyD88 Fig.11 Relative expression of P. olivaceus MyD88 after infection by E. tarda : A. ; B. ; C.
6 4 : (Edwardsiella tarda) (Paralichthys olivaceus)tlr1 TLR TNF-α IL-1,, (, 2010) (TNF) (IL) (INF), TNF-α IL-6 IL-1β IL-8 TLRs, TNF-α IL-1 (tumor necrosis factor, TNF), /,,,, TNF (, 2013),,,,,, TNF-α, 1h, 300 (P<0.01),,, TNF-α 1h, 400 (P<0.01),, 1h, 130 (P<0.01); 6h, TNF-α 225 (P<0.01) (interleukin, IL) IL-1,, IL-1,,, IL-1, 1h, 305 (P<0.01); 6h, 370 (P<0.01),,, IL-1 1h,, 75 (P<0.01),, 6h,, 30 (P<0.01) TNF-α IL-1 E. tarda Fig.12 Relative expression of P. olivaceus TNF-α and IL-1 after infection by E. Tarda : A. ; B. ; C. 3 Toll,, TLR1,, TLR1 (Wu et al, 2008), (Wu et al, 2008; Palti et al, 2010; Rebl et al, 2010) TLR2 TLR, TLR2 MyD88, (Li et al, 2016) TLR2 TLR1 TLR6, (pathogen associated molecular patterns, PAMPs) (Fan et al, 2015),
7 854 48,,, TLR1 TLR2,, TLR1 TLR2, (Jault et al, 2004; Meijer et al, 2004), : TLR1 (Wu et al, 2008); TLR1, (Palti et al, 2010); Poly(I:C),, TLR1 TLR2 (Wei et al, 2011);, TLR2, (Baoprasertkul et al, 2007),, TLR1 TLR2,, TLR1 TLR2 (, 2009) PCR,, 7, TLR1 TLR2, TLR1, ; TLR2,, TLR1 TLR2,, 9, TLR1 (Wei et al, 2011), TLR1 8,, (Wu et al, 2008), TLRs, TLR1 TLR2, TLR1,, TLR1 TLRs MyD88,, MyD88 TLR1, TLR1 MyD88, TNF-α IL-1,, TLRs, TLR (, 2010), TLR20 TLR21 TLR22 TLR23(Wu et al, 2012),, TLR21 (Li et al, 2012; Gao et al, 2013; Yeh et al, 2013;, 2015), TLR TLRs PAMP, TLR3 TLR22 (Matsuo et al, 2008), TLR5 TLR5s (Tsujita et al, 2004), (, 2012) TLR5 TLR5s ; TLR21, TLR9 (Oshiumi et al, 2003; Meijer et al, 2004; Ishii et al, 2007), TLR6 TLR10, TLR1 TLR2 TLR10 TLR6 (, 2011), (Roach et al, 2005), TLR1 TLR2 TLR6 TLR10,,, Toll, Toll (Wu et al, 2012);,, TLRs,,,,, , (10): 50 51,, Toll (TLRs)., 33(9): ,,, Toll., 29(2): 56 60, :
8 4 : (Edwardsiella tarda) (Paralichthys olivaceus)tlr1 TLR2 855, TLR1 TLR2 MyD88. :, , 45(5): 21 25,,, Toll., 31(8): 40 43,,, TLR5 TLR5S., 33(05): 30 38,,, (Paralichthys olivaceus)tlr21 (Edwardsiella tarda)., 46(6): ,,, Toll., 39(1): ,, TLR21., 38(3): , Toll 4. :,,, , 8(3): Akira S, Uematsu S, Takeuchi O et al, Pathogen recognition and innate immunity. Cell, 124(4): Baoprasertkul P, Peatman E, Abernathy J et al, Structural characterisation and expression analysis of toll-like receptor 2 gene from catfish. Fish & Shellfish Immunology, 22(4): Bonnert T P, Garka K E, Parnet P et al, The cloning and characterization of human MyD88: a member of an IL-1 receptor related family. FEBS Letters, 402(1): Fan Z J, Jia Q J, Yao C L, Characterization and expression analysis of Toll-like receptor 2 gene in large yellow croaker, Larimichthys crocea. Fish & Shellfish Immunology, 44(1): Gao H, Wu L, Sun J S et al, Molecular characterization and expression analysis of Toll-like receptor 21 cdna from Paralichthys olivaceus. Fish & Shellfish Immunology, 35(4): Ishii A, Kawasaki M, Matsumoto M et al, Phylogenetic and expression analysis of amphibian Xenopus Toll-like receptors. Immunogenetics, 59(4): Jault C, Pichon, Chluba J, Toll-like receptor gene family and TIR-domain adapters in Danio rerio. Molecular Immunology, 40(11): Li X P, Sun L, Toll-like receptor 2 of tongue sole Cynoglossus semilaevis: signaling pathway and involvement in bacterial infection. Fish & Shellfish Immunology, 51: Li Y W, Luo X C, Dan X M et al, Molecular cloning of orange-spotted grouper (Epinephelus coioides) TLR21 and expression analysis post Cryptocaryon irritans infection. Fish & Shellfish Immunology, 32(3): Matsuo A, Oshiumi H, Tsujita T et al, Teleost TLR22 recognizes RNA duplex to induce IFN and protect cells from birnaviruses. The Journal of Immunology, 181(5): Meijer A H, Gabby Krens S F, Medina Rodriguez I A et al, Expression analysis of the Toll-like receptor and TIR domain adaptor families of zebrafish. Molecular Immunology, 40(11): Oshiumi H, Tsujita T, Shida K et al, Prediction of the prototype of the human Toll-like receptor gene family from the pufferfish, Fugu rubripes, genome. Immunogenetics, 54(11): Palti Y, Rodriguez M F, Gahr S A et al, Identification, characterization and genetic mapping of TLR1 loci in rainbow trout (Oncorhynchus mykiss). Fish & Shellfish Immunology, 28(5 6): Rebl A, Goldammer T, Seyfert H M, Toll-like receptor signaling in bony fish. Veterinary Immunology and Immunopathology, 134(3 4): Roach J C, Glusman G, Rowen L et al, The evolution of vertebrate Toll-like receptors. Proceedings of the National Academy of Sciences of the United States of America, 102(27): Tsujita T, Tsukada H, Nakao M et al, Sensing bacterial flagellin by membrane and soluble orthologs of Toll-like receptor 5 in rainbow trout (Onchorhynchus mikiss). The Journal of Biological Chemistry, 279(47): Wei Y C, Pan T S, Chang M X et al, Cloning and expression of Toll-like receptors 1 and 2 from a teleost fish, the orange-spotted grouper Epinephelus coioides. Veterinary Immunology and Immunopathology, 141(3 4): Wu L, Sun J S, Geng X Y et al, Molecular cloning and expression analysis of Toll-like receptor 1 cdna in Japanese flounder, Paralichthys olivaceus. Agricultural Science & Technology, 13(12): Wu X Y, Xiang L X, Huang L et al, Characterization, expression and evolution analysis of Toll-like receptor 1 gene in pufferfish (Tetraodon nigroviridis). International Journal of Immunogenetics, 35(3): Yeh D W, Liu Y L, Lo Y C et al, Toll-like receptor 9 and 21 have different ligand recognition profiles and cooperatively mediate activity of CpG-oligodeoxynucleotides in zebrafish. Proceedings of the National Academy of Sciences of the United States of America, 110(51):
9 EXPRESSION OF TLR1 AND TLR2 GENES OF JAPANESE FLOUNDER PARALICHTHYS OLIVACEUS INDUCED BY EDWARDSIELLA TARDA LI Qing-Ya 1, ZHOU Mi 1, ZHANG Jie 1, ZHENG Jin-Hui 1, GENG Xu-Yun 2, PAN Bao-Ping 1, SUN Jin-Sheng 1, 2, GAO Hong 1 (1. Tianjin Key Laboratory of Animal and Plant Resistance, College of Life Sciences, Tianjin Normal University, Tianjin , China; 2. Tianjin Aquaculture Disease Prevention & Treatment Center, Tianjin , China) Abstract Toll-like receptors (TLRs) are a class of proteins that play an important role in the innate immunity. Toll-like receptor 1 (TLR1) forms a heterodimer with Toll-like receptor 2 (TLR2) to recognize lipopeptides of pathogenic bacteria and initiate host innate immunity system. We detected the mrna levels of TLR1 and TLR2 in various tissues of healthy or Edwardsiella tarda induced Japanese flounder Paralichthys olivaceus by quantitative real time reverse transcription-pcr (RT-qPCR) and discussed the roles of TLR1 and TLR2 in the innate immunity of P. olivaceus. The results indicate that TLR1 and TLR2 were widely expressed in various tissues of healthy P. olivaceus. The highest expression level of TLR1 was observed in spleen, followed by heart, muscle, liver, intestine, gills, and head kidney, and that of TLR2 in intestine, followed by liver, heart, muscle, gills, and spleen. Immunostimulation test shows that TLR1 transcript peaked in level 6h after E. tarda challenge in most tissues; the highest expression level soared to 92.2 fold increase (P<0.01) from that of the initial point in the spleen. Similarly, TLR2 transcript topped in 1h in the spleen for a 17.8 fold increase (P<0.01), and 14 fold increase (P<0.01) in the heart; and then the TLR2 expression stayed. These facts suggest that the TLR1 and TLR2 genes were involved in immune response to E. tarda infection. In addition, expressions of MyD88, TNF-α, and IL-1 genes were up-regulated after E. tarda challenge. Therefore, we believe that E. tarda could up-regulate MyD88 expression via TLR1 pathway and up-regulate ultimately the expression of inflammatory factors TNF-α and the IL-1 genes against pathogen infection. Key words TLR1; TLR2; Paralichthys olivaceus; Edwardsiella tarda; expression; real-time PCR
IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2
344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.
The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea
2011 48 4 909 914 * 1 2** 2 2 2 2 2*** 1. 110161 2. 100081 026000 3 Calliptamus italicus L. 3 LC 50 LC 90 1. 34 14. 17 mg / L LC 50 LC 90 2. 09 45. 22 mg / L 50 mg / L 14 d 87% 100% 50 mg / L 50% The toxicity
Contents Part I Psychoneuroimmunology and Systems Biology Mechanisms 1 From Psychoneuroimmunology to Personalized, Systems, and Dynamical Medicine
Contents Part I Psychoneuroimmunology and Systems Biology Mechanisms 1 From Psychoneuroimmunology to Personalized, Systems, and Dynamical Medicine... 3 1.1 Psychoneuroimmunology (PNI) and Systems Biology...
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN
BIOTECHNOLOGY BULLETIN 2011 3 α 1 2-300457 PCR Helicobacter pylori HP DNA α 1 2- α 1 2-fucosyltransferase α 1 2-fuct 906 bp pet-22b + pet-fuct BL21 DE3 25 0. 1 mmol /L IPTG 4 h SDS-PAGE 33 kd α 1 2- BL21
Τα ηπατικά επίπεδα του FOXP3 mrna στη χρόνια ηπατίτιδα Β εξαρτώνται από την έκφραση των οδών Fas/FasL και PD-1/PD-L1
Τα ηπατικά επίπεδα του FOXP3 mrna στη χρόνια ηπατίτιδα Β εξαρτώνται από την έκφραση των οδών Fas/FasL και PD-1/PD-L1 Γ. Γερμανίδης, Ν. Αργέντου, Θ. Βασιλειάδης, Κ. Πατσιαούρα, Κ. Μαντζούκης, A. Θεοχαρίδου,
Cellular Physiology and Biochemistry
Original Paper 2016 The Author(s). 2016 Published The Author(s) by S. Karger AG, Basel Published online: November 25, 2016 www.karger.com/cpb Published by S. Karger AG, Basel 486 www.karger.com/cpb Accepted:
TGFp FSH INH INH
(210095) E-mail ( genlinwang@hotmail.com) - -(Strept Avidin-Biotin-Peroxidase Complex SABC), 1 32,, 1 inhibin INH α 32 000 TGFp FSH FSH [1] INHα Sertoli Noguchi 1997 [2] Meunier et al.1988 [3] INH INH
Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology
2012 34 2 382-387 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com 212018 105 W 42 2 min 0. 631 TS202. 3 A 1000-2286 2012 02-0382 - 06 Optimizing
(Vibrio anguillarum) (Cyclina sinensis) *
43 4 Vol.43, No.4 2012 7 OCEANOLOGIA ET LIMNOLOGIA SINICA July, 2012 (Vibrio anguillarum) (Cyclina sinensis) * ( 300387) (GSTs), SMART cdna, σ (CsGSTS) PCR CsGSTS, CsGSTS cdna 793bp, 206, GST-N GST-C GSTs
(Fenneropenaeus chinensis)
3 1 2 1 1 2 (1. 266071 2. 266003) (Fenneropenaeus chinensis) MCP-KP 3 C 16.38e -2.58t 0.32e -0.1t C 18.7e -2.57t 0.26e -0.12t C 15.08e 1.49t +0.65e -0.09t 15.74e 10.38t (t (1/2)α ) 0.269,0.270 0.465 h
Journal of the CUN(Natural Sciences Edition) ...
2007 2 16 1 ( ) Journal of the CUN(Natural Sciences Edition) Feb. 2007 Vol. 16 No. 1 1,2, 1, 1, 2 (11, 100081 ; 21, 100875) :. 2,42D NAA 62BA.,.. : ; ; ; :Q94513 :A :100528036 (2007) 0120023206 : (1),
Chinese Bulletin of Life Sciences. ZHENG Jie
19 1 2007 2 Chinese Bulletin of Life Sciences Vol. 19, No. 1 Feb., 2007 1004-0374(2007)01-0015-06 TLRs 210009 To11 To11 To11 To11 R730.3 A Toll-like receptors, chronic inflammation and cancer ZHENG Jie
Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού
Σχολή Θετικών Επιστημών Τμήμα Βιολογίας Πρόγραμμα Μεταπτυχιακών Σπουδών Κατεύθυνση: Εφαρμοσμένη γενετική και βιοτεχνολογία ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου
Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
33 2 2011 4 Vol. 33 No. 2 Apr. 2011 1002-8412 2011 02-0096-08 1 1 1 2 3 1. 361005 3. 361004 361005 2. 30 TU746. 3 A Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
30s 56 60s 72 60s dntp cm s s s 23
31 3 Vol 31 No 3 2012 8 JOURNAL OF OCEANOGRAPHY IN TAIWAN STRAIT Aug 2012 AFLP 1 1 2 1 1 361005 2 361005 dntp Taq Mg 2 + 300 ng DNA 5U PstI 5U MseI 4 h 16 10 50 AFLP AFLP 64 12 AFLP DOI 10 3969 /J ISSN
Q L -BFGS. Method of Q through full waveform inversion based on L -BFGS algorithm. SUN Hui-qiu HAN Li-guo XU Yang-yang GAO Han ZHOU Yan ZHANG Pan
3 2015 12 GLOBAL GEOLOGY Vol. 3 No. Dec. 2015 100 5589 2015 0 1106 07 L BFGS Q 130026 Q 2D L BFGS Marmousi Q L BFGS P631. 3 A doi 10. 3969 /j. issn. 1005589. 2015. 0. 02 Method of Q through full waveform
1 (forward modeling) 2 (data-driven modeling) e- Quest EnergyPlus DeST 1.1. {X t } ARMA. S.Sp. Pappas [4]
212 2 ( 4 252 ) No.2 in 212 (Total No.252 Vol.4) doi 1.3969/j.issn.1673-7237.212.2.16 STANDARD & TESTING 1 2 2 (1. 2184 2. 2184) CensusX12 ARMA ARMA TU111.19 A 1673-7237(212)2-55-5 Time Series Analysis
CorV CVAC. CorV TU317. 1
30 8 JOURNAL OF VIBRATION AND SHOCK Vol. 30 No. 8 2011 1 2 1 2 2 1. 100044 2. 361005 TU317. 1 A Structural damage detection method based on correlation function analysis of vibration measurement data LEI
ΓΕΝΙΚΕΣ ΑΡΧΕΣ ΑΝΟΣΟΠΑΘΟΓΕΝΕΙΑΣ ΣΤΗ ΣΗΨΗ
5 ο ΠΑΝΕΛΛΗΝΙΟ ΣΥΝΕΔΡΙΟ ΕΛΛΗΝΙΚΗΣ ΕΤΑΙΡΕΙΑΣ ΑΙΜΑΦΑΙΡΕΣΗΣ ΓΕΝΙΚΕΣ ΑΡΧΕΣ ΑΝΟΣΟΠΑΘΟΓΕΝΕΙΑΣ ΣΤΗ ΣΗΨΗ Θωμάς Τσαγανός, MD, PhD Πανεπιστημιακός Υπότροφος Δ Παθολογική Κλινική Πανεπιστημιακό Γενικό Νοσοκομείο
Antimicrobial Ability of Limonene, a Natural and Active Monoterpene
2010,32 (1) :24 28 http :/ / xuebao. jlau. edu. cn Journal of Jilin Agricultural University E2mail : jlndxb @vip. sina. com Ξ,,,, ΞΞ, 200062 : : 320 mg/ L,; ph 4 9, ; 80, 100,121 : : ; ; : TS20213 : A
Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic
Supporting Information Asymmetric Binary-acid Catalysis with Chiral Phosphoric Acid and MgF 2 : Catalytic Enantioselective Friedel-Crafts Reactions of β,γ- Unsaturated-α-Ketoesters Jian Lv, Xin Li, Long
Differences in Contents of Neutral Aroma Components and Sensory Evaluation in Air-cured Burley Leaves from Different Curing Barns
2 0 1 0 25 3 1 13-1 1 7 1 2 2 1 1 2 2 1. 450002 2. 635000 6 > > > > > > > > > > > > > > > S572 A 1000-7091 2010 03-0113 - 05 Differences in Contents of Neutral Aroma Components and Sensory Evaluation in
Shiraia sp. Slf14 III
39 4 Vol 39 No 4 2015 7 Journal of Jiangxi Normal University Natural Science Jul 2015 1000-5862 2015 04-0430-05 Shiraia sp Slf14 III 1 1 2 1 1 1 2* 1 330022 2 330013 Polyketide synthase PKS Shiraia sp
ER-Tree (Extended R*-Tree)
1-9825/22/13(4)768-6 22 Journal of Software Vol13, No4 1, 1, 2, 1 1, 1 (, 2327) 2 (, 3127) E-mail xhzhou@ustceducn,,,,,,, 1, TP311 A,,,, Elias s Rivest,Cleary Arya Mount [1] O(2 d ) Arya Mount [1] Friedman,Bentley
Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis
HPLC * 271016 HPLC - DAD DiamonsilC 18 250 mm 4. 6 mm 5 μm - -1% 370 nm 1. 0 ml /min 40 R282. 7 A 1001-1528 2011 01-0001-05 Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus
HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332
,**1 The Japanese Society for AIDS Research The Journal of AIDS Research +,, +,, +,, + -. / 0 1 +, -. / 0 1 : :,**- +,**. 1..+ - : +** 22 HIV AIDS HIV HIV AIDS : HIV AIDS HIV :HIV AIDS 3 :.1 /-,**1 HIV
1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.
2 0 1 5 7 Journal of Chinese Institute of Food Science and Technology Vol. 15 No. 7 Jul. 2 0 1 5 1,2 1 1 1 1* ( 1 315211 2 315502) : ( ) : (E-Nose), - : GC-MS, 20.98% 2.5%, 53.15% 11.2%, 0. 51% 71.86%
Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil
J. Jpn. Soc. Soil Phys. No. +*0, p.- +*,**1 Eh * ** Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil Daisuke MURAKAMI* and Tatsuaki KASUBUCHI** * The United Graduate
Christopher Stephen Inchley, 2015
Christopher Stephen Inchley, 2015 Series of dissertations submitted to the Faculty of Medicine, University of Oslo No. 2009 ISBN 978-82-8264-990-2 All rights reserved. No part of this publication may be
(Plecoglossus altivelis) /
46 6 Vol.46, No.6 2015 11 OCEANOLOGIA ET LIMNOLOGIA SINICA Nov., 2015 (Plecoglossus altivelis) -α (TNF-α) * ( 315211) -α(tumor necrosis factor-alpha, TNF-α) TNF, (Plecoglossus altivelis) /, TNF-α (PaTNF-α)
Supporting Information
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Supporting Information Crotonols A and B, Two Rare Tigliane Diterpenoid
8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,
31 2003 8 (FENXI HUAXUE) 8 Chinese Journal of Analytical Chemistry 976 980 22( 82 252 272 )21,82 23,62 3 (, 510631) 22(82 252 272 )21,82 23,62 (BSA), 8Q5SAC BSA 298K, 35 40 6. 1 10 5 LΠmol 8Q5SAC, ph =
Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water
31 1 2010 1 ENVIRONMENTAL SCIENCE Vol. 31,No. 1 Jan.,2010, 3, (,, 100084) :,.,, ( Microcystis aeruginosa),3 (A 2 O ) 10 6 ml - 1,> 0139 d - 1. A 2 O222,. TP ( K max ) ( R max ), Monod. :; ; ; ; :X173 :A
E#ects of Drying on Bacterial Activity and Iron Formation in Acid Sulfate Soils
J. Jpn. Soc. Soil Phys. No. 3+, p..3 /1,**, * ** ** E#ects of Drying on Bacterial Activity and Iron Formation in Acid Sulfate Soils Kaoru UENO*, Tadashi ADACHI** and Hajime NARIOKA** * The Graduate School
svari Real-time RT-PCR RSV
19 39-43 12 Real-time RS svarireal-time RSV subgroup HMPV RSV N Real-time 100 100 Real-time RSV subgroup RSV HMPV F Real-time 55.8 95.5 genotype A2 B1 TaqMan svari InfV RS RSV HMPV HRV PIV RSV HMPV RSV
CPT. Tsuchiya. beta. quantitative RT PCR QIAGEN IGFBP. Fect Transfection Reagent sirna. RT PCR RNA Affymetrix GeneChip Expression Array
7 PTEN p Tsuchiya DNA Hepatocyte nuclear factor beta HNF beta HNFbeta IGFBP GLUT G Pase MODY maturity onset diabetes of the young Tsuchiya HNFbeta HNFbeta HNFbeta sirna CPT HNFbeta HNFbeta TOVG KOC ESMCAS
College of Life Science, Dalian Nationalities University, Dalian , PR China.
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2018 Postsynthetic modification
MSM Men who have Sex with Men HIV -
,**, The Japanese Society for AIDS Research The Journal of AIDS Research HIV,0 + + + + +,,, +, : HIV : +322,*** HIV,0,, :., n,0,,. + 2 2, CD. +3-ml n,, AIDS 3 ARC 3 +* 1. A, MSM Men who have Sex with Men
Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2015 Supporting information An unusual bifunctional Tb-MOF for highly sensing
Electronic Supplementary Information DFT Characterization on the Mechanism of Water Splitting Catalyzed by Single-Ru-substituted Polyoxometalates
Electronic Supplementary Information DFT Characterization on the Mechanism of Water Splitting Catalyzed by Single-Ru-substituted Polyoxometalates Zhong-Ling Lang, Guo-Chun Yang, Na-Na Ma, Shi-Zheng Wen,
Arbitrage Analysis of Futures Market with Frictions
2007 1 1 :100026788 (2007) 0120033206, (, 200052) : Vignola2Dale (1980) Kawaller2Koch(1984) (cost of carry),.,, ;,, : ;,;,. : ;;; : F83019 : A Arbitrage Analysis of Futures Market with Frictions LIU Hai2long,
Nguyen Hien Trang* **
152 Nippon Shokuhin Kagaku Kogaku Kaishi Vol.., No.., +,+3 (,**1) 10 Nguyen Hien Trang* ** * Department of Food Science and Technology, Hue University of Agriculture and Forestry ** Properties of "Shishibishio
Identification of Fish Species using DNA Method
5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,
TLR2 expression in rats with Candida albicans infection in lung
337 Toll 2 110001 Toll 2 3 7 Toll 2 R 379. 4 A 1673-3827 2011 06-0337-04 expression in rats with Candida albicans infection in lung LIN Li WANG Li ZHOU Yang-yang CHEN Yao-hua MENG Xin-li KANG Jian Department
Supporting Information
Supporting Information Mitochondria-Targeting Polydopamine Nanocomposites as Chemophotothermal Therapeutics for Cancer Zhuo Wang *,, Yuzhi Chen, Hui Zhang, Yawen Li, Yufan Ma, Jia Huang, Xiaolei Liu, Fang
Journal of Ningxia Medical University. Annexin P19 mrna P < AnnexinA2 P19 mrna. AnnexinA2 P19 mrna. PCR 1.
33 6 2011 6 Journal of Ningxia Medical University 511 1674-6309 2011 06-0511 - 04 AnnexinA2 P19 1 2 3 3 3 1. 415700 2. 750004 3. 750004 AnnexinA2 P19 62 IHC RT - PCR Western blot AnnexinA2P19 mrna AnnexinA2
D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical and experimental study
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical
Αξιοποίηση Φυσικών Αντιοξειδωτικών στην Εκτροφή των Αγροτικών
Ζώων για Παραγωγή Προϊόντων Ποιότητας» 1 Αξιοποίηση Φυσικών Αντιοξειδωτικών στην Εκτροφή των Αγροτικών Ζώων για Παραγωγή Προϊόντων Ποιότητας Γεωπονικό Πανεπιστήμιο Αθηνών Εργαστήριο Ζωοτεχνίας MIS 380231
- A. A Biphenol A BPA BPA BPA LLE 5 SPE Electrospinning Kang. Packed-fiber solid-phase extraction PFSPE 1 ml
38 200 4 FENXI HUAXUE Chinese Journal of Analytical Chemistry 4 503 ~ 507 DOI 0. 3724 /SP. J. 096. 200. 00503 6 - A * 2 2 * 2 20009 2 20096 6 - A ph 6 0 ml ph 8. 0 3 ml /min. 5 mg 6 300 μl A 6 0. 20 ~
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity Jian-Long Li 1,a, Wei Zhao 1,a, Chen Zhou 1,a, Ya-Xuan
A/A Είδος Προδιαγραφές
A/A Είδος Προδιαγραφές 1 Κιτ για απομόνωση γενομικού DNA από διάφορους τύπους αρχικών δειγμάτων, όπως ιστούς, κύτταρα, βακτήρια, αίμα, buffy coat & ιούς. Κιτ για απομόνωση γενομικού DNA από διάφορους τύπους
Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin
2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,
DOI /SP. J Q 175 S 917. Larimichthys crocea HONMA 1. marmoratus. Ctenopharyngodon idellus
35 4 2011 4 JOURNAL OF FISHERIES OF CHINA Vol. 35 No. 4 Apr. 2011 1000-0615 2011 04-0604 - 10 DOI 10. 3724 /SP. J. 1231. 2011. 17164 12 1 2 1 2 2 2* 1. 361021 2. 361005 12 12 3 4 Q 175 S 917 A 13 9 HONMA
( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;
28 1 2006 1 RESOURCES SCIENCE Vol. 28 No. 1 Jan. 2006 :1007-7588(2006) 01-0002 - 07 20 1 1 2 (11 100101 ; 21 101149) : 1978 1978 2001 ; 2010 ; ; ; : ; ; 24718kg 1) 1990 26211kg 260kg 1995 2001 238kg( 1)
,,, (, 100875) 1989 12 25 1990 2 23, - 2-4 ;,,, ; -
25 3 2003 5 RESOURCES SCIENCE Vol. 25 No. 3 May 2003 ( 100875) : 500L - 2-4 - 6-8 - 10 114h - 120h 6h 1989 12 25 1990 2 23-2 - 4 : ; ; - 4 1186cm d - 1 10cm 514d ; : 714 13 317 714 119 317 : ; ; ; :P731
Supporting Information
Supporting Information for AgOTf-catalyzed one-pot reactions of 2-alkynylbenzaldoximes with α,β-unsaturated carbonyl compounds Qiuping Ding 1, Dan Wang 1, Puying Luo* 2, Meiling Liu 1, Shouzhi Pu* 3 and
Electronic Supplementary Information
Electronic Supplementary Information Unprecedented Carbon-Carbon Bond Cleavage in Nucleophilic Aziridine Ring Opening Reaction, Efficient Ring Transformation of Aziridines to Imidazolidin-4-ones Jin-Yuan
2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _
41 Vol.41, No. 01 RARE METAL MATERIALS AND ENGINEERING March 01 Pb O 4 PbO ( 710049) SnO -Sb Pb O 4 Pb O 4 100.5 h 970 h XRF XRD SEM Pb O 4 PbO PbO TG146.1 + A 100-185X(01)0-046-05 [1,] 1 PbO PbO Sn-Sb
ΠΕΡΙΛΗΨΗ. Λέξεις κλειδιά: Υγεία και συμπεριφορές υγείας, χρήση, ψυχότροπες ουσίες, κοινωνικό κεφάλαιο.
Α.Τ.Ε.Ι. ΚΡΗΤΗΣ Σ.Ε.Υ.Π. ΤΜΗΜΑ ΚΟΙΝΩΝΙΚΗΣ ΕΡΓΑΣΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Τίτλος: «Χρήση ψυχοτρόπων ουσιών από μαθητές Α Λυκείου της Δευτεροβάθμιας Εκπαίδευσης του Νομού Ηρακλείου και ο ρόλος του Κοινωνικού
ΜΕΤΑΠΤΥΧΙΑΚΗ ΕΡΕΥΝΗΤΙΚΗ ΔΙΑΤΡΙΒΗ
ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ & ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ ΕΡΓΑΣΤΗΡΙΟ ΠΟΙΟΤΙΚΟΥ ΕΛΕΓΧΟΥ & ΥΓΙΕΙΝΗΣ ΤΡΟΦΙΜΩΝ ΚΑΙ ΠΟΤΩΝ Π.Μ.Σ. «ΕΠΙΣΤΗΜΗ & ΤΕΧΝΟΛΟΓΙΑ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗ ΤΟΥ ΑΝΘΡΩΠΟΥ» Η ΕΠΙΔΡΑΣΗ
Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang
13 4 2015 7 Chinese Journal of Bioprocess Engineering Vol. 13 No. 4 Jul. 2015 doi 10. 3969 /j. issn. 1672-3678. 2015. 04. 012 1 2 2 2 2 1. 830054 2. 361005 L- 50% IC 50 0. 27 mg /ml K I - K IS 0. 218 0.
Survivin sirna. Inhibitory effect of small interference RNA targeting survivin nanospheres on human pancreatic carcinoma BXPC-3 cell growth
Experimental Research Chin J Curr Adv Gen Surg Survivin sirna 253 1 2 1 3 1 1 1 1 266003 266003 : survivin sirna survivin sirna BXPC- 3 : BXPC- 3 BXPC- 3 4 survivin sirna survivin sirna RT- PCR survivin
*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G
J. Hot Spring Sci. /2 +.,.,**2 + + + +, - +3 ++ -*,* + -+ Evaluation of the E# ect of Hyperthermia on Bedrock Bath Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G + + + HNAMI KOUCHI
ΕΦΑΡΜΟΓΗ ΕΥΤΕΡΟΒΑΘΜΙΑ ΕΠΕΞΕΡΓΑΣΜΕΝΩΝ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΕ ΦΥΣΙΚΑ ΣΥΣΤΗΜΑΤΑ ΚΛΙΝΗΣ ΚΑΛΑΜΙΩΝ
ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙ ΕΥΤΙΚΟ Ι ΡΥΜΑ ΚΡΗΤΗΣ ΤΜΗΜΑ ΦΥΣΙΚΩΝ ΠΟΡΩΝ ΚΑΙ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΕΦΑΡΜΟΓΗ ΕΥΤΕΡΟΒΑΘΜΙΑ ΕΠΕΞΕΡΓΑΣΜΕΝΩΝ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΕ ΦΥΣΙΚΑ ΣΥΣΤΗΜΑΤΑ ΚΛΙΝΗΣ ΚΑΛΑΜΙΩΝ ΕΠΙΜΕΛΕΙΑ: ΑΡΜΕΝΑΚΑΣ ΜΑΡΙΝΟΣ ΧΑΝΙΑ
0. 35g kg ~ 2. 0cm 10min. Nar- 15μL 6mm
22 Journal of Ningxia Medical University 34 1 2012 1 1674-6309 2012 01-0022 - 03 1 2 1 3 1. 750004 2. 750004 3. 750004 60 SD 300 ± 20 g 5 S ICH M 2 M 4 M 8 12 Deinsberger S M 2 4 8 - ICH 10min 2 4 8 mg
Neutralization E#ects of Acidity of Rain by Cover Plants on Slope Land
J. Jpn. Soc. Soil Phys. No. 33, p.2/ 3.,**/ * * * ** Neutralization E#ects of Acidity of Rain by Cover Plants on Slope Land Tadashi ADACHI*, Yoko OKI*, Akihiro NAGAI* and Shogo NAKATSUKASA** * Faculty
ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΙΣ «ΚΛΙΝΙΚΕΣ ΚΑΙ ΚΛΙΝΙΚΟΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΤΡΙΚΕΣ ΕΙΔΙΚΟΤΗΤΕΣ»
ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΙΣ «ΚΛΙΝΙΚΕΣ ΚΑΙ ΚΛΙΝΙΚΟΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΤΡΙΚΕΣ ΕΙΔΙΚΟΤΗΤΕΣ» ΑΡΝΗΤΙΚΗ ΡΥΘΜΙΣΗ ΤΗΣ ΜΕΤΑΒΙΒΑΣΗΣ ΤΟΥ ΣΗΜΑΤΟΣ ΤΗΣ
Θωμάς ΣΑΛΟΝΙΚΙΟΣ 1, Χρήστος ΚΑΡΑΚΩΣΤΑΣ 2, Βασίλειος ΛΕΚΙΔΗΣ 2, Μίλτων ΔΗΜΟΣΘΕΝΟΥΣ 1, Τριαντάφυλλος ΜΑΚΑΡΙΟΣ 3,
Αξιοποίηση Έξι Σεισμών στην Πελοπόννησο για την Συσχέτιση Φασματικών Επιταχύνσεων με την Απόκριση του Δομημένου Περιβάλλοντος Correlation of Spectral Accelerations with the Response of the Built Environment
Motion analysis and simulation of a stratospheric airship
32 11 Vol 32 11 2011 11 Journal of Harbin Engineering University Nov 2011 doi 10 3969 /j issn 1006-7043 2011 11 019 410073 3 2 V274 A 1006-7043 2011 11-1501-08 Motion analysis and simulation of a stratospheric
ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ
- - ό ό : Ω ί ό ί ώ.. ά ή ί ός ή ς ύ ί ί ή έ ώ ό. ή ς ά ς ής ό ός ά ς ή έ ός ή ς ί ής ί ς. ό έ ώ - ώ ή ής ή ς- ί ά ά ς ί ς. ά ί ί έ έ ά ύ ή, ό ί ά, ό ό ά έ ά ής ί ύ George Wald ή ί έ ς ί ύ ό ς ί ς ά έ
Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene
2001, 24 (1) : 2529 Journal of Nanjing Agricultural University rolc (, 210095) :, rolc ( Nicotiana tabacum ), GUS, PCR Southern rolc,, rolc : ; ; rolc ; : S572103513 : A : 1000Ο2030 (2001) 01Ο0025Ο05 Study
Octretide joint proton pump inhibitors in treating non-variceal gastrointestinal bleeding a Metaanalysis
528 2012 6 21 6 Chin J Gastroenterol Hepatol Jun 2012 Vol. 21 No. 6 doi 10. 3969 /j. issn. 1006-5709. 2012. 06. 011 Meta 430060 Cochrane Library Pubmed 2 Revman 5. 0 6 484 Meta Meta R573. 2 A 1006-5709
# Effect of PPAR-α agonist on adipokines expression in rats fed with high-fat diet LI yan#, HUANG bin, CHENG hua, LIANG zhen, LIU shan-ying
PPAR-α # 510120 PPAR-α SD SD 6 4 RT-PCR?? mrna FFA TG HOME-IR FFA 2.37±0.60 1.59±0.30 1.33±0.34 mmol/l p
Identification of Salmonella,Campylobacter jejuni and Enterohemorrhagic E.coli by Denaturing High-performance Liquid Chromatography
BIOTECHNOLOGY BULLETIN 2009 3 116015 PCR multiplex PCR mpcr denaturing high-performance liquid chromatography DHPLC O157 H7 fimy gyra O157 H7 rfbe 3 O157 H7 PCR 284 159 499 bp PCR O157 H7 1.5 CFU/ ml 15
No. 7 Modular Machine Tool & Automatic Manufacturing Technique. Jul TH166 TG659 A
7 2016 7 No. 7 Modular Machine Tool & Automatic Manufacturing Technique Jul. 2016 1001-2265 2016 07-0122 - 05 DOI 10. 13462 /j. cnki. mmtamt. 2016. 07. 035 * 100124 TH166 TG659 A Precision Modeling and
FENXI HUAXUE Chinese Journal of Analytical Chemistry. Savitzky-Golay. n = SG SG. Savitzky-Golay mmol /L 5700.
38 2010 3 FENXI HUAXUE Chinese Journal of Analytical Chemistry 3 342 ~ 346 DOI 10. 3724 /SP. J. 1096. 2010. 00342 Savitzky-Golay 1 * 1 2 1 3 1 1 510632 2 510632 3 200444 PLS Savitzky-Golay SG 10000 ~ 5300
BIOTECHNOLOGY BULLETIN cdna. Construction and Preliminary Analysis of Normalized cdna Library from the Gonad of Larimichthys crocea
BIOTECHNOLOGY BULLETIN 2011 7 cdna 1 1 2 1 1 361021 2 78666 Larimichthys crocea SMART switching mechanism at 5' end of RNA transcript DSN duplex-specific nuclease cdna 4. 3 10 6 PFU /ml 95. 8% 0. 5-3 kb
Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo
Bull. Earthq. Res. Inst. Univ. Tokyo Vol. 2.,**3 pp.,,3,.* * +, -. +, -. Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Kunihiko Shimazaki *, Tsuyoshi Haraguchi, Takeo Ishibe +, -.
Supporting Information. Multigenerational Disruption of Thyroid Endocrine System in Marine Medaka
Supporting Information Multigenerational Disruption of Thyroid Endocrine System in Marine Medaka after A Life-Cycle Exposure to Perfluorobutane Sulfonate (PFBS) Lianguo Chen,, Chenyan Hu #, Mirabelle M.
Influence of Flow Rate on Nitrate Removal in Flow Process
J. Jpn. Soc. Soil Phys. No. 33, p.1-2-,**/, ******* Influence of Flow Rate on Nitrate Removal in Flow Process Toshio TABUCHI*, Hisao KURODA**, Akiko IKENOBE** and Mayumi HIRANO** * Former professor of
Quick algorithm f or computing core attribute
24 5 Vol. 24 No. 5 Cont rol an d Decision 2009 5 May 2009 : 100120920 (2009) 0520738205 1a, 2, 1b (1. a., b., 239012 ; 2., 230039) :,,.,.,. : ; ; ; : TP181 : A Quick algorithm f or computing core attribute
þÿ Ç»¹º ³µÃ ± : Ãż²» Ä Â
Neapolis University HEPHAESTUS Repository School of Economic Sciences and Business http://hephaestus.nup.ac.cy Master Degree Thesis 2015 þÿ Ç»¹º ³µÃ ± : Ãż²» Ä Â þÿãå½±¹ã ¼±Ä¹º  ½ ¼ Ãͽ  þÿ±à ĵ»µÃ¼±Ä¹º
A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Vol. 31,No JOURNAL OF CHINA UNIVERSITY OF SCIENCE AND TECHNOLOGY Feb
Ξ 31 Vol 31,No 1 2 0 0 1 2 JOURNAL OF CHINA UNIVERSITY OF SCIENCE AND TECHNOLOGY Feb 2 0 0 1 :025322778 (2001) 0120016205 (, 230026) : Q ( m 1, m 2,, m n ) k = m 1 + m 2 + + m n - n : Q ( m 1, m 2,, m
Research Papers. TNF-α. L929 LPS Carswell [1] BCG. pet-41d TNF).TNF. NEB TNF-α cdna Invitrogen DNA. 75 ku TNF TransTaq High %
Research Papers Progress in Biochemistry and Biophysics 2009, 36(4): 424~430 wwwpibbaccn * TNF-α 1, 2) 1) 1)** ( 1) 100101 2) 100039) TNF-α TNF-α TNF-α TNF-α TNF-α TNF-α 9C6 TNF-α 29~40 TNF-α 9C6 TNF-α
ΜΕΛΕΤΗ ΑΠΟΤΙΜΗΣΗΣ ΠΑΡΑΓΟΜΕΝΗΣ ΕΝΕΡΓΕΙΑΣ Φ/Β ΣΥΣΤΗΜΑΤΩΝ ΕΓΚΑΤΕΣΤΗΜΕΝΩΝ ΣΕ ΕΛΛΑ Α ΚΑΙ ΤΣΕΧΙΑ
ΜΕΛΕΤΗ ΑΠΟΤΙΜΗΣΗΣ ΠΑΡΑΓΟΜΕΝΗΣ ΕΝΕΡΓΕΙΑΣ Φ/Β ΣΥΣΤΗΜΑΤΩΝ ΕΓΚΑΤΕΣΤΗΜΕΝΩΝ ΣΕ ΕΛΛΑ Α ΚΑΙ ΤΣΕΧΙΑ V. Poulek 1, M. Libra 2, Ι. Γράβαλος 3, Θ. Γιαλαµάς 3,. Μόσχου 4, Π. Ξυραδάκης 3,. Κατέρης 4, Ζ. Τσιρόπουλος 3,
Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica
35 1 2 0 1 7 1 DOI 10. 13193 /j. issn. 1673-7717. 2017. 01. 035 1 1 1 1 2 1. 150036 2. 150040 D101 DEAE Cellulose 52 Sephacryl S - 300 - - PJP - 1a PJP - 3a 1. 34 10 3 Da 1. 70 10 7 Da - PJP - 3a 4. 56
Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2
Free Radical Initiated Coupling Reaction of Alcohols and Alkynes: not C-O but C-C Bond Formation Zhongquan Liu,* Liang Sun, Jianguo Wang, Jie Han, Yankai Zhao, Bo Zhou Institute of Organic Chemistry, Gannan
Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic
Effects of Polygonatum sibiricum Polysaccharide on Immunosuppressive Action Induced by Cyclophosphamide in Mice
37 2 Vol37 No2 2018 6 Journal of South-Central University for NationalitiesNatSciEdition Jun2018 1 1 2 1 1 1 1 4300742 430074 MTT 200 μg ml -1 ConA 700% ConA IL-6 TNF-α 150 mg kg -1 790%ConA 433% 1483%
Journal of Ningxia Medical University BRCA2. M2610I 2405 delt stp ± t = P > %
33 6 2011 6 Journal of Ningxia Medical University 515 1674-6309 2011 06-0515 - 04 16 BRCA2 1 2 2 1 3 1. 750004 2. 750021 3. 750004 16-2 BRCA2 16 16 30 PCR BRCA2 16 3 18. 75% 2 M2610I 2405 delt stp729 1
A strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines
1 2 Supplementary information 3 4 A strategy for the identification of combinatorial bioactive compounds contributing to the holistic effect of herbal medicines 5 6 Fang Long 1, Hua Yang 1, Yanmin Xu,
Η ΤΟΞΙΚΟΤΗΤΑ ΤΟΥ ΒΟΡΙΟΥ(B) ΣΤΗΝ ΚΑΛΛΙΕΡΓΕΙΑ ΤΗΣ ΤΟΜΑΤΑΣ
ΑΛΕΞΑΝΔΡΕΙΟ Τ.Ε.Ι. ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ ΚΑΙ ΔΙΑΤΡΟΦΗΣ ΤΜΗΜΑ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΕΡΓΑΣΤΗΡΙΟ ΑΝΑΤΟΜΙΑΣ ΚΑΙ ΦΥΣΙΟΛΟΓΙΑΣ ΦΥΤΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Η ΤΟΞΙΚΟΤΗΤΑ ΤΟΥ ΒΟΡΙΟΥ(B)
M. marburgensis DX01 M. thermoautotrophicus M. marburgensis Marburg. MCR I mrna
2010 32 4 0797-0801 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com DX01 1 2 2* 1. 337000 2. 310058 DX01 Methanothermobacter marburgensis DX01 DX01
Quantum dot sensitized solar cells with efficiency over 12% based on tetraethyl orthosilicate additive in polysulfide electrolyte
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2017 Supplementary Information (SI) Quantum dot sensitized solar cells with
Vol. 35 No Journal of South-Central University for Nationalities Nat. Sci. Edition Jun TNFα. . MDSCs
35 2 Vol 35 No 2 2016 6 Journal of South-Central University for Nationalities Nat Sci Edition Jun 2016 ASICs TNF-α 1 1 2 3 4 * 1 430074 2 437100 3 430200 4 437100 ASICs TNFα PCR ph 7 3 ph 5 5 ASICs TNF-α
Effects of soothing liver and invigorating spleen recipes of TCM on hepatic inflammatory cytokines of rats with nonalcoholic steatosishepatitis
33 2 Vol. 33 No. 2 2012 4 Journal of Jinan University Medicine Edition Apr. 2012 TNF-α IL-6 IL-1 1 2 1 3 2 2 2 1. 510630 2. 510632 3. 510630 NASH TNF-α 6 IL-6 1 IL-1 NASH NASH 16 HE O ELISA TNF-α IL-6
rp, ribosomal protein 60S rp mrna rpl30 rps14 RT-PCR mrna nonsense-mediated mrna decay smg-2 smg-2 mrna rp rpl-1 rpl-1
rp, ribosomal protein 60S 47 rpl 40S 32 rps rp mrna rpl30 rps14 rpl12 rpl3 rps13 rp mrna nonsense-mediated mrna decay (NMD) C. elegans smg-2 smg-2 mrna 50 rp 7 rp 4 rpl 4 rp NMD mrna 6 rp mrna rp mrna
LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing
2003 61 3, 435 439 ACTA CHIMICA SINICA Vol 61, 2003 No 3, 435 439 2 ΞΞ ( 400715), 2, 2, 2, 3/ 2 2,, 2,, Ne w Methods for the Determination of the Inclusion Constant between Procaine Hydrochloride and 2Cyclodextrin
Η ΥΠΕΡΕΚΦΡΑΣΗ ΤΟΥ SMAD7 ΠΡΟΣΤΑΤΕΥΕΙ ΤΟ ΗΠΑΡ ΑΠΟ ΤΗΝ TGF-Β/SMAD ΜΕΣΟΛΑΒΟΥΜΕΝΗ ΙΝΟΓΕΝΕΣΗ
Η ΥΠΕΡΕΚΦΡΑΣΗ ΤΟΥ SMAD7 ΠΡΟΣΤΑΤΕΥΕΙ ΤΟ ΗΠΑΡ ΑΠΟ ΤΗΝ TGF-Β/SMAD ΜΕΣΟΛΑΒΟΥΜΕΝΗ ΙΝΟΓΕΝΕΣΗ OVEREXPRESSION OF SMAD7 PROTECTS LIVER FROM TGF-B/SMAD-MEDIATED FIBROGENESIS Γ. Γερμανίδης(1), Ν. Αργέντου(2), Ε.