«Μειέηεο ζηε ρσξηθή θαη ρξνληθή έθθξαζε ηνπ γνληδίνπ C3 θαη ηνπ ζπκπιόθνπ MAC ηνπ ζπζηήκαηνο ηνπ ζπκπιεξώκαηνο ζηελ όξληζα (Gallus gallus)»

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "«Μειέηεο ζηε ρσξηθή θαη ρξνληθή έθθξαζε ηνπ γνληδίνπ C3 θαη ηνπ ζπκπιόθνπ MAC ηνπ ζπζηήκαηνο ηνπ ζπκπιεξώκαηνο ζηελ όξληζα (Gallus gallus)»"

Transcript

1 ΠΑΝΔΠΗΣΖΜΗΟ ΠΑΣΡΩΝ ΥΟΛΖ ΔΠΗΣΖΜΩΝ ΤΓΔΗΑ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ Πξόγξακκα Μεηαπηπρηαθώλ πνπδώλ Δθαξκνγέο ζηηο Βαζηθέο Ηαηξηθέο Δπηζηήκεο «Μνξηαθή Βηνινγία θαη Κπηηαξνγελεηηθή» ΓΗΠΛΩΜΑΣΗΚΖ ΔΡΓΑΗΑ «Μειέηεο ζηε ρσξηθή θαη ρξνληθή έθθξαζε ηνπ γνληδίνπ C3 θαη ηνπ ζπκπιόθνπ MAC ηνπ ζπζηήκαηνο ηνπ ζπκπιεξώκαηνο ζηελ όξληζα (Gallus gallus)» Μηθξνύ Αγγειηθή Βηνιόγνο Δπηβιέπσλ: Ησάλλεο Κ. Εαξθάδεο ΠΑΣΡΑ 2009

2 2 Περιεχβμενα ΠΡΟΛΟΓΟ ΕΙΣΑΓΩΓΗ ΑΝΟΗΑ ΦΤΗΚΖ ΑΝΟΗΑ ΔΗΓΗΚΖ Ή ΠΡΟΑΡΜΟΣΗΚΖ ΑΝΟΗΑ ΣΟ ΤΣΖΜΑ ΣΟΤ ΤΜΠΛΖΡΧΜΑΣΟ ΟΓΟΗ ΔΝΔΡΓΟΠΟΗΖΖ ΣΟΤ ΤΜΠΛΖΡΧΜΑΣΟ ΚΛΑΗΚΖ ΟΓΟ ΔΝΑΛΛΑΚΣΗΚΖ ΟΓΟ ΛΔΚΣΗΝΗΚΖ ΟΓΟ ΣΟ ΣΡΗΣΟ ΤΣΑΣΗΚΟ ΣΟΤ ΤΜΠΛΖΡΧΜΑΣΟ (C3) Σν γνλίδην C Ζ πξσηεΐλε C Ζ βηνινγηθή δξάζε ηνπ ζπζηαηηθνχ C Ζ ΛΤΣΗΚΖ ΟΓΟ ΣΟ ΤΜΠΛΟΚΟ ΛΤΖ ΜΔΜΒΡΑΝΖ ΡΤΘΜΗΖ ΣΟΤ ΤΣΖΜΑΣΟ ΣΟΤ ΤΜΛΖΡΧΜΑΣΟ Α) Ρχζκηζε θαηά ηελ έλαξμε ηεο ελεξγνπνίεζεο Β) Ρχζκηζε θαηά ηελ ελίζρπζε ηεο ελεξγνπνίεζεο Γ) Ρχζκηζε θαηά ηε ιπηηθή νδφ ΒΗΟΤΝΘΔΖ ΣΧΝ ΠΡΧΣΔΗΝΧΝ ΣΟΤ ΤΜΠΛΖΡΧΜΑΣΟ ΓΟΜΗΚΑ ΚΑΗ ΡΤΘΜΗΣΗΚΑ ΓΟΝΗΓΗΑ ΣΟΤ ΤΜΠΛΟΚΟΤ MAC ΣO ΤΣΑΣΗΚΟ C

3 3 ΣΟ ΤΣΑΣΗΚΟ C ΣΟ ΤΣΑΣΗΚΟ C ΠΡΟΣΔΚΣΗΝΖ (CD59) ΒΗΣΡΟΝΔΚΣΗΝΖ (vitronectin) ΚΛΑΣΔΡΗΝΖ (Clusterin) ΤΜΠΛΖΡΧΜΑ ΚΑΗ ΔΞΔΛΗΞΖ ΟΡΝΗΘΑ (Gallus gallus) ΔΗΑΓΧΓΖ ΣΟ ΤΜΠΛΖΡΧΜΑ ΣΑ ΠΣΖΝΑ ΚΑΗ ΣΖΝ ΟΡΝΗΘΑ (Gallus gallus) ΑΝΑΠΣΤΞΖ ΔΜΒΡΤΟΤ ΟΡΝΗΘΑ Οξγαλνγέλεζε ηνπ ήπαηνο Ζ ΟΡΝΗΘΑ Χ ΟΡΓΑΝΗΜΟ ΜΟΝΣΔΛΟ Δθαξκνγέο ζηε Βηνινγία ΚΟΠΟ ΥΛΙΚΑ ΚΑΙ ΜΕΘΟΔΟΙ A ΤΛΗΚΑ B ΜΔΘΟΓΟΗ Απνκφλσζε λνπθιετθψλ νμέσλ Α) Απνκφλσζε πιαζκηδηθνχ DNA (κέζνδνο άιθαιη) Β) Απνκφλσζε πιαζκηδηθνχ DNA (mini preparation) κε πξνεηνηκαζκέλα πιηθά Γ) Απνκφλσζε νιηθνχ RNA απφ ηζηφ Γ) Απνκφλσζε δψλεο DNA απφ πήθησκα αγαξφδεο Πνζνηηθφο πξνζδηνξηζκφο λνπθιετθψλ νμέσλ Α) Φσηνκεηξηθφο πξνζδηνξηζκφο Β) Πξνζδηνξηζκφο κε ειεθηξνθφξεζε ζε πήθησκα αγαξφδεο... 57

4 Ζιεθηξνθφξεζε λνπθιετθψλ νμέσλ ζε πήθησκα αγαξφδεο Α) Ζιεθηξνθφξεζε DNA B) Ζιεθηξνθφξεζε RNA Αιπζηδσηή αληίδξαζε πνιπκεξάζεο (PCR) Α) Αιπζηδσηή αληίδξαζε αληίζηξνθεο κεηαγξαθάζεο (RT-PCR) ν Βήκα: χλζεζε πξψηεο αιπζίδαο cdna απφ RNA ν Βήκα: Αιπζηδσηή αληίδξαζε πνιπκεξάζεο Β) Αιπζηδσηή Αληίδξαζε Σαρείαο Δλίζρπζεο Άθξσλ (5 /3 RAPID Amplification of cdna Ends, RACE PCR) Δθιεθηηθφο Πνιιαπιαζηαζκφο ηνπ 5 άθξνπ Δθιεθηηθφο Πνιιαπιαζηαζκφο ηνπ 3 άθξνπ Καηάηκεζε ηνπ DNA κε έλδπκα πεξηνξηζκνχ Αληίδξαζε ζπλδεηάζεο (ligation) Μεηαζρεκαηηζκφο βαθηεξηαθψλ θπηηάξσλ E.coli κε πιαζκηδηθφ DNA Τγξέο θαιιηέξγεηεο βαθηεξηαθψλ θπηηάξσλ E.coli Πξνζδηνξηζκφο λνπθιενηηδηθήο αιιεινπρίαο DNA (Sequencing) Λνγηζκηθά πξνγξάκκαηα αλάιπζεο λνπθιενηηδηθψλ θαη ακηλνμηθψλ αιιεινπρηψλ ΑΠΟΤΕΛΕΣΜΑΤΑ Κισλνπνίεζε θαη ραξαθηεξηζκφο ηνπ γνληδίνπ C6 ηνπ ζπκπιεξψκαηνο ζηελ φξληζα Κισλνπνίεζε ηκήκαηνο ηνπ cdna ηνπ γνληδίνπ C6 ηεο φξληζαο (θιψλνο # 1) Κισλνπνίεζε ηνπ 5 άθξνπ ηνπ cdna ηνπ γνληδίνπ C6 ηεο φξληζαο (θιψλνο#2)

5 Κισλνπνίεζε ηνπ 3 άθξνπ ηνπ cdna ηνπ γνληδίνπ C6 ηεο φξληζαο, (θιψλνο#3) χλζεζε ησλ θιψλσλ θαη δνκηθή κειέηε ηεο ζπλαγφκελεο ακηλνμηθήο αιιεινπρίαο Φπινγελεηηθή αλάιπζε ησλ πξσηετλψλ ηεο νηθνγέλεηαο MACPF Μειέηε ηεο ηζηηθήο-αλαπηπμηαθήο έθθξαζεο, ζε επίπεδν mrna, ησλ γνληδίσλ ηνπ ζπκπιεξψκαηνο ζηελ φξληζα Μειέηε ηεο αλαπηπμηαθήο έθθξαζεο, ζε επίπεδν mrna, ηνπ γνληδίνπ C3 ζηελ φξληζα Μειέηε ηζηηθήο θαη αλαπηπμηαθήο έθθξαζεο, ζε επίπεδν mrna ησλ δνκηθψλ γνληδίσλ ηνπ ζπκπιφθνπ MAC ζηελ φξληζα χγθξηζε ηεο έθθξαζεο ησλ ζπζηαηηθψλ ηνπ ζπκπιφθνπ MAC κεηαμχ ηεο πέζηξνθαο (Oncorynchus mykiss), ηεο φξληζαο (Gallus gallus) θαη ηνπ αλζξψπνπ (Homo sapiens) Μειέηε αλαπηπμηαθήο έθθξαζεο, ζε επίπεδν mrna, ησλ ξπζκηζηηθψλ γνληδίσλ ηνπ ζπκπιφθνπ MAC ζηελ φξληζα ΣΥΖΗΤΗΣΗ ΠΔΡΗΛΖΦΖ SUMMARY ΒΗΒΛΗΟΓΡΑΦΗΑ

6 6 ΠΡΟΛΟΓΟ Ζ παξνχζα εξγαζία εθπνλήζεθε ζην Δξγαζηήξην Γεληθήο Βηνινγίαο, ηεο Ηαηξηθήο ρνιήο ηνπ Παλεπηζηεκίνπ Παηξψλ, ζηα πιαίζηα ηνπ κεηαπηπρηαθνχ πξνγξάκκαηνο Δθαξκνγέο Βαζηθψλ Ηαηξηθψλ Δπηζηεκψλ κε θαηεχζπλζε: Μνξηαθή Γελεηηθή- Κπηηαξνγελεηηθή ππφ ηελ επίβιεςε ηνπ Αλ. Καζεγεηή Ησάλλε Κ. Εαξθάδε θαηά ηα έηε Πξψηα απ φια ζα ήζεια λα επραξηζηήζσ ηνλ επηβιέπνληα θαζεγεηή κνπ, ηνλ δάζθαιφ κνπ, Ησάλλε Κ. Εαξθάδε, γηα ηελ επθαηξία πνπ κνπ έδσζε λα δνπιέςσ ζην εξγαζηήξηφ ηνπ, γηα ηε ζηήξημή ηνπ θαζφιε ηε δηάξθεηα ηεο ζπλεξγαζίαο καο, ηελ ππνκνλή θαη ηε θαηαλφεζή ηνπ θαη γηα ηηο ζπκβνπιέο ηνπ, ηφζν ζε επαγγεικαηηθφ φζν θαη ζε πξνζσπηθφ επίπεδν. Δπίζεο, ζα ήζεια λα επραξηζηήζσ ηελ θαζεγήηξηα Αγιαΐα Αζαλαζηάδνπ θαη ηνλ επίθνπξν θαζεγεηή ηαχξν Σαξαβήξα φρη κφλν γηα ηηο ζπκβνπιέο ηνπο, αιιά θαη γηα ηελ πξνζπκία ηνπο λα πξνζθέξνπλ θάζε ζηηγκή ηε βνήζεηά ηνπο θαηά ηελ εθπφλεζε ηεο εξγαζίαο κνπ. Θα ήζεια αθφκα λα ηνπο επραξηζηήζσ, φπσο επίζεο θαη ηα ππφινηπα κέιε ΓΔΠ ηνπ ηνκέα Γεληθήο Βηνινγίαο, Α. Παπαραηδνπνχινπ, Ν. Μνζρνλά, Ε. Λπγεξνχ θαη Γ. πάζα, γηα ηε βνήζεηά ηνπο απηά ηα δχν ρξφληα θαη θπξίσο γηα ην γεγνλφο φηη φινη ηνπο ζπληέιεζαλ ζην λα ππάξρεη έλα άξηζην θιίκα επηθνηλσλίαο κεηαμχ καο. Δπηπιένλ, ζα ήζεια λα επραξηζηήζσ ηνπο ζπλεξγάηεο κνπ ζην εξγαζηήξην, κε πξψηε απ φινπο ηε Γήκεηξα Μαξηφιε, γηα ηε βνήζεηά ηεο θαη ηε ζηήξημή ηεο ζε φιε ηε δηάξθεηα ηεο ζπλεξγαζίαο καο πνπ ππήξμε άςνγε. Δπίζεο, ζα ήζεια λα επραξηζηήζσ ηελ Αδακαληία Λφληνπ, πνπ κε βνήζεζε ζηα πξψηα κνπ βήκαηα θαη ηνλ Σάζν Παπαλαζηαζίνπ γηα ηηο ζπκβνπιέο ηνπ θαη ηηο ζπδεηήζεηο καο. Πνιχηηκε ππήξμε επίζεο ε βνήζεηα απφ ηνλ Παλαγηψηε Κσηζαληή, ηε Μάγδα πέιια θαη ηε Υξηζηίλα Κπξνχζε. Γε ζα κπνξνχζα βέβαηα λα παξαιείςσ ηε θίιε θαη ζπλάδειθν Ήξηλλα Παπαγγειή, ε νπνία αλ θαη καθξπά, πάληα ήηαλ δίπια κνπ, ζηεξίδνληάο κε ζε επηζηεκνληθφ θαη πξνζσπηθφ επίπεδν. Σέινο, φζα «επραξηζηψ» θαη λα πσ ζηελ νηθνγέλεηά κνπ ζα ήηαλ ιίγα, γηα ηε ζηήξημή ηνπο φια απηά ηα ρξφληα, ηελ εκπηζηνζχλε ηνπο ζε εκέλα θαη ηελ ελζάξξπλζή ηνπο ζηηο επηινγέο κνπ. Μαδί κε απηνχο, ζα ήζεια λα επραξηζηήζσ φινπο ηνπο δηθνχο κνπ αλζξψπνπο, ηνπο θίινπο κνπ, πνπ ν θαζέλαο ηνπο κε ζηήξημε ζε θάζε κηθξφ κνπ βήκα.

7 1. ΕΙΣΑΓΩΓΗ 7

8 ΑΝΟΗΑ Όινη νη γλσζηνί νξγαληζκνί ηνπ πιαλήηε έρνπλ αλαπηχμεη κεραληζκνχο άκπλαο νη νπνίνη ηνπο επηηξέπνπλ λα επηβηψλνπλ ζην εθάζηνηε πεξηβάιινλ ζην νπνίν δνπλ. Με ηνλ φξν «κεραληζκνί άκπλαο» αλαθεξφκαζηε ζε θάζε κεραληζκφ, ν νπνίνο έρεη αλαπηπρζεί ζε έλα θχηηαξν ή νξγαληζκφ, κε ζθνπφ ηελ πξνζηαζία ηνπ γηα επηβίσζε θαη αλαπαξαγσγή (1). πγθεθξηκέλα, νη νξγαληζκνί έρνπλ αλαπηχμεη κεραληζκνχο θαηαζηξνθήο ή εμνπδεηέξσζεο ηεο μέλεο χιεο πνπ εηζβάιιεη ζην ζψκα. Οη ακπληηθνί κεραληζκνί δχλαληαη α) λα πξνζηαηεχνπλ απφ κηθξννξγαληζκνχο β) λα απνκνλψλνπλ ή απνκαθξχλνπλ κε κηθξνβηαθήο θχζεο μέλνπο παξάγνληεο θαη γ) λα θαηαζηξέθνπλ θαξθηληθά θχηηαξα, ιεηηνπξγία ε νπνία είλαη γλσζηή σο αλνζνινγηθή επηηήξεζε. Ζ αληίζηαζε ινηπφλ, ε νπνία παξέρεηαη κέζσ ησλ κεραληζκψλ άκπλαο, νλνκάδεηαη αλνζία H αλνζία ρσξίδεηαη ζε δχν θαηεγνξίεο: ζηε θπζηθή ή κε-εηδηθή θαη ηελ έκθπηε ή πξνζαξκνζηηθή (2). Δηθόλα 1.1: Απεηθφληζε ησλ δνκψλ πνπ απαξηίδνπλ ην αλνζνπνηεηηθφ ζχζηεκα: Με θίηξηλν ρξψκα απεηθνλίδνληαη ηα πξσηνγελή φξγαλα (ζχκνο, κπειφο ησλ νζηψλ) φπνπ θαη

9 9 αλαπηχζζνληαη ηα θχηηαξα ηνπ αλνζνπνηεηηθνχ, ελψ κε κπιε ρξψκα ηα δεπηεξνγελή φξγαλα, φπνπ θαη ιακβάλνπλ ρψξα νη αληηδξάζεηο ηεο αλνζίαο (1999, Gardland Publishing/ Elsevier Science) ΦΤΗΚΖ ΑΝΟΗΑ Ζ θπζηθή αλνζία, είλαη ε αξραηφηεξε θπινγελεηηθά θαη απαληάηαη ζε φινπο ζρεδφλ ηνπο δσηθνχο νξγαληζκνχο. Απνηειεί ηελ πξψηε γξακκή άκπλαο ηνπ νξγαληζκνχ θαη νη ακπληηθνί κεραληζκνί πνπ πεξηιακβάλεη πξνζηαηεχνπλ ηνλ νξγαληζκφ απέλαληη ζε μέλεο νπζίεο ή θχηηαξα εηζβνιείο, ρσξίο λα αλαγλσξίδνπλ πξνεγνπκέλσο ηελ εηδηθή ηαπηφηεηά ηνπο. Πξνθεηκέλνπ ινηπφλ νη κεραληζκνί απηνί λα αζθήζνπλ ηε βηνινγηθή ηνπο δξάζε, ζα πξέπεη λα είλαη ζε ζέζε λα αλαγλσξίζνπλ θάπνηα γεληθή ηδηφηεηα ηνπ εηζβνιέα. Ζ ηδηφηεηα απηή ζπλήζσο αλαθέξεηαη ζε εηδηθέο ηάμεηο πδαηαλζξάθσλ ή ιηπηδίσλ, ηα νπνία απνηεινχλ ζπρλά κέξνο ησλ θπηηαξηθψλ ηνηρσκάησλ ηνπο. πγθεθξηκέλα, ε θπζηθή αλνζία ρξεζηκνπνηεί κε εηδηθνχο κεραληζκνχο, νη νπνίνη έρνπλ ηα εμήο ραξαθηεξηζηηθά: α) έιιεηςε κλήκεο γηα ηε θχζε ηνπ εηζβνιέα, β) ε απνηειεζκαηηθφηεηά ηνπο δε βειηηψλεηαη κε ζπλερή έθζεζε ηνπ νξγαληζκνχ ζην ζπγθεθξηκέλν παζνγφλν θαη γ) δελ απαηηνχλ ρξφλν γηα ηελ πιήξε αλάπηπμή ηνπο. Βαζηθή κέξηκλα ηεο θπζηθήο αλνζίαο είλαη λα παξεκπνδίδεη ηελ είζνδν ησλ παζνγφλσλ κηθξννξγαληζκψλ, δηαθνξεηηθά, ζε πεξίπησζε απνηπρίαο, ν επφκελνο ζηφρνο είλαη ν πεξηνξηζκφο ηεο εμάπισζήο ηνπο. Οη παξάγνληεο νη νπνίνη ζπκκεηέρνπλ ζηε κε εηδηθή αλνζία, ρσξηδφκελνη αλάινγα κε ηε θχζε ηνπο, είλαη α) νη θπζηθνί θξαγκνί (δέξκα, βιελλνγφλνη, θπζηθέο ξνέο ηνπ νξγαληζκνχ), β) νη δηαιπηνί παξάγνληεο (ιπζνδχκε, πεςίλε, ηα ιηπαξά νμέα, γαζηξηθφ νμχ, νξηζκέλα αληηκηθξνβηαθά πεπηίδηα, ζπζηαηηθά ηνπ ζπκπιεξψκαηνο, πξσηεΐλεο νμείαο θάζεο, ρπκηθνί κεζνιαβεηέο, πξνζηαγιαλδίλεο, ππεξπεξνμεηδάζεο, ιεπθνηξηέληα, ληηξηθφ νμχ, παξάγνληαο ελεξγνπνίεζεο ησλ αηκνπεηαιίσλ, ηζηακίλε, ζεξνηνλίλε), γ) νη θπηηαξηθνί παξάγνληεο (κνλνθχηηαξα, καθξνθάγα, νπδεηεξφθηια, θπζηθά θχηηαξα θνληάδεο, καζηνθχηηαξα) (3). Οη κεραληζκνί κέζσ ησλ νπνίσλ εθδειψλεηαη ε θπζηθή αλνζία είλαη α) ε θιεγκνλή (εληνπηζκέλε απφθξηζε ζε κφιπλζε ή ηξαπκαηηζκφ, ε νπνία έρεη σο ζηφρν ηελ θαηαζηξνθή ή απελεξγνπνίεζε ησλ μέλσλ εηζβνιέσλ θαη ε επηδηφξζσζε ηεο ηζηηθήο

10 10 βιάβεο), β) ε θαγνθπηηάξσζε (πεξηιακβάλεη ηελ αλαγλψξηζε καθξνκνξίσλ, ηελ πξφζιεςή ηνπο απφ θαγνθχηηαξα θαη ηελ θαηαζηξνθή ηνπο), γ) ε νςσλνπνηεζε (θάιπςε επηθάλεηαο παζνγφλνπ κε νςσλίλεο κε απνηέιεζκα ηελ ελίζρπζε ηεο θαγνθπηηάξσζεο) θαη δ) ε ιύζε ησλ παζνγόλσλ. Οη παξαπάλσ κεραληζκνί παξεκπνδίδνπλ ηφζν ηελ είζνδν, φζν θαη ηε δηάδνζε ησλ παζνγφλσλ, σζηφζν αδπλαηνχλ λα πεξηνξίζνπλ εμνινθιήξνπ ηελ πξνθαινχκελε βιάβε. Δάλ παξφια απηά, θάπνηνο κηθξννξγαληζκφο θαηαθέξεη λα μεπεξάζεη ηνπο θξαγκνχο ηεο θπζηθήο αλνζίαο, ζηα ζπνλδπισηά επηζηξαηεχνληαη πην απνηειεζκαηηθνί κεραληζκνί άκπλαο, νη νπνίνη απνηεινχλ κέξνο ηνπ αλνζνπνηεηηθνχ ζπζηήκαηφο ηνπο ΔΗΓΗΚΖ Ή ΠΡΟΑΡΜΟΣΗΚΖ ΑΝΟΗΑ Ο ηχπνο απηφο ηεο αλνζίαο απνθηάηαη θαη αλαπηχζζεηαη θαηά ηε δηάξθεηα ηεο δσήο ελφο αηφκνπ, είλαη δειαδή «επίθηεηνο». Πξφθεηηαη γηα έλα πξφζθαην εμειηθηηθά κεραληζκφ, θαζψο εκθαλίζηεθε πξηλ απφ 450 εθαη. ρξφληα πεξίπνπ, καδί κε ηνπο ρνλδξηρζχεο. Βαζηθή ηνπ ηδηφηεηα είλαη φηη αλαγλσξίδεη θαη ζπκάηαη θάζε παζνγφλν πνπ έρεη ζην παξειζφλ πξνζβάιιεη ηνλ νξγαληζκφ, κε απνηέιεζκα ε απφθξηζή ηνπ λα είλαη θάζε θνξά ηαρχηεξε θαη απνηειεζκαηηθφηεξε. Ζ εηδηθή αλνζία, αλαθέξεηαη ζηνλ ηχπν εθείλν ηεο αλνζίαο ε νπνία απνθηάηαη απφ ην άηνκν θαηά ηε δηάξθεηα ηεο δσήο ηνπ, δειαδή είλαη «επίθηεηε». Ζ εηδηθή αλνζία εμαξηάηαη απφ ηελ εηδηθή αλαγλψξηζε ηνπ παζνγφλνπ, κε πςειή κάιηζηα εμεηδίθεπζε θαη δηαζέηεη ηα εμήο ραξαθηεξηζηηθά: α) κεραληζκφ κλήκεο, κε κεγάιε δηάξθεηα, ράξε ζηνλ νπνίν ν νξγαληζκφο ζπκάηαη ηελ μέλε νπζία ή ην θχηηαξν ην νπνίν ζην παξειζφλ εηζέβαιιε ζε απηφλ, β) πξνζαξκνζηηθφηεηα ζηνπο μέλνπο εηζβνιείο, γ) ηθαλφηεηα δηάθξηζεο ησλ μέλσλ αληηγφλσλ απφ ηα ίδηα αληηγφλα, ε νπνία είλαη απαξαίηεηε γηα ηελ απνθπγή αλνζναπφθξηζεο ελάληηα ζε βηνκφξηα ηνπ ίδηνπ ηνπ νξγαληζκνχ (αλνζναλνρή) δ) κεζνιάβεζε κεγαιχηεξνπ ρξνληθνχ δηαζηήκαηνο πξνθεηκέλνπ λα επηηεπρζεί ε κέγηζηε αλνζνινγηθή απφθξηζε, ζε ζχγθξηζε κε ηε κε εηδηθή αλνζία, ε νπνία επηηπγράλεη άκεζα ηε κέγηζηε αλνζηαθή ηθαλφηεηα. Βάζεη ησλ κεζνιαβεηψλ, νη νπνίνη ρξεζηκνπνηνχληαη απφ ηελ εηδηθή αλνζία, δηαθξίλνληαη δχν ηχπνη εηδηθήο αλνζίαο. Α) Υπκηθή αλνζία

11 11 Ο ζπγθεθξηκέλνο ηχπνο αλνζίαο κεζνιαβείηαη απφ εηδηθέο δηαιπηέο πξσηεΐλεο, ηα αληηζψκαηα, ηα νπνία παξάγνληαη απφ ηα Β ιεκθνθχηηαξα. Ο θχξηνο ξφινο ηεο είλαη ε πξνζηαζία απφ εμσθπηηάξηα βαθηήξηα, παξάζηηα, κχθεηεο θαη ηνμίλεο. Β) Κπηηαξηθή αλνζία Ζ θπηηαξηθή αλνζία κεζνιαβείηαη απφ εμεηδηθεπκέλα ιεκθνθχηηαξα, ηα Σ ιεκθνθχηηαξα θαη ν θχξηνο ξφινο ηεο είλαη ε πξνζηαζία απφ ελδνθπηηάξηα βαθηήξηα, παξάζηηα θαη ηνχο (3,1). Οη δχν παξαπάλσ αλνζνινγηθνί κεραληζκνί, ηεο κε εηδηθήο θαη εηδηθήο αλνζίαο, ιεηηνπξγνχλ αιιεινδηαδφρσο, θαζψο ηα ζπζηαηηθά ηεο κε εηδηθήο αλνζίαο παξέρνπλ θαηεπζχλζεηο, πξνθεηκέλνπ λα δξάζνπλ νη εηδηθνί κεραληζκνί ηεο επίθηεηεο αλνζίαο, λα επηιέμνπλ δειαδή ηνπο θαηάιιεινπο ζηφρνπο φπσο επίζεο θαη ηηο ζηξαηεγηθέο γηα ηελ εμνιφζξεπζή ηνπο. Υαξαθηεξηζηηθφ παξάδεηγκα απηήο ηεο ζπλεξγαζίαο είλαη ε θιεγκνλψδεο αληίδξαζε, θαηά ηελ νπνία ελεξγνπνηνχληαη δηάθνξα θχηηαξα "θιεηδηά", φπσο είλαη ηα καθξνθάγα, ελψ παξάιιεια εθθξίλνληαη δηάθνξεο νπζίεο πνπ απνηεινχλ έλα ζεκείν ζχλδεζεο αλάκεζα ζηα δχν απηά ζπζηήκαηα αλνζίαο ΣΟ ΤΣΖΜΑ ΣΟΤ ΤΜΠΛΖΡΩΜΑΣΟ Σν ζχζηεκα ηνπ ζπκπιεξψκαηνο αλαθαιχθζεθε πξψηε θνξά ην 1986 απφ ηνλ Joules Bordet, σο έλαο ζεξκνεπαίζζεηνο παξάγνληαο ηνπ νξνχ, ν νπνίνο «ζπκπιήξσλε ηε δξάζε εηδηθψλ αληηζσκάησλ θαηά ηε βαθηεξηαθή ιχζε θαη ηε ιχζε εξπζξνθπηηάξσλ (4). Ζ νλνκαζία ηνπ νθείιεηαη ζηνλ Erhlich (5), ν νπνίνο εηζήγαγε ηνλ φξν ζηα ηέιε ηεο δεθαεηίαο ηνπ Πξφθεηηαη γηα έλα εμαηξεηηθά αξραίν θαη ζπληεξεκέλν κεραληζκφ άκπλαο, ν νπνίνο ζχκθσλα κε πξφζθαηεο κειέηεο πξσηνεκθαλίδεηαη εμειηθηηθά ζηα πξσηνζηφκηα (6). Μέρξη ζήκεξα έρνπλ αλαγλσξηζηεί πεξίπνπ 35 πξσηεΐλεο ηνπ ζπζηήκαηνο ηνπ ζπκπιεξψκαηνο. Οη πεξηζζφηεξεο πξσηεΐλεο είλαη δηαιπηέο ζηνλ νξφ, ελψ αξθεηέο απνηεινχλ ζπζηαηηθά θπηηαξηθήο επηθάλεηαο, δξψληαο σο ππνδνρείο ή ξπζκηζηηθά κφξηα ηνπ ζπζηήκαηνο. Ζ πιεηνςεθία ησλ ζπζηαηηθψλ ηνπ ζπκπιεξψκαηνο βξίζθνληαη σο αλελεξγά πξνέλδπκα (δπκνγφλα), ηα νπνία ελεξγνπνηνχληαη κέζσ απνηθνδφκεζεο, ππξνδνηψληαο έλαλ θαηαξξάθηε αληηδξάζεσλ, θαηά ηνλ νπνίν ην πξντφλ ηεο πξνεγνχκελεο δηάζπαζεο δξα θαηαιπηηθά ελεξγνπνηψληαο ην έλδπκν ηεο επφκελεο

12 12 αληίδξαζεο. Κάζε ελεξγνπνηεκέλν ζπζηαηηθφ έρεη κηθξφ ρξφλν εκηδσήο πξνηνχ απελεξγνπνηεζεί (7). Σν ζχζηεκα ηνπ ζπκπιεξψκαηνο αζθεί ηε βηνινγηθή ηνπ δξάζε πξνζηαηεχνληαο ηνλ μεληζηή απφ παζνγφλα α) κέζσ άκεζεο ιχζεο βαθηεξίσλ, θπηηάξσλ θαη ηψλ, β) ζπκβάιινληαο ζηελ αληίδξαζε θιεγκνλήο κε ηελ παξαγσγή αλαθπιαηνμηλψλ θαη γ) ζπκβάιινληαο ζηε θαγνθπηηάξσζε κέζσ νςσλνπνίεζεο θαη αλνζνπξνζήισζεο (8). Δπηπιένλ, ην ζπκπιήξσκα έρεη ηελ ηδηφηεηα λα γεθπξψλεη ηελ έκθπηε θαη ηελ επίθηεηε αλνζία, εληζρχνληαο ηε ρπκηθή αλνζνινγηθή απφθξηζε ζε εμαξηψκελα απφ Σ- θχηηαξα αληηγφλα θαη επεξεάδνληαο ηελ νπδφ ελεξγνπνίεζεο ησλ Β- ιεκθνθπηηάξσλ (9), θαζψο θαη εληζρχνληαο ηελ αλνζνινγηθή κλήκε (10). Μηα αθφκα θαιά κειεηεκέλε ιεηηνπξγία ηνπ ζπκπιεξψκαηνο είλαη εθείλε ε νπνία ζρεηίδεηαη κε ηελ ελαπφζεζε άρξεζηνπ πιηθνχ ηνπ νξγαληζκνχ, κέζσ εθθαζάξηζεο αλνζνζπκπιεγκάησλ θαη απνκάθξπλζεο απνπησηηθψλ θπηηάξσλ (11). Πξφζθαηα, φιν θαη πεξηζζφηεξεο κειέηεο ζπλδένπλ ην ζπκπιήξσκα κε ελαιιαθηηθέο βηνινγηθέο δηεξγαζίεο νη νπνίεο απνθιίλνπλ απφ ηηο παξαδνζηαθέο ιεηηνπξγίεο ηνπ πνπ αλαθέξνληαη ζηελ αλνζία, φπσο είλαη ε ζπκκεηνρή ηνπ ζηα πξψηκα ζηάδηα αλάπηπμεο, ζηνλ θαζνξηζκφ ησλ βιαζηηθψλ θπηηάξσλ (stem-cell commitment) θαη ζηε δηαθνξνπνίεζε θαη αλαγέλλεζε ηζηψλ θαη νξγάλσλ (12). Δπηπιένλ, έρεη δεηρζεί φηη ην ζπκπιήξσκα ζρεηίδεηαη κε ηνλ θπηηαξηθφ πνιιαπιαζηαζκφ, ηελ θπηηαξηθή επηβίσζε θαη ηελ απφπησζε (13) ΟΓΟΗ ΔΝΔΡΓΟΠΟΗΖΖ ΣΟΤ ΤΜΠΛΖΡΩΜΑΣΟ Πξνυπφζεζε γηα ηελ εθδήισζε ησλ βηνινγηθψλ ηδηνηήησλ ηνπ ζπκπιεξψκαηνο απνηειεί ε ελεξγνπνίεζε ησλ θιαζκάησλ, ε νπνία αθνινπζεί πάληνηε κηα θαζνξηζκέλε αιιεινπρία. Ζ ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο κπνξεί λα γίλεη κέζσ ηξηψλ δηαθξηηψλ νδψλ: ηεο θιαζηθήο νδνχ, ηεο ελαιιαθηηθήο θαη ηεο ιεθηηληθήο νδνχ, αλάινγα κε ην αξρηθφ εξέζηζκα ην νπνίν ζα ππξνδνηήζεη ηελ ελεξγνπνίεζε. Ζ θιαζηθή νδφο ελεξγνπνηείηαη απφ ηελ παξνπζία ζπκπιφθνπ αληηγφλνπ-αληηζψκαηνο, ε ελαιιαθηηθή απφ ηελ πξφζδεζε ελφο ζπζηαηηθνχ ηνπ ζπκπιεξψκαηνο ζηελ επηθάλεηα ηνπ παζνγφλνπ, ελψ ε ιεθηηληθή νδφο απφ ηε ζχλδεζε ελφο ζπζηαηηθνχ ην νξνχ (κηα ιεθηίλε ή θηθνιίλε)

13 13 ζε πδαηαλζξαθηθέο δνκέο ηεο βαθηεξηαθήο επηθάλεηαο (14). Δηθόλα 1.2: Απεηθφληζε ησλ ηξηψλ νδψλ ελεξγνπνηήζεσο ηνπ ζπκπιεξψκαηνο, ηεο θιαζηθήο, ηεο ιεθηηληθήο θαη ηεο ελαιιαθηηθήο, θαζψο θαη ηεο ιπηηθήο νδνχ ζηελ νπνία νη παξαπάλσ ζπγθιίλνπλ.

14 14 ΚΛΑΗΚΖ ΟΓΟ Ζ θιαζηθή νδφο ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο, απνηειεί έλαλ απφ ηνπο ζεκαληηθφηεξνπο κεραληζκνχο επίθηεηεο αλνζίαο. Όπσο αλαθέξζεθε παξαπάλσ, ε ελεξγνπνίεζε ηεο νδνχ είλαη θαηεπζπλφκελε απφ αληηζψκαηα. πγθεθξηκέλα, ηα αληηζψκαηα ηα νπνία κπνξνχλ λα ελεξγνπνηήζνπλ ηελ θιαζηθή νδφ είλαη είηε νξηζκέλνη ππφηππνη ηεο θιάζεο IgG (IgG 1 IgG 2 IgG 3 ) είηε αληηζψκαηα IgM. Ζ θιαζηθή νδφο εθθηλεί φηαλ ε ππνκνλάδα C1q ηνπ πξψην ζπζηαηηθφ ηνπ ζπκπιεξψκαηνο, C1, δεζκεπηεί ζηελ Fc πεξηνρή ηνπ ζπκπιφθνπ αληηγφλνπαληηζψκαηνο, ην νπνίν κπνξεί λα είλαη είηε δηαιπηφ, είηε πξνζδεδεκέλν πάλσ ζε θχηηαξν-ζηφρν. Σν ζπζηαηηθφ C1 ππάξρεη ζηνλ νξφ σο καθξνκνξηαθφ ζχκπιεγκα, απνηεινχκελν απφ ηξεηο ππνκνλάδεο: ηε C1q (1 κφξην), ηε C1r (2 κφξηα) θαη ηε C1s (2 κφξηα), νη νπνίεο ζηαζεξνπνηνχληαη κε ηελ παξνπζία ηφλησλ Ca ++. Ζ αιιειεπίδξαζε ησλ αληηζσκάησλ κε ηελ ππνκνλάδα C1q, επάγεη αιιαγέο ζηε ζηεξενδηακφξθσζε ηνπ κνξίνπ C1, νη νπνίεο κε ηε ζεηξά ηνπο νδεγνχλ ζηελ ελεξγνπνίεζε ησλ ππνκνλάδσλ C1r θαη C1s, νη νπνίεο παξνπζίαδνπλ δξαζηηθφηεηα ζεξηλνπξσηεαζψλ. ηε ζπλέρεηα, έπεηηα απφ ηελ ελεξγνπνίεζε ηνπ C1, αθνινπζεί ε δέζκεπζή ηνπ ζην ζπζηαηηθφ C4, κέζσ ηεο ππνκνλάδαο C1s θαη ε επαθφινπζε πξσηεφιπζε ηνπ C4 ζε δχν ζξαχζκαηα, ζην C4a θαη ζην C4b. Σν ζξαχζκα C4b ελψλεηαη κε ηελ επηθάλεηα-ζηφρν θνληά ζην C1. Έπεηηα, ην πξνέλδπκν C2 πξνζδέλεηαη ζηελ επηθάλεηα ηνπ C4b (ζχλδεζε εμαξηψκελε απφ ηφληα Mg ++ ), φπνπ δηαζπάηαη απφ ην γεηηνληθφ C1s ζε δχν ζξαχζκαηα, ζην C2a θαη ζην C2b. Απφ απηά, ην κηθξφηεξν ζξαχζκα (C2b) δηαρέεηαη. Σν ελδπκηθφ ζχκπινθν C4bC2a ην νπνίν πξνθχπηεη, απνηειεί πιένλ ηελ θνλβεξηάζε ηνπ C3, ε νπνία θαηαιχεη ηε δηάζπαζή ηνπ ζε C3a θαη ζε C3b. Σν ζπζηαηηθφ C3 απνηειεί θνκβηθφ κφξην ησλ ηξηψλ νδψλ ελεξγνπνηήζεσλ ηνπ ζπκπιεξψκαηνο. Σν ζξαχζκα ηνπ C3b δξα σο νςσλίλε, ελψ ην C3a, ην νπνίν πεξηθιείεη ηα αλνζνζπκπιέγκαηα θαη ηα αληηγφλα, ειεπζεξψλεηαη ζηελ πγξή θάζε θαη δξα σο αλαθπιαηνμίλε. ην ζπγθεθξηκέλν βήκα ηνπ θαηαξξάθηε αληηδξάζεσλ ελεξγνπνίεζεο έρνπκε ηεξάζηηα ελίζρπζε, θαζψο έλα θαη κνλαδηθφ κφξην θνλβεξηάζεο ηνπ C3 κπνξεί λα δεκηνπξγήζεη πάλσ απφ 200 κφξηα C3b. Απφ ηα πξνθχπηνληα θιάζκαηα κεηά ηελ ελεξγνπνίεζε ηνπ C3, έλα κέξνο απφ ην C3b ζπλδέεηαη κε ην C4b2a, πξνθεηκέλνπ λα ζρεκαηηζηεί έλα ζχκπινθν ην νπνίν νλνκάδεηαη θνλβεξηάζε ηνπ C5 (15; 16).

15 15 Δλ ζπλερεία, ην ζχκπινθν ηεο θνλβεξηάζεο ηνπ C5 δηαζπά ην ζπζηαηηθφ C5 ζε C5a θαη ζε C5b (17). Σν πξψην απφ ηα δχν απηά ζξαχζκαηα, ην C5a, δηαρέεηαη θαη παξνπζηάδεη ηζρπξή δξαζηηθφηεηα αλαθπιαηνμίλεο, ελψ ην δεχηεξν, ην C5b, ζπλδέεηαη ζηελ αληηγνληθή επηθάλεηα, δξψληαο σο νςσλίλε. Σν πξνζδεδεκέλν απηφ κφξην C5b ππξνδνηεί ην ζρεκαηηζκφ ηνπ ζπκπιφθνπ ιχζεσο MAC (Membrane Attack Complex). Δηθόλα 1.3: Α: Ζ θιαζηθή νδφο ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο. Β: Γνκηθή αλαπαξάζηαζε ηνπ ζπζηαηηθνχ C1. ΔΝΑΛΛΑΚΣΗΚΖ ΟΓΟ Ζ ελαιιαθηηθή νδφο ηνπ ζπκπιεξψκαηνο αλαθαιχθζεθε αξρηθά απφ ηνλ Pillemer θαη ηνπο ζπλεξγάηεο ηνπ, σο «ην ζχζηεκα ηεο πξνπεξδίλεο» (18). ε αληίζεζε κε ηελ εηδηθή αιιειεπίδξαζε πξσηεΐλεο-πξσηεΐλεο ή πξσηεΐλεο-πδαηαλζξαθηθψλ νκάδσλ, ε νπνία είλαη ραξαθηεξηζηηθή ζηελ ελεξγνπνίεζε ηεο θιαζηθήο θαη ιεθηηληθήο νδνχ αληίζηνηρα, ε ελαιιαθηηθή νδφο ππξνδνηείηαη απζφξκεηα, απφ ζπζηαηηθά ηεο επηθάλεηαο ηνπ μεληζηή. πγθξνηείηαη δε, απφ ηέζζεξεηο πξσηεΐλεο: ην C3, ηνλ παξάγνληα Β, ηνλ παξάγνληα D θαη ηελ πξνπεξδίλε, εθ ησλ νπνίσλ νη ηξεηο ηειεπηαίεο απαληψληαη απνθιεηζηηθά ζηελ ελαιιαθηηθή νδφ (19; 20; 21). Πην ζπγθεθξηκέλα, ε ελαιιαθηηθή νδφο ελεξγνπνηείηαη κε ηνπο εμήο ηξφπνπο: α) κε πνιπζαθραξίηεο, θπξίσο κηθξνβηαθήο πξνειεχζεσο (πρ. δπκνδάλε, ηλνπιίλε, ηεηρνετθφ νμχ, LPS), β) κε νξηζκέλα παξάζηηα (πρ. Schistosoma mansoni) γ) κε εξπζξά αηκνζθαίξηα δηαθφξσλ δψσλ, δ) κε ζπζζσκαηνπνηεκέλα IgG4 θαη IgA, δ) κε

16 16 ζπζζσκαηνπνηεκέλα θιάζκαηα (Fab ) 2 (22). Δπίζεο, πξφζθαηεο κειέηεο δείρλνπλ φηη ε ελεξγνπνίεζε ηεο ελαιιαθηηθήο νδνχ ηνπ ζπκπιεξψκαηνο κπνξεί λα ζπκβεί θαη κέζσ ηεο ελεξγνπνίεζεο ηεο πξνπεξδίλεο ζε ζπγθεθξηκέλεο επηθάλεηεο ζηφρνπο (23). Ζ ελεξγνπνίεζε ηεο ελαιιαθηηθήο νδνχ ιακβάλεη ρψξα κε ηελ απζφξκεηε πδξφιπζε θαη ελεξγνπνίεζε ηνπ ηξίηνπ ζπζηαηηθνχ ηνπ ζπκπιεξψκαηνο Σν C3, πεξηέρεη έλαλ αζηαζή ζεηνεζηεξηθφ δεζκφ, ν νπνίνο ππφθεηηαη ζε αξγή απηφκαηε πδξφιπζε ζηα θιάζκαηα C3a θαη C3b, ζε ζπλνιηθφ πνζνζηφ 1% πεξίπνπ ηνπ ζπλφινπ ησλ κνξίσλ ηνπ C3 (24; 25). Σν C3b έρεη ηελ ηθαλφηεηα λα πξνζδέλεηαη ζε πδξνμπινκάδεο ή ακηλνκάδεο ζε μέλεο αληηγνληθέο επηθάλεηεο (ζε βαθηεξηαθά θχηηαξα θαη ητθά κφξηα) ή αθφκε θαη ζηα θχηηαξα ηνπ ίδηνπ ηνπ μεληζηή. Παξφια απηά, ηα θχηηαξα ηνπ μεληζηή πξνζηαηεχνληαη απφ ην ζπγθεθξηκέλν κφξην, ιφγσ ησλ πςειψλ επηπέδσλ ζηαιηθνχ νμένο ηα νπνία πεξηέρνληαη ζηηο θπηηαξηθέο κεκβξάλεο ησλ πεξηζζφηεξσλ ζειαζηηθψλ. Απφ ηε ζηηγκή πνπ ζα δεκηνπξγεζεί ην ζξαχζκα C3b, ζπλδέεηαη κε ηνλ παξάγνληα B, κε ηελ παξεκβνιή ηφλησλ Mg ++, νδεγψληαο ζην ζρεκαηηζκφ ηεο θνλβεξηάζεο ηνπ C3 (26). Ζ δεκηνπξγία ηνπ ζπκπιφθνπ απηνχ, νδεγεί ζε αιιαγή ζηε ζηεξενδηάηαμε ηνπ παξάγνληα Β θαη εθηίζεηαη κε απηφλ ηνλ ηξφπν, κηα ζέζε - ππφζηξσκα ζηελ νπνία ζα ζπλδεζεί ν παξάγνληαο D (27). ηε ζπλέρεηα, ν παξάγνληαο D θαηαιχεη ηε δηάζπαζε ηνπ παξάγνληα Β, νδεγψληαο ζηε δεκηνπξγία ηνπ ζπκπιφθνπ C3bBb, ην νπνίν απνηειεί ηελ θνλβεξηάζε ηνπ C3 ηεο ελαιιαθηηθήο νδνχ, θαη αληηζηνηρία κε ην ζχκπινθν C4b2a ηεο θιαζζηθήο νδνχ. Ζ ζπγθεθξηκέλε θνλβεξηάζε, ζηαζεξνπνηείηαη απφ κηα γιπθνπξσηεΐλε ηνπ νξνχ, ηελ πξνπεξδίλε, ε νπνία παξεκπνδίδεη ηε κεηαηξνπή ηνπ ζην ελδπκηθά αδξαλέο θιάζκα Βi. ηελ ελαιιαθηηθή νδφ έρνπκε επίζεο ελίζρπζε, θαζψο έλα κφξην ηεο θνλβεξηάζεο ηνπ C3 θαηαιχεη ηε δηάζπαζε πνιιψλ κνξίσλ C3. Δπηπιένλ, ε θνλβεξηάζε απηή δξα θαη ζηελ θιαζηθή νδφ, αθνχ ζρεκαηηζηεί ην ζξαχζκα C3b, επνκέλσο έρνπκε πεξεηαίξσ ελίζρπζε ηεο ελεξγνπνίεζεο ηνπ ζπζηήκαηνο ηνπ ζπκπιεξψκαηνο (27). Σέινο, κε ηελ πξνζζήθε ελφο αθφκα κνξίνπ C3b, ε θνλβεξηάζε ηνπ C3 κεηαηξέπεηαη ζε θνλβεξηάζε ηνπ C5 (C3bBbC3b), ε νπνία αθνινχζσο δηαζπά ην C5 ζε C5a θαη C5b. Σν ηειεπηαίν απηφ ζξαχζκα, νδεγεί ζην ζρεκαηηζκφ ηνπ ζπκπιφθνπ ΜΑC (28; 29).

17 17 Δλδηαθέξνλ παξνπζηάδνπλ πξφζθαηα δεδνκέλα, ζχκθσλα κε ηα νπνία είλαη δπλαηφλ λα ελεξγνπνηεζεί ε ελαιιαθηηθή νδφο απεπζείαο απφ ηελ ελεξγνπνίεζε ηεο πξνπεξδίλεο. ηελ πεξίπησζε απηή, ε ίδηα ε πξνπεξδίλε κπνξεί λα πξνζδεζεί απεπζείαο ζε θχηηαξα ζηφρνπο ή βαθηεξηαθέο επηθάλεηεο θαη λα πξνάγεη ηε θαγνθπηηάξσζε ηνπ ζηφρνπ (30). Δηθόλα 1.4: Ζ ελαιιαθηηθή νδφο ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο. ΛΔΚΣΗΝΗΚΖ ΟΓΟ Ζ ιεθηηληθή νδφο παξέρεη ζηνλ μεληζηή κηα πνξεία ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο αλεμάξηεηε ησλ αληηζσκάησλ. Πξφθεηηαη γηα έλα αξραίν θπινγελεηηθά ζχζηεκα, ην νπνίν πξνεγείηαη ηεο πξνζαξκνζηηθήο αλνζίαο θαη ηεο θιαζηθήο νδνχ ελεξγνπνηήζεσο ηνπ ζπκπιεξψκαηνο, ελψ απνηειεί έλα ζχζηεκα άκπλαο κε ηδηαίηεξε ζεκαζία, ηδηαίηεξα ζε θαηψηεξνπο εμειηθηηθά νξγαληζκνχο, φπσο είλαη ηα νπξνρνξδσηά θαη ηα θεθαινρνξδσηά, απφ ηνπο νπνίνπο ιείπεη ην ζχζηεκα επίθηεηεο αλνζίαο. ηα ζειαζηηθά, ε ιεθηηληθή νδφο παξέρεη ηελ πξψηε γξακκή άκπλαο θαηά ηε δηάξθεηα ηεο ιαλζάλνπζαο θάζεο (lag phase), ε νπνία πξνεγείηαη ηεο έλαξμεο ηεο ελεξγνπνίεζεο ηεο επίθηεηεο αλνζίαο (31; 32; 33). Ζ ιεθηηληθή νδφο ελεξγνπνίεζεο εθθηλεί κέζσ δηαιπηψλ ζπζηαηηθψλ ηνπ νξνχ, ηα νπνία αλαγλσξίδνπλ ζπγθεθξηκέλα πδαηαλζξαθηθά κνηίβα ζε κηθξνβηαθέο επηθάλεηεο. Μέρξη ζήκεξα έρνπλ πεξηγξαθεί δχν ηχπνπ ηέηνηα κφξηα, νη ιεθηίλεο νη νπνίεο πξνζδέλνληαη ζηε καλφδε (mannan-binding lectins, MBL) θαη νη θηθνιίλεο (34; 35).

18 18 Δηθόλα 1.5: ρεκαηηθή αλαπαξάζηαζε ηεο πξφζδεζεο ησλ πξσηετλψλ MBL ζε αληηγφλα θπηηαξηθψλ επηθαλεηψλ. Γνκηθά, ηα κφξηα απηά παξνπζηάδνπλ πνιχ κεγάιε νκνηφηεηα, θαζψο απνηεινχλ νκνηξηκεξή κίαο θαη κνλαδηθήο πνιππεπηηδηθήο αιπζίδαο, ε νπνία θέξεη κηα ακηλνηειηθή πεξηνρή παξφκνηα κε ηνπ θνιιαγφλνπ θαη κηα θαξβνμπηειηθή πεξηνρή αλαγλψξηζεο πδαηαλζξάθσλ (CRD) (Δηθ. 1.5). ην πιάζκα, ηα βαζηθά απηά νκνηξηκεξή ζρεκαηίδνπλ κεγαιχηεξεο ηάμεο νιηγνκεξή, ηα νπνία κε ηε ζεηξά ηνπο ζρεκαηίδνπλ ζχκπινθα κε ηηο πξσηετλάζεο ζεξίλεο νη νπνίεο ζρεηίδνληαη κε ηηο MBL (MBL-associated serine proteases, MASP-1, -2, θαη -3) (36; 37). Παιαηφηεξα πηζηεχνληαλ φηη κφλν ε MASP-2 κπνξεί λα ελεξγνπνηήζεη ην ζπκπιήξσκα (38). Παξφια απηά, ζήκεξα έρεη δεηρζεί φηη θαη νη MASP-1 θαη -3 είλαη ζε ζέζε λα ελεξγνπνηήζνπλ ηε ιεθηηληθή νδφ (39). Ζ έλαξμε ηεο ιεθηηληθήο νδνχ, φπσο πξναλαθέξζεθε, ππξνδνηείηαη απφ ηε δέζκεπζε ηεο πξσηεΐλεο MBL πάλσ ζην παζνγφλν. Ζ δέζκεπζε απηή έρεη σο απνηέιεζκα ηελ πξσηενιπηηθή δηάζπαζε ησλ κνξίσλ C4 θαη C2. Απφ ηα ζξαχζκαηα πνπ πξνθχπηνπλ, ηα C4b θαη C2a ζπγθξνηνχλ ηελ θνλβεξηάζε ηνπ C3 (C4bC2a), ε νπνία είλαη ε ίδηα

19 19 θνλβεξηάζε κε εθείλε πνπ δεκηνπξγείηαη θαηά ηελ ελεξγνπνίεζε ηεο θιαζηθήο νδνχ (40). Ζ θνλβεξηάζε απηή, ζηε ζπλέρεηα δηαζπά ην κφξην C3, νδεγψληαο ζην ζρεκαηηζκφ ηεο θνλβεξηάζεο ηνπ C5, ε νπνία κε ηε ζεηξά ηεο θαηαιχεη ηε δηάζπαζε ηνπ C5 θαη ηειηθά, φπσο θαη νη πξνεγνχκελεο νδνί, νδεγεί ζην ζρεκαηηζκφ ηνπ ζπκπιφθνπ MAC. Δηθόλα 1.6: Ζ ιεθηηληθή νδφο ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο ΣΟ ΣΡΗΣΟ ΤΣΑΣΗΚΟ ΣΟΤ ΤΜΠΛΖΡΩΜΑΣΟ (C3) Αλεμάξηεηα απφ ηνλ ηξφπν κε ηνλ νπνίν ελεξγνπνηείηαη ην ζχζηεκα ηνπ ζπκπιεξψκαηνο θαη νη ηξεηο νδνί ελεξγνπνίεζεο ζπγθιίλνπλ ζηελ ελεξγνπνίεζε ηνπ κνξίνπ C3. Σο γονίδιο C3 ηνλ άλζξσπν, ην γνλίδην ην νπνίν θσδηθνπνηεί ην C3 έρεη έθηαζε 41 kb θαη είλαη ηνπνζεηεκέλν ζην ρξσκφζσκα 19, ζηε ζέζε 19p13.3-p13 (41). Απνηειείηαη απφ 41 εμψληα, ην κήθνο ησλ νπνίσλ θπκαίλεηαη απφ βάζεηο, εθ ησλ νπνίσλ 16 θσδηθνπνηνχλ ηε β-αιπζίδα θαη 25 ηελ α-αιπζίδα. Η πρωτεανη C3 Ζ πξσηεΐλε C3 απνηειεί ηελ αθζνλφηεξε πξσηεΐλε ηνπ νξνχ κεηαμχ ησλ ζπζηαηηθψλ ηνπ ζπκπιεξψκαηνο (1-2 mg/ml). Μαδί κε ηηο νκφινγεο πξσηεΐλεο C4 θαη C5, αλήθεη ζηελ νηθνγέλεηα ηεο α2-καθξνζθαηξίλεο (α2m). Οη πξσηεΐλεο πνπ αλήθνπλ ζε απηή ηελ νηθνγέλεηα εκθαλίζηεθαλ πξηλ απφ 700 εθαηνκκχξηα ρξφληα (42). Δληνπίδνληαη ζε φια ηα κεηάδσα θαη ε πξσηαξρηθή ηνπο ιεηηνπξγία ζρεηίδεηαη κε ηελ άκπλα ηνπ μεληζηή (43).

20 20 Άιια θαιά κειεηεκέλα κέιε ηεο νηθνγέλεηαο πεξηιακβάλνπλ ηνλ παγθφζκην αλαζηνιέα πξσηετλαζψλ ηεο α2-καθξνζθαηξίλεο (universal protease inhibitor α2-macroglobulin) θαη ηηο πξσηεΐλεο ησλ εληφκσλ θαη ησλ λεκαησδψλ πνπ πεξηέρνπλ ζεηνεζηέξεο (thioestercontaining proteins, TEPs) (44). Ζ πξσηαξρηθή δνκή ηνπ κνξίνπ C3 (ΜΒ 188 kd) απνηειείηαη απφ of ακηλνμέα, ζπκπεξηιακβαλνκέλσλ 22 ακηλνμέσλ ηα νπνία απνηεινχλ ην πεπηίδην ζήκαηνο. Σν ζπγθεθξηκέλν κφξην απνηειείηαη απφ δχν αιπζίδεο, ηε β (ΜΒ 75kD, θαηάινηπα 1-645) θαη ηελ α (ΜΒ 113 kd, θαηάινηπα ) νη νπνίεο ζπλδένληαη κεηαμχ ηνπο κε έλαλ δηζνπιθηδηθφ δεζκφ θαη κε νκνηνπνιηθέο αιιειεπηδξάζεηο (45). Ζ θξπζηαιιηθή δνκή ηνπ C3, απνθαιχπηεη ηελ παξνπζία 13 πεξηνρψλ, ζπκπεξηιακβαλνκέλσλ νθηψ νκνιφγσλ πεξηνρψλ καθξνζθαηξίλεο (Macroglobulin Domains, MG). Μεηαμχ απηψλ ησλ πεξηνρψλ βξίζθνληαη ηέζζεξηο ιεηηνπξγηθά ζεκαληηθέο πεξηνρέο, ηεο αλαθπιαηνμίλεο (ΑΝΑ), ηνπ ζεηνεζηεξηθνχ δεζκνχ (TED), ηνπ CUB (Complement C1r/C1s, Uegf, Bmp1) θαη ηεο NTR (Netrin-like) ή C345C. Ζ πεξηνρή ΑΝΑ, απειεπζεξψλεηαη θαηά ηελ ελεξγνπνίεζε ηνπ κνξίνπ θαη εκπιέθεηαη ζηε θιεγκνλψδε απφθξηζε, ελψ ε TED, θέξεη ην ζεηνεζηεξηθφ δεζκφ ν νπνίνο είλαη ππεχζπλνο γηα ηελ νκνηνπνιηθή πξφζδεζε ηνπ ζξαχζκαηνο C3b ζην ζηφρν ηνπ. Οη δχν πεξηνρέο CUB (Complement C1r/C1s, Uegf, Bmp1), απνηεινχλ δνκηθά ζπληεξεκέλα κνηίβα, ηα νπνία βξίζθνληαη ζρεδφλ απνθιεηζηηθά ζε εμσθπηηάξηεο πξσηεΐλεο θαη πξσηεΐλεο ηνπ πιάζκαηνο ζρεηηδφκελεο κε κεκβξάλεο, πνιιέο απφ ηηο νπνίεο ξπζκίδνληαη αλαπηπμηαθά (46). Σέινο, ε ιεηηνπξγία ηεο εληνπηδφκελε C345C ζηελ θαξβνμπηειηθή πεξηνρή ηεο πξσηεΐλεο δελ έρεη δηεπθξηληζηεί επαξθψο. Λεηηνπξγηθά, ε θαηάηκεζε ηνπ κνξίνπ κεηαμχ ησλ θαηαινίπσλ 77 θαη 78 (Arg-Ser) ηεο α- αιπζίδαο, κέζσ ηεο θνλβεξηάζεο ηνπ C3 είηε ηεο θιαζηθήο είηε ηεο ελαιιαθηηθήο νδνχ, νδεγεί ζηε δεκηνπξγία ησλ ζξαπζκάησλ C3b θαη C3a. Σν C3b απνθηά ηφηε πξνζσξηλά ηελ ηθαλφηεηα λα δεζκεχεηαη νκνηνπνιηθά, κε έλα εζηεξηθφ ή ακηδηθφ δεζκφ ζηηο πδξνμπι- ή ακηλν- νκάδεο νη νπνίεο βξίζθνληαη ζηηο θπηηαξηθέο επηθάλεηεο, ζηνπο ζχλζεηνπο πδαηάλζξαθεο ή ζηα αλνζνινγηθά ζχκπινθα. Ζ νκνηνπνιηθή πξφζδεζε ηνπ C3b κεζνιαβείηαη απφ ηε ζεηνεζηεξηθή νκάδα ηνπ, ελψ ζε απηήλ εκπιέθεηαη θαη ε ζνπιθσληνκέλε θπζηεΐλε (Cys) 988 θαη ε θαξβνλπινκάδα ηνπ γινπηακηληθνχ νμένο (Glu) 990. Καη νη δχν απηέο νη νκάδεο βξίζθνληαη ζην C3d ζξαχζκα ηνπ κνξίνπ C3.

21 21 Η βιολογική δράςη του ςυςτατικογ C3 Μεηαμχ ησλ ζπζηαηηθψλ ηνπ ζπκπιεξψκαηνο, ην C3 θαηέρεη πνιιαπινχο ξφινπο, εμαηηίαο ησλ δηαθνξεηηθψλ ραξαθηεξηζηηθψλ πεξηνρψλ πνπ απαληψληαη ζην κφξην, ησλ δηαθφξσλ ππνδνρέσλ ζηνπο νπνίνπο δεζκεχεηαη θαη εμαηηίαο ησλ πξσηενιπηηθψλ δηαζπάζεσλ ηηο νπνίεο πθίζηαηαη. Αλαθνξηθά κε ηηο ηειεπηαίεο, αξθεηέο απφ ηηο βηνινγηθέο δξάζεηο ηνπ κνξίνπ κεζνιαβνχληαη απφ ηελ ελεξγνπνίεζή ηνπ κέζσ ηεο δηάζπαζεο ηνπ ελδνκνξηαθνχ ζεηνεζηεξηθνχ δεζκνχ πνπ πεξηέρεη. Δπίζεο, ηα παξαγφκελν ελεξγφ ζξαχζκα, C3b, κπνξεί λα ππνζηεί δηαδνρηθνχο γχξνπο δηάζπαζεο νη νπνίνη νδεγνχλ ζε δηαθνξεηηθά ζξαχζκαηα (ic3b, C3dg), θαζέλα απφ ηα νπνία κπνξεί λα αληηδξά κε ππνδνρείο εθθξαδφκελνπο απφ ηα πεξηζζφηεξα θχηηαξα ηνπ αλνζνπνηεηηθνχ. Σα ραξαθηεξηζηηθά απηά πξνζδίδνπλ κηα πνηθηιία δηαθνξεηηθψλ ηδηνηήησλ ζην C3 θαη ζηα ζξαχζκαηά ηνπ, ζπκπεξηιακβαλνκέλεο ηεο δξάζεο ηνπο σο δηπνιηθά πξνζδέκαηα κεηαμχ αληηγφλσλ (Ag) θαη θπηηάξσλ, σο ηειεζηέο κεηαγσγήο κελπκάησλ, σο νςσλίλεο ή αλαθπιαηνμίλεο. Σν C3 δηαδξακαηίδεη ζεκαληηθφ ξφιν ζηελ έκθπηε αλνζία, κέζσ ηεο ζπκκεηνρήο ηνπ ζηε θαγνθπηηάξσζε (47), ζηε ρεκεηνηαμία θπηηάξσλ ηνπ αλνζνπνηεηηθνχ θαη ηελ πξφζδεζή ηνπ ζε αλνζνζπκπιέγκαηα. (48). Ο ξφινο ηνπ C3 ζηελ επίθηεηε αλνζία έρεη δεηρζεί ηφζν απφ in vivo, φζν θαη απφ in vitro πεηξάκαηα, ηα νπνία απνδεηθλχνπλ ηελ πνιχπινθε δξάζε ηνπ ζε δηαθνξεηηθά επίπεδα, ζπκπεξηιακβαλνκέλεο ηεο απειεπζέξσζεο θπηηαξνθηλψλ, ηνλ πνιιαπιαζηαζκφ ησλ T- θπηηάξσλ, ηε ξχζκηζε ηεο αλάπηπμεο ησλ T θπηηάξσλ θαη ηελ ελεξγνπνίεζε θαη δηαθνξνπνίεζε ησλ Β θπηηάξσλ (49). Πξφζθαηα, φιν θαη πεξηζζφηεξεο ιεηηνπξγίεο απνδίδνληαη ζην κφξην ηνπ C3, νη νπνίεο δε ζρεηίδνληαη κε ηελ αλνζία. πγθεθξηκέλα, έρεη πξνηαζεί φηη ππάξρεη ζχλδεζε κεηαμχ ηεο έθθξαζεο ηνπ κνξίνπ ζηελ θπηηαξηθή ζηηβάδα ηνπ βιαζηήκαηνο ησλ αλαγελλψκελσλ άθξσλ ησλ νπξνδειψλ θαη ηεο αλαγέλλεζεο ησλ ηζηψλ απηψλ. Δπίζεο, παξνπζία ηνπ C3 έρεη δηαπηζησζεί ζε θπηηαξηθή ζεηξά θπηηάξσλ βιαζηήκαηνο ηεο κπνγελνχο ζεηξάο, ην νπνίν ππνδεηθλχεη ηελ πηζαλή ζπκκεηνρή ηνπ C3 ζηε κπτθή αλάπηπμε θαη ηε δηαθνξνπνίεζε ησλ κπνβιαζηψλ δηαδηθαζίεο νη νπνίεο εκπιέθνληαη ζηελ αλαθαηαζθεπή ησλ κπψλ, φπσο ζπκβαίλεη παξαδείγκαηνο ράξηλ ζηελ αλαγέλλεζε ησλ άθξσλ. Δπηπιένλ, ην C3 δελ έρεη αληρλεπζεί ζε παξφκνηεο δνκέο εληφο ησλ

22 22 θπζηνινγηθά αλαπηπζζφκελσλ άθξσλ ησλ νπξνδειψλ (50). Σέινο, έρεη δεηρζεί ε ζπκκεηνρή ηνπ κνξίνπ ζηελ αιιειεπίδξαζε σνθπηηάξνπ ζπεξκαηνδσαξίνπ θαηά ηα αξρηθά ζηάδηα ηεο γνληκνπνίεζεο, ζηε ζχληεμε ησλ κεκβξαλψλ ησλ γακεηψλ (51).

23 Ζ ΛΤΣΗΚΖ ΟΓΟ Κνηλή θαηάιεμε θαη ησλ ηξηψλ νδψλ ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο απνηειεί ε ιπηηθή νδφο, κέζσ ηνπ ζρεκαηηζκνχ ηνπ ηειηθνχ ζπκπιφθνπ ιχζεσο (Membrane Attack Complex, MAC) ηεο θπηηαξηθήο κεκβξάλεο. Ζ ιπηηθή νδφο εθθηλεί κε ηε δηάζπαζε ηνπ ζπζηαηηθνχ C5 ζε C5a θαη C5b απφ ηελ θνλβεξηάζε ηνπ C5. ηε ζπλέρεηα, ην ζξαχζκα C5b ζπλδέεηαη ζην C3b, ην νπνίν είλαη ήδε ζπλδεδεκέλν ζηελ επηθάλεηα ηνπ παζνγφλνπ. Ζ ζχλδεζε απηή έρεη σο απνηέιεζκα ηελ έθζεζε κηαο ζέζεσο ζην C5, πάλσ ζηελ νπνία ζα ζπλδεζεί ην ζπζηαηηθφ C6. Αθνινπζεί ινηπφλ ε δεκηνπξγία ελφο ζηαζεξνχ, δηαιπηνχ ζπκπιφθνπ, ηνπ C5b6. Έπεηηα, ην C7 πξνζδέλεηαη ζην C5b6 πξνθεηκέλνπ λα ζρεκαηίζεη ην πδξφθνβν ζχκπινθν C5b67, ην νπνίν κπνξεί λα πξνζθνιιεζεί ραιαξά ζηελ θπηηαξηθή επηθάλεηα, ρσξίο φκσο λα βιάπηεη ηελ αθεξαηφηεηά ηεο. ηε ζπλέρεηα, αθνινπζεί ε πξφζδεζε ηνπ C8 (ζπγθεθξηκέλα ηεο β- αιπζίδαο ηνπ) ζην ήδε πξνζδεδεκέλν ζηε κεκβξάλε ζχκπινθν C5b7. Με ηελ πξφζδεζε απηή ζρεκαηίδεη ην C5b678, ην νπνίν εηζρσξεί βαζχηεξα ζηε κεκβξάλε θαη πξνθαιεί ειαθξηά δηαξξνή ηνπ θπηηαξνπιαζκαηηθνχ πεξηερνκέλνπ. Σέινο, ν ζρεκαηηζκφο ηνπ ηειηθνχ ιπηηθνχ ζπκπιφθνπ νινθιεξψλεηαη κε ηε βαζκηαία πξνζζήθε έσο θαη 18 αληηγξάθσλ ηνπ κνξίνπ C9 ζην C5b678. Ζ πξνζζήθε απηή αιιάδεη ηε δηακφξθσζε ηνπ C9 απφ ζθαηξηθή θαη πδξφθνβε, ζε κηα επηκεθπζκέλε, ακθηπαζή δνκή ε νπνία εηζάγεηαη δηακέζνπ ηεο κεκβξάλεο θαη δηαπεξλά θαη ηελ θπηηαξνπιαζκαηηθή πιεπξά ηεο. Οη αιιαγέο απηέο εθζέηνπλ ζέζεηο γηα ηελ πξφζδεζε, μεηχιηγκα θαη εηζαγσγή ζηε κεκβξάλε, επηπιένλ κνξίσλ C9 (Δηθ. 1.8Β) (52). A B

24 24 Δηθόλα 1.8: A) Αλαπαξάζηαζε ηεο ιπηηθήο νδνχ.b) Απεηθφληζε δηαδνρηθήο ζπγθέληξσζεο ησλ ζπζηαηηθψλ ηνπ ζπκπιφθνπ MAC ζηε κεκβξάλε ηνπ θπηηάξνπ ζηφρνπ. ΣΟ ΤΜΠΛΟΚΟ ΛΤΖ ΜΔΜΒΡΑΝΖ Όπσο πξναλαθέξζεθε, ζε θάζε ζχκπινθν MAC ζπγθεληξψλνληαη κέρξη θαη 18 κφξηα C9, ηα νπνία θαη ζρεκαηίδνπλ ηελ θαιά κειεηεκέλε ζσιελνεηδή δνκή ηνπ θαλαιηνχ πνπ ζρεκαηίδεη ην MAC, ε νπνία είλαη νξαηή ζε εηθφλεο ειεθηξνληθήο κηθξνζθνπίαο (53; 54) (Δηθ. 1.9). Οη πφξνη πνπ ζρεκαηίδνληαη απφ ην ζχκπινθν έρνπλ εμσηεξηθή δηάκεηξν (κέζα ζηε ιηπηδηθή δηπινζηνηβάδα) 115 Å θαη εζσηεξηθή 100 Å (ε πξνεθβνιή πάλσ απφ ηελ θπηηαξηθή επηθάλεηα). Ζ ζσιελνεηδήο απηή δνκή είλαη ραξαθηεξηζηηθή θαη κνηάδεη κε απηήλ πνπ ζρεκαηίδεηαη απφ πξσηεΐλεο πνπ δεκηνπξγνχλ πφξνπο, φπσο είλαη ε πεξθνξίλε, ε κειηηίλε θαη ε θπηνιπζίλε, ε νπνία εθθξάδεηαη ζηα θπηηαξνηνμηθά Σ- ιεκθνθχηηαξα θαζψο θαη ζηα θχηηαξα θπζηθνχο θνληάδεο (ΝΚ cells). Ζ βηνινγηθή δξάζε ηνπ ζπκπιόθνπ MAC Αλαθνξηθά κε ην κεραληζκφ δξάζεο ηνπ ζπκπιφθνπ MAC θαη ηε ζπκβνιή ηνπ ζηελ άκπλα ηνπ μεληζηή, απηφο έγθεηηαη θπξίσο ζηελ νζκσηηθή ιχζε ησλ θπηηάξσλ ζηφρσλ. Οη πφξνη νη νπνίνη ζρεκαηίδνληαη απφ ην ζχκπινθν, είλαη δπλαηφλ λα πξνθαιέζνπλ ηελ νζκσηηθή ιχζε παζνγφλσλ κηθξννξγαληζκψλ, θαζψο κε ηε δηάλνημή ηνπο αθνινπζεί ε παζεηηθή κεηαθίλεζε κηθξψλ δηαιπηψλ κνξίσλ, ηφλησλ θαη λεξνχ. Ζ παξαπάλσ δηαδηθαζία έρεη σο απνηέιεζκα ηελ είζνδν λεξνχ ζηα θχηηαξα, νδεγψληαο ηα ζε νζκσηηθή ιχζε. Δλαιιαθηηθά, ε εγθαηάζηαζε ησλ ηειηθψλ ζπζηαηηθψλ ηνπ ζπκπιεξψκαηνο ζηε θπηηαξηθή κεκβξάλε, είλαη δπλαηφ λα νδεγήζεη ζε θπηηαξηθφ ζάλαην αλεμάξηεηα απφ νζκσηηθή ιχζε, επηηξέπνληαο ζ έλα ζαλαηεθφξν πνζφ αζβεζηίνπ λα εηζέιζεη παζεηηθά ζην θχηηαξν. πγθεθξηκέλα, έρεη δεηρζεί φηη απφ ηα πξψηα γεγνλφηα ηα νπνία αθνινπζνχλ ην ζρεκαηηζκφ ηνπ, είλαη κηα κεγάιε εηζξνή ηφλησλ αζβεζηίνπ ζην θχηηαξν (55; 56) θαη ηα απμαλφκελα επίπεδα εμσθπηηάξηνπ αζβεζηίνπ επηηαρχλνπλ ηελ πξφνδν ηνπ θπηηαξηθνχ ζαλάηνπ (57). Ζ επαθφινπζε θξίζε, έρεη σο θχξην κεζνιαβεηή ην κηηνρφλδξην. πγθεθξηκέλα, ε ππεξβνιηθή εηζξνή ηφλησλ αζβεζηίνπ, πξνθαιεί απψιεηα

25 25 ηνπ κεκβξαληθνχ δπλακηθνχ ηνπ κηηνρνλδξίνπ, ην νπνίν έρεη σο απνηέιεζκα κηα ελεξγεηαθή θξίζε κέζα ζην θχηηαξν, θαζψο νη εμαξηψκελεο απφ ελέξγεηα αληιίεο ηφλησλ, πξνζπαζνχλ λα απνθαηαζηήζνπλ ηελ ηζνξξνπία (58). Ζ επηθίλδπλε απηή θαηάζηαζε γηα ην θχηηαξν επηηείλεηαη απφ ηελ επηπιένλ απψιεηα ATP θαη ησλ πξφδξνκσλ κνξθψλ ηνπ δηακέζνπ ηνπ πφξνπ ηνπ ζπκπιφθνπ MAC πξνο ην εμσθπηηάξην πεξηβάιινλ (59). Ζ κείσζε ηνπ ATP κέζσ ηεο θαηαλάισζήο ηνπ θαη ηεο δηαξξνήο ηνπ, θαζηζηά ην θχηηαξν αλίθαλν λα δηαηεξήζεη ηηο απαξαίηεηεο γηα ηελ επηβίσζή ηνπ κεηαβνιηθέο δηαδηθαζίεο, νδεγψληαο ην ζε λέθξσζε. Παξφια απηά, ην ζχκπινθν MAC δελ είλαη απνηειεζκαηηθφ ζε νξηζκέλα βαθηήξηα. Παξαδείγκαηνο ράξηλ, ηα βαθηήξηα πνπ είλαη Gram-ζεηηθά, δηαζέηνπλ έλα παρχ θπηηαξηθφ ηνίρσκα, ην νπνίν απνηξέπεη ηε δεκηνπξγία ηνπ ζρεκαηηζκνχ ηνπ ζπκπιφθνπ. Ζ απιή απφζεζε ηνπ MAC ζην θχηηαξν δελ πξνθαιεί ηε ιχζε ηνπ (60). Αληίζεηα, ζηα Gram-αξλεηηθά βαθηήξηα, ε ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο πξψηα δηαηξππά ηελ εμσηεξηθή κεκβξάλε, ζηε ζπλέρεηα απνηθνδνκεί ην ιεπηφ θπηηαξηθφ ηνίρσκα θαη ηέινο εθζέηεη ηελ εζσηεξηθή κεκβξάλε ζην ζρεκαηηζκφ ηνπ ζπκπιφθνπ MAC θαη ηελ επαθφινπζε ιχζε. Δίλαη επίζεο δπλαηφλ λα ζηνρεχεη δψλεο εγγχηεηαο (apposition) ηεο εζσηεξηθήο θαη εμσηεξηθήο κεκβξάλεο θαη λα δηαηξππά θαη ηηο δχν ηαπηφρξνλα (61). Πέξα φκσο απφ ηηο ιεηηνπξγίεο ηνπ ζπκπιφθνπ MAC νη νπνίεο ζρεηίδνληαη κε ηε ιχζε, πξφζθαηεο έξεπλεο έρνπλ ζπζρεηίζεη ην ζχκπινθν κε ηηο βηνινγηθέο δηεξγαζίεο ηεο απφπησζεο, ηεο θπηηαξηθήο επηβίσζεο θαη ηεο ελεξγνπνίεζεο θπηηάξσλ. Οη παξαπάλσ δηεξγαζίεο θαίλεηαη λα νδεγνχλ ζηελ αχμεζε ησλ ελδνθπηηάξησλ ηφλησλ Ca ++, είηε άκεζα κε ηελ είζνδφ ηνπο απφ ηνλ πφξν πνπ έρεη δηαλνηρζεί, είηε κέζσ ηεο ελεξγνπνίεζεο ηεο εμφδνπ ηνπ απφ ηηο ελδνθπηηάξηεο απνζήθεο ηφλησλ Ca ++ (62).

26 26 Α Β Δηθόλα 1.9: Α) Φσηνγξαθία απφ ειεθηξνληθφ κηθξνζθφπην πνιπκεξηζκέλσλ κνξίσλ C9. Β) Οπέο ζε επηθάλεηα εξπζξνθπηηάξνπ έπεηηα απφ ηε δξάζε ηνπ ζπκπιφθνπ MAC ΡΤΘΜΗΖ ΣΟΤ ΤΣΖΜΑΣΟ ΣΟΤ ΤΜΛΖΡΩΜΑΣΟ Πξνθεηκέλνπ ην ζχζηεκα ην ζπκπιεξψκαηνο λα αζθήζεη ηε βηνινγηθή ηνπ δξάζε, δηαηεξψληαο ηελ νκνηφζηαζε ηνπ νξγαληζκνχ, είλαη απαξαίηεηε ε ζσζηή ξχζκηζε ηνπ, ψζηε λα απνθεπρζεί ε αλεμέιεγθηε ελεξγνπνίεζε ηνπ θαη λα εμαζθαιηζηεί ε απνθπγή πξφθιεζεο βιαβψλ ζε απηφινγα θχηηαξα. Ζ ζεκαζία ηεο ζσζηήο ξχζκηζεο γίλεηαη εκθαλήο ζε πεξηπηψζεηο έιιεηςεο νξηζκέλσλ ξπζκηζηηθψλ πξσηετλψλ ηνπ ζπκπιεξψκαηνο, πνπ νδεγνχλ ζε παζνινγηθέο θαηαζηάζεηο. Ζ ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο ξπζκίδεηαη απζηεξά ζε δηαθνξεηηθά ζηάδηα κέζσ ηεο δξάζεο πξσηετλψλ, νη νπνίεο δξνπλ αλαζηέιινληαο ή απνζηαζεξνπνηψληαο ηα ελεξγά ζχκπινθα ή θηλεηνπνηψληαο δηαδηθαζίεο πξσηενιπηηθήο απνηθνδφκεζεο ησλ ελεξγνπνηεκέλσλ ζπζηαηηθψλ. Ζ ξχζκηζε απηή επηηπγράλεηαη είηε κέζσ δηαιπηψλ ζηνλ νξφ πξσηετλψλ, είηε κέζσλ κνξίσλ πξνζδεδεκέλσλ ζηηο θπηηαξηθέο κεκβξάλεο (63). πγθεθξηκέλα, ζηελ πξψηε θαηεγνξία πεξηιακβάλνληαη νη πξσηεΐλεο : C1-INH, C4bp, Factor I, Factor H,clusterin θαη S-protein, ελψ ζηε δεχηεξε νη πξσηεΐλεο : CR1, DAF, MCP, CD59 θαη ππνδνρέαο C1q. Αλαθνξηθά κε ην ζηάδην ζην νπνίν ιακβάλεη ρψξα ε ξχζκηζε ηνπ ζπζηήκαηνο ηνπ ζπκιεξψκαηνο, ε ξχζκηζε απηή κπνξεί λα γίλεη α) ζηελ έλαξμε ηεο ελεξγνπνίεζεο, β)

27 27 ζην ζρεκαηηζκφ ησλ θνλβεξηαζψλ (ζηάδην ελίζρπζεο) θαη γ) ζην ζρεκαηηζκφ ηνπ ζπκπιφθνπ MAC. Δηθόλα 1.15: Ρχζκηζε ηνπ ζπζηήκαηνο ηνπ ζπκπιεξψκαηνο κέζσ κεκβξαληθψλ θαη δηαιπηψλ ζηνλ νξφ αλαζηνιέσλ. Α) Ρύζκηζε θαηά ηελ έλαξμε ηεο ελεξγνπνίεζεο Ζ πξσηεΐλε ε νπνία ζπκκεηέρεη ζηελ ξχζκηζε ηνπ ζπζηήκαηνο ηνπ ζπκπιεξψκαηνο θαηά ηελ έλαξμε ηεο ελεξγνπνίεζεο ηνπ είλαη ν αλαζηνιέαο ηνπ C1 (C1-inhibitor, C1- INH), ν νπνίνο δξα θαηά ηελ έλαξμε ηεο θιαζηθήο νδνχ. Πξφθεηηαη γηα κηα ζεξηληθή γιπθνπξσηεΐλε 104 kd, ε νπνία απνηειεί κέινο ηεο νηθνγέλεηαο ησλ αλαζηνιέσλ ησλ ζεξηλνπξσηεαζψλ (serine protease inhibitor, SERPINs) (64; 65) θαη αλαζηέιιεη ηελ πξσηενιπηηθή ηθαλφηεηα ησλ κνξίσλ C1s θαη C1r γηα ηα

28 28 ππνζηξψκαηά ηνπο. Δπηπιένλ, ν ζπγθεθξηκέλνο αλαζηνιέαο απνηξέπεη ηελ ηπραία ελεξγνπνίεζε ηνπ C1, ε νπνία κπνξεί λα παξαηεξείηαη ζηνλ νξφ, αθφκα θαη απνπζία αληηζσκάησλ ζηελ θπθινθνξία. Β) Ρύζκηζε θαηά ηελ ελίζρπζε ηεο ελεξγνπνίεζεο Ζ ξχζκηζε θαηά ην ζηάδην ηεο ελίζρπζεο, επηηπγράλεηαη κε ηε ξχζκηζε ζην επίπεδν ησλ θνλβεξηαζψλ. Οη πξσηεΐλεο νη νπνίεο επηηεινχλ απηή ηε ιεηηνπξγία πεξηιακβάλνπλ ηφζν δηαιπηά ζπζηαηηθά ηνπ νξνχ, φπσο είλαη ε C4- binding protein (C4bp), ν Factor H, ν Factor I θαη ε πξνπεξδίλε, φζν θαη δηακεκβξαληθέο πξσηεΐλεο, φπσο είλαη νη Memmbarne Cofactor Protein (MCP), Decay Accelerating Factor (DAF), Complement Receptor type 1 (CR1), Complement Receptor type 2 (CR2). Απφ ηα παξαπάλσ ξπζκηζηηθά κφξηα, φια αλαζηέιινπλ ηελ ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο, κε εμαίξεζε ηελ πξνπεξδίλε, ε νπνία δξα σο ζεηηθφο ξπζκηζηήο, ζηαζεξνπνηψληαο ηηο θνλβεξηάζεο ηεο ελαιιαθηηθήο νδνχ (66). Γ) Ρύζκηζε θαηά ηε ιπηηθή νδό Ζ ξχζκηζε θαηά ηε ιπηηθή νδφ πξαγκαηνπνηείηαη κε αλαζηνιή ηεο δξάζεο ηνπ ζπκπιφθνπ MAC. Ο κηθξφο ρξφλνο εκηδσήο ηνπ ζπκπιφθνπ C5b67 είλαη ήδε έλαο κεραληζκφο ειέγρνπ. Δάλ ην ζχκπινθν δελ πξνζδεζεί ζηε κεκβξάλε θαη δελ αθνινπζήζεη ε πξφζδεζε ηνπ C8 κέζα ζε ιίγα εθαηνζηά ηνπ ρηιηνζηνχ ηνπ δεπηεξνιέπηνπ, ηφηε ην ζχκπινθν C5b67 δελ κπνξεί λα πξνζδέζεη ην C9 θαη επνκέλσο ζηακαηά ε ελεξγνπνίεζε ηεο ιπηηθήο νδνχ (67). Δπηπιένλ, ε ξχζκηζε επηηειείηαη κε ηξεηο γιπθνπξσηεΐλεο, ηελ πξνηεθηίλε, ηε βηηξνλεθηίλε θαη ηελ θιαζηεξίλε ΒΗΟΤΝΘΔΖ ΣΩΝ ΠΡΩΣΔΗΝΩΝ ΣΟΤ ΤΜΠΛΖΡΩΜΑΣΟ Σα επαηνθχηηαξα θαη ηα κνλνθχηηαξα ηνπ αίκαηνο απνηεινχλ ηα βαζηθά ζεκεία ζχλζεζεο ησλ πξσηετλψλ ηνπ ζπκπιεξψκαηνο. Πην ζπγθεθξηκέλα, ηo ήπαξ είλαη ππεχζπλν γηα ηε βηνζχλζεζε πεξίπνπ ηνπ 80-90% ησλ πξσηετλψλ ηνπ ζπκπιεξψκαηνο, κε εμαίξεζε ηα ζπζηαηηθά C1q, παξάγνληα D θαη C7, αλ θαη ε ζχλζεζε απφ ηα κνλνθχηηαξα κπνξεί λα είλαη εμίζνπ ζεκαληηθή ζε πεξηνρέο θιεγκνλήο.

29 29 Γεληθά ε δηείζδπζε ησλ πξσηετλψλ ηνπ ζπκπιεξψκαηνο απφ ην πιάζκα ζε δηάθνξνπο ηζηνχο πεξηνξίδεηαη απφ ην κεγάιν κέγεζνο ησλ ζπζηαηηθψλ ηνπ, ηδηαίηεξα ζε πξνζηαηεπφκελεο πεξηνρέο, φπσο πρ. είλαη ν εγθέθαινο, φπνπ έρνπκε πεξηνξηζκφ εηζφδνπ ιφγσ ηνπ αηκαηνεγθεθαιηθνχ θξαγκνχ. Γηα ην ιφγν απηφ, ζε νξηζκέλνπο ηζηνχο παξαηεξείηαη ηνπηθή ζχλζεζε ησλ ζπζηαηηθψλ ηνπ ζπκπιεξψκαηνο (68) ΓΟΜΗΚΑ ΚΑΗ ΡΤΘΜΗΣΗΚΑ ΓΟΝΗΓΗΑ ΣΟΤ ΤΜΠΛΟΚΟΤ MAC Α) ΓΟΜΗΚΑ ΓΟΝΗΓΗΑ ΣO ΤΣΑΣΙΚΟ C6 Σν γνλίδην C6 απνηειείηαη απφ bps θαη πεξηέρεη 18 εμψληα, ελψ ηνπνζεηείηαη ζην κηθξφ βξαρίνλα ηνπ 5 νπ ρξσκνζψκαηνο, ζηε ζέζε p13.1.to παξαγφκελν mrna πθίζηαηαη ελαιιαθηηθή ζπξξαθή, κε απνηέιεζκα λα παξάγνληαη δχν ηζνκνξθέο κεηαγξάθσλ, ηα νπνία θσδηθνπνηνχλ ηελ ίδηα πξσηεΐλε. Ζ πξσηεΐλε C6 απνηειείηαη απφ 913 ακηλνμέα, εθ ησλ νπνίσλ ηα 21 πξψηα απνηεινχλ ηελ αιιεινπρία ζήκαηνο θαη έρεη κνξηαθφ βάξνο 120kD. Πεξηέρεη κεγάιν αξηζκφ θπζηετλψλ, ζπλνιηθά 64, νη νπνίεο ζπλδένληαη κεηαμχ ηνπο κε 32 δηζνπιθηδηθνχο δεζκνχο. Γέθα δηαθξηηέο δνκηθά πεξηνρέο έρνπλ ραξαθηεξηζηεί ζην C6. πγθεθξηκέλα, ηξεηο πεξηνρέο παξνπζηάδνπλ νκνινγία κε ηε ζξνκβνζπνλδίλε (thrombospondin, TSP1,2, 3), κία κε ηνλ ππνδνρέα ιηπνπξσηεΐλεο ρακειήο ππθλφηεηαο (low density lipoprotein receptor, LDLa), κία κε ηελ πεξηνρή MAC/πεξθνξίλεο (MACPF) θαη κία κε ηνλ επηδεξκηθφ απμεηηθφ παξάγνληα (epidermal growth factor, EGF). Δπηπιένλ, έρνπλ αλαγλσξηζηεί δχν πεξηνρέο ζχληνκσλ επαλαιήςεσλ (Short Consensus Repeats, SCRl, 2 ή Complement Control Protein, CCP) θαη δχν πεξηνρέο πνπ ζρεηίδνληαη κε ηνλ παξάγνληα Η (Factor I Membrane Attack Complex, FIMΑC), νη νπνίεο είλαη ππεχζπλεο γηα ηε δέζκεπζε ηνπ C5b (69).

30 30 Δηθόλα 1.10: Ζ πξσηετληθή δνκή ηνπ C6 φπσο πξνθχπηεη έπεηηα απφ αλάιπζε κε ηε ρξήζε ηνπ ινγηζκηθνχ SMART. ΣΟ ΤΣΑΣΙΚΟ C7 Σν γνλίδην C7 έρεη κήθνο bp θαη πεξηέρεη 18 εμψληα, ελψ εληνπίδεηαη ζην κηθξφ βξαρίνλα ηνπ 5 νπ ρξσκνζψκαηνο, ζηε ζέζε 5p13.1. Ζ πξσηεΐλε C7 (ΜΒ 100kD) απνηειείηαη απφ 821 ακηλνμέα. Ζ δνκηθή νξγάλσζή ηεο κνηάδεη αξθεηά κε απηή ηνπ C6 (TSP 2,3, LDLa, MACPF, EGF, CCP I, 2 θαη FIMAC l, 2). Σν κφξην ηνπ C7 έρεη ηνλ ίδην αξηζκφ δηαδνρηθψλ ζπληεξεκέλσλ πεξηνρψλ αιιά ζηεξείηαη ηεο πεξηνρήο TSΡl. Σα κφξηα C6 θαη C7 παξνπζηάδνπλ 35% ηαπηνζεκία ακηλνμέσλ, ε νπνία πεξηιακβάλεη ηα 57 θπζηετληθά θαηάινηπα ηνπ C7. Ο ζρεκαηηζκφο ηνπ ζπκπιφθνπ C5b67 ζπλνδεχεηαη απφ κεγάιε αιιαγή ζηε ζηεξενδηακφξθσζε ηνπ κνξίνπ C7. Σν ζχκπινθν πνπ ζρεκαηίδεηαη δελ είλαη αθφκα ζε ζέζε λα δηαζρίζεη ηε θσζθνιηπηδηθή δηπινζηηβάδα αιιά θαίλεηαη πσο πξνζδέλεηαη κεξηθψο κφλν ζηε δηπινζηηβάδα. Παξφια απηά, ε δνκή ηνπ C7 παίδεη ζεκαληηθφ ξφιν ζηελ πδξφθηιε κεηάβαζε θαηά ηε δηάξθεηα ηνπ ζρεκαηηζκνχ ηνπ ζπκπιφθνπ MAC, θαζψο ην ζπγθεθξηκέλν κφξην δξα σο κεκβξαληθή άγθπξα γηα ην ζχκπινθν C5b67. Δηθόλα 1.11: Ζ πξσηετληθή δνκή ηνπ C7 φπσο πξνθχπηεη έπεηηα απφ αλάιπζε κε ηε ρξήζε ηνπ ινγηζκηθνχ SMART. ΣΟ ΤΣΑΣΙΚΟ C8 Σν κφξην C8 (ΜΒ 151 kda) είλαη ην πιένλ πνιχπινθν δνκηθά κφξην απφ ηα ζπζηαηηθά ηνπ ζπκπιφθνπ MAC. Απνηειείηαη απφ ηξεηο ππνκνλάδεο, ηελ α (ΜΒ 64 kda), ηε β (ΜΒ 64 kda) θαη ηε γ (ΜΒ 22 kda). Οη ππνκνλάδεο απηέο ηνπνζεηνχληαη αζχκκεηξα, θαζψο δχν απφ απηέο ζπλδένληαη νκνηνπνιηθά κε δηζνπιθηδηθνχο δεζκνχο, ζρεκαηίδνληαο έλα εηεξνδηκεξέο (αιπζίδα α θαη γ) ελψ ε αιπζίδα β ζπλδέεηαη κε νκνηνπνιηθά. Σα γνλίδηα C8α θαη C8β είλαη νκφινγα κε ηα C6, C7 θαη C9 θαη φια καδί

31 31 κε ηηο πεξθνξίλεο αλήθνπλ ζηελ πξσηετληθή νηθνγέλεηα MACPF. Αληίζεηα, ην γνλίδην C8γ αλήθεη ζηελ νηθνγέλεηα ησλ ιηπνθαιηλψλ, νη νπνία πεξηιακβάλεη κηθξέο, εθθξηλφκελεο πξσηεΐλεο, νη νπνίεο έρνπλ ηελ ηδηφηεηα λα πξνζδέλνπλ κηθξά, πδξφθνβα πξνζδέκαηα. Σο ςυςτατικβ C8α Σν γνλίδην ηεο πξσηεΐλεο C8α ραξηνγξαθείηαη ζην ρξσκφζσκα 1 θαη ζπγθεθξηκέλα ζην κηθξφ βξαρίνλα, ζηε ζέζε 32 (1p32) (70).Ο ραξαθηεξηζκφο ηνπ γνληδηαθνχ θιψλνπ, ν νπνίνο θαιχπηεη φιν ην γνλίδην ηνπ C8α δείρλεη φηη ην ζπγθεθξηκέλν γνλίδην έρεη κήθνο πεξίπνπ 30 kb (71). Ζ παξαγφκελε απφ ην γνλίδην C8α πξσηεΐλε (64 KDa) απνηειείηαη απφ 584 ακηλνμέα. Αλάιπζε απηήο ηεο ακηλνμηθήο αιιεινπρίαο, απνθαιχπηεη ηελ χπαξμε ηεζζάξσλ ζπληεξεκέλσλ πεξηνρψλ νκφινγσλ ηνπ C6 θαη ηνπ C7 (TSP 2, 3, LDLa l, EGF θαη MACPF). Ζ αλάιπζε ηεο δεπηεξνηαγνχο δνκήο ηνπ κνξίνπ, απνθάιπςε φηη δηαθξηηά ηκήκαηα ζηελ ηειεπηαία απηή πεξηνρή (θαηάινηπα θαη ), είλαη ηθαλά λα ζρεκαηίζνπλ ακθηπαζείο δνκέο νη νπνίεο «αλαδεηνχλ κεκβξάλεο» (amphilic membraneseeking structures) (72). Σν C8α θέξεη ηξεηο πεξηνρέο αιιειεπίδξαζεο. Μηα πεξηνρή ηεο αιπζίδαο C8α αιιειεπηδξά κε ην C8β, ελψ κηα άιιε παξνπζηάδεη πςειή ζπγγέλεηα γηα ην C9, επάγνληαο κε απηφ ηνλ ηξφπν ηνλ πνιπκεξηζκφ ηνπ (73). Μηα ηξίηε πεξηνρή αιιειεπίδξαζεο είλαη απηή κε ην C8γ, ε νπνία επηηπγράλεηαη κέζσ δχν ππνπεξηνρψλ ηεο πεξηνρήο MACPF (74). Απηή ε πξφζδεζε ηνπ C8γ απνηειεί απνθιεηζηηθή ηδηφηεηα ηνπ C8. Δηθόλα 1.12: Ζ πξσηετληθή δνκή ηνπ C8α φπσο πξνθχπηεη έπεηηα απφ αλάιπζε κε ηε ρξήζε ηνπ ινγηζκηθνχ SMART.

32 32 Σο ςυςτατικβ C8β Σν γνλίδην C8β ραξηνγξαθείηαη ζην ρξσκνζψκα 1 θαη ζπγθεθξηκέλα ζην κηθξφ βξαρίνλα, ζηε ζέζε 32 (1p32), πιεζίνλ ηνπ γνληδίνπ C8α (75). Σν κήθνο ηνπ θηάλεη πεξίπνπ ηηο 40kb θαη πεξηέρεη 12 εμψληα, ην κέγεζνο ησλ νπνίσλ θπκαίλεηαη απφ 69 έσο 347 bp. Απφ ηελ αλάιπζε θιψλσλ cdna, θαίλεηαη πσο ην C8β ζπληίζεηαη σο κνλνκεξήο γιπθνπξσηεΐλε 64kDa (76). Ζ πξσηετληθή αιιεινπρία θαλεξψλεη πέληε ζπληεξεκέλεο πεξηνρέο, δχν TSP 1, κία LDLa, κία MACPF θαη κία EGF. Σν C8β πεξηέρεη ηνπιάρηζηνλ ηξία δηαθνξεηηθά ζεκεία πξφζδεζεο, έλα εθ ησλ νπνίσλ κεζνιαβεί γηα ηελ αιιειεπίδξαζε κε ην C8α θαη έλα δεχηεξν, ην νπνίν ρξεζηκεχεη γηα ηελ θαζνδήγεζε ηνπ C8 ζην ζχκπινθν MAC, κε ηελ πξφζδεζή ηνπ ζην C5b-7 (77). Έλα ηξίην ζεκείν πξφζδεζεο απνηειείηαη απφ έλα ή πεξηζζφηεξα ηκήκαηα ηα νπνία θαη αιιειεπηδξνχλ κε ηε θσζθνιηπηδηθή δηπινζηηβάδα ηεο κεκβξάλεο ζηφρνπ. Λεηηνπξγηθά, ν πξσηαξρηθφο ξφινο ηνπ C8β είλαη ε θαζνδήγεζε ηνπ C8 ζην λενζρεκαηηζζέλ ζχκπινθν C5b67. Δηθόλα 1.13: Ζ πξσηετληθή δνκή ηνπ C8β φπσο πξνθχπηεη έπεηηα απφ αλάιπζε κε ηε ρξήζε ηνπ ινγηζκηθνχ SMART. Σο ςυςτατικβ C8γ Σν γνλίδην ηνπ αλζξψπνπ γηα ην C8γ έρεη κήθνο 1.8 kb θαη πεξηέρεη εθηά εμψληα θαη εληνπίδεηαη ζην ρξσκφζσκα 9q34.3 θνληά ζε νκαδνπνηεκέλα γνλίδηα άιισλ ιηπνθαιηλψλ (78). Ζ ψξηκε πξσηεΐλε C8γ, είλαη κνλνκεξήο θαη πεξηέρεη 182 ακηλνμηθά θαηάινηπα. Πξφθεηηαη γηα ηε κηθξφηεξε απφ ηξεηο πξσηεΐλεο πνπ ζρεκαηίδνπλ ην ζχκπινθν ηνπ C8, έρνληαο κνξηαθφ βάξνο 22 kda (79). Σν C8γ, απνηειεί ην κνλαδηθφ ζπζηαηηθφ ηνπ ζπκπιεξψκαηνο (θαζψο θαη ησλ ξπζκηζηηθψλ κνξίσλ ηνπ) ην νπνίν αλήθεη ζηελ πξσηετληθή νηθνγέλεηα ησλ ιηπνθαιηλψλ (80). Δθηφο απηνχ, ην ζπγθεθξηκέλν κφξην, απνηειεί ην κνλαδηθφ κέινο ηεο νηθνγέλεηαο

33 33 πνπ έρεη ηελ ηδηφηεηα λα εκθαλίδεηαη σο δηκεξέο, ζπλδεδεκέλν κε δηζνπιθηδηθφ δεζκφ κε κηα άιιε πξσηεΐλε, ελ πξνθεηκέλσ κε ην C8α. Οη ιηπνθαιίλεο είλαη κηα κεγάιε νηθνγέλεηα εθθξηλφκελσλ πξσηετλψλ κε παξφκνην κέγεζνο (~ 20 KDa) θαη ηελ ραξαθηεξηζηηθή ηδηφηεηα λα δεζκεχνπλ κηθξνχο πδξφθνβνπο πξνζδέηεο, π.ρ. ξεηηλφιε (retinol-binding protein, RBP), θεξνκφλεο (odorant-binding protein) θιπ (81), αλ θαη επίζεο είλαη ηθαλέο λα πξνζδέλνπλ δηαιπηά καθξνκφξηα, φπσο επίζεο θαη ππνδνρείο θπηηαξηθήο επηθαλείαο (82; 83). Δηθόλα 1.14: Ζ πξσηετληθή δνκή ηνπ C8γ φπσο πξνθχπηεη έπεηηα απφ αλάιπζε κε ηε ρξήζε ηνπ ινγηζκηθνχ SMART. Β) ΡΤΘΜΗΣΗΚΑ ΓΟΝΗΓΗΑ ΠΡΟΣΕΚΣΙΝΗ (CD59) Σν γνλίδην ηεο πξνηεθηίλεο έρεη κήθνο bp θαη απνηειείηαη απφ 5 εμψληα, ελψ ηνπνζεηείηαη ζην 11 ν ρξσκφζσκα, ζηε ζέζε 11p13. Ζ πξνηεθηίλε απνηειεί ηνλ πιένλ άθζνλν κεκβξαληθφ ξπζκηζηή ηνπ ζπκπιεξψκαηνο θαη εθθξάδεηαη ζε φια ηα θχηηαξα ηνπ θπθινθνξηθνχ, ηα ελδνζειηαθά θαη επηζειηαθά θχηηαξα θαη πνιινχο ηζηνχο (84; 85). Σν κφξηφ ηεο ζπγθξνηείηαη απφ κηα πξσηεΐλε kda, πξνζδεδεκέλε ζηε κεκβξάλε κε γιπθνδπινθαζθαηηδπινηλνζηηφιε, (GPI-anchored membrane protein). Λεηηνπξγηθά, ε πξνηεθηίλε απνηειεί ηνλ θχξην αλαζηνιέα ηνπ ζρεκαηηζκνχ ηνπ ζπκπιφθνπ MAC, απνηξέπνληαο ηε ζχλδεζε ηνπ C9 ζην ζχκπινθν C5b-8 (86). πγθεθξηκέλα, ε ηθαλφηεηα αλαζηνιήο ηνπ κνξίνπ, έγθεηηαη ζηε δπλαηφηεηα πνπ έρεη ην CD59 λα πξνζδέλεηαη αθελφο ζην ζπζηαηηθφ C8α ηνπ ζπκπιφθνπ C5b678, θαη αθεηέξνπ ζηε β πεξηνρή ηνπ C9 (87).

34 34 Δηθόλα 1.16: : Ζ πξσηετληθή δνκή ηνπ CD59 φπσο πξνθχπηεη έπεηηα απφ αλάιπζε κε ηε ρξήζε ηνπ ινγηζκηθνχ SMART. Γηαθξίλεηαη κία πεξηνρή παξφκνηα κε ην αληηγφλν Ly-6 / ππνδνρέα upa (LU), ε νπνία ζπλαληάηαη ζηνλ ππνδνρέα ηνπ ελεξγνπνηεηή ηνπ πιαζκηλνγφλνπ ηχπνπ νπξνθηλάζεο. ΒΙΣΡΟΝΕΚΣΙΝΗ (vitronectin) Σν γνλίδην ηεο βηηξνλεθηίλεο έρεη κήθνο 5.3 kb θαη απνηειείηαη απφ 8 εμψληα. Σνπνζεηείηαη ζην 17 ν ρξσκφζσκα, ζηε ζέζε 17q11. Ζ παξαγφκελε πξσηεΐλε γιπθνδηιψλεηαη θαη εθθξίλεηαη ζηνλ νξφ, ελψ απνηειείηαη απφ κία πνιππεπηηδηθή αιπζίδα 478 ακηλνμέσλ, κε κνξηαθφ βάξνο 83 kda (88). Ζ βηηξνλεθηίλε, φπσο θαη ε θιαζηεξίλε, αλήθεη ζηα δηαιπηά ξπζκηζηηθά κφξηα ηεο ηειηθήο ιπηηθήο νδνχ. Αλαζηέιιεη ηελ θπηηαξηθή ιχζε πνπ κεζνιαβείηαη απφ ην ζπκπιήξσκα, κε κέζσ ηεο πξφζδεζή ηεο ζην C5b-7, κε ηειηθφ απνηέιεζκα έλα δηαιπηφ ζχκπινθν, ην SC5b-7(-9), ην νπνίν δελ είλαη ζε ζέζε λα δεκηνπξγήζεη πφξνπο ζηελ θπηηαξηθή κεκβξάλε (89). Πέξα απφ ηε βηνινγηθή δξάζε ηεο βηηξνλεθηίλεο αλαθνξηθά κε ηελ αλνζία, αξθεηέο άιιεο ιεηηνπξγίεο έρνπλ απνδνζεί ζην κφξηφ ηεο. Παξαδείγκαηνο ράξηλ, έρεη δεηρζεί ε ζπκκεηνρή ηεο ζηελ θπηηαξηθή πξνζθφιιεζε ζε ηζηνχο θαη ζηε ξχζκηζε ηεο κεζνιαβνχκελεο απφ επαξίλε παξεκπφδηζεο ηεο πήμεο (90). Δηθόλα 1.17: Ζ πξσηετληθή δνκή ηεο βηηξνλεθηίλεο φπσο πξνθχπηεη έπεηηα απφ αλάιπζε κε ηε ρξήζε ηνπ ινγηζκηθνχ SMART. Γηαθξίλεηαη κία πεξηνρή ζσκαηνκεδίλεο-β (SO) θαη 4 πεξηνρέο παξφκνηεο κε ηελ αηκνπεμίλε (HX).

35 35 ΚΛΑΣΕΡΙΝΗ (Clusterin) Σν γνλίδην ηεο θιαζηεξίλεο βξίζθεηαη ζην 8 ν ρξσκφζσκα, ζηε ζέζε 8p21-p12. Έρεη κήθνο bp θαη απνηειείηαη απφ 9 εμψληα. Σν γνλίδην ηεο θιαζηεξίλεο παξάγεη έλα πξφδξνκν κεηάγξαθν mrna, ην νπνίν κε ελαιιαθηηθή ζπξξαθή ζα δψζεη δχν ηζνκνξθέο ηεο πξσηεΐλεο, κηα εθθξηλφκελε κνξθή (sclu) θαη κηα ππξεληθή (nclu). Καζεκία απφ ηηο δχν δηαθνξεηηθέο ηζνκνξθέο παξνπζηάδεη δηαθξηηέο βηνινγηθέο ιεηηνπξγίεο. Ζ εθθξηλφκελε κνξθή (449 αα), ε νπνία είλαη θαη ε θπξίαξρε, κεζνιαβεί γηα ηνλ θπηηαξηθφ πνιιαπιαζηαζκφ, ηε δηαθνξνπνίεζε θαη ηελ θπηηαξηθή πξνζθφιιεζε (91), ηε ιηπηδηθή κεηαθνξά (92) θαη ηελ θπηηαξηθή πξνζηαζία ελάληηα ζε θπηηαξνηνμηθνχο παξάγνληεο, θαζψο δξα σο πξσηεΐλε ζεξκηθνχ ζνθ (93). Ζ ππξεληθή κνξθή, αληίζεηα, ζρεηίδεηαη κε δηαδηθαζίεο απφπησζεο (94). Αλαθνξηθά κε ηνλ ηξφπν δξάζεο ηεο ζηε ξχζκηζε ηνπ ζπζηήκαηνο ηνπ ζπκπιεξψκαηνο, ε θιαζηεξίλε, φπσο θαη ε βηηξνλεθηίλε, πξνζδέλεηαη ζην ζχκιπνθν C5b-7 θαη απνηξέπεη ηελ πξνζθφιιεζή ηνπ ζε θπηηαξηθέο επηθάλεηεο (95). Δπηπιένλ, κπνξεί λα πξνζδεζεί ζην C7, C8 θαη C9 (96). Δηθόλα 1.18: Ζ πξσηετληθή δνκή ηεο θιαζηεξίλεο, φπσο πξνθχπηεη έπεηηα απφ αλάιπζε κε ηε ρξήζε ηνπ ινγηζκηθνχ SMART. Γηαθξίλνλνληαη νη δχν πνιππεπηηδηθέο αιπζίδεο, ε α θαη ε β ΤΜΠΛΗΡΩΜΑ ΚΑΙ ΕΞΕΛΙΞΗ Ζ πξνζαξκνζηηθή αλνζία είλαη εηδηθή γηα ηα γλαζνζηφκαηα ζπνλδπισηά, ην νπνίν ηνπνζεηεί ηελ εκθάληζή ηεο ζηα 600 εθαηνκκχξηα ρξφληα πξηλ (97). Ζ έλαξμε ηεο έκθπηεο αλνζίαο, πηζηεχεηαη πσο είλαη αθφκα αξραηφηεξε, παξφιν πνπ απνηειείηαη απφ πνιιά εηεξνγελή ζπζηήκαηα θαη ζηελ πιεηνλφηεηα ησλ πεξηπηψζεσλ νη εμειηθηηθέο απαξρέο ηνπο δελ είλαη επαξθψο ραξαθηεξηζκέλεο. Σν ζχζηεκα ηνπ ζπκπιεξψκαηνο, έρεη κειεηεζεί εθηελψο απφ εμειηθηηθήο ζθνπηάο. Δδψ θαη 30 ρξφληα ηνπιάρηζηνλ, νη θπινγελεηηθέο κειέηεο δηεμάγνληαλ, θπξίσο κε ηε ρξήζε ηεο αηκνιπηηθήο ηθαλφηεηαο ζηα

36 36 πγξά ηνπ ζψκαηνο γηα ηελ παξνπζία ηνπ ζπζηήκαηνο ηνπ ζπκπιεξψκαηνο, ηφζν ζε ζπνλδπισηά, φζν θαη ζε αζπφλδπια (98). Καηά ηε δηάξθεηα ησλ 10 ηειεπηαίσλ εηψλ, ε αλάιπζε ζε επίπεδν DNA, ζπκπεξηιακβαλνκέλεο ηεο γνληδησκαηηθήο αλάιπζεο θαη ηεο αλάιπζεο EST, ζπλέβαιιε ζεκαληηθά ζηηο γλψζεηο καο γηα ηελ εμέιημε ηνπ ζπζηήκαηνο ηνπ ζπκπιεξψκαηνο. Ζ δξάζε ηνπ ζπκπιεξψκαηνο έρεη πηζηνπνηεζεί θαη ζηελ αξραηφηεξε νκάδα ζπνλδπισηψλ, ζηα άγλαζα (99). Σν πξσηφγνλν ζχζηεκα ηνπ ζπκπιεξψκαηνο ζηνπο άγλαζνπο ηρζχεο είλαη έλα απφ ηα θαιχηεξα νξγαλσκέλα ζπζηήκαηα έκθπηεο αλνζίαο. Χζηφζν, θαη ηα αζπφλδπια θαη ηα άγλαζα έρνπλ έιιεηςε αλνζνζθαηξηλψλ, νπφηε δελ δηαζέηνπλ ηα αληίζηνηρα κνλνπάηηα ηεο θιαζηθήο νδνχ (100).Αξρηθά δείρζεθε ε παξνπζία γνληδίσλ ηνπ ζπκπιεξψκαηνο ζε αζπφλδπια δεπηεξνζηφκαηα, φπσο είλαη νη αρηλνί (101) θαη ηα αζθίδηα (102). Αληίζεηα, δε βξέζεθαλ γνλίδηα ηνπ ζπκπιεξψκαηνο ζηε Drosophila melanogaster (103) ή ζηνλ Caenorhabditis elegans (104), ππνδεηθλχνληαο φηη ην ζχζηεκα ηνπ ζπκπιεξψκαηνο εκθαλίζηεθε ζηε δηαθιάδσζε ησλ δεπηεξνζηνκίσλ. Παξφια απηά, πξφζθαηεο κειέηεο ζηα γνλίδηα C3 θαη factor B (Bf) ηνπ μηθφζνπξνπ (horseshoe crab) (105) θαη ηνπ C3 ηνπ θνξαιηνχ (106) θαζψο θαη ε γνληδησκαηηθή αλάιπζε ηεο ζαιάζζηαο αλεκψλεο, δείρλνπλ φηη ην ζχζηεκα ηνπ ζπκπιεξψκαηνο είλαη αθφκα αξραηφηεξν. Δλψ ε εκθάληζε ζπζηαηηθψλ ηνπ ζπκπιεξψκαηνο πνπ αλήθνπλ ζηελ ελαιιαθηηθή θαη ιεθηηληθή νδφ έρεη πηζηνπνηεζεί ήδε ζηα άγλαζα, ε εκθάληζε κνξίσλ πνπ αλήθνπλ θαη ζηηο ηξεηο νδνχο ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο ζπκπίπηεη κε ηελ εκθάληζε ησλ ρνλδξηρζχσλ (107). Έηζη, ην ζπκπιήξσκα γηα πξψηε θνξά ιεηηνπξγεί ζε απηνχο ηνπο νξγαληζκνχο θαη κε ηηο ηξεηο νδνχο ελεξγνπνίεζεο. ην ακέζσο επφκελν εμειηθηηθφ ζηάδην, ζηνπο ηειεφζηενπο ηρζχεο, ε εξεπλεηηθή καο νκάδα έρεη θισλνπνηήζεη θαη ραξαθηεξίζεη ηελ πιεηνςεθία ησλ γνληδίσλ ηνπ ζπκπιεξψκαηνο (C3, C5, C6, C7, C8α, C8β, C8γ, C9, MBL, πξνπεξδίλε, παξάγνληα B, θιαζηεξίλε, βηηξνλεθηίλε,cd59, (108; 109; 110; 111; 112; 113; 114; 115; 116; 117; 118; 119; 120) ζηελ ηξηδίδνπζα πέζηξνθα (Oncorhynchus mykiss irideus ). Σν ηδηαίηεξν ελδηαθέξνλ κε ηνπο ηειεφζηενπο βξίζθεηαη ζην γεγνλφο φηη νη νξγαληζκνί απηνί έρνπλ αθνινπζήζεη έλαλ κνλαδηθφ ηξφπν επέθηαζεο ηεο αλνζίαο, κέζσ ηνπ δηπιαζηαζκνχ ζεκαληηθνχ αξηζκνχ γνληδίσλ ηνπ ζπκπιεξψκαηνο, φπσο ην C3, C4, C5, C7, MBL, πξνπεξδίλε, CD59, θιαζηεξίλε.

37 37 Όια ηα ππφινηπα ζπνλδπισηά πνπ αθνινπζνχλ εμειηθηηθά: νζηετρζχεο, ακθίβηα, εξπεηά, πηελά θαη ζειαζηηθά εκθαλίδνπλ έλα αλαπηπγκέλν ζχζηεκα ζπκπιεξψκαηνο πνπ θαηαιήγεη ζηε δηακφξθσζε ηνπ ηειηθνχ ζπκπιφθνπ ιχζεο ηεο κεκβξάλεο. Δμαίξεζε απνηειεί ε παξνπζία ηνπ παξάγνληα D θαη κειψλ ηεο νηθνγέλεηαο ησλ ξπζκηζηψλ ηεο ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο (RCAs) θαζψο θαη ζπνξαδηθέο απνπζίεο ζπζηαηηθψλ, φπσο είλαη ην C9 θαη ε πξνπεξδίλε ζηα πηελά, ν αλαζηνιέαο ηνπ C1 ζηα ακθίβηα θαη νη MASP-1 θαη MASP-3 ζηνπο ηειεφζηενπο (121). 900my 450my Δηθόλα 1.19: Ζ εμέιημε ηεο αλνζίαο θαηά ηε δηάξθεηα ησλ γεσινγηθψλ ρξφλσλ. εκεηψλεηαη ε πξψηε εκθάληζε ηεο έκθπηεο αλνζίαο (900 εθαηνκκχξηα ρξφληα πξηλ) θαη ηεο πξνζαξκνζηηθήο αλνζίαο (450 εθαηνκκχξηα ρξφληα πξηλ).

38 ΟΡΝΗΘΑ (Gallus gallus) ΔΗΑΓΩΓΖ Ζ φξληζα (Gallus gallus, ή Gallus gallus domesticus) απνηειεί έλα απφ ηα πιένλ θνηλά θαη δηαδεδνκέλα θαηνηθίδηα δψα. Ο πιεζπζκφο ηνπ, ν νπνίνο μεπεξλνχζε ηα 24 δηζεθαηνκκχξηα ην 2003, απνηειεί ην κεγαιχηεξν πιεζπζκφ κεηαμχ ησλ πηελψλ ζηνλ πιαλήηε. Αλήθεη ζηελ νηθνγέλεηα ησλ νξληζνεηδψλ θαη ζηελ ηάμε ησλ αιεθηνξνεηδψλ θη απνηειεί ην βαζηθφηεξν είδνο ησλ εμεκεξσκέλσλ πνπιεξηθψλ. Σν πφηε αθξηβψο έγηλε ε εμεκέξσζή ηεο δελ είλαη γλσζηφ. Αθφκε θαη ζήκεξα ππάξρνπλ άγξηα είδε φξληζαο, απ' ηα νπνία πξνέξρνληαη νη ζεκεξηλέο θπιέο. Παξαδνζηαθά ζεσξείηαη φηη είλαη απφγνλνο ηνπ άγξηνπ Red Junglefowl ην νπνίν θαηάγεηαη απφ ηελ Ηλδία (είδνο: Gallus gallus). Παξφια απηά, νξηζκέλεο κειέηεο γελεηηθήο πξνηείλνπλ φηη ην ζπγθεθξηκέλν πηελφ πηζαλφηαηα θαηάγεηαη ηφζν απφ ην Red φζν θαη απφ ην Grey Junglefowl (G. sonneratii) (122). Ζ πιήξεο ζπζηεκαηηθή θαηάηαμε ηεο φξληζαο είλαη ε αθφινπζε : Δπηθξάηεηα: Δπθάξπα Βαζίιεην: Zψα Φύιν : Υνξδσηά Τπόθπιν: Κξαλησηά Τπεξθιάζε : Γλαζνζηφκαηα Κιάζε : Πηελά Τπέξηαμε : Νεφγλαζα Σάμε : Galliformes Οηθνγέλεηα : Phasianidae Γέλνο : Gallus Δίδνο : Gallus gallus Τπνείδνο : Gallus gallus domesticus

39 ΣΟ ΤΜΠΛΖΡΩΜΑ ΣΑ ΠΣΖΝΑ ΚΑΗ ΣΖΝ ΟΡΝΗΘΑ (Gallus gallus). Ζ φξληζα απνηειεί έλαλ νξγαληζκφ, ν νπνίνο παξνπζηάδεη κεγάιν νηθνλνκηθφ ελδηαθέξνλ Ζ εκπνξηθή πηελνηξνθία είλαη επάισηε απέλαληη ζε βαθηεξηαθέο, ηηθέο θαη παξαζηηηθέο κνιχλζεηο, νη νπνίεο κπνξνχλ λα πξνθαιέζνπλ αμηνζεκείσηε ζλεζηκφηεηα θαη νηθνλνκηθή απψιεηα. Δπίζεο, ηα πηελά κπνξεί λα είλαη θνξείο κεηαδνηηθψλ παζνγφλσλ νξγαληζκψλ γηα ησλ άλζξσπν, ζπκπεξηιακβαλνκέλσλ ησλ Salmonella, Campylobacter, θαη δπλεηηθά επηθίλδπλσλ ζηειερψλ γξίπεο, φπσο ν ηφο H5N1 (Guangdong) ν νπνίνο πξνθάιεζε 1997 ηελ έμαξζε ηεο γξίπεο ησλ πηελψλ ζην Υνλγθ Κνλγθ. Παξφιν πνπ ην ζχζηεκα ηεο πξνζαξκνζηηθήο αλνζίαο έρεη κειεηεζεί εθηελψο ζηελ φξληζα, νη γλψζεηο καο γηα ην ζχζηεκα ηνπ ζπκπιεξψκαηνο ππνιείπνληαη αξθεηά. Μέρξη ζήκεξα ζηελ φξληζα έρνπλ βξεζεί φια ηα ζπζηαηηθά ηνπ ζπζηήκαηνο ηνπ ζπκπιεξψκαηνο απφ ην C1 έσο ην C8, εθηφο απφ ην C9 (123;124), ην νπνίν πηζηεχεηαη πσο έρεη ραζεί δεπηεξνγελψο θαηά ηελ εμέιημε. ε παιαηφηεξεο κειέηεο, δελ είρε βξεζεί νκφινγν ηνπ C2 θαη επηθξαηνχζε ε ππφζεζε φηη ην ξφιν ηνπ C2 ίζσο λα αλαιάκβαλε ε πξσηετλάζε ηεο φξληζαο πνπ είλαη παξφκνηα κε ηνλ παξάγνληα Β (factor B-like protease), έλα εμειηθηηθφ θαηάινηπν ηνπ θνηλνχ πξνγφλνπ ηνπ C2/παξάγνληα B ην νπνίν είρε πεξηγξαθεί πξνεγνπκέλσο. Παξφια απηά, λέεο κειέηεο αλαγλψξηζαλ θαη ραξηνγξάθεζαλ ηα νκφινγα γνλίδηα γηα ην C2 θαη ηνλ παξάγνληα B ζηελ φξληζα θαη έδεημαλ φηη ν ζπγθεθξηκέλνο νξγαληζκφο δε ζηεξείηαη ηνπ C2 (Skjoedt K. and Kaufman J., unpublished observations) ΑΝΑΠΣΤΞΖ ΔΜΒΡΤΟΤ ΟΡΝΗΘΑ Απφ ηε ζηηγκή ηεο επψαζεο ελφο απγνχ, ε αλάπηπμε ηνπ εκβξχνπ βξίζθεηαη ήδε ζην ζηάδην ηνπ δηπιφζηηβνπ δίζθνπ πνιιψλ ρηιηάδσλ ζηελ θνξπθή ηεο ιεθίζνπ (125). Ζ αθνινπζία ησλ γεγνλφησλ ε νπνία ιακβάλεη ρψξα θαηά ηηο επφκελεο εκέξεο, απφ ηε ζηηγκή πνπ ην απγφ επσάδεηαη, νδεγεί ζην ζρεκαηηζκφ ηνπ άμνλα ηνπ ζψκαηνο θαη θαζνξίδεη ηα ζεκεία ζηα νπνία ζα ζρεκαηηζηνχλ ηα δηάθνξα φξγαλα.

40 40 Σν πξψην νξαηφ ζεκάδη ην νπνίν θαηαδεηθλχεη ην ζρεκαηηζκφ άμνλα απφ ηελ θεθαιή σο ηελ νπξά ηνπ εκβξχνπ είλαη ε πξσηαξρηθή γξακκή (primitive streak), κηα ιεπηή, αδηαθαλήο δψλε θπηηάξσλ, ε νπνία εθηείλεηαη απφ ηελ άθξε ηνπ εκβξπηθνχ δίζθνπ. Έλα απφ ηα πξψηα νξγαληθά ζπζηήκαηα ην νπνίν αλαπηχζζεηαη, είλαη ην αγγεηαθφ. Νεζίδεο αίκαηνο παξαηεξνχληαη ακέζσο κεηά ηελ πξψηε κέξα ηεο επψαζεο θαη ε θπθινθνξία εγθαζίζηαηαη κία εκέξα αξγφηεξα. Καηά ηε ζπγθεθξηκέλε ρξνληθή πεξίνδν, ην έκβξπν απμάλεη ζε κέγεζνο θαη αιιάδεη ζρήκα. Οη θχξηεο πεξηνρέο νη νπνίεο γίλνληαη αλαγλσξίζηκεο, πρ ε θεθαιή, ν θνξκφο θαη ε νπξά, αθνινπζνχληαη απφ ην ζρεκαηηζκφ ζπγθεθξηκέλσλ νξγάλσλ, φπσο είλαη ηα άθξα, ηα κάηηα, νη πλεχκνλεο θιπ, ηα νπνία γίλνληαη νξαηά θαηά ηελ ηξίηε θαη ηέηαξηε κέξα επψαζεο. ηα ηειηθά ζηάδηα ηεο αλάπηπμεο, απφ ηε δέθαηε κέξα κέρξη θαη ηελ εηθνζηή πξψηε, φπνπ ε φξληζα εθθνιάπηεηαη ιακβάλεη ρψξα αμηνζεκείσηε αχμεζε ηνπ εκβξχνπ θαζψο θαη ησλ ηειηθψλ δηεξγαζηψλ νκάδσλ δηαθνξνπνηεκέλσλ θπηηάξσλ θαη ηζηψλ, ζπκπεξηιακβαλνκέλσλ ηεο νζηενπνίεζεο ηνπ ζθειεηνχ θαη ηνπ ζρεκαηηζκνχ θηεξψλ. Ζ αθνινπζία ηεο αλάπηπμεο ηνπ εκβξχνπ ηεο φξληζαο έρεη πεξηγξαθεί σο κηα ζεηξά εηθνλνγξαθεκέλσλ αλαπηπμηαθψλ ζηαδίσλ, απφ ηνπο Eyal-Giladi θαη Kochav (126) γηα ηηο πξψηεο επηά ψξεο ηεο αλάπηπμεο θαη απφ ηνπο Hamburger θαη Hamilton (1951) γηα ηα ππφινηπα ζηάδηα ηεο αλάπηπμεο, κέρξη θαη ηελ εηθνζηή εκέξα, επηηξέπνληαο κε απηφ ηνλ ηξφπν ηελ θαζηέξσζε ελφο πξνηχπνπ γηα ηνπο κειεηεηέο ηεο αλάπηπμεο ηεο φξληζαο (127). Οργανογένεςη του ήπατοσ Ζ πξψηε έλδεημε ηεο νξγαλνγέλεζεο ηνπ ήπαηνο εκθαλίδεηαη ζην εκβξπηθφ ζηάδην ησλ ζσκηηψλ (50-53 ψξεο επψαζεο) φηαλ ηα ελδνδεξκηθά εθθνιπψκαηα πνπ πξνθχπηνπλ απφ ην ηνίρσκα ηνπ πξφζζηνπ εληέξνπ εθηείλνληαη πξνο ηα εκπξφο ζην κεζφδεξκα ηνπ εγθάξζηνπ δηαθξάγκαηνο (septum transversum). Σα πεξηθεξηθά ηκήκαηα ησλ εθθνιπσκάησλ ζρεκαηίδνπλ ην ήπαξ, ελψ ηα εγγχο ηκήκαηα ζρεκαηίδνπλ ηνπο ρνιεθφξνπο αγσγνχο θαη ηε ρνιεδφρν θχζηε. Σν εγθάξζην δηάθξαγκα ζα δψζεη ηνλ επαηηθφ ζχλδεζκν, ηα αηκνπνηεηηθά βιαζηνθχηηαξα θαη ηα θχηηαξα Kupffer γηα ηα επαηηθά θνιπνεηδή.

41 41 Οη κειινληηθέο επαηηθέο πεξηνρέο ζρεηίδνληαη ζηελά κε απηέο ηεο θαξδηάο θαη είλαη γλσζηέο σο θαξδην-επαηηθέο πεξηνρέο. Βξίζθνληαη ζε κία πιεπξά ηνπ θφκβνπ ηνπ Hensen ζηα ζηάδηα 4-5. Παξφια απηά, ελψ ε θαξδηά είλαη έλαο ζρεκαηηζκφο πξνεξρφκελνο απνθιεηζηηθά απφ κεζφδξεκα, ην ήπαξ ζρεκαηίδεηαη ηφζν απφ κεζφδεξκα φζν θαη απφ ελδφδεξκα. Σν κεζνδεξκηθφ ηκήκα, απνηειεί κέξνο ηνπ θνηιηαθνχ κεζεληέξηνπ, ην νπνίν πξνέξρεηαη απφ ην ζπιαρληθφ κεζφδεξκα θαη παξνπζηάδεηαη σο δχν ακθίπιεπξα νγθψκαηα, ηα νπνία εθηείλνληαη σο ην επίπεδν ηνπ 15 νπ ζσκίηε. Απφ ηελ άιιε κεξηά, ην ελδνδεξκηθφ ηκήκα ρσξίδεηαη ζε δχν εθθνιπψκαηα γχξσ απφ ην θιεβηθφ πφξν, έλα πξφζζην θαη έλα νπίζζην ηκήκα (κεξηθέο θνξέο νλνκάδνληαη ην δεμηφ θαη ην αξηζηεξφ εθθφιπσκα, αληίζηνηρα). Καηά ηα ζηάδηα 15-16, ην κπξνζηηλφ εθθφιπσκα έρεη επεθηαζεί πάλσ απφ ηνλ θιεβηθφ πφξν, ηφζν φζν θαη νη ζπλεζηζκέλεο θχξηεο θιέβεο. Καηά ην ζηάδην 17, ην πξφζζην εθθφιπσκα βξίζθεηαη αξηζηεξά ηνπ θιεβηθνχ πφξνπ, θαη ην νπίζζην ζηα δεμηά. Πεηξάκαηα έρνπλ δείμεη φηη ν θαζνξηζκφο ηνπ ελδνδέξκαηνο πξνο ήπαξ εθθηλεί θαηά ην ζηάδην 8. Μεηά απφ απηφ, ην ελδφδεξκα επάγεηαη απφ ην κεζφδεξκα ηεο επαηνθαξδηαθήο πεξηνρήο. Μηα δεχηεξε επαγσγή, ηψξα απφ ην επαηηθφ κεζέγρπκα, νδεγεί ζην ζρεκαηηζκφ ησλ επαηηθψλ ρνξδψλ απφ ηνπο πνιπδχλακνπο επαηνβιάζηεο. Οη ρνξδέο απηέο ζπληζηνχλ ην επαηηθφ παξέγρπκα κεηά απφ ηε δηαθνξνπνίεζε θαη ηελ εγθαζίδξπζε ηεο έθθξαζεο εηδηθψλ γηα ην ήπαξ γνληδίσλ. Ζ επαηηθή ρνξδή απνηειεί ηε δνκηθή κνλάδα ηνπ ήπαηνο θαη ν ζρεκαηηζκφο ηεο είλαη εμέρνπζαο ζεκαζίαο γηα ηηο κεηέπεηηα ιεηηνπξγίεο ηεο ρεκηθήο επεμεξγαζίαο, ηνπ κεηαβνιηζκνχ θαη ηεο παξαγσγήο πξσηετλψλ ηνπ νξνχ (Δηθ. 1.21). Ζ αηκνπνίεζε ζην ήπαξ μεθηλάεη θαηά ην εκβξπηθφ ζηάδην 30 θαη θηάλεη ην απνθνξχθσκά ηεο, ζην ζηάδην 40 (128).

42 Γηαθνξνπνίεζε Μνξθνγέλεζε Δπαγσγή ρεκαηηθή απεηθόληζε ήπαηνο Δ2 Δπίπεδν θνηιηαθό ελδόδεξκα Απνκνλσκέλν Ήπαξ Δ4 42 Δ3 Δθθόιπσκα Δ4 Δθβιάζηεζε ήπαηνο Δ5 1 νο ινβόο Δ5 1 νο θαη 2 νο ινβόο Δ6 Δ6 Δ7 1 νο, 2 νο θαη 3 νο ινβόο Δ7 Δηθόλα 1.21: Αλάπηπμε ηνπ ήπαηνο ηεο φξληζαο. ην αξηζηεξφ ηκήκα ηεο εηθφλαο παξαηεξείηαη ε ζρεκαηηθή απεηθφληζε ηεο αλάπηπμεο ηνπ ήπαηνο, ελψ ζην δεμί ε κνξθνινγία ηνπ απνκνλσκέλνπ ήπαηνο ηνπ εθάζηνηε αλαπηπμηαθνχ ζηαδίνπ Ζ ΟΡΝΗΘΑ Ω ΟΡΓΑΝΗΜΟ ΜΟΝΣΔΛΟ Ζ φξληζα απνηειεί ζεκαληηθφ πεηξακαηηθφ ζχζηεκα γηα ηελ αλαπηπμηαθή βηνινγία, ηελ αλνζνινγία (ηδηαίηεξα γηα ηε κειέηε ησλ Β θπηηάξσλ) θαη ηε κηθξνβηνινγία, ην νπνίν έρεη νδεγήζεη ζε πνιιέο ζεκειηψδεηο αλαθαιχςεηο. Δπηπιένλ, πνιιά απφ ηα ραξαθηεξηζηηθά ηεο βηνινγίαο ησλ πηελψλ θαη ηεο νξγάλσζεο ηνπ γνληδηψκαηνο ηεο φξληζαο ηελ θαζηζηνχλ ηδαληθφ κνληέιν γηα θπινγελεηηθέο κειέηεο θαζψο θαη γηα εθαξκνγέο ζηε γεσξγία θαη ηελ ηαηξηθή.

43 43 Οη ιφγνη γηα ηνπο νπνίνπο ε φξληζα απνηειεί έλα απφ ηα θπξίαξρα κνληέια νξγαληζκνχο γηα βηνινγηθέο κειέηεο, είλαη νη εμήο: Πξψηα απ φια, νη φξληζεο απνηεινχλ ηδαληθά ζπζηήκαηα γηα θιαζηθή γελεηηθή, θαζψο δηαηεξνχληαη εχθνια, αλαπαξάγνληαη ηαρέσο, ηα λενγέλλεηα έρνπλ κεγάιν κέγεζνο θαη δηαθξηηά ραξαθηεξηζηηθά, ηα νπνία θαζηζηνχλ δπλαηή ηελ θαηαγξαθή ραξαθηεξηζηηθψλ απφ ηνπο γνλείο ζηνπο απνγφλνπο. Γεχηεξνλ, απνηεινχλ ηδαληθά ζπζηήκαηα γηα ηελ αλάπηπμε ησλ ζπνλδπισηψλ θαζψο ηα έκβξπα ηεο φξληζαο αλαπηχζζνληαη κε ηξφπνπο κνξθνινγηθά φκνηνπο κε εθείλνπο ησλ ζειαζηηθψλ, αιιά, ζε αληίζεζε κε απηά, παξέρνπλ ηε δπλαηφηεηα κειέηεο ηεο αλάπηπμεο κέζα απφ ην απγφ. Σξίηνλ, κπνξνχλ λα παξάζρνπλ έλα κνληέιν γηα ηηο αλζξψπηλεο γελεηηθέο αζζέλεηεο, θαζψο ήδε έρνπλ δεκηνπξγεζεί εηδηθέο ζεηξέο σο κνληέια αζζελεηψλ. Σέινο, ν ζπγθεθξηκέλνο νξγαληζκφο κπνξεί λα ρξεζηκνπνηεζεί σο κνληέιν κειέηεο ησλ ηηθψλ κνιχλζεσλ, θαζψο νη φξληζεο θαη ηα ζειαζηηθά έρνπλ παξφκνηα αλνζνινγηθή απφθξηζε, επηηξέπνληαο έηζη ηελ έξεπλα ησλ κεραληζκψλ κφιπλζεο θαη ηεο γελεηηθήο βάζεο ηεο εππάζεηαο ζε ηνχο (129). Σν γνληδίσκα ηεο φξληζαο, απνηεινχκελν απφ δεχγε βάζεσλ είλαη πεξίπνπ ην έλα ηξίην ηνπ κεγέζνπο ηνπ αλζξψπηλνπ γνληδηψκαηνο, ελψ έρεη ήδε νινθιεξσζεί ε αιιεινχρηζε ελφο πξνζρεδίνπ ηνπ (130). Εφαρμογέσ ςτη Βιολογία Ζ επθνιία ζηελ πξφζβαζε θαη ζηνπο ρεηξηζκνχο ησλ εκβξχσλ νδήγεζε ζε πνιιέο εξεπλεηηθέο αλαθαιχςεηο πνπ αθνξνχλ ζηελ αλαπηπμηαθή δηαδηθαζία (131). Αλαθνξηθά κε ηε ρξήζε ηεο φξληζαο σο πεηξακαηηθφ κνληέιν ζηελ θιαζηθή πεηξακαηηθή εκβξπνινγία, δχν είλαη νη θχξηεο ζηξαηεγηθέο πνπ ρξεζηκνπνηνχληαη: Ζ κεηακφζρεπζε ελφο απηφινγνπ ηκήκαηνο ηζηνχ ζε έλα άιιν κέξνο ηνπ ίδηνπ εκβξχνπ θαη πεηξάκαηα εθηφο απγνχ, θαζψο ηα πξψηκα έκβξπα κπνξνχλ λα ηνπνζεηεζνχλ ζε απιά ζπζηήκαηα θαιιηέξγεηαο. Ζ εμέιημε ησλ θιαζηθψλ πεηξακαηηθψλ εθαξκνγψλ, νδήγεζε ζε αξθεηέο πεξηπηψζεηο ζηελ αλαγλψξηζε ησλ κεραληζκψλ αιιειεπίδξαζεο θπηηάξνπ κε θχηηαξν, π.ρ. κε ζαθή δηαρσξηζκφ ησλ επηζειηαθψλ θαη κεζεγρπκαηηθψλ ηζηψλ θαη ζηε ζπλέρεηα ηνλ

44 44 αλαζπλδπαζκφ κεηαμχ ησλ δχν ηζηψλ, ζε δηαθνξεηηθφ πξνζαλαηνιηζκφ ή ηνλ αλαζπλδπαζκφ ηζηψλ απφ έκβξπα δηαθνξεηηθψλ αλαπηπμηαθψλ ζηαδίσλ θαη ηελ αθφινπζε κεηακφζρεπζή ηνπο πάιη ζην έκβξπν. Δπηπιένλ, ε φξληζα ρξεζηκνπνηήζεθε σο κνληέιν ζε πεηξάκαηα κειέηεο ηνπ θπηηαξηθνχ θαζνξηζκνχ. ηελ πεξίπησζε απηή, νη ρίκαηξεο νξλίζσλ/νξηπθηψλ απνηεινχλ ηζρπξά εξγαιεία (132). Δθηφο φκσο απφ ηελ αλαπηπμηαθή βηνινγία, ν ζπγθεθξηκέλνο νξγαληζκφο βξίζθεη εθαξκνγέο θαη ζε θπινγελεηηθέο κειέηεο. Ζ φξληζα απέθιηλε θπινγελεηηθά απφ ηνλ άλζξσπν πεξίπνπ εθαηνκκχξηα ρξφληα πξηλ θαη έηζη απνηειεί εμειηθηηθά έλα ελδηάκεζν ζηάδην κεηαμχ ησλ ζειαζηηθψλ απφ ηε κηα κεξηά θαη ησλ ηρζχσλ απφ ηελ άιιε. Γηα ην ιφγν απηφ, θαιχπηεη έλα θελφ ζηηο γλψζεηο καο γηα ηελ εμέιημε θαη ζπληήξεζε ηνπ γνληδηψκαηνο ησλ ζπνλδπισηψλ. Ζ αιιεινχρηζε ηνπ γνληδηψκαηνο θαη ε δηαζεζηκφηεηα 3 εθαηνκκπξίσλ γελεηηθψλ πνιπκνξθηζκψλ, αλακέλεηαη λα βνεζήζνπλ ζηελ ηαπηνπνίεζε γνληδίσλ ηα νπνία ειέγρνπλ γλσξίζκαηα εμέρνπζαο ζεκαζίαο γηα ηελ πηελνηξνθία (133). Σέινο, λέα ψζεζε αλακέλεηαη λα δψζεη ζηελ έξεπλα ε αλάπηπμε ηεο ηερλνινγίαο ησλ δηαγνληδηαθψλ πηελψλ, θαζψο ε ζπγθεθξηκέλε ππνιείπεηαη έλαληη εθείλεο ησλ ζειαζηηθψλ, θαζψο απνηειεί κηα αξθεηά πεξίπινθε θαη επίπνλε δηαδηθαζία. Παξφια απηά, νξηζκέλνη εξεπλεηέο έρνπλ ήδε πξνζπαζήζεη λα δεκηνπξγήζνπλ δηαγνληδηαθέο φξληζεο σο αλαπηπμηαθά κνληέια γηα ηε βηνινγηθή εξεπλεηηθή θνηλφηεηα (134).

45 ΚΟΠΟ Σν ζχζηεκα ηνπ ζπκπιεξσκαηνο, απνηειεί έλαλ αξραίν θπινγελεηηθά θαηαξξάθηε αληηδξάζεσλ, νη νπνίεο δηαδξακαηίδνπλ κείδνλα ξφιν ζηελ έκθπηε θαη πξνζαξκνζηηθή αλνζία. Ζ ελεξγνπνίεζε ηνπ ηξίηνπ ζπζηαηηθνχ (C3), απνηειεί θνκβηθφ ζεκείν ησλ ηξηψλ νδψλ ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο (θιαζηθή, ελαιιαθηηθή, ιεθηηληθή), νδεγψληαο ζηε δεκηνπξγία ηνπ ζπκπιφθνπ MAC, κε απνηέιεζκα ηελ νζκσηηθή ιχζε ησλ θπηηάξσλ ζηφρσλ. Πξφζθαηα δεδνκέλα, έρνπλ δείμεη φηη ην ζχζηεκα ηνπ ζπκπιεξψκαηνο ζρεηίδεηαη θαη κε άιιεο δηαδηθαζίεο, πέξα απφ εθείλεο πνπ εκπιέθνληαη ζηνπο κεραληζκνχο αλνζίαο. Δηδηθφηεξα, ην κφξην C3 έρεη δεηρζεί φηη ζπκκεηέρεη ζηελ αλαγέλλεζε ηζηψλ θαη ζηε δηαθνξνπνίεζε θπηηάξσλ, ελψ ην ζχκπινθν MAC έρεη ζπζρεηηζζεί επηπιένλ κε δηαδηθαζίεο ελεξγνπνίεζεο αιιά θαη απφπησζεο θπηηάξσλ. ηφρνο ηεο παξνχζαο εξγαζίαο είλαη ε κειέηε ηεο έθθξαζεο γνληδίσλ ηνπ ζπκπιεξψκαηνο ζε αλαπηπμηαθφ θαη ηζηηθφ επίπεδν ζηνλ νξγαληζκφ ηεο φξληζαο (Gallus gallus). Ο ζπγθεθξηκέλνο νξγαληζκφο επηιέρζεθε ιφγσ ηεο εχθνιεο πξφζβαζεο ζην έκβξπν, γεγνλφο πνπ ηνλ θαζηζηά ηδηαληθφ κνληέιν γηα αλαπηπμηαθέο κειέηεο. Δπίζεο, ε ζπγθεθξηκέλε επηινγή έγηλε, θαζψο νη γλψζεηο καο γηα ην ζχζηεκα ηνπ ζπκπιεξψκαηνο ζηελ φξληζα ππνιείπνληαη αξθεηά. Ζ θαηαγξαθή ηεο εηθφλαο ηα ησλ γνληδίσλ ηνπ ζπκπιεξψκαηνο, είλαη ην πξψην βήκα γηα κειέηεο πνπ αθνξνχλ άιιεο πηζαλέο ιεηηνπξγίεο ησλ γνληδίσλ ηνπ ζπκπιεξψκαηνο πνπ δε ζρεηίδνληαη κε ηελ αλνζία.

46 2. ΥΛΙΚΑ ΚΑΙ ΜΕΘΟΔΟΙ 46

47 47 2.A ΤΛΙΚΑ 1. Γηαιύκαηα Γηα 500 ml δηαιχκαηνο, πξνζζήθε: 50 ml δ/ηνο 1Μ 10X Σ.Δ Buffer Tris (ηειηθή C 100mM), 10 ml δ/ηνο 0,5Μ EDTA ph 8 (ηειηθή C 10mM) ζε ddh 2 O. Σν ph θαζνξίδεηαη απφ απηφ ηνπ Tris-HCl. Απνζηείξσζε. ε ddh 2 0 πξνζζήθε 60,55g Tris base κέρξη φγθνπ 1Μ Tris-HCl 500 ml. H ξχζκηζε ηνπ ph γίλεηαη κε ~21 ml ππθλφ HCl γηα ph 8, ~30 ml γηα ph 7.6 θαη ~35 ml γηα ph 7,4.Απνζηείξσζε. 10Ν ΝαΟΖ Γηα 100 ml, πξνζζήθε 40g NaOH ζε ddh 2 0. Γε ρξεηάδεηαη απνζηείξσζε. 1Ν HCl Γηα 100 ml, πξνζζήθε 3.65g HCl ζε ddh Μ NaCl Γηα 500 ml, πξνζζήθε 146,4g NaCl ζε ddh 2 0. Απνζηείξσζε. 250mM KCl Γηάιπζε 1,86g KCl ζε 100ml ddh 2 0. Φπιάζζεηαη ζηνπο 4 0 C. Αηζαλόιε 70% Γηάιπκα 70% θ.ν. απφιπηεο αηζαλφιεο ζε ddh 2 0. Γιπθεξόιε 80% Γηάιπκα 80%θ.ν. απφιπηεο γιπθεξφιεο ζε ddh 2 0. Γηα 1 lt, πξνζζήθε : 108g Tris Base, 55g boric acid, 10Υ ΣΒΔ 40 ml 0,5M EDTA ή 7,5g EDTA ζε ddh 2 0. Αλάδεπζε. Απνζηείξσζε. Παξαζθεπάδεηαη δηάιπκα 10 mg/ml ζε ddh 2 0. ε Γηάιπκα Et Br πήθησκα αγαξφδεο ε ηειηθή ζπγθέληξσζε είλαη 0.5 mg/ml. 10X δηάιπκα ρξσζηηθήο Na 2 HPO 4 ph 7.2 1Μ MgSO 4 2Μ MgCl 2 DEPC H 2 O 0.1% Γηάιπκα δενμπλνπθιενηηδίσλ (dntps) 0.25% bromophenol blue, 0.25% xylene cyanol FF, 15% Ficoll. Γηα 200 ml ηειηθνχ δ/ηνο, αλάκημε ml δ/ηνο 1Μ Na 2 HPO 4 θαη 63.2 ml δ/ηνο 1Μ NaH 2 PO 4 ψζηε ην ph λα γίλεη 7.2. Γηα 100 ml πξνζζήθε 24,6g MgSO 4 7H 2 0 ή 12g MgSO 4 ζε ddh 2 0. Αλάδεπζε. Απνζηείξσζε ζε απηφθαπζην ή κε θίιηξν. Πξνζζήθε 40,66g MgCl 2 6 H 2 0 ζε 100 ml ddh 2 0 ή 19g MgCl 2 ζε 100 ml ddh 2 0. Αλάδεπζε. Απνζηείξσζε. Καιή δηάιπζε 1ml Diethylpyrocarbonate ζε 1lt ddh 2 0. Δπψαζε ζηνπο 37 0 C νινλχρηηα. Τγξή απνζηείξσζε. Παξαζθεπάδεηαη 25mM δηάιπκα dntps κε αλάκημε ίζσλ φγθσλ απφ ηα stock δ/καηα 100mM φισλ ησλ dntps (dαtp, dσtp, dctp, dgtp).

48 48 2. Θξεπηηθά Τιηθά SOB Medium SOB Medium ηεξεό SOC Medium 1Μ γιπθόδε Γηα 1 lt πξνζζήθε: 20g bacto-tryptone, 5g bacto-yeast extract, 0.5g NaCl ζε ddh 2 0. Αλάδεπζε κέρξη δηάιπζεο. Πξνζζήθε 10 ml δ/ηνο 250mM KCl. Ρχζκηζε ηνπ ph ζην 7, κε 5Ν ΝαΟΖ (~0,2ml). Ογθνκέηξεζε ζην 1lt. Απνζηείξσζε. Πξηλ ην ρξεζηκνπνηήζνπκε πξνζζέηνπκε 5 ml δ/ηνο 2M MgCl 2. Πξνζνρή! Πξηλ ξίμνπκε ην MgCl 2 δηάιπκα πξέπεη απηφ λα κελ είλαη δεζηφ, δηαθνξεηηθά ζα θξνθθηδσζεί. Γηα 20 ηξπβιία πεξίπνπ: Πξνζζήθε 10g bacto-tryptone, 5g bacto-yeast extract, 0.25g NaCl ζε ddh 2 0, κέρξη ηειηθνχ φγθνπ 500ml. Αλάδεπζε. Πξνζζήθε 5 ml δ/ηνο 250mM KCl. Ρχζκηζε ηνπ ph ζην 7, κε 5Ν ΝαΟΖ. Πξνζζήθε 7,5g bacto-agar. Απνζηείξσζε. Μφιηο ην δ/κα θξπψζεη πξνζζήθε 2,5 ml δ/ηνο 2Μ MgCl 2 θαη 600 κl ακπηθηιιίλεο ψζηε ε ηειηθή ζπγθέληξσζε ηνπ αληηβηνηηθνχ λα είλαη 60κg/ml. Γηα top agarose βάδσ 4g agarose γηα 500ml ζξεπηηθνχ. Παξαζθεπάδεηαη φπσο ην SOB κε επηπιένλ 1M γιπθφδε. Μεηά ηελ απνζηείξσζε ηνπ SOB θαη φηαλ ε ζεξκνθξαζία ηνπ είλαη 60 0 C, γίλεηαη πξνζζήθε 20 ml απνζηεηξσκέλνπ δηαιχκαηνο 1Μ γιπθφδεο. Γηάιπζε 18g καιηφδεο ζε ddh 2 0 κέρξη ηειηθνχ φγθνπ 100 ml. Απνζηείξσζε κε θίιηξν 0.22κm. 3. Δηδηθά Γηαιύκαηα Ampicillin (Sigma) Αληηβηνηηθό Stock solution (50mg/ml): ε 5 ml dh 2 0 πξνζζήθε 0.25g Ampicillin. Φηιηξάξνπκε θαη ρσξίδνπκε ζε eppendorf. Γηαηήξεζε ζηνπο C. Όια ηα δηαιχκαηα πνπ ρξεζηκνπνηνχληαη γηα ηηο πεηξακαηηθέο δηαδηθαζίεο παξαζθεπάδνληαη απφ ηα παξαπάλσ κε ηηο θαηάιιειεο αξαηψζεηο. Οη πγξέο απνζηεηξψζεηο γίλνληαη ζε απηφθαπζην, ελψ νη απνζηεηξψζεηο κε δηήζεζε γίλνληαη ζε θίιηξα Millipore.

49 49 4. Εεύγε εθθηλεηώλ Γνλίδην GAPDH C3 C6 C7 C8α C8β C8γ CD59 CLU VTN Δθθηλεηέο (Forward/Reverse) Μέγεζνο Πξντόληνο (bp) Σ an ( o C) 5 -TGA CGT GCA GCA GGA ACA C-3 5 -CAG TTG GTG GTG CAC GAT G CCC CAT ACA CCA TCC ACT T-3 5 -AGA GTT CCC CTG GCT TTG AT CTA TAA ACA CCT CTG CTA TGG-3 5 -GCT CCT GCC TAA TGC CTT ACC ATG GGA GAG AAT ACT ACA GGC-3 5 -GTG TTC TCA ACA ACC ATC AGC CCT CGG CTT CAC CTT ATC ACG-3 5 -CTG AAA CGC CCA GTG AGA GG CCC ATT ACA TTG CGG ACA CG-3 5 -ACG GGC GTG GAG GAA TTT GC ACCTTCAGGAAGCTGGATGGG-3 5 -CTATGGCATTGCTGAGCTGGC TGC TTG CAG ATG AGA TTT GG-3 5 -TAC GGG GGC AAT ACT GAA AG ATG GGG TGA AGC AGA TGA AG-3 5 -CAG TGA CAG CAT CGT CTC GT CAG TAC TGG CGC TTT GAT GA-3 5 -CGG GAT GAC ACG TAG ATC CT

50 50 2.B ΜΕΘΟΔΟΙ 2.1. Απομβνωςη νουκλεΰκών οξέων Α) Απομβνωςη πλαςμιδικογ DNA (μέθοδοσ άλκαλι) Ζ ζπγθεθξηκέλε κέζνδνο απνκφλσζεο πιαζκηδηθνχ DNA απφ πγξή θαιιηέξγεηα ελφο θιψλνπ E.coli είλαη γλσζηή σο «κέζνδνο ιχζεο κε άιθαιη». Υξεζηκνπνηείηαη γηα ηνλ έιεγρν ηνπ κεηαζρεκαηηζκνχ ησλ βαθηεξηαθψλ θπηηάξσλ. Τιηθά: Θξεπηηθφ πιηθφ αλάπηπμεο βαθηεξηαθήο θαιιηέξγεηαο (SOB) Γηάιπκα ακπηθηιιίλεο 50 mg/ml, σο αληηβηνηηθφ επηινγήο. Γηάιπκα Η (50 mm glucose, 25 mm TrisΖCl ph 8) Γηαιπκα ΗΗ (0.2N NaOH, 1% SDS) Γηαιπκα ΗΗΗ ( 3Μ νμαιηθφ θάιην ph 4.5. Σν ph ξπζκίδεηαη κε θαζαξφ νμηθφ νμχ) Γηαδηθαζία: Δκβνιηαζκφο 5 ml πγξνχ ζξεπηηθνχ πιηθνχ, παξνπζία ακπηθηιιίλεο, (ηειηθή ζπγθέληξσζε 50 κg/ml), κε κηα κνλαδηθή απνηθία θιψλνπ βαθηεξηαθψλ θπηηάξσλ. Οινλχρηηα αλάπηπμε ηεο θαιιηέξγεηαο ζε θηλνχκελν επσαζηή ζηνπο 37 0C. Φπγνθέληξεζε 1 ml ηεο θαιιηέξγεηαο ζηηο rpm γηα 5 min. Δπαλαδηάιπζε ησλ θπηηάξσλ ζε 100 κl δηαιύκαηνο I. Πξνζζήθε 200 κl θξέζθνπ δηαιύκαηνο II. Ήπηα αλάδεπζε κε αλαζηξνθή γηα 3-5 min. Καηά ην ζηάδην απηφ έρνπκε θπηηαξηθή ιχζε ππφ ηελ επίδξαζε ηνπ SDS. Σν NaOH δεκηνπξγεί έλα αιθαιηθφ πεξηβάιινλ. Σν δηάιπκα ζην ζηάδην απηφ παξακέλεη δηαπγέο. Πξνζζήθε 150 κl δηαιύκαηνο III θαη ήπηα αλάδεπζε κε αλαζηξνθή. ην βήκα απηφ έρνπκε θαηαθξήκληζε θπηηαξηθψλ κεκβξαλψλ, πξσηετλψλ, γνληδησκαηηθνχ DNA θαη κεγαινκνξηαθνχ RNA. Φπγνθέληξεζε ζηηο rpm γηα 5 min.

51 51 Λήςε ηεο ππεξθείκελεο πδαηηθήο θάζεο (πιαζκηδηαθφ DNA θαη RNAs) θαη πξνζζήθε 1ml παγσκέλεο απφιπηεο αηζαλφιεο (θαηαθξήκληζε ηνπ πιαζκηδηθνχ DNΑ). Ήπηα αλάδεπζε θαη θπγνθέληξεζε ζηηο rpm γηα 5 min,. Απνκάθξπλζε ηεο πδαηηθήο θάζεο κε αληιία θελνχ θαη μέπιπκα ηνπ DNA κε πξνζζήθε 500κl δηαιύκαηνο 70% αηζαλόιεο. Σν δηάιπκα 70% αηζαλφιεο δηαηεξεί ην DNA ζε ίδεκα, ελψ ηαπηφρξνλα, ην λεξφ (30%) δηψρλεη ηα άιαηα πνπ πξνεγνπκέλσο είραλ ρξεζηκνπνηεζεί ζηα δηαιχκαηα. Φπγνθέληξεζε ζηηο rpm γηα 5 min. Απνκάθξπλζε ηεο πδαηηθήο θάζεο θαη ζηέγλσκα ηνπ DNA ζε θπγφθεληξν ππφ θελφ ή κε ζέξκαλζε ζηνπο C γηα ιίγα min. Δπαλαδηάιπζε ηνπ πιαζκηδηθνχ DNA ζε απνζηεηξσκέλν ddh 2 O. Φχιαμε ζηνπο C. Ζ πνηφηεηα ηνπ απνκνλσκέλνπ πιαζκηδηθνχ DNA ειέγρεηαη κε ειεθηξνθφξεζε ζε 0.8% πήθησκα αγαξφδεο. Β) Απομβνωςη πλαςμιδικογ DNA (mini preparation) με προετοιμαςμένα υλικά Γηα απνκφλσζε πιαζκηδηθνχ DNA απφ θαιιηέξγεηα κηθξήο θιίκαθαο, ρξεζηκνπνηείηαη ην NucleoSpin Plasmid QuickPure ηεο MACHEREY-NAGEL (Cat. No / 50/ 250). Τιηθά (Buffer): A1 A2 A3 AQ Elution Γηαδηθαζία:

52 52 I) Παξαγσγή θαζαξνύ ππεξθείκελνπ Φπγνθέληξεζε βαθηεξηαθψλ θπηηάξσλ απφ 5 ml θαιιηέξγεηα Ecoli, 5 θνξέο δηαδνρηθά απφ 1 ml, ζηηο rpm γηα 1 min. Απφξξηςε ππεξθεηκέλνπ θαη αλαδηάιπζε ηνπ ηδήκαηνο ζε 250 κl Buffer A1. Πξνζζήθε 250 κl Buffer A2 θαη απαιή αλάδεπζε κε αλαζηξνθή ηνπ ζσιήλα eppendorf 6-8 θνξέο. Δπψαζε ζε ζεξκνθξαζία δσκαηίνπ γηα 5 min, πξνθεηκέλνπ λα γίλεη ιχζε ησλ θπηηαξηθψλ κεκβξαλψλ. Πξνζζήθε 300 κl παγσκέλνπ Buffer A3 θαη απαιή αλάδεπζε κε αλαζηξνθή 6-8 θνξέο. Σν δηάιπκα γίλεηαη λεθψδεο θαη ζρεκαηίδεηαη ραξαθηεξηζηηθφ ίδεκα. Φπγνθέληξεζε ζηηο rpm γηα 10 min. ΗΗ) Καζαξηζκόο πιαζκηδηθνύ DNA Μεηαθνξά φινπ ηνπ ππεξθεηκέλνπ ηεο πξνεγνχκελεο θπγνθέληξεζεο ζηε ζηήιε NucleoSpin Plasmid QuickPure. Φπγνθέληξεζε ζηηο rpm γηα 1 min. III) Έθπιπζε ηεο ζηήιεο Απφξξηςε ηνπ δηαιχκαηνο πνπ έρεη πεξάζεη απφ ηε ζηήιε. Πξνζζήθε 450 κl Buffer AQ ζηελ επάλσ επηθάλεηα ηνπ θίιηξνπ. Φπγνθέληξεζε ζηηο rpm γηα 3 min, ψζηε λα μεπιπζεί ην δεζκεπκέλν ζηε ζηήιε πιαζκίδην θαη ηαπηφρξνλα λα ζηεγλψζεη ε ζηήιε. ΗV) Έθινπζε πιαζκηδηθνύ DNA Δηζαγσγή ηεο ζηήιεο ζε θαζαξφ eppendorf 1.5 ml. Πξνζζήθε 50 κl Elution Buffer. Δπψαζε ζε ζεξκνθξαζία δσκαηίνπ γηα 1 min. Φπγνθέληξεζε ζηηο rpm γηα 1 min. Σν έθινπζκα πεξηέρεη ην πιαζκηδηθφ DNA. Γ) Απομβνωςη ολικογ RNA απβ ιςτβ Γηα ηελ απνκφλσζε νιηθνχ RNA απφ ηζηνχο φξληζαο ρξεζηκνπνηήζεθε ην ζχζηεκα Nucleospin RNA II ηεο εηαηξείαο Macherey-Nagel (Cat.No: /.20/.50/.250).

53 53 Τιηθά: Buffer RA1, RA2, RA3, Buffer MDB (Membrane Desalting Buffer) Buffer γηα ηελ r-dnase r-dnase, (RNase free) H 2 O (RNase free) Φίιηξα Nucleospin ηήιεο Nucleospin RNA II σιήλεο ζπιινγήο Nucleospin σιήλεο κηθξνθπγφθεληξνπ Γηαδηθαζία: Γηα ηελ απνκφλσζε νιηθνχ RNA, ρξεζηκνπνηήζεθαλ νη παξαθάησ ηζηνί: α) ήπαξ, ζπιήλα, ζηνκάρη, εγθέθαιν, θαξδηά, έληεξν, πλεχκνλα θαη λεθξφ ελήιηθνπ αηφκνπ φξληζαο β) ήπαξ εκβξχνπ φξληζαο 12 θαη 17 εκεξψλ, θαζψο θαη λενγέλλεηνπ αηφκνπ φξληζαο 2 θαη 5 εκεξψλ. γ) νιηθφ νκνγελνπνηεκέλν (ζε πγξφ άδσην) έκβξπν φξληζαο, 4 θαη 6 εκεξψλ. Αθνινχζεζε κεηαθνξά κε ιαβίδα 30mg ηζηνχ ζε απνζηεηξσκέλν ζσιελάθη eppendorf ζην νπνίην είρε πξνεγεζεί ε πξνζζήθε 350 κl buffer RA1 θαη 3.5 κl β- κεξθαπηναηζαλόιεο. Σφζν ζηε ιαβίδα, φζν θαη ζην ζσιελάθη, νη RNases είραλ αδξαλνπνηεζεί έπεηηα απφ θαηεξγαζία κε DEPC H 2 O. Άκεζε νκνγελνπνίεζε ηνπ ηζηνχ ζην ζσιελάθη eppendorf κε έκβνιν εηδηθφ γηα ηηο δηαζηάζεηο ηνπ ζσιήλα. Φηιηξάξηζκα ηνπ νκνγελνπνηεκέλνπ κίγκαηνο ζε ζηήιε Nucleospin Filter unit, κέζσ θπγνθέληξεζεο ζε x g γηα 1 min. Πξνζζήθε 350 κl αηζαλόιεο (70%) ζην θηιηξαξηζκέλν δηάιπκα θαη θαιή αλάκημε κε ηε ρξήζε κηθξνπηπέηαο.

54 54 Μεηαθνξά ηνπ ππεξθείκελνπ ζηε ζηήιε Nucleospin RNA II θαη θπγνθέληξεζε γηα 30 δεπηεξφιεπηα ζηα x g. Πξνζζήθε 350 κl buffer ΜDB θαη θπγνθέληξεζε ζε x g γηα 30 sec πξνθεηκέλνπ λα αθαιαησζεί ε κεκβξάλε. Πξνζζήθε 95 κl κίγκαηνο αληίδξαζεο rdnase ζηε ζηήιε (10 κl επαλαδηαιπηνπνηεκέλεο rdnase θαη 90 κl Reaction Buffer γηα rdnase) θαη αλακνλή ζε ζεξκνθξαζία δσκαηίνπ γηα 15 min πξνθεηκέλνπ λα θαηαηκεζεί ην DNA. Αθνινπζεί ε πξψηε έθπιπζε ηεο ζηήιεο, κε πξνζζήθε 200 κl buffer RA2 θαη θπγνθέληξεζε ζε x g γηα 30 sec πξνθεηκέλνπ λα απελεξγνπνηεζεί ε rdnase. Αθνινπζεί ε δεχηεξε έθπιπζε κε πξνζζήθε 600 κl buffer RA3 ζηε ζηήιε θαη θπγνθέληξεζε ζε x g γηα 30 sec πξνθεηκέλνπ λα αθαιαησζεί ε κεκβξάλε. Πξνζζήθε 250 κl buffer RA3 ζηε ζηήιε θαη θπγνθέληξεζε ζε x g γηα 2 min πξνθεηκέλνπ λα μεξαλζεί εληειψο ε κεκβξάλε. Έθινπζε RNA ζε 60κl H2O (RNase free) θαη θπγνθέληξεζε ζε x g γηα 1 min. Απνκάθξπλζε ηεο ζηήιεο θαη απνζήθεπζε ηνπ eppendorf, ην νπνίν πεξηέρεη ην θαζαξφ RNA, ζηνπο C. Ζ πνζφηεηα ηνπ RNA πνπ απνκνλψζεθε, πξνζδηνξίδεηαη κε θσηνκέηξεζε, ζηα 260 nm, ελψ ε πνηφηεηά ηνπ κε ειεθηξνθφξεζε ζε πήθησκα αγαξφδεο-θνξκαιδεχδεο ή πην απιά ζε θξέζθν πήθησκα αγαξφδεο -TBE. εκείσζε: Όια ηα πιηθά πνπ ρξεζηκνπνηνχληαη θαηά ηελ παξαπάλσ δηαδηθαζία είλαη επεμεξγαζκέλα κε DEPC. Δ) Απομβνωςη ζώνησ DNA απβ πήκτωμα αγαρβζησ Ζ δπλαηφηεηα απνκφλσζεο ηνπ επηζπκεηνχ πξντφληνο PCR απφ ηα πεθηψκαηα αγαξφδεο έπεηηα απφ ειεθηξνθφξεζε, πνπ παξέρεηαη κε ηε κέζνδν απηή, απνηειεί έλα ζεκαληηθφ εξγαιείν γηα ηηο κνξηαθέο ηερληθέο. Γηα ηελ παξαπάλσ δηαδηθαζία ρξεζηκνπνηήζεθε ην QIAquick Gel Extraction Kit ηεο Qiagen (Cat.No:28704).

55 55 Τιηθά: Γηάιπκα QG Ηζνπξνπαλφιε 100% Γηάιπκα PE H 2 O for injection Γηαδηθαζία: Αξθεηά κεγάιε πνζφηεηα DNA ειεθξνθνξείηαη ζε παξαζθεπαζηηθφ πήθησκα αγαξφδεο κηθξήο ζρεηηθά ζπγθέληξσζεο ππφ ρακειή ηάζε, ψζηε λα επηηεπρζεί ν θαιχηεξνο δηαρσξηζκφο ησλ ηκεκάησλ DNA (ηδίσο φηαλ έρνπκε πεξηζζφηεξεο απφ κία δψλεο). Απνθνπή ηεο δψλεο ηνπ DNA απφ ην πήθησκα αγαξφδεο πάλσ ζε ηξάπεδα ππεξηψδνπο αθηηλνβνιίαο (UV lamp) θαη ηνπνζέηεζή ηεο ζε ζσιελάθη eppendorf. Εχγηζκα ηνπ ηκήκαηνο πεθηψκαηνο. Πξνζζήθε 3 φγθσλ δηαιύκαηνο QG γηα 1 φγθν πεθηψκαηνο (π.ρ. γηα 100 mg πήθησκα πξνζζήθε 300 κl δηαιχκαηνο QG). Γηα πεθηψκαηα 2% γίλεηαη πξνζζήθε 6 φγθσλ δηαιχκαηνο QG. Σν κέγηζην πνζφ πεθηψκαηνο γηα θάζε QIAquick ζηήιε είλαη 400 mg. Δπψαζε ζηνπο 50 0 C γηα 10 min ή κέρξη ην πήθησκα λα δηαιπζεί εληειψο. Κάζε 3 min αλαθηλψ θαιά. Πξνζζήθε 1 φγθνπ ηζνπξνπαλόιεο ζην δείγκα θαη αλάκημε. Απηφ ην βήκα απμάλεη ηελ απφδνζε ηκεκάησλ DNA <500 bp θαη > 4 kb. Γηα ελδηάκεζνπ κεγέζνπο ηκήκαηα ε ηζνπξνπαλφιε δελ επεξεάδεη ηελ απφδνζε. Σνπνζέηεζε κηαο QIAquick ζηήιεο ζε ζπιιεθηήξην ζσιήλα 2 ml. Φφξησζε ηνπ δείγκαηνο ζηε ζηήιε γηα πξφζδεζζε ηνπ DNA. Φπγνθέληξεζε ζηηο rpm γηα 1 min. Αλ ην δείγκα είλαη πεξηζζφηεξν απφ 800 κl θνξηψλνπκε δηαδνρηθά θαη θπγνθεληξνχκε πάιη. Απφξξηςε ηνπ δηαιχκαηνο θαη επαλαηνπνζέηεζε ηεο ζηήιεο ζηνλ ίδην ζσιήλα. Πξνζζήθε 500 κl δηαιύκαηνο QG ζηε ζηήιε θαη θπγνθέληξεζε ζηηο rpm γηα 1 min. απηφ ην βήκα απνκαθξχλνλνληαη φια ηα ίρλε αγαξφδεο. Δίλαη

56 56 απαξαίηεην έλα αθνινπζήζεη πξνζδηνξηζκφο ηεο αιιεινπρίαο ηνπ DNA, in vitro κεηαγξαθή θαη κηθξνέλεζε. Πιχζηκν κε πξνζζήθε 750 κl δηαιύκαηνο PE ζηε ζηήιε. Ζ ζηήιε κέλεη ζηαζεξή γηα 2-5 min. Φπγνθέληξεζε ζηηο rpm γηα 1 min. Απφξξηςε ηνπ δηαιχκαηνο πνπ πέξαζε θαη επηπιένλ θπγνθέληξεζε ζηηο rpm γηα 1 min. (πιήξεο απνκάθξπλζε ηεο αηζαλφιεο). Δηζαγσγή ηεο ζηήιεο ζε θαζαξφ eppendorf 1.5 ml. Γηα ηελ έθινπζε, πξνζζέηνπκε 50 κl Elution Buffer θαη αθήλνπκε ηε ζηήιε ζηαζεξή γηα 1 min. Αθνινπζεί θπγνθέληξεζε ζηηο rpm γηα 1 min Ποςοτικβσ προςδιοριςμβσ νουκλεΰκών οξέων Πξνθεηκέλνπ λα κεηξεζεί ε πνζφηεηα ησλ λνπθιετθψλ νμέσλ, ρξεζηκνπνηνχληαη επξέσο δχν κέζνδνη: ε πεξίπησζε πνπ ην δείγκα είλαη θαζαξφ, δειαδή δελ πεξηέρεη ζεκαληηθά πνζά απφ πξσηεΐλεο, αγαξφδε, θαηλφιε ή άιια λνπθιετθά νμέα, ηφηε πξνηηκάηαη ν θσηνκεηξηθφο πξνζδηνξηζκφο. ηελ πεξίπησζε φπνπ δηαζέηνπκε πνιχ κηθξή πνζφηεηα DNA ή ηνπ RNA, ηφηε ελδείθλπηαη ν πξνζδηνξηζκφο κε βάζε ηελ έληαζε ηνπ εθπεκπφκελνπ απφ βξσκηνχρν αηζίδην θζνξηζκνχ, θαηά ηελ έθζεζε ησλ λνπθιετθψλ νμέσλ ζε ππεξηψδε αθηηλνβνιία. Α) Υωτομετρικβσ προςδιοριςμβσ Ο θσηνκεηξηθφο πξνζδηνξηζκφο λνπθιετθψλ νμέσλ, κπνξεί λα καο δψζεη δχν πιεξνθνξίεο, κία γηα ηελ πνζφηεηα ηνπ DNA ή ηνπ RNA ηνπ δείγκαηνο θαη κία γηα ηελ θαζαξφηεηα ηνπ δείγκαηνο, αλαθνξηθά κε ηελ αλάκημή ηνπ κε πξσηεΐλεο. Ζ κέηξεζε ζηα 260 nm επηηξέπεη ηνλ ππνινγηζκφ ηεο ζπγθέληξσζεο ηνπ λνπθιετθνχ νμένο ζην δείγκα. Μία κνλάδα OD (OD=1) αληηζηνηρεί πεξίπνπ ζε 50 κg/ml δίθισλνπ DNA, 40 κg/ml κνλφθισλνπ DNA θαη RNA, θαη 20 κg/ml νιηγνλνπθιενηηδίσλ. κνλφθισλσλ Ζ κέηξεζε ζηα 280 nm, καο επηηξέπεη ηνλ ππνινγηζκφ ηεο ζπγθέληξσζεο ησλ πξνζκίμεσλ ησλ πξσηετλψλ ή θαηλφιεο πνπ βξίζθνληαη ζην δείγκα. Γηα ην ιφγν απηφ, γηα ην ε θαζαξφηεηα ηνπ DNA ή ηνπ RNA εθηηκάηαη έπεηηα απφ δχν κεηξήζεηο: κία ζηα

57 nm θαη κία ζηα 280 nm. ηε ζπλέρεηα, απφ ην ιφγν απηφ ησλ ηηκψλ ηεο νπηηθήο απνξξφθεζεο ζηα 260 nm θαη ζηα 280 nm (OD 260 /OD 280 ), ππνινγίδεηαη ν βαζκφο ηεο θαζαξφηεηαο ηνπ λνπθιετθνχ νμένο. Καζαξά δείγκαηα DNA θαη RNA δίλνπλ ηηκέο 1.8 θαη 2.0 αληίζηνηρα. Δάλ ππάξρνπλ πξνζκίμεηο πξσηετλψλ ή θαηλφιεο ν ιφγνο OD 260 / OD 280 δίλεη πνιχ κηθξφηεξεο ηηκέο απφ ηηο πξνεγνχκελεο θαη ν αθξηβήο πξνζδηνξηζκφο ηεο πνζφηεηαο ησλ λνπθιετθψλ νμέσλ δελ είλαη δπλαηφο. Ζ ζπγθέληξσζε ηνπ λνπθιετθνχ νμένο ζην δείγκα ζε κg/ml ππνινγίδεηαη γηα ην DNA απφ ηνλ ηχπν: OD 260 x 50 x αραίωση (π.ρ. αλ έρνπκε 1 κl απφ ην δείγκα δηαιπκέλν ζε 99 κl H 2 O, ε αξαίσζε είλαη 100/1), ελψ γηα ην RNA απφ ηνλ ηχπν: OD 260 x 40 x αραίωση. Β) Προςδιοριςμβσ με ηλεκτροφβρηςη ςε πήκτωμα αγαρβζησ Ζ ειεθηξνθφξεζε είλαη κία γξήγνξε κέζνδνο πξνζδηνξηζκνχ ηεο ζπγθέληξσζεο ηνπ DNA, θπξίσο ζε δείγκαηα ηα νπνία πεξηέρνπλ κηθξή ζπγθέληξσζε DNA (250ng/ml). Καηά ηελ πεξίπησζε απηή, ν πξνζδηνξηζκφο γίλεηαη κε βάζε ηελ έληαζε ηνπ θζνξηζκνχ πνπ εθπέκπεηαη απφ ην βξσκηνχρν αηζίδην, ην νπνίν παξεκβάιιεηαη κεηαμχ ησλ βάζεσλ ηνπ λνπθιετθνχ νμένο. Σν πνζφ ηνπ θζνξηζκνχ είλαη αλάινγν ηεο ζπλνιηθήο κάδαο ηνπ DNA ή RNA, επνκέλσο ε ζπγθέληξσζε κπνξεί λα ππνινγηζηεί ζπγθξίλνληαο ηελ έληαζε θζνξηζκνχ ηνπ δείγκαηνο κε ηελ έληαζε πνπ εθπέκπεη έλα δείγκα γλσζηήο ζπγθέληξσζεο, φηαλ απηά ειεθξνθνξνχληαη ζην ίδην πήθησκα αγαξφδεο θαη εθηίζεληαη ζε ππεξηψδεο θσο. Ζ ειάρηζηε ζπγθέληξσζε πνπ κπνξεί λα πξνζδηνξηζηεί κε ηε κέζνδν απηή είλαη 1-5 ng γηα ην DNA θαη 50 ng γηα ην RNA Ηλεκτροφβρηςη νουκλεΰκών οξέων ςε πήκτωμα αγαρβζησ Ζ ζπγθεθξηκέλε ηερληθή, επηηξέπεη ην δηαρσξηζκφ, ην ραξαθηεξηζκφ θαη ηελ απνκφλσζε ηκεκάησλ λνπθιετθψλ νμέσλ. Δπηπιένλ, παξέρεη ηε δπλαηφηεηα αλάιπζεο ηκεκάησλ DNA ηα νπνία δελ κπνξνχλ λα δηαρσξηζηνχλ κε άιιεο ζπκβαηηθέο ηερληθέο δηαρσξηζκνχ, φπσο είλαη ε θπγνθέληξεζε. Ζ αξρή ζηελ νπνία ζηεξίδεηαη ε ειεθηξνθφξεζε, είλαη φηη θνξηηζκέλα θνιινεηδή κφξηα θηλνχληαη ππφ ηελ επίδξαζε εθαξκνδφκελνπ ειεθηξηθνχ πεδίνπ.

58 58 Ζιεθηξνθόξεζε ζε πήθησκα αγαξόδεο ε πεθηψκαηα αγαξφδεο δηαθφξσλ ζπγθεληξψζεσλ κπνξνχλ λα δηαρσξηζηνχλ ηκήκαηα DNA κεγέζνπο απφ 100 bp έσο 50 kb. Ζ ειεθηξνθφξεζε γίλεηαη ζπλήζσο ζε νξηδφληην επίπεδν ππφ ειεθηξηθφ πεδίν ζηαζεξήο ηάζεο. Σα πεθηψκαηα αγαξφδεο θηηάρλνληαη αθνχ πξψηα δηαιχζνπκε κε ζέξκαλζε ηελ αγαξφδε κέζα ζε έλα ηνληηθφ δηάιπκα. Όηαλ απηφ γίλεη δηαπγέο ρχλνπκε ην κίγκα ζηελ κήηξα θαη πεξηκέλνπκε λα ζηεξενπνηεζεί. Καζψο ζηεξενπνηείηαη ε αγαξφδε, θηηάρλεη έλα δίθηπν ηνπ νπνίνπ ε ππθλφηεηα είλαη αλάινγε ηεο ζπγθέληξσζεο ηεο αγαξφδεο πνπ ρξεζηκνπνηήζακε. Με ηελ εθαξκνγή ειεθηξηθνχ πεδίνπ ζηα άθξα ηνπ πεθηψκαηνο, ηα λνπθιετθά νμέα, ηα νπνίν είλαη αξλεηηθά θνξηηζκέλα, θηλνχληαη πξνο ηελ άλνδν. Ζ ειεθηξνθνξεηηθή θηλεηηθφηεηα ησλ λνπθιετθψλ νμέσλ εμαξηάηαη απφ ηηο παξαθάησ παξακέηξνπο: α) Μνξηαθφ βάξνο ησλ ηκεκάησλ ησλ λνπθιετθψλ νμέσλ: Σα δίθισλα γξακκηθά ηκήκαηα DNA θηλνχληαη ζε έλα πήθησκα αγαξφδεο κε ξπζκφ ν νπνίνο είλαη αληηζηξφθσο αλάινγνο ηνπ δεθαδηθνχ ινγάξηζκνπ (log 10 ) ηνπ αξηζκνχ ησλ δεπγψλ βάζεσλ απφ ηηο νπνίεο απνηεινχληαη. Σα κεγάια ηκήκαηα DNA κεηαλαζηεχνπλ πην αξγά απφ φ,ηη ηα κηθξφηεξα ηκήκαηα ιφγσ ησλ κεγαιχηεξσλ ηξηβψλ πνπ δεκηνπξγνχληαη θαηά ηελ κεηαθίλεζή ηνπο δηακέζνπ ησλ πφξσλ ηεο αγαξφδεο. β) Δθαξκνδφκελε ηάζε ηνπ ειεθηξηθνχ πεδίνπ. Τπφ ρακειή δηαθνξά δπλακηθνχ, ν ξπζκφο κεηαλάζηεπζεο γξακκηθψλ κνξίσλ DNA είλαη αλάινγνο ηεο εθαξκνδφκελεο ηάζεο. Αλ φκσο απμεζεί ε δηαθνξά δπλακηθνχ ζην θχθισκα, ε θηλεηηθφηεηα ησλ κεγάινπ κνξηαθνχ βάξνπο ηκεκάησλ DNΑ ζα απμεζεί δηαθνξηθά. Σν ηθαλνπνηεηηθφ ινηπφλ εχξνο δηαρσξηζκνχ ζε πεθηψκαηα αγαξφδεο κεηψλεηαη φζν απμάλεηαη ε εθαξκνδφκελε δηαθνξά δπλακηθνχ. Ζ κέγηζηε ηάζε πνπ πξέπεη λα εθαξκφζνπκε ζην πήθησκα γηα λα επηηχρνπκε ηε κεγαιχηεξε αλάιπζε ηκεκάησλ DNA ηα νπνία δηαθέξνπλ θαηά 2kb, είλαη 5V/cm. γ) χλζεζε ηνπ ηνληηθνχ δηαιχκαηνο ειεθηξνθφξεζεο. Ζ ειεθηξνθνξεηηθή θηλεηηθφηεηα ηνπ DNA επεξεάδεηαη απφ ηε ζχλζεζε θαη ην βαζκφ ηνληηζκνχ ηνπ δηαιχκαηνο ειεθηξνθφξεζεο. Απνπζία ηφλησλ ε ειεθηξηθή αγσγηκφηεηα είλαη ειάρηζηε θαη ην DNA κεηαθηλείηαη κε πνιχ αξγφ ξπζκφ ή θαζφινπ. Γηαιχκαηα κε πςειφ βαζκφ ηνληηζκνχ δεκηνπξγνχλ πςειή ειεθηξηθή αγσγηκφηεηα, κε απνηέιεζκα ηελ αλάπηπμε

59 59 ζεξκφηεηαο ζηε ζπζθεπή. ηε ρεηξφηεξε πεξίπησζε, ην πήθησκα ιεηψλεη θαη ην DNA απνδηαηάζζεηαη. Σα πην ζπλεζηζκέλα δηαιχκαηα πνπ ρξεζηκνπνηνχληαη είλαη ην Trisacetate (TAE) θαη ην Tris-borate (TBE), ph:8,5. δ) Ζ ζπγθέληξσζε ηεο αγαξφδεο ζην πήθησκα. Πεθηψκαηα αγαξφδεο δηαθνξεηηθήο ζπγθεληξψζεσο επεξεάδνπλ δηαθνξεηηθά ηελ ειεθηξνθνξεηηθή ζπκπεξηθνξά ησλ ηκεκάησλ DNA. Μηα γξακκηθή ζρέζε ηζρχεη αλάκεζα ζηελ ειεθηξνθνξεηηθή θηλεηηθφηεηα ηνπ DNA (κ) θαη ζηελ ζπγθέληξσζε ηνπ πεθηψκαηνο (η), ε νπνία πεξηγξάθεηαη απφ ηελ εμίζσζε: logκ=logκ 0 - K r η, φπνπ κ 0 ε ειεχζεξε ειεθηξνθνξεηηθή θηλεηηθφηεηα ηνπ DNA θαη φπνπ K r ν ζπληειεζηήο θαζπζηέξεζεο (retardation coefficient), ζηαζεξά πνπ ζρεηίδεηαη κε ηηο ηδηφηεηεο ηνπ πεθηψκαηνο, ην κέγεζνο θαη ην ζρήκα ησλ θηλνχκελσλ κνξίσλ. Με ηνλ ηξφπν απηφ ρξεζηκνπνηψληαο πεθηψκαηα δηαθνξεηηθψλ ζπγθεληξψζεσλ, κπνξνχκε λα δηαρσξίζνπκε έλα επξχ θάζκα κεγεζψλ DNA, ζχκθσλα κε ηνλ παξαθάησ πίλαθα: Πνζόηεηα ηεο αγαξόδεο ζην πήθησκα (%w/v) Δύξνο δηαρσξηζκνύ ηκεκάησλ DNA (kb) Δηδηθά γηα ηελ ειεθηξνθνξεηηθή θηλεηηθφηεηα κνξίσλ DNA, ζε απηήλ επηδξά θαη ε παξαθάησ παξάκεηξνο: ε) ηεξενδνκή ησλ κνξίσλ DNA. Σκήκαηα DNA ηα νπνία είλαη ππεξειηθσκέλα, αλνηθηά θπθιηθά θαη επζχγξακκα ηνπ ίδηνπ κνξηαθνχ βάξνπο, θηλνχληαη κε δηαθνξεηηθφ ξπζκφ ζην ίδην πήθησκα αγαξφδεο. Οη ζρεηηθέο θηλεηηθφηεηεο ησλ ηξηψλ κνξθψλ εμαξηψληαη θπξίσο απφ ηε ζπγθέληξσζε ηεο αγαξφδεο ζην πήθησκα, αιιά επεξεάδνληαη θαη απφ ηελ εθαξκνδφκελε ηάζε ηνπ ξεχκαηνο, ην βαζκφ ηνληζκνχ ηνπ δηαιχκαηνο θαη

60 60 ηελ ππθλφηεηα ησλ ειίθσλ ηνπ ππεξειηθσκέλνπ DNA. Τπφ ζπγθεθξηκέλεο ζπλζήθεο, ην ππεξειηθσκέλν DNA κεηαλαζηεχεη γξεγνξφηεξα απφ ην γξακκηθφ. Τπφ άιιεο ζπλζήθεο, ε ζεηξά απηή κπνξεί λα αληηζηξαθεί. Παξαζθεπή πεθηώκαηνο αγαξόδεο - Γηαδηθαζία ειεθηξνθόξεζεο Α) Ηλεκτροφβρηςη DNA Τιηθά: 10Υ ΣΒΔ δηάιπκα ειεθηξνθφξεζεο 10Υ δηάιπκα ρξσζηηθήο Γηαδηθαζία: Γηάιπζε αγαξφδεο ζε δηάιπκα 0.5Υ TBE κε βξαζκφ θαη πξνζζήθε δηαιχκαηνο βξσκηνχρνπ αηζηδίνπ (ηειηθή ζπγθέληξσζε 0.1 κg/ml). Αθνινπζεί ζηεξενπνίεζε ηνπ πεθηψκαηνο, ε νπνία γίλεηαη ζε επηθάλεηα ζπγθεθξηκέλσλ δηαζηάζεσλ. Οη ζέζεηο ππνδνρείο ησλ δεηγκάησλ DNA (πεγαδάθηα) ζρεκαηίδνληαη κε ηε βνήζεηα εηδηθήο κήηξαο πνπ ηνπνζεηείηαη ζηε ζπζθεπή πξηλ ηελ νξηζηηθή πήμε ηνπ πεθηψκαηνο. Πξνζζήθε δηαιχκαηνο 10Υ ρξσζηηθήο (ηειηθή ζπγθέληξσζε 1Υ) ζηα δείγκαηα DNA πνπ πξφθεηηαη λα ειεθηξνθνξεζνχλ. Με ηε ρξσζηηθή γίλεηαη ε παξαθνινχζεζε ηεο ειεθηξνθφξεζεο ησλ δεηγκάησλ, ιφγσ ηνπ κεηψπνπ πνπ δεκηνπξγεί, ελψ παξάιιεια απμάλεηαη ε ππθλφηεηά ηνπο θαη επνκέλσο πεξηνξίδεηαη ε δηάρπζή ηνπο ιφγσ ηεο θηθφιιεο πνπ πεξηέρεη ε ρξσζηηθή. Σνπνζέηεζε δεηγκάησλ ζηνπο εηδηθνχο ππνδνρείο κε ηε βνήζεηα κηθξνπηπέηηαο. Ζ αλάιπζε ησλ δεηγκάησλ γίλεηαη ζε ζεξκνθξαζία δσκαηίνπ ππφ ζηαζεξή έληαζε ξεχκαηνο ma. Πξνθεηκέλνπ λα είλαη δπλαηή ε εθηίκεζε ηνπ κεγέζνπο ησλ ηκεκάησλ DNA πνπ αλαιχνληαη, ειεθηξνθνξείηαη καδί κε ηα δείγκαηα θαη κάξηπξαο DNA γλσζηψλ κνξηαθψλ κεγεζψλ θαη γλσζηήο ζπγθέληξσζεο. Ο κάξηπξαο απηφο είλαη ζπλήζσο DNA ι θάγνπ θαηαηεηκεκέλν κε έλδπκα πεξηνξηζκνχ. Γηα ην ζθνπφ απηφ ρξεζηκνπνηήζεθαλ νη εμήο δείθηεο DNA:

61 61 - ι x PvuII ( bp) - ι x EcoRI / HindIII ( bp) Μεηά ην ηέινο ηεο ειεθηξνθφξεζεο ην πήθησκα θσηνγξαθίδεηαη ζε ζχζηεκα: Kodak Digital Science Electrophoresis Documentation and Analysis System 120 (EDAS 120). B) Ηλεκτροφβρηςη RNA Πξνθεηκέλνπ λα ειεγρζεί ε πνηφηεηα ηνπ RNA πνπ απνκνλψλεηαη, γίλεηαη αλάιπζή ηνπ ζε απνδηαηαθηηθφ πήθησκα αγαξφδεο θνξκακηδίνπ, ή ελαιιαθηηθά ζε θξέζθν πήθησκα αγαξφδεο απφ TBE κε λεξφ θαηεξγαζκέλν κε DEPC. Σν RNA κεηαλαζηεχεη ζην πήθησκα δηαλχνληαο απφζηαζε πνπ βξίζθεηαη ζε γξακκηθή ζρέζε κε ην ινγάξηζκν ηνπ κνξηαθνχ ηνπ βάξνπο. Ζ ειεθηξνθνξεηηθή αλάιπζε νιηθνχ RNA ζε πήθησκα κε βξσκηνχρν αηζίδην, καο δίλεη ηηο δχν δψλεο ηνπ ξηβνζσκηθνχ RNA (28S θαη 18S), ελψ ην mrna θαίλεηαη σο «smear». Καη ζηελ πεξίπησζε απηή καδί κε ηα δείγκαηα αλαιχνληαη θαη θαηάιιεινη RNA δείθηεο. Γηα ηελ απνθπγή ησλ ξηβνλνπθιεαζψλ (RNases), νη νπνίεο κέζα ζε ιίγα min κπνξνχλ λα θαηαζηξέςνπλ ην RNA, ρξεζηκνπνηνχληαη πιηθά θαηεξγαζκέλα κε DEPC (diethyl pyrocarbonate).tα γπαιηθά θαη ηα πιαζηηθά επσάδνληαη νινλχρηηα κε 0.1% DEPC ζηνπο 37 o C θαη ηελ επφκελε εκέξα απνζηεηξψλνληαη ζε απηφθαπζην (120 0 C, 1.2 atm),ψζηε λα απνκαθξπλζνχλ ηπρφλ ππνιείκκαηα DEPC, ελψ φια ηα δηαιχκαηα θηηάρλνληαη κε λεξφ επεμεξγαζκέλν κε DEPC. Γηαδηθαζία: Καζαξηζκφο φισλ ησλ ζπζηεκάησλ ειεθηξνθφξεζεο (ζπζθεπή, κήηξα πεθηψκαηνο θ.ά.) κε ηα παξαθάησ δηαιχκαηα, δηαδνρηθά: 0.5% SDS, Ζ 2 Ο, αηζαλφιε, ζηέγλσκα ζηνλ αέξα, 3% Ζ 2 Ο 2 γηα 10 min θαη θαιφ μέπιπκα κε Ζ 2 Ο - DEPC. Γηάιπζε αγαξφδεο κε βξαζκφ ζε 2.5ml δηαιχκαηνο 10Υ DEPC-ΣΒΔ ml Ζ2Ο. Πξνζζήθε βξσκηνχρνπ αηζηδίνπ αθνχ θξπψζεη ην δηάιπκα (ηειηθή ζπγθέληξσζε 0.1κg/ml).

62 62 ηεξενπνίεζε ηνπ πεθηψκαηνο ζε γπάιηλε επηθάλεηα ζπγθεθξηκέλσλ δηαζηάζεσλ. Οη ζέζεηο ππνδνρείο ησλ δεηγκάησλ DNA ζρεκαηίδνληαη κε ηε βνήζεηα εηδηθήο κήηξαο πνπ ηνπνζεηείηαη ζηε ζπζθεπή πξηλ ηελ νξηζηηθή πήμε ηνπ πεθηψκαηνο. Σνπνζέηεζε ηνπ πεθηψκαηνο ζην δηάιπκα ειεθηξνθφξεζεο 1Υ DEPC-TBE ιίγα ιεπηά πξηλ ηελ έλαξμε ηεο ειεθηξνθφξεζεο. Πξνζζήθε loading buffer 5Υ (εηδηθά γηα ηα δείγκαηα RNA) θαη ηνπνζέηεζή ηνπο ζηνπο ππνδνρείο ηνπ πεθηψκαηνο, εθαξκφδνληαο ζηαζεξή έληαζε mA Αλυςιδωτή αντίδραςη πολυμεράςησ (PCR) Ζ αιπζηδσηή αληίδξαζε πνιπκεξάζεο ή PCR (Polymerase Chain Reaction) είλαη κία ελδπκηθή κέζνδνο πνιιαπιαζηαζκνχ ζπγθεθξηκέλσλ αιιεινπρηψλ ηνπ DNA, ε νπνία επηηξέπεη ηελ in vitro παξαγσγή κεγάινπ αξηζκνχ αληηγξάθσλ ησλ αιιεινπρηψλ απηψλ απφ κηθξέο πνζφηεηεο DNA (0.1-1 κg). Ζ αξρή ηεο κεζφδνπ ζηεξίδεηαη ζηελ ηδηφηεηα ησλ αιπζίδσλ DNA λα απνδηαηάζζνληαη ζε πςειέο ζεξκνθξαζίεο θαη ζηε ζπλέρεηα λα επαλαδηαηάζζνληαη ζε ρακειφηεξεο, βάζεη ηεο αξρήο ηεο ζπκπιεξσκαηηθφηεηαο ησλ βάζεσλ θαη ηέινο λα αληηγξάθνληαη. Σν έλδπκν ην νπνίν ρξεζηκνπνηείηαη γηα ηελ αληηγξαθή ηνπ DNA, είλαη κηα DNA πνιπκεξάζε, ε νπνία ρξεζηκνπνηεί κνλφθισλα κφξηα DNA σο εθκαγεία γηα ηε ζχλζεζε λέσλ ζπκπιεξσκαηηθψλ θιψλσλ κε θαηεχζπλζε 5 3. Σα κνλφθισλα απηά κφξηα, πξνθχπηνπλ έπεηηα απφ ζέξκαλζε ζε πςειέο ζεξκνθξαζίεο. Ζ πνιπκεξάζε πνπ ρξεζηκνπνηείηαη γηα ηελ αιπζηδσηή αληίδξαζε πνιπκεξάζεο πξνέξρεηαη απφ ην ζεξκνθηιηθφ βαθηήξην Thermus aquaticus θαη έρεη ηελ ηδηφηεηα λα είλαη ζεξκναλζεθηηθή θαη λα κελ αδξαλνπνηείηαη ζηνπο 95 o C. Δπνκέλσο, δελ ρξεηάδεηαη αλαλέσζε ηεο πνζφηεηαο ηνπ ελδχκνπ ζε θάζε θχθιν ηεο αληίδξαζεο. Δπηπιένλ, γηα ηελ έλαξμε ηεο ζχλζεζεο, ην ζπγθεθξηκέλν έλδπκν απαηηεί κηα κηθξή δίθισλε πεξηνρή DNA. Γηα ην ζθνπφ απηφ ρξεζηκνπνηνχληαη ζηελ PCR δχν νιηγνλνπθιενηηδηθά ελαξθηήξηα κφξηα (εθθηλεηέο, primers) ηα νπνία είλαη ζπκπιεξσκαηηθά πξνο ηα άθξα ηνπ ηκήκαηνο ηνπ DNA ζηφρνπ, ην νπνίν ζέινπκε λα

63 63 πνιιαπιαζηάζνπκε. Σν κέγεζνο ινηπφλ ηνπ επηιεγκέλνπ πξνο πνιιαπιαζηαζκφ ηκήκαηνο DNA νξίδεηαη απφ ηε ζέζε πνπ θαηέρνπλ ηα 5 άθξα ησλ εθθηλεηψλ. Σα βήκαηα ηα νπνία πεξηιακβάλεη ε αιπζηδσηή αληίδξαζε πνιπκεξάζεο είλαη ηα εμήο: Απνδηάηαμε ηνπ DNA (denaturation). Καηά ην ζηάδην απηφ, νη δίθισλεο αιπζίδεο ηνπ DNA απνρσξίδνληαη κε ζέξκαλζε ζηνπο 95 o C. Δπαλαζχλδεζε (annealing). Καηά ηελ επαλαζχλδεζε, ην δεχγνο ησλ εθθηλεηψλ πβξηδνπνηείηαη κε ηελ αιιεινπρία ηνπ DNA, βάζεη ηεο αξρήο ηεο ζπκπιεξσκαηηθφηεηαο ησλ βάζεσλ. Ζ ζεξκνθξαζία ζχλδεζεο (Tan) ζπλήζσο είλαη ρακειφηεξε θαηά 2-5 o C απφ ηε ζεξκνθξαζία ηήμεο ησλ νιηγνλνπθιενηηδίσλ ησλ εθθηλεηψλ, ε νπνία ππνινγίδεηαη απφ ηε ζρέζε Tm = 2(A+T) + 4(C+G). Ζ ηδαληθή ζεξκνθξαζία πξφζδεζεο είλαη αξθεηά ρακειή ψζηε λα επηηξέπεη ηελ πβξηδνπνίεζε ησλ εθθηλεηψλ θαη αξθεηά πςειή ψζηε λα απνθιείεη ην ζρεκαηηζκφ εηεξνκεξψλ. χλζεζε (extension). Δπηκήθπλζε ηνπ αλαζπλδπαζκέλνπ νιηγνλνπθιενηηδίνπ απφ ηελ Taq πνιπκεξάζε ζηνπο 72 o C. Σν ζπγθεθξηκέλν έλδπκν πνιπκεξίδεη κε ηαρχηεηα 1kb DNA /1 min. Σα παξαπάλσ βήκαηα απνδηάηαμεο, ζχλδεζεο θαη επηκήθπλζεο επαλαιακβάλνληαη ζπλήζσο θνξέο (θχθινη ηεο PCR). Σα πξντφληα ηνπ DNA πνπ δεκηνπξγνχληαη ζε θάζε θχθιν ρξεζηκνπνηνχληαη ζα κήηξα γηα ηνλ επφκελν. Χο απνηέιεζκα ηεο φιεο δηαδηθαζίαο πξνθχπηεη ν εθζεηηθφο πνιιαπιαζηαζκφο (amplification) ηνπ επηιεγκέλνπ ηκήκαηνο DNA. Α) Αλυςιδωτή αντίδραςη αντίςτροφησ μεταγραφάςησ (RT-PCR) Πξνθεηκέλνπ λα επηηεπρζεί ε εθηίκεζε ηεο έθθξαζεο γνληδίσλ ζε ηζηνχο θαη ζε θχηηαξα ζην επίπεδν ηνπ mrna έρεη αλαπηπρζεί πιήζνο ηερληθψλ, φπσο είλαη ε αλάιπζε Νorthern Blot, ε RT-PCR, ε RNase Protection Assay θαη ε S1 Nuclease Assay. Μεηαμχ ησλ παξαπάλσ ηερληθψλ, ε RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) είλαη ε πην επαίζζεηε απφ φιεο. Υξεζηκνπνηείηαη γηα ηνλ θαζνξηζκφ ηεο παξνπζίαο ή απνπζίαο κεηαγξάθνπ ελφο γνληδίνπ, ηνπ επηπέδνπ έθθξαζήο ηνπ (πνζνηηθνπνίεζε πξντφλησλ RT-PCR) θαζψο θαη γηα ηελ παξαγσγή cdna κνξίσλ. ηελ αληίδξαζε απηή, σο ππφζηξσκα ρξεζηκνπνηείηαη νιηθφ θπηηαξνπιαζκαηηθφ RNA (1pg 2.5κg) ή poly(a) + RNA (1 pg 100 ng). Ζ αξρή ηεο κεζφδνπ βαζίδεηαη ζηνλ

64 64 in vivo πνιιαπιαζηαζκφ νξηζκέλσλ RNA ηψλ κέζα ζηα θχηηαξα. Σν έλδπκν αληίζηξνθε κεηαγξαθάζε είλαη κηα RNA εμαξηψκελε DNA πνιπκεξάζε, δειαδή ρξεζηκνπνηεί σο ππφζηξσκα κφξηα RNA γηα ηε ζχλζεζε ζπκπιεξσκαηηθνχ DNA (cdna). Απνηέιεζκα είλαη ε δεκηνπξγία πβξηδηθψλ κνξίσλ RNA-DNA. Απφ εθεί θαη πέξα αθνινπζείηαη ε πνξεία ηεο θιαζηθήο PCR, φπνπ πνιιαιπαζηάδνληαη ηα cdna κφξηα. ηελ παξνχζα εξγαζία, ε RT-PCR πξαγκαηνπνηήζεθε ζε δχν βήκαηα. ην πξψην έγηλε ε ζχλζεζε ηεο πξψηεο αιπζίδαο ζπκπιεξσκαηηθνχ DNA κε ππφζηξσκα νιηθφ RNA απφ ηζηνχο (PrimeScript 1st strand cdna Synthesis Kit Cat.No: 6110A), ελψ ζηε δεχηεξν βήκα αθνινχζεζε ν πνιιαπιαζηαζκφο ηνπ παξαρζέληνο cdna κε ηε ρξήζε ησλ θαηάιιεισλ γηα θάζε γνλίδην εθθηλεηψλ, κε ηελ αιπζηδσηή αληίδξαζε πνιπκεξάζεο. 1 ο Βήμα: γνθεςη πρώτησ αλυςίδασ cdna απβ RNA Όπσο πξναλαθέξζεθε, ε ζχλζεζε ηεο πξψηεο αιπζίδαο cdna απφ RNA, θαηαιχεηαη απφ κηα RNA-εμαξηψκελε, DNA πνιπκεξάζε, ηελ αληίζηξνθε κεηαγξαθάζε. Ζ αληίδξαζε ηεο αληίζηξνθεο κεηαγξαθήο, κπνξεί λα εθθηλήζεη κε ηξεηο δηαθνξεηηθνχο ηξφπνπο: Α) κε ηε ρξήζε ηπραίσλ εμακεξψλ, δειαδή κε εηδηθψλ εμαλνπθιενηηδίσλ, ηα νπνία ρξεζηκνπνηνχληαη θπξίσο ζηελ πεξίπησζε πνπ ζέινπκε λα κεηαγξάςνπκε αθέξαην έλα κήλπκα RNA ην νπνίν είλαη δχζθνιν λα κεηαγξαθεί νιφθιεξν. Με ηε κέζνδν απηή, φιν ην αξρηθφ RNA απνηειεί ππφζηξσκα γηα ηελ αληίδξαζε, ελψ ε απαηηνχκελε εμεηδίθεπζε επηηπγράλεηαη θαηά ηελ αθφινπζε PCR, κε ηε ρξήζε εηδηθνχ εθθηλεηή. Β) κε ηε ρξήζε ελφο εθθηλεηή oligo(dt), ν νπνίνο πβξηδίδεηαη κε ηελ 3 poly (A) + νπξά ηνπ κελχκαηνο mrna, ε νπνία ζπλαληάηαη ζηε κεγάιε πιεηνςεθία ησλ επθαξπσηηθψλ mrnas. Καζψο ε ην RNA πνπ θέξεη poly (A) + νπξά απνηειεί πεξίπνπ ην 1% κε 2% ηνπ ζπλνιηθνχ RNA, ε πνζφηεηα θαη ε πνιππινθφηεηα ηνπ cdna είλαη ζεκαληηθά κηθξφηεξε απφ εθείλε ζηελ πεξίπησζε ρξήζεο ηπραίσλ εμακεξψλ. Γ) κε ηε ρξήζε ελφο εηδηθνχ εθθηλεηή γηα ην γνλίδην ηνπ ελδηαθέξνληφο καο, ν νπνίνο πεξηέρεη ηελ πιεξνθνξία ηεο αιιεινπρίαο ηνπ cdna ζηφρνπ. ηελ πεξίπησζε απηή, ν εθθηλεηήο ζα πξέπεη λα βξίζθεηαη φζν ην δπλαηφλ πην θνληά ζην 3 άθξν ηνπ mrna.

65 65 Γηαδηθαζία: Γηα ηε ζχλζεζε ηεο πξψηεο ζπκπιεξσκαηηθήο αιπζίδα DNA, ρξεζηκνπνηήζεθαλ ngr νιηθνχ RNA, ην νπνίν απνκνλψζεθε κε ηελ πεξηγξαθείζα δηαδηθαζία θαη ηε ρξήζε ηπραίσλ εμακεξψλ, σο κέζνδν εθθίλεζεο ηεο ζχλζεζεο. Σν πξσηφθνιιν ην νπνίν αθνινπζήζεθε, είρε σο εμήο: Πξνεηνηκαζία ηνπ δηαιχκαηνο RNA/εθθηλεηψλ ζε RNase-free ζσιελάθηα ησλ 0.5 ml, ζχκθσλα κε ηνλ παξαθάησ πίλαθα: Τιηθά: V (κl) ngr νιηθφ RNA n Σπραία εμακεξή 1 10mM dntp mix 1 DEPC-H 2 O έσο ηα 10 πλνιηθφο Όγθνο 10 Δπψαζε θάζε δείγκαηνο ζηνπο 65 ν C γηα 5 ιεπηά θαη επψαζε ζηνλ πάγν, ηνπιάρηζηνλ γηα 1 ιεπηφ. Πξνεηνηκαζία ησλ παξαθάησ δηαιπκάησλ κε πξφζζεζε ησλ ζπζηαηηθψλ ηνπο θαηά ηελ ελδεδεηγκέλε ζεηξά. Τιηθά: V (κl) 10x RT buffer 2 25 mm MgCl M DTT 2 RNaseOUT Recombinant Ribonuclease Inhibitor 1 Πξνζζήθε 9κl θάζε κίγκαηνο αληίδξαζεο ζε θάζε δηάιπκα RNA/εθθηλεηψλ, ειαθξηά αλάκημε θαη ζπιινγή κε ζχληνκε θπγνθέληξεζε. Δπψαζε ζηνπο 25 ν C γηα 2 ιεπηά.

66 66 Πξνζζήθε 1κl (50 units) Supercript II RT ζε θάζε αληίδξαζε, αλάκημε θαη επψαζε ζηνπο 25 ν C γηα 10 ιεπηά. Μεηαθνξά ησλ αληηδξάζεσλ ζηνπο 42 ν C θαη επψαζε γηα 60 ιεπηά. Σεξκαηηζκφο ηεο αληίδξαζεο ζηνπο 70 ν C γηα 15 ιεπηά, κεηαθνξά ζηνλ πάγν. πιινγή ησλ αληηδξάζεσλ κε ζχληνκε θπγνθέληξεζε. Πξνζζήθε 1κl RNase H ζε θάζε δνθηκαζηηθφ ζσιήλα θαη επψαζε γηα 20 ιεπηά ζηνπο 37 ν C πξηλ απφ ηε ρξήζε ηνπ πξντφληνο γηα αληίδξαζε PCR. 2 ο Βήμα: Αλυςιδωτή αντίδραςη πολυμεράςησ Γηαδηθαζία: Ζ αληίδξαζε ηεο PCR πξαγκαηνπνηείηαη κε ην θαηάιιειν δεχγνο εθθηλεηψλ γηα ην θάζε γνλίδην, ελψ σο αξρηθή πνζφηεηα ππνζηξψκαηνο cdna ρξεζηκνπνηείηαη 1 κl απφ ηελ αληίδξαζε ηεο ζχλζεζεο ηεο πξψηεο αιπζίδαο cdna. Γηα ηελ θάζε αληίδξαζε αλακηγλχνληαη ζε ζσιήλα eppendorf ησλ 500κl ηα πιηθά: Τιηθά: V(κl) H 2 O for injection X ξπζκηζηηθφ δηάιπκα 10 25mM MgCl κΜ dntps 1 λνεκαηηθφο εθθηλεηήο (25 pmoles/κl) 1 αληηλνεκαηηθφο εθθηλεηήο (25 pmoles/κl) 1 DNA 1 Taq polymerase (5 u/κl) 0.5 πλνιηθφο φγθνο 100 Αθνινπζεί θαιή αλάκημε θαη ε αληίδξαζε γίλεηαη ζην ζεξκηθφ αλαθπθισηή PTC- 200 ΜJ Research Peltier Thermal Cycler. Σν πξόγξακκα πνπ αθνινπζείηαη ζε γεληθέο γξακκέο είλαη ην εμήο:

67 C γηα 2 min C γηα 30 sec 3. T an γηα 30 sec C γηα 30 sec Δπαλάιεςε θνξέο ησλ βεκάησλ C γηα 10 min C Αθνινπζεί έιεγρνο ηνπ πξντφληνο ηεο αληίδξαζεο ειεθηξνθνξψληαο ην 1/10 απηήο ζε πήθησκα αγαξφδεο θαηάιιειεο ππθλφηεηαο, καδί κε 10Υ δηάιπκα ρξσζηηθήο (bromophenol blue), ζε ηειηθφ φγθν 20 κl. Με ηε ρξήζε ηνπ αλάινγνπ DNA κάξηπξα κπνξνχκε λα εθηηκήζνπκε ην κέγεζνο θαη ηελ πνζφηεηα ηνπ εληζρπκέλνπ πιένλ DNA πνπ πξνέθπςε. Β) Αλυςιδωτή Αντίδραςη Σαχείασ Ενίςχυςησ Ϊκρων (5 /3 RAPID Amplification of cdna Ends, RACE PCR) Ζ ζπγθεθξηκέλε ηερληθή, ζηνρεχεη ζηελ εθιεθηηθή ελίζρπζε ησλ άθξσλ (5 /3 UTR) γνληδίσλ, φηαλ γλσξίδνπκε έλα ηκήκα ζην εζσηεξηθφ ηεο αιιεινπρίαο. Ξεθηλψληαο απφ νιηθφ RNA ή poly(a) RNA, ε ζπγθεθξηκέλε δηαδηθαζία θαζηζηά δπλαηή ηε κεηαγξαθή ζπγθεθξηκέλσλ αιιεινπρηψλ mrna ζηφρσλ ζε ζπκπιεξσκαηηθή αιπζίδα cdna. ηελ πεξίπησζε πνπ ζέινπκε λα πνιιαπιαζηάζνπκε ην 5 άθξν, αθνινπζεί ε πξνζζήθε poly(a) νπξάο ζην παξαγφκελν cdna. Απηφ γίλεηαη ψζηε ζηε ζπλέρεηα, κε κηα PCR, λα κπνξέζεη λα πβξηδνπνηεζεί ζε απηή έλαο oligo d(t) anchor primer θαη, καδί κε έλαλ αθφκα εηδηθφ γηα ηελ αιιεινπρία ζηφρν, εζσηεξηθφ ηνπ πξψηνπ, εθθηλεηή (SP2), λα εληζρπζεί ε επηζπκεηή αιιεινπρία πνπ πεξηιακβάλεη ην 5 άθξν. ε πεξίπησζε κε επαξθνχο πνζφηεηαο πξντφληνο, αθνινπζεί θαη δεχηεξε PCR, κε ππφζηξσκα ην πξντφλ ηεο πξνεγνχκελεο, έλαλ ηξίην εηδηθφ εθθηλεηή (SP3) θαη έλαλ PCR anchor primer.

68 68 Εκλεκτικβσ Πολλαπλαςιαςμβσ του 5 άκρου I) ύλζεζε πξώηεο αιπζίδαο - cdna Αξρηθά ζπληίζεηαη ε ζπκπιεξσκαηηθή αιπζίδα DNA ηνπ ηκήκαηνο πνπ καο ελδηαθέξεη, κε ηε ρξήζε εηδηθνχ εθθηλεηή θαη νιηθφ RNA πνπ απνκνλψζεθε απφ ηνλ ηζηφ (απφ ήπαξ φξληζαο ελ πξνθεηκέλσ) σο ππφζηξσκα. Τιηθά: V (κl) cdna synthesis buffer 4 10mM dntp mix 1 cdna synthesis primer SP ngr νιηθφ RNA 1 Transcriptor Reverse Transcriptase 1 DEPC-H 2 O έσο ηα 20 πλνιηθφο Όγθνο 20 Αλάκημε ησλ ζπζηαηηθσλ θαη ζχληνκε θπγνθέληξεζε. Δπψαζε γηα 60 min ζηνπο 55 C (ζχλζεζε cdna). Δπηπιένλ επψαζε γηα 15 min ζηνπο 72 (απελεξγνπνίεζε ηεο αληίζηξνθεο κεηαγξαθάζεο) II) Καζαξηζκόο ηνπ cdna Ο θαζαξνζκφο πξαγκαηνπνηήζεθε κε NucleoSpin Extract II (Cat. No.: /.50/.250), ζχκθσλα κε ηελ παξαθάησ δηαδηθαζία: Αλάκημε 1 φγθνπ δεηγκαηνο κε 2 φγθνπο Buffer NT (ελ πξνθεηκέλσ κε 40κl ΝΣ). Σνπνζέηεζε δηαιχκαηνο ζε ζηήιε NucleoSpin Extract II θαη θπγνθέληξεζε ζηηο rpm γηα 1 min. Απφξξηςε ηνπ εθινχζκαηνο θαη κεηαθνξά 600 κl Buffer NT3 ζηε ζηήιε, πξνθεηκέλνπ λα θαζαξηζηεί. Φπγνθέληξεζε ζηηο rpm γηα 1 min.

69 69 ηέγλσκα ηεο κεκβξάλεο κε θπγνθέληξεζε ηεο ζηήιεο ζηηο rpm γηα 2 min. Έηζη επηηπγράλεηαη ε απνκάθξπλζε ηεο πεξίζζεηαο ηνπ Buffer NT3, ην νπνίν πεξηέρεη αηζαλφιε. Πξνζζήθε ζηε ζηήιε 50 κl Elution Buffer NE θαη επψαζε γηα 1 min ζε ζεξκνθξαζία δσκαηίνπ. Φπγνθέληξεζε ζηηο rpm γηα 1 min θαη έθινπζε θαζαξνχ DNA. III) Πξνζζήθε Poly(A) νπξάο ζην cdna Αθνινπζεί ε πξνζζήθε κηαο νκνπνιπκεξνχο νπξάο Αδελίλεο ζην 3 άθξν ηεο πξψηεο αιπζίδαο ηνπ cdna κε ηε ρξήζε αλαζπλδπαζκέλεο ηειηθήο ηξαλζθεξάζεο θαη datp. Γηα ην ζθνπφ απηφ κεηαθέξνληαη κε πηπέηα ζε απνζηεηξσκέλν ζσιήλα κηθξνθπγφθεληξνπ (ζε πάγν) ηα εμήο ζπζηαηηθά: Τιηθά: V (κl) Γείγκα θαζαξηζκέλνπ cdna 1 2mM dαtp mix 1 Ρπζκηζηηθφ Γηάιπκα Αληίδξαζεο (10x) 1 Αλάκημε ησλ ζπζηαηηθψλ ηεο αληίδξαζεο θαη ζχληνκε θπγνθέληξεζε. Δπψαζε ζηνπο 94 C γηα 3 min. Πάγσκα ηεο αληίδξαζεο ζε πάγν. Πξνζζήθε 1κl ηειηθήο ηξαλζθεξάζεο (80 U/κl) Αλάκημε θαη επψαζε ζηνπο 37 C γηα 30 min. Δπψαζε ζηνπο 70 C γηα 10 min πξνθεηκέλνπ λα απελεξγνπνηεζεί ε ηειηθή ηξαλζθεξάζε. IV) Δλίζρπζε ηνπ cdna πνπ θέξεη ηελ Poly(A)-νπξά κε PCR Ζ ελίζρπζε ηνπ πνιχ-α cdna γίλεηαη κε κία πξψηε θαη ελ ζπλερεία κε κία δεχηεξε (nested) PCR, ρσξίο πξνεγνχκελν θαζαξηζκφ ηνπ πξντφληνο, κε ηνλ αθφινπζν ηξφπν: Μεηαθνξά κε πηπέηα ησλ αθφινπζσλ ζπζηαηηθψλ ζε απνζηεηξσκέλν ζσιήλα κηθξνθπγφθεληξνπ ζε πάγν:

70 70 Τιηθά: V (κl) πνιπ(α) cdna 1 Oligo dt-anchor primer 1 Δηδηθφο εθθηληεηήο SP2 (12.5 κm) 1 Μίγκα δενμπξηβνλνπθιενηηδίσλ 1 Reaction Buffer (10x) 5 MgCl 2 3 Double dist. H 2 O 37.5 Taq DNA Polymerase, 5 U/κl 0.5 πλνιηθφο Όγθνο 50 Αλάκημε ησλ παξαπάλσ αληηδξαζηεξίσλ θαη ζχληνκε θπγνθέληξεζε. Σνπνζέηεζε ηεο αληίδξαζεο ζην κεράλεκα ηεο PCR. Σν πξόγξακκα πνπ αθνινπζείηαη είλαη ην εμήο: C γηα 2 min C γηα 30 sec C γηα 30 sec C γηα 30 sec Δπαλάιεςε 30 θνξέο ησλ βεκάησλ C γηα 10 min C ηε ζπλέρεηα, αθνινπζεί θαη δεχηεξε PCR, κε ηξίην εηδηθφ εθθηλεηή γηα εδηθή ελίζρπζε ηνπ πξντφληνο ηεο πξνεγνχκελεο αληίδξαζεο. Σo πξντφλ ηεο PCR ην νπνίν ρξεζηκνπνηείηαη σο ππφζηξσκα, αξαηψλεηαη ζε ddζ 2 Ο κε αξαίσζε 1:10. ηε ζπλέρεηα, κεηαθέξνληαη ηα αθφινπζα ζπζηαηηθά ζε απνζηεηξσκέλν ζσιήλα ζε πάγν:

71 71 Τιηθά: V (κl) Πξντφλ πξνεγνχκελεο PCR 1 PCR anchor primer 1 Δηδηθφο εθθηληεηήο SP3 (12.5 κm) 1 Μίγκα δενμπξηβνλνπθιενηηδίσλ 1 Reaction Buffer (10x) 5 MgCl 2 3 Double dist. H 2 O 33.5 Taq DNA Polymerase, 5 U/κl 0.5 πλνιηθφο Όγθνο 50 Αθνινπζεί θαιή αλάκημε ηεο αληίδξαζεο θαη ηνπνζέηεζε ζην κεράλεκα ηεο PCR. Σν πξφγξακκα ηεο αληίδξαζεο είλαη ην αθφινπζν: C γηα 2 min C γηα 30 sec C γηα 30 sec C γηα 30 sec Δπαλάιεςε 30 θνξέο ησλ βεκάησλ C γηα 10 min C Εκλεκτικβσ Πολλαπλαςιαςμβσ του 3 άκρου I) ύλζεζε πξώηεο αιπζίδαο cdna Οκνίσο θαη γηα ην 3 άθξν, αξρηθά ζπληίζεηαη ε ζπκπιεξσκαηηθή αιπζίδα DNA ηνπ ηκήκαηνο πνπ καο ελδηαθέξεη, κε ηε ρξήζε εηδηθνχ εθθηλεηή θαη νιηθνχ RNA πνπ απνκνλψζεθε απφ ην ήπαξ φξληζαο σο ππφζηξσκα.

72 72 Τιηθά: V (κl) cdna synthesis buffer 4 10mM dntp mix 1 cdna synthesis primer SP ngr νιηθφ RNA 1 Transcriptor Reverse Transcriptase 1 DEPC-H 2 O έσο ηα 20 πλνιηθφο Όγθνο 20 Αλάκημε ησλ ζπζηαηηθψλ θαη ζχληνκε θπγνθέληξεζε. Δπψαζε ζηνπο 55 C γηα 60 min (ζχλζεζε cdna). Δπηπιένλ επψαζε ζηνπο 72 C γηα 15 min (απελεξγνπνίεζε ηεο αληίζηξνθεο κεηαγξαθάζεο) ΗΗ) Δλίζρπζε cdna κε PCR Σν cdna ην νπνίν έρεη παξαρζεί, κπνξεί λα εληζρπζεί απεπζείαο, ρσξίο πξνεγνχκελν θαζαξηζκφ. Γηα ην ζθνπφ απηφ, ρξεζηκνπνηείηαη έλαο αθφκα εηδηθφο εθθηλεηήο, ν SP2, ν PCR anchor primer σο δεχηεξνο εθθηλεηήο θαη 1 κl απφ ην πξντφλ ηεο πξνεγνχκελεο αληίδξαζεο σο ππφζηξσκα. Τιηθά: V (κl) cdna 1 PCR-anchor primer 1 Δηδηθφο εθθηληεηήο SP2 (12.5 κm) 1 Μίγκα δενμπξηβνλνπθιενηηδίσλ 1 Reaction Buffer (10x) 5 MgCl 2 3

73 73 Double dist. H 2 O 37.5 Taq DNA Polymerase, 5 U/κl 0.5 πλνιηθφο Όγθνο 50 Σνπνζέηεζε ηεο αληίδξαζεο ζε ζεξκηθφ αλαθπθισηή θαη αθνινπζνχκε ην εθαξκνγή ηνπ παξαθάησ πξνγξάκκαηνο: C γηα 2 min C γηα 30 sec C γηα 30 sec C γηα 30 sec Δπαλάιεςε 30 θνξέο ησλ βεκάησλ C γηα 10 min C 2.5. Κατάτμηςη του DNA με ένζυμα περιοριςμογ Οη ελδνλνπθιεάζεο πεξηνξηζκνχ είλαη έλδπκα ηα νπνία απνκνλψλνληαη απφ πξνθαξπσηηθνχο νξγαληζκνχο. Αλαγλσξίδνπλ θαη θαηαηέκλνπλ ζπγθεθξηκέλεο αιιεινπρίεο δίθισλσλ κνξίσλ DNA. Οη θχξηνη παξάγνληεο απφ ηνπο νπνίνπο εμαξηάηαη ε δξάζε ησλ ελδχκσλ είλαη: ε ζεξκνθξαζία θαη ε ηνληηθή ηζρχο ηνπ ξπζκηζηηθνχ δηαιχκαηνο ηεο αληίδξαζεο. Πξνθεηκέλνπ λα επηηεπρζεί ε βέιηηζηε δξάζε ησλ πεξηνξηζηηθψλ ελδχκσλ, ιακβάλνληαη ππφςε ηα εμήο: Μία κνλάδα ελδχκνπ (1 unit) νξίδεηαη σο ε πνζφηεηα ηνπ ελδχκνπ πνπ απαηηείηαη γηα πιήξε θαηάηκεζε 1 κg DNA ζε 1 ψξα θαη ζε θαηάιιειεο ζπλζήθεο ζεξκνθξαζίαο θαη ηνληηθήο ηζρχνο. ηα πεηξάκαηά καο ππνινγίδνπκε 5u έλδπκν αλά 1 κg DNA. Όηαλ ην DNA πξέπεη λα θαηαηκεζεί κε δχν ή πεξηζζφηεξα έλδπκα πεξηνξηζκνχ, νη αληηδξάζεηο κπνξνχλ λα γίλνπλ ηαπηφρξνλα αλ φια ηα έλδπκα απαηηνχλ ηελ ίδηα ζπγθέληξσζε αιάησλ γηα λα δξάζνπλ. Αλ φκσο ηα έλδπκα έρνπλ δηαθνξεηηθέο απαηηήζεηο ηφηε γίλεηαη ε πξψηε αληίδξαζε θαηάηκεζεο κε ην έλδπκν πνπ απαηηεί ηε

74 74 ρακειφηεξε ζπγθέληξσζε NaCl. Έπεηηα πξνζηίζεηαη ε θαηάιιειε πνζφηεηα αιάησλ θαη ζπλερίδεηαη ε θαηάηκεζε κε ην δεχηεξν πεξηνξηζηηθφ έλδπκν. Οη βέιηηζηεο ζπλζήθεο δξάζεο ηνπ θάζε ελδχκνπ θαζνξίδνληαη απφ ηελ πξνκεζεχηξηα εηαηξία. ηα πεηξάκαηα ρξεζηκνπνηήζεθαλ σο ελδνλνπθιεάζεο πεξηνξηζκνχ, απφ ηελ Minotech: Έλδπκν πεξηνξηζκνύ EcoRI HindIII PvuII Θεξκνθξαζία επώαζεο ( 0 C) Αιιεινπρία αλαγλώξηζεο G AATTC A AGCTT CAG CTG Μηα αληίδξαζε πέςεο DNA γίλεηαη ζπλήζσο ζε ηειηθφ φγθν κl θαη πεξηέρεη: Τιηθά: DNA σο ππφζηξσκα δηαιπκέλν ζε λεξφ. 10Υ ξπζκηζηηθό δηάιπκα εηδηθφ γηα θάζε έλδπκν ή θνηλφ γηα νξηζκέλα έλδπκα, ζε πεξίπησζε π.ρ. δηπιήο πέςεο Πεξηνξηζηηθό έλδπκν (έλα ή πεξηζζφηεξα) RNase γηα απαιιαγή απφ ην RNA. Πξνζηίζεηαη κηζή ψξα πξηλ απφ ην ηέινο ηεο αληίδξαζεο (πξναηξεηηθά). Γηαδηθαζία: Δπψαζε ζηνπο 37 0 C γηα 1-2 ψξεο ή θαη νινλχρηηα. Ζ αληίδξαζε ζηακαηά κε πξνζζήθε ρξσζηηθήο ή κε ηνπνζέηεζε ζηελ θαηάςπμε. Ζιεθηξνθφξεζε φιεο ηεο πνζφηεηαο ηεο αληίδξαζεο ζε αξαηφ πήθησκα αγαξφδεο.

75 Αντίδραςη ςυνδετάςησ (ligation) Γηα ηελ αληίδξαζε ρξεζηκνπνηήζεθαλ πξνεηνηκαζκέλα πιηθά απφ ην ζχζηεκα pgem-t easy Vector ηεο Promega. Σα βαζηθά ραξαθηεξηζηηθά ηνπ θνξέα θαίλνληαη ζην ζρήκα πνπ αθνινπζεί. Σν έλδπκν ζπλδεηάζε Σ4 DNA (T4 ligase), έλα πνιππεπηίδην κνξηαθνχ βάξνπο 68kD, θαηαιχεη in vitro ην ζρεκαηηζκφ θσζθνδηεζηεξηθψλ δεζκψλ κεηαμχ γεηηνληθψλ 3 -ΟΖ θαη 5 -P άθξσλ δίθισλνπ DNA. Με ηελ αληίδξαζε ζπλδεηάζεο είλαη δπλαηή ε ελζσκάησζε ηκήκαηνο cdna ζε γξακκηθφ πιαζκηδηθφ φρεκα κε ζπκπιεξσκαηηθά πξνο απηφ άθξα. Σν θπθιηθφ κφξην πνπ πξνθχπηεη είλαη έλα αλαζπλδπαζκέλν πιαζκίδην ην νπνίν κπνξεί λα κεηαζρεκαηίζεη βαθηεξηαθά θχηηαξα E. coli. Γηαδηθαζία: Γηα ηελ αληίδξαζε αλακηγλχνληαη ζε ζσιήλα eppendorf ησλ 500 κl ηα πιηθά: Τιηθά: V(κl) 2X ξπζκηζηηθφ δηάιπκα 5 DNA έλζεην 3.5 * pgem-t easy (50 ng/κl) 0.5 ζπλδεηάζε Σ4 (1 u/κl) 1 ddζ 2 Ο Υ πλνιηθφο φγθνο 10

76 76 Μεηά απφ θαιή αλάδεπζε ε αληίδξαζε επσάδεηαη ζηνπο 16 o C γηα 2 ψξεο πεξίπνπ ή ζηνπο 4 o C νινλπρηίσο, εθφζνλ κεηά κείλεη γηα 1 ψξα ζε ζεξκνθξαζία δσκαηίνπ πξηλ ην κεηαζρεκαηηζκφ. *Ζ αλαινγία έλζεην/πιαζκίδην ζε ζρέζε κε ηα κεγέζε ησλ αληίζηνηρσλ DNAs ξπζκίδεηαη έηζη ψζηε λα έρνπκε ίζν αξηζκφ κνξίσλ DNA, ελζέηνπ θαη θνξέα, ή πεξίζζεηα ηνπ ελζέηνπ, ψζηε λα απνθεπρζεί ε επαλαθπθινπνίεζε ηνπ πιαζκηδηθνχ DNA ρσξίο ελζσκάησζε ηνπ έλζεηνπ ηκήκαηνο cdna. πλήζσο θαιχηεξα απνηειέζκαηα παίξλνπκε κε αξθεηά κεγαιχηεξε πνζφηεηα ελζέηνπ (πρ 3:1 αληίζηνηρα). Ζ πνζφηεηα ηνπ ελζέηνπ ζηελ αληίδξαζε είλαη επίζεο αλάινγε ηνπ κεγέζνπο ηνπ Μεταςχηματιςμβσ βακτηριακών κυττάρων E.coli με πλαςμιδικβ DNA Τιηθά: DH5a Subcloning θχηηαξα E.coli SOC medium X-gal ηξπβιία SOB / ακπηθηιιίλε Γηαδηθαζία: Οκαιή απφςπμε (ζε πάγν γηα 10 πεξίπνπ min) δεθηηθψλ ζε κεηαζρεκαηηζκφ θπηηάξσλ E.coli (DH5a Subcloning cells). Πξνζζήθε 4 κl ηεο αληίδξαζεο ζπλδεηάζεο ζε 40 κl ελαησξήκαηνο θπηηάξσλ θαη ήπηα αλάδεπζε. Παξακνλή ζε πάγν γηα 30min. ε απηφ ην ζηάδην ηα πιαζκίδηα πξνζεγγίδνπλ ηα ηνηρψκαηα ηνπ βαθηεξίνπ θαη πξέπεη λα παξακείλνπλ ζηαζεξά. Αθνινπζεί επψαζε ζηνπο 37 o C γηα 20 sec αθξηβψο. Ακέζσο ηα θχηηαξα ηνπνζεηνχληαη ζηνλ πάγν γηα 2 min αθξηβψο. Σν ζπγθεθξηκέλν ζεξκνθξαζηαθφ ζηξεο πνπ πθίζηαληαη ηα θχηηαξα είλαη απαξαίηεην πξνθεηκέλνπ λα εηζέιζνπλ ηα πιαζκίδηα ζε απηά.

77 77 Πξνζζήθε 950 κl πγξνχ ζξεπηηθνύ πιηθνύ SOC θαη επψαζε ζηνπο 37 o C ππφ αλαθίλεζε γηα 1 ψξα. Φπγνθέληξεζε ζηηο rpm γηα 1 min. Απφξξηςε 800 κl πεξίπνπ απφ ην ππεξθείκελν θαη επαλαηψξεζε ησλ θπηηάξσλ ζηα ελαπνκείλαληα κl ηνπ ζξεπηηθνχ πιηθνχ. Πξνζζήθε 12 κl X-gal θαη αλάκημε. Ζ νπζία X-gal ρξεζηκνπνηείηαη σο κέζν επηινγήο ησλ ζεηηθψλ απνηθηψλ. Μεηαβνιίδεηαη απφ ηα θχηηαξα κφλν φηαλ απηά δηαζέηνπλ ην έλδπκν ηεο β-γαιαθηνζηδάζεο θαη θαίλνληαη κε κπιε ρξψκα ζην ηξπβιίν. ε πεξίπησζε πνπ ηα βαθηήξηα θέξνπλ ην αλαζπλδπαζκέλν πιαζκίδην, ε αιιεινπρία πνπ έρεη εηζαρζεί είλαη έλζεηε ζην γνλίδην ηεο β- γαιαθηνζηδάζεο, κε απνηέιεζκα απηφ λα κελ είλαη ιεηηνπξγηθφ, επνκέλσο λα κε κεηαβνιίδεη ηελ X-gal θαη άξα νη απνηθίεο ηνπο λα θαίλνληαη ιεπθέο. Δπίζηξσζε ησλ θπηηάξσλ ζε ηξπβιία SOB / ακπηθηιιίλε. Ζ ακπηθηιιίλε απνηειεί ην δεχηεξν κέζν επηινγήο, θαζψο ν θνξέαο pgem-t easy θέξεη γνλίδην αλζεθηηθφηεηαο ζηελ ακπηθηιιίλε. Δπψαζε ζε ζάιακν 37 0 C γηα ψξεο πεξίπνπ. Δπηινγή ησλ ζεηηθψλ απνηθηψλ Τγρέσ καλλιέργειεσ βακτηριακών κυττάρων E.coli Τιηθά: SOB medium ακπηθηιιίλε γιπθεξφιε 80 % Γηαδηθαζία: Δκβνιηαζκφο 10 ml ζξεπηηθνύ πιηθνύ SOB πνπ πεξηέρεη ακπηθηιιίλε ζε ηειηθή ζπγθέληξσζε 50 κg/ml κε κία κνλαδηθή ζεηηθή απνηθία, πνπ αληηζηνηρεί ζε έλα θιψλν θπηηάξσλ.

78 78 Δπψαζε ππφ αλαθίλεζε νμπγφλνπ. ζηνπο 37 0 C γηα ψξεο πεξίπνπ, παξνπζία Γηαηήξεζε ζηνπο 4 0 C γηα 15 εκέξεο πεξίπνπ. Γηαηήξεζε ζηνπο C γηα κεγάια ρξνληθά δηαζηήκαηα σο απνζέκαηα γιπθεξφιεο, ηα νπνία θηηάρλνληαη κε πξνζζήθε 230 κl γιπθεξόιεο 80% ζε 1 ml πγξήο θαιιηέξγεηαο θαη θαιή αλάκημε Προςδιοριςμβσ νουκλεοτιδικήσ αλληλουχίασ DNA (Sequencing) Ο πξνζδηνξηζκφο ηεο πξσηνηαγνχο λνπθιενηηδηθήο αιιεινπρίαο ηνπ DNA πξαγκαηνπνηήζεθε κε ηελ ελδπκηθή κέζνδν (θαηά Sanger). Ζ κέζνδνο βαζίδεηαη ζηελ ηδηφηεηα ηεο DNA πνιπκεξάζεο λα ζπλζέηεη in vitro κία αιπζίδα DNA ρξεζηκνπνηψληαο σο κήηξα κνλφθισλν DNA θαη ζηελ ρξήζε αλαιφγσλ ησλ δενμπλνπθιενηηδίσλ. Ζ ειεθηξνθφξεζε ησλ αληηδξάζεσλ θαη ε αλάιπζε ησλ απνηειεζκάησλ έγηλε απφ ην ηελ εηαηξία Macrogen, ζην 10F World Meridian Center, ζηελ Κνξέα, κε ην ζχζηεκα ABI3730XL. Πξφθεηηαη γηα έλαλ πιήξσο απηνκαηνπνηεκέλν αλαιπηή πνπ κπνξεί λα «δηαβάδεη» κεγάια κφξηα DNA ζε κηθξφ ρξφλν. Σν πξνο αλάιπζε ηκήκα DNA θισλνπνηείηαη αξρηθά ζε έλα πιαζκηδηαθφ φρεκα, ην νπνίν θέξεη ηκήκα αιιεινπρίαο ηνπ θάγνπ M13. Με βάζε απηή ηελ αιιεινπρία έρνπλ ζρεδηαζηεί ζπκπιεξσκαηηθά ζπλζεηηθά νιηγνλνπθιενηίδηα θαη πξνο ηηο δχν θαηεπζχλζεηο (forward θαη reverse). Σα νιηγνλνπθιενηίδηα απηά απνηεινχλ ηνπο εθθηλεηέο γηα ηε δεκηνπξγία ζπκπιεξσκαηηθψλ θιψλσλ DNA κε ηε βνήζεηα ηεο DNA πνιπκεξάζεο θαη δενμπξηβνλνπθιενηηδίσλ. Αλαιπηηθά, ην αξρηθφ κίγκα ηεο αληίδξαζεο πεξηέρεη: - Σν αλαζπλδπαζκέλν πιαζκίδην κε ην έλζεην ηκήκα ηνπ DNA πνπ πξφθεηηαη λα αλαιπζεί. - Δθθηλεηή Μ13 ζεκαζκέλν κε IRD700 ή IRD41. - Σξηθσζθνξηθά δενμπξηβνλνπθιενηίδηα. (dntps) - Taq- πνιπκεξάζε ηνπ DNA. ηε ζπλέρεηα ην κίγκα δηακνηξάδεηαη εμίζνπ ζε ηέζζεξα ζσιελάθηα, ζε θαζέλα απφ ηα νπνία πξνζηίζεηαη θαη θαηάιιειε πνζφηεηα ελφο αλαιφγνπ δενμπξηβνλνπθιενηηδίνπ.

79 79 Σα αλάινγα ησλ λνπθιενηηδίσλ είλαη 2, 3 δηδενμπλνπθιενηίδηηα (ddntps) ζηα νπνία ε 3 - ΟΖ νκάδα έρεη αληηθαηαζηαζεί απφ Ζ. Πξαγκαηνπνηνχληαη έηζη ηέζζεξηο μερσξηζηέο αληηδξάζεηο, κία γηα θάζε δηαθνξεηηθφ ddntp (ddatp, ή ddctp, ή ddgtp, ή ddttp). Ζ ζχλζεζε μεθηλά απφ ην 3 -ΟΖ άθξν ηνπ εθθηλεηή, αιιά ζηακαηά κε ηελ ελζσκάησζε ελφο αλαιφγνπ δενμπλνπθιενηηδίνπ κηα θαη ν 5 3 θσζθνδηεζηεξηθφο δεζκφο δελ κπνξεί λα ζρεκαηηζηεί ρσξίο ηελ παξνπζία 3 -πδξνμπινκάδαο. Δθφζνλ ε ελζσκάησζε ddntp αληί ηνπ θαλνληθνχ dntp γίλεηαη κε ηπραίν ηξφπν, ην πξντφλ ηεο θάζε κίαο απφ ηηο ηέζζεξηο αληηδξάζεηο πεξηέρεη κφξηα DNA πνπ δηαθέξνπλ σο πξνο ηα κήθε ηνπο αιιά φια ηεξκαηίδνληαη ζηελ ίδηα βάζε. Ζ αλάιπζε φισλ ησλ αληηδξάζεσλ γίλεηαη έπεηηα απφ ηελ απνδηάηαμε ησλ ηκεκάησλ DNA πνπ παξήρζεζαλ, ζε πήθησκα πνιπαθξπιακηδίνπ. Ο αλαιπηήο δηαζέηεη ην θαηάιιειν ινγηζκηθφ γηα ηελ επεμεξγαζία ησλ ρξσκαηνγξαθεκάησλ. Έηζη απφ ην ζπλδπαζκφ ησλ πξντφλησλ ησλ ηεζζάξσλ αληηδξάζεσλ αιιεινχρεζεο πξνθχπηεη ε DNA αιιεινπρία Λογιςμικά προγράμματα ανάλυςησ νουκλεοτιδικών και αμινοξικών αλληλουχιών Αλαδήηεζε βηβιηνγξαθίαο θαη αιιεινπρηώλ 1. PubMed ΝCBI. Αλήθεη ζηε National Library of Medicine θαη πεξηέρεη αλαθνξέο βηνινγηθνχ θαη ηαηξηθνχ πεξηερνκέλνπ, απφ ηελ δεθαεηία ηνπ Απαηηεί ηελ εηζαγσγή ιέμεσλ-θιεηδηψλ θαη είλαη δηαζέζηκν ζηελ δηεχζπλζε: NCBI / Entrez / Gene. Δχξεζε γνληδησκαηηθψλ αιιεινπρηψλ. NCBI / Entrez / Nucleotide. Δχξεζε λνπθιενηηδηθψλ αιιεινπρηψλ. NCBI / Entrez / Protein. Δχξεζε ακηλνμηθψλ αιιεινπρηψλ. 2. Enseml Genome Browser. Ο ζρεδηαζκφο ηνπ θαη ε νξγάλσζή ηνπ απνηειεί κηα θνηλή πξνζπάζεηα κεηαμχ ησλ EMBL - EBI θαη ηνπ Wellcome Trust Sanger Institute. Παξέρεη βάζεηο δεδνκέλσλ γηα ην γνληδίσκα ζπνλδπισηψλ θαη άιισλ επθαξπσηηθψλ νξγαληζκψλ θαη είλαη δηαζέζηκν ζηε δηεχζπλζε:

80 80 Μεηαηξνπέο αιιεινπρηώλ Γηα λα κεηαηξαπεί κηα αιιεινπρία ζε δηάθνξεο κνξθέο πξνο επεμεξγαζία ρξεζηκνπνηείηαη ε δηεχζπλζε: Αλαδήηεζε ζέζεσλ πεξηνξηζκνύ ΝΔΒ cutter, V. 2. Αλήθεη ζηελ εηαηξία BioLabs θαη είλαη δηαζέζηκν ζηε δηεχζπλζε: ρεδηαζκόο εθθηλεηώλ 1. PcGene. Πξφγξακκα ινγηζκηθνχ γηα ζρεδηαζκφ εθθηλεηψλ, κε δηαζέζηκν ζην δηαδίθηπν. 2. Primer 3. Πξφγξακκα ινγηζκηθνχ γηα ζρεδηαζκφ εθθηλεηψλ, δηαζέζηκν ζην δηαδίθηπν, ζηε δηεχζπλζε: 3. Οligos. To πξφγξακκα απηφ απνηειεί έλα θαιφ εξγαιείν γηα ηνλ έιεγρν εθθηλεηψλ, φκσο δελ είλαη δηαζέζηκν ζην δηαδίθηπν. Δύξεζε πξνηύπνπ έθθξαζεο γνληδίνπ 1. PubMed ΝCBI., ζην ηκήκα NCBI / Entrez / Unigene: Παξέρεη πιεξνθνξίεο γηα ηελ έθθξαζε ελφο γνληδίνπ, ζε επίπεδν mrna, αλάινγα κε ηνλ ηζηφ, ην αλαπηπμηαθφ ζηάδην θαη ηελ θαηάζηαζε πγείαο. 2. GeneAtlas. Παξέρεη πιεξνθνξίεο γηα ηελ έθθξαζε ελφο γνληδίνπ, ζε επίπεδν mrna, γηα ηνλ άλζξσπν θαη ηνλ πνληηθφ, αλάινγα κε ηνλ ηζηφ θαη δηάθνξεο θπηηαξηθέο ζεηξέο θπξίσο θαη ελ κέξεη αλάινγα κε ην αλαπηπμηαθφ ζηάδην. Δίλαη δηαζέζηκν ζηε δηεχζπλζε: Μεηάθξαζε λνπθιενηηδηθήο αιιεινπρίαο ΔxPASy - Translate tool. Σν ινγηζκηθφ απηφ κεηαθξάδεη λνπθιενηηδηθέο αιιεινπρίεο νπνηαζδήπνηε κνξθήο ζε αιιεινπρία ακηλνμέσλ θαη είλαη δηαζέζηκν ζηελ δηεχζπλζε:

81 81 Δπεμεξγαζία ακηλνμηθώλ αιιεινπρηώλ ExPASy SMART. Με απηφ αλαιχνληαη ακηλνμηθέο αιιεινπρίεο θαη γίλεηαη πξφβιεςε πξσηετληθψλ δνκηθψλ κνηίβσλ. Δίλαη δηαζέζηκν ζηελ δηεχζπλζε: Δύξεζε νκνινγηώλ λνπθιενηηδηθώλ ή ακηλνμηθώλ αιιεινπρηώλ ΝCBI - Basic Local Alignment Search Tool (BLAST). Απηφ ηo ινγηζκηθφ ζπγθξίλεη λνπθιενηηδηθέο ή ακηλνμηθέο αιιεινπρίεο κε αληίζηνηρεο αιιεινπρίεο ησλ βάζεσλ δεδνκέλσλ θαη ππνινγίδεη πνζνζηά ηαπηνζεκίαο κεηαμχ ηνπο. Δίλαη δηαζέζηκν ζηελ δηεχζπλζε: ExPASy Blast. Δίλαη δηαζέζηκν ζηελ δηεχζπλζε: Δπζπγξάκκηζε λνπθιενηηδηθώλ ή ακηλνμηθώλ αιιεινπρηώλ Clustal W. Με απηφ ην ινγηζκηθφ γίλεηαη επζπγξάκκηζε δχν ή πεξηζζνηέξσλ λνπθιενηηδηθψλ ή ακηλνμηθψλ αιιεινπρηψλ. Σν ινγηζκηθφ είλαη δηαζέζηκν ζηελ δηεχζπλζε: Γηακόξθσζε θπινγελεηηθνύ δέληξνπ MEGA (Molecular Evolution Genetics Analysis), version 3. ην ινγηζκηθφ απηφ εηζάγνληαη νη ακηλνμηθέο αιιεινπρίεο απφ δηάθνξνπο νξγαληζκνχο, κε ζθνπφ ηε δεκηνπξγία θαη ην ζρεδηαζκφ θπινγελεηηθνχ δέλδξνπ. Δίλαη δηαζέζηκν ζηελ δηεχζπλζε:

82 3. ΑΠΟΤΕΛΕΣΜΑΤΑ 82

83 Κλωνοποίηςη και χαρακτηριςμβσ του γονιδίου C6 του ςυμπληρώματοσ ςτην βρνιθα Κλωνοποίηςη τμήματοσ του cdna του γονιδίου C6 τησ βρνιθασ (κλώνοσ # 1) Πξνθεηκέλνπ λα θισλνπνηεζεί ην cdna ηνπ γνληδίνπ C6 ηεο φξληζαο ζρεδηάζηεθαλ εηδηθά νιηγνλνπθιενηίδηα (Δηθόλα 3.1), κε βάζε κηα λνπθιενηηδηθή αιιεινπρία ηνπ ηδίνπ νξγαληζκνχ, ε νπνία βξέζεθε θαηαρσξεκέλε ζηηο ηξάπεδεο δεδνκέλσλ (GeneBank, XM_429140). Δηθόλα 3.1: ρεδηαζκφο εηδηθψλ εθθηλεηψλ Οη εηδηθνί εθθηλεηέο GGC6R : 5 - GAACCACCCATCTTTCCAGA -3 θαη GGC6F: 5 - CGTGCGTGTAACCAACAAAC -3 ρξεζηκνπνηήζεθαλ ζε αληίδξαζε PCR, κε κήηξα cdna απφ βηβιηνζήθε cdna ιgt11 παξεγθεθαιίδαο φξληζαο. Σν πξφγξακκα ηεο αληίδξαζεο είρε σο εμήο : 95 0 C γηα 5 min, 95 0 C γηα 1 min, 56 0 C γηα 1 min, 72 0 C γηα 1:30 min (30 θχθινη), 72 0 C γηα 10 min. Σα πξντφληα ηεο αληίδξαζεο αλαιχζεθαλ ζε πήθησκα αγαξφδεο 1%. Παξαηεξήζεθε κηα δψλε 900 bp πεξίπνπ, ε νπνία θαη απνκνλψζεθε (Δηθ. 3.2). Σν πξντφλ ηεο αληίδξαζεο PCR ππεβιήζε ζε αληίδξαζε ζπλδεηάζεο, παξνπζία ηνπ πιαζκηδηθνχ νρήκαηνο pgem-t Easy. Αθνινχζεζε κεηαζρεκαηηζκφο βαθηεξηαθψλ θπηηάξσλ Ε.coli ηνπ ζηειέρνπο DH5α κε ην αλαζπλδπαζκέλν πιαζκίδην θαη θαιιηέξγεηεο ζε ηξπβιία κε ζξεπηηθφ πιηθφ θαη ακπηθηιίλε σο επηιεθηηθφο κάξηπξαο ηεο αλάπηπμεο. ηελ ζπλέρεηα, επηιέρζεθαλ ζεηηθέο απνηθίεο, απφ ηηο νπνίεο απνκνλψζεθε

84 84 ην πιαζκηδηθφ DNA. Ζ πνηφηεηα θαη ε πνζφηεηα ηνπ απνκνλσκέλνπ πιαζκηδηθνχ DNA ειέγρζεθε κε ειεθηξνθφξεζε ζε πήθησκα αγαξφδεο 0.8%. Αθνινχζεζε πέςε κε έλδπκα πεξηνξηζκνχ (EcoRI γηα ην θνξέα pgem-t easy) ε νπνία επηβεβαίσζε ηελ παξνπζία ηνπ ελζέηνπ DNA. Αθνινχζεζε πξνζδηνξηζκφο ηεο πξσηνηαγνχο λνπθιενηηδηθήο δνκήο ηνπ ελζέηνπ ηκήκαηνο DNA, κε ηελ ελδπκηθή κέζνδν θαηά Sanger, ρξεζηκνπνηψληαο universal εθθηλεηέο M13F : 5 -TGTAAAACGACGGCCAGT- 3 θαη M13R : 5 - GAAACAGCTATGACCATG- 3. Α Β ~900 bp 947 bp 831 bp Δηθόλα 3.2. Ζιεθηξνθφξεζε ζε πήθησκα αγαξφδεο 1% ηνπ πξντφληνο ηεο PCR (Α) θαη ηνπ κάξηπξα ιx EcorI/HindIII (Β). Ζ αλάιπζε ησλ απνηειεζκάησλ έγηλε κε ην ινγηζκηθφ BLAST ησλ βάζεσλ δεδνκέλσλ ηνπ NCBI. Ζ παξαγφκελε ακηλνμηθή αιιεινπρία απφ ηo έλζεην ηκήκα DNA έδεημε ηαπηνζεκία 62% κε ηo C6 ηνπ αλζξψπνπ, πνπ ήηαλ θαη ην κεγαιχηεξν ζθνξ ηαπηνζεκίαο, πηζηνπνηψληαο έηζη φηη επξφθεηην γηα ηκήκα ηεο λνπθιενηηδηθήο αιιεινπρίαο ηνπ cdna ηνπ γνληδίνπ C6 ζηελ φξληζα. ην ηκήκα απηφ αλαγλσξίζηεθε ηκήκα ηεο θσδηθνπνηνχζαο πεξηνρήο ηνπ γνληδίνπ κήθνπο 881 bp, πνπ αληηζηνηρεί ζε ηκήκα ηεο πξσηεΐλεο 294 aa. Σν ηκήκα απηφ απνηέιεζε νδεγφ γηα ηε ζχλζεζε λέσλ εθθηλεηψλ, ζηνρεχνληαο ζηελ νινθιήξσζε ηεο θισλνπνίεζεο πξνο ην 5 άθξν.

85 Κλωνοποίηςη του 5 άκρου του cdna του γονιδίου C6 τησ βρνιθασ (κλώνοσ#2). Αξθεηέο θνξέο, ζε ρξεζηκνπνηνχκελεο c-dna βηβιηνζήθεο δελ ππάξρεη αθέξαηε ε 5 πεξηνρή, ιφγσ ηνπ ηξφπνπ ζχλζεζήο ηνπο, κε ηε ρξήζε εθθηλεηψλ oligo-dt. Πξνθεηκέλνπ ινηπφλ λα θισλνπνηεζεί ην cdna ηνπ 5 άθξνπ ηνπ γνληδίνπ C6 ηεο φξληζαο, ρξεζηκνπνηήζεθε ην νινθιεξσκέλν ζχζηεκα αληηδξαζηεξίσλ 5 /3 RACE (Roche). Δηδηθά νιηγνλνπθιενηίδηα ζρεδηάζηεθαλ κε βάζε ηελ αιιεινπρία ηνπ ηκήκαηνο DNA πνπ πξνζδηνξίζηεθε πξνεγνπκέλσο (θιψλνο#1). Δηθόλα 3.3. ρεδηαζκφο εηδηθψλ εθθηλεηψλ (SP1, SP2, SP3, SP4) κε βάζε ηελ εηδηθή λνπθιενηηδηθή αιιεινπρία ηνπ θιψλνπ#1. Οη εθθηλεηέο απηνί αλαθέξνληαη ζηνπο GGC6R1, GGCR2, GGC6R3 θαη GGC6UF1 αληίζηνηρα. Αξρηθά απνκνλψζεθε νιηθφ RNA ήπαηνο φξληζαο, κε ηε κέζνδν πνπ πεξηγξάθεθε παξαπάλσ, θαζψο απφ πεηξάκαηα κειέηεο ηεο έθθξαζεο ηνπ γνληδίνπ C6 έδεημαλ φηη ην ήπαξ σο ηνλ ηζηφ κε ηε κεγαιχηεξε έθθξαζε ηνπ γνληδίνπ ζε επίπεδν mrna. ηε ζπλέρεηα αθνινχζεζε αληίζηξνθε κεηαγξαθή ηνπ RNA, κε ηε ρξήζε εηδηθνχ εθθηλεηή (SP1), ηνπ GGC6R1 5 -GGTTTGTTGGTTACACGCACG-3, πξνζζήθε poly(a) νπξάο ζην παξαρζέλ cdna, θαζαξηζκφο ηνπ θαη ελίζρπζε κε PCR. Χο κήηξα γηα ηελ πξψηε αληίδξαζε ρξεζηκνπνηήζεθαλ 2,5 κg νιηθνχ RNA. Αθνινχζσο, θαηά ηελ ελίζρπζε ηνπ πξντφληνο κε RT-PCR, ρξεζηκνπνηήζεθε 1κl απφ ην πξντφλ ηεο πξψηεο PCR. Οη εθθηλεηέο πνπ ρξεζηκνπνηήζεθαλ ήηαλ έλαο δεχηεξνο εηδηθφο εθθηλεηήο (SP2), ν GGC6R2: 5 -GCCTTGTCTGTGTGCCATAA-3, θαζψο θαη ν εθθηλεηήο oligod(t) anchor primer πνπ παξέρεηαη απφ ην νινθιεξσκέλν ζχζηεκα αληηδξαηεξίσλ ηεο Roche, ε αιιεινπρία ηνπ νπνίνπ είλαη: 5 - GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTTV-3 (V= A, C ή G). Σν

86 86 πξφγξακκα ηεο αληίδξαζεο PCR είρε σο εμήο : 94 0 C γηα 2 min, {95 0 C γηα 30 sec, 48 0 C γηα 30 sec, 72 0 C γηα 30 sec} (30 θχθινη), 72 0 C γηα 10 min. Αθνινχζεζε θαη ηξίηε PCR, κε ηξίην εηδηθφ εθθηλεηή (SP3), GGC6R3: 5 - TTTGAACAGCTGGACCATGAC-3 θαη κε ηνλ εθθηλεηή πνπ παξέρεηαη απφ ην νινθιεξσκέλν ζχζηεκα αληηδξαζηεξίσλ, ηνλ PCR anchor primer: 5 - GACCACGCGTATCGATGTCGAC-3. Σν πξφγξακκα ηεο αληίδξαζεο PCR είρε σο εμήο : 95 0 C γηα 5 min, {95 0 C γηα 30 sec, 47 0 C γηα 30 sec, 72 0 C γηα 30 sec} (30 θχθινη), 72 0 C γηα 10 min. Σα πξντφληα ηεο αληίδξαζεο αλαιχζεθαλ ζε πήθησκα αγαξφδεο 2%, φπνπ θαη παξαηεξήζεθε δψλε κήθνπο πεξίπνπ 150bp (Δηθ.3.4). Α Β 340 bp ~ 150 bp Δηθόλα 3.4. Ζιεθηξνθφξεζε ζε πήθησκα αγαξφδεο 2%, ηνπ πξντφληνο ηεο PCR (A), κε κάξηπξα DNA ιxpvuii (B). ηε ζπλέρεηα, ην πξντφλ ηεο αληίδξαζεο PCR ππεβιήζε ζε αληίδξαζε ζπλδεηάζεο, παξνπζία ηνπ πιαζκηδηαθνχ νρήκαηνο pgem-t Easy. Σν αλαζπλδπαζκέλν πιαζκίδην πνιιαπιαζηάζηεθε θαη απνκνλψζεθε, αθνχ ππέζηε κεηαζρεκαηηζκφ ζε θχηηαξα E.coli DH5α. Σέινο, 30 ng απφ θαζαξφ πιαζκηδηθφ DNA ρξεζηκνπνηήζεθαλ σο κήηξα γηα ηε δηεμαγσγή nested PCR, ε νπνία επηβεβαίσζε ηελ χπαξμε ηνπ ελζέηνπ. Χο εθθηλεηέο ρξεζηκνπνηήζεθαλ νη GGC6F2 (SP4): 5 -CTATAAACACCTCTGCTATGG-3 θαη GGC6R2 (SP2): 5 - GCCTTGTCTGTGTGCCATAA-3, νη νπνίνη έδσζαλ πξντφλ κεγέζνπο 50bp. Σν πξφγξακκα πνπ εθαξκφζηεθε γηα ηε nested-pcr είρε σο εμήο: 95 0 C γηα 5 min, {95 0 C γηα 30 sec, 48 0 C γηα 30 sec, 72 0 C γηα 30 sec} (30 θχθινη), 72 0 C γηα 10 min.

87 87 Αθνινχζεζε πξνζδηνξηζκφο ηεο πξσηνηαγνχο λνπθιενηηδηθήο δνκήο ηνπ πξντφληνο, κε ηεv ελδπκηθή κέζνδν θαηά Sanger, ρξεζηκνπνηψληαο universal εθθηλεηέο M13F : 5 - TGTAAAACGACGGCCAGT-3 θαη M13R : 5 -GAAACAGCTATGACCATG-3. Ζ αλάιπζε ησλ απνηειεζκάησλ έγηλε κε ην πξφγξακκα BLAST ησλ βάζεσλ δεδνκέλσλ ηνπ NCBI. O θιψλνο#2, βξέζεθε φηη είρε κήθνο 142 bp θαη πεξηειάκβαλε ην 5 άθξν ηνπ mrna θαη ηελ 5 -UTR Κλωνοποίηςη του 3 άκρου του cdna του γονιδίου C6 τησ βρνιθασ, (κλώνοσ#3) Πξνθεηκέλνπ λα θισλνπνηεζεί ην 3 άθξν ηνπ cdna ηνπ γνληδίνπ C6 ηεο φξληζαο, ζρεδηάζηεθαλ εηδηθά νιηγνλνπθιενηίδηα (Δηθ.3.5), κε βάζε ηε λνπθιενηηδηθή αιιεινπρία ηνπ ηδίνπ νξγαληζκνχ, ε νπνία βξίζθεηαη θαηαρσξεκέλε ζηε GeneBank κε αξηζκφ πξφζβαζεο: Accession number XM_ Δηθόλα 3.5. Απεηθνλίδεηαη ν ζρεδηαζκφο ησλ εηδηθψλ εθθηλεηψλ (SP1, SP2, SP3 ) κε βάζε ηελ εηδηθή λνπθιενηηδηθή αιιεινπρία. Οη ζπγθεθξηκέλνη εθθηλεηέο αλαθέξνληαη ζηνπο GGC6UF1, GGC6UF2 θαη GGC6R4 αληίζηνηρα. Αξρηθά ρξεζηκνπνηήζεθαλ 2,5κg νιηθνχ RNA ήπαηνο φξληζαο θαη o εηδηθφο εθθηλεηήο SP1, GGC6UF1: 5 -CAGTGCCCCAGAGAAGAG-3 γηα ηελ παξαγσγή ηνπ ζπκπιεξσκαηηθνχ cdna θιψλνπ κε ηελ αληίδξαζε ηεο αληίζηξνθεο κεηαγξαθήο. ηε ζπλέρεηα, πξαγκαηνπνηήζεθε αληίδξαζε PCR κε κήηξα 1κl απφ ην πξντφλ ηεο παξαπάλσ αληίδξαζεο θαη εθθηλεηέο ην δεχηεξν εηδηθφ εθθηλεηή SP2,GGC6UF2: 5 - TGGAGTCAACAGGGAGAAGG-3 θαη ηνλ παξερφκελν απφ ην νινθιεξσκέλν ζχζηεκα αληηδξαζηεξίσλ ηεο Roche εθθηλεηή, ηνλ PCR-anchor primer. Σν πξφγξακκα

88 88 πνπ εθαξκφζηεθε ήηαλ ην εμήο: 94 0 C γηα 2 min, {95 0 C γηα 30 sec, 48 0 C γηα 30 sec, 72 0 C γηα 30 sec} (30 θχθινη), 72 0 C γηα 10 min. Α Β ~ 270bp 340 bp Δηθόλα 3.6. Ζιεθηξνθφξεζε ζε πήθησκα αγαξφδεο 2%, ηνπ πξντφληνο ηεο PCR (Α), κε κάξηπξα ιxpvuii (Β). Αθνινχζεζε ειεθηξνθφξεζε ζε πήθησκα αγαξφδεο 2% (Δηθ.3.6) θαη εμαγσγή ηνπ πξντφληνο DNA, κεγέζνπο πεξίπνπ 270 bp, απφ ην πήθησκα. ηε ζπλέρεηα, ην θαζαξηζκέλν πξντφλ DNA ππεβιήζε ζε αληίδξαζε ζπλδεηάζεο γηα ηελ έλζεζε ζε πιαζκηδηθφ φρεκα, αθνινχζεζε κεηαζρεκαηηζκφο ζε δεθηηθά θχηηαξα E.coli DH5α, θαη απνκνλψζεθε αλαζπλδπαζκέλν πιαζκίδην, κε ηηο δηαδηθαζίεο πνπ πεξηγξάθεθαλ παξαπάλσ. Σέινο, 30 ng απφ θαζαξφ πιαζκηδηθφ DNA ρξεζηκνπνηήζεθαλ σο κήηξα γηα ηε δηεμαγσγή nested PCR, ε νπνία επηβεβαίσζε ηελ χπαξμε ηνπ ελζέηνπ. Χο εθθηλεηέο ρξεζηκνπνηήζεθαλ νη GGC6R4: 5 -CCAGCACACAGTGACTGACTC-3 θαη GGC6UF2: 5 -TGGAGTCAACAGGGAGAAGG-3 θαη ην παξαγφκελν πξντφλ DNA ήηαλ κεγέζνπο 44bp. Σν πξφγξακκα πνπ εθαξκφζηεθε γηα ηε nested-pcr είρε σο εμήο: 95 0 C γηα 5 min, {95 0 C γηα 30 sec, 55 0 C γηα 30 sec, 72 0 C γηα 30 sec} (30 θχθινη), 72 0 C γηα 10 min. Αθνινχζεζε πξνζδηνξηζκφο ηεο πξσηνηαγνχο λνπθιενηηδηθήο δνκήο ηνπ πξντφληνο, κε ηελ ελδπκηθή κέζνδν θαηά Sanger, ρξεζηκνπνηψληαο universal εθθηλεηέο M13F : 5 - TGTAAAACGACGGCCAGT-3 θαη M13R : 5 -GAAACAGCTATGACCATG-3. Ζ αλάιπζε ησλ απνηειεζκάησλ έγηλε κε ην πξφγξακκα BLAST ησλ βάζεσλ δεδνκέλσλ ηνπ NCBI θαη έδεημε πσο ην ζπγθεθξηκέλν ηκήκα DNA, κήθνπο 256 bp,

89 89 πεξηειάκβαλε κέξνο ηεο θσδηθήο πεξηνρήο ηνπ γνληδίνπ C6 θαη ηελ 3 ακεηάθξαζηε πεξηνρή ηνπ cdna ηνπ γνληδίνπ γνθεςη των κλώνων και δομική μελέτη τησ ςυναγβμενησ αμινοξικήσ αλληλουχίασ πλζέηνληαο ηνπο ηξεηο θιψλνπο cdna πνπ απνκνλψζεθαλ, πξνθχπηεη έλαο θιψλνο κεγέζνπο 1137 bp πνπ αληηζηνηρεί ζηελ 5 πεξηνρή ηνπ γνληδίνπ C6 ηεο φξληζαο (16 bp) θαη ζε κέξνο ηεο θσδηθήο πεξηνρήο ηνπ γνληδίνπ ( bp). Ο ηξίηνο θιψλνο, πεξηιακβάλεη ηελ 3 ακεηάθξαζηε πεξηνρή ( bp), ζηελ νπνία εληνπίδνληαη δχν πηζαλά ζήκαηα πνιπαδελπιίσζεο. Δηθόλα 3.7: ρεκαηηθή απεηθφληζε ησλ δηαδνρηθψλ θισλνπνηήζεσλ θαζψο θαη ηνπ ζπλνιηθνχ cdna ηνπ γνληδίνπ C6 ηεο φξληζαο. ηελ Δηθόλα 3.8 απεηθνλίδεηαη ε λνπθιενηηδηθή θαη ε ζπλαγφκελε ακηλνμηθή αιιεινπρία ηνπ C6 ηεο φξληζαο ε νπνία θαηαηέζεθε ζηελ ηξάπεδα δενκέλσλ EMBL θαη είλαη θαηαρσξεκέλε κε αξηζκφ πξφζβαζεο Genebank FM tataatcacc tctgct 17 atggagaagactgtgctaatacagctgatcctgctgagcctggtg M E K T V L I Q L I L L S L V 62 gttgggagctgccaagggtgctactgtgaacattacccatggggg V G S C Q G C Y C E H Y P W G

90 107 tcatggtccagctgttcaaaaacctgcaattatggcacacagaca S W S S C S K T C N Y G T Q T 152 aggcacaggcaaataaaaatggatgaatattataaccaaaacttc R H R Q I K M D E Y Y N Q N F 197 tgtgaccggttgtgcaccaagcaggaatctcgtgcgtgtaaccaa C D R L C T K Q E S R A C N Q 242 caaacctgtcctatcaactgccaacttggagacttcggcccttgg Q T C P I N C Q L G D F G P W 287 tcagaatgtgacccatgcattgaaaaacaatttcgtgtcaggaaa S E C D P C I E K Q F R V R K 332 ctcctgcggccatcccagttcgggggccaggcctgcaccgagacg L L R P S Q F G G Q A C T E T 377 ctggtgcaatcccgaccgtgctttccagccaagctctgcaacatc L V Q S R P C F P A K L C N I 422 gtggatgtggactgcaagaataaattccagtgcgaaaatggtcgc V D V D C K N K F Q C E N G R 467 tgtattgcaaaaaaattggagtgcaatggagataatgactgtggg C I A K K L E C N G D N D C G 512 gacaactctgatgaaagatattgtgggagaaaaaaggtggtgtgt D N S D E R Y C G R K K V V C 557 agcagaaaatttgagagcatcccaggtgtgcatttaattggcagc S R K F E S I P G V H L I G S 602 ggatttcacattctgtcgggagagagccgaggggaagtccttggc G F H I L S G E S R G E V L G 647 aactcgttcaatggaggagaatgtagaacagtgagacgcaatgag N S F N G G E C R T V R R N E 692 acaaggaagtcctatcgtgtgcctgcaaacctggaggctgtcagc T R K S Y R V P A N L E A V S 737 tttcaggtaatagatgaagaggatgatgtaaaatcagatttctac F Q V I D E E D D V K S D F Y 782 agggatttaacgcctctgagtgacggtgatgtgggaagtagtaca R D L T P L S D G D V G S S T 827 tcctcccattcttctcagagaagatctggcataccgggtctattc S S H S S Q R R S G I P G L F 872 tcaaaaaagagaaaagttcaaatcacatcatcttcctccttcaag S K K R K V Q I T S S S S F K 917 aaagccattgaagcttcacatgaaaagaattccaactttattaga K A I E A S H E K N S N F I R 962 atccataaagtcatctctgttgcaaacttcacaatgaaagagtca I H K V I S V A N F T M K E S 1007 aatctgcagctctcagatgtctttctaaaagcactaaaccagctg N L Q L S D V F L K A L N Q L 1052 cccctggagtacaactatgctttatatagcagaatatttgacgac P L E Y N Y A L Y S R I F D D 1097 tttggcactcattactacacctctggaaagatgggtggttcctac F G T H Y Y T S G K M G G S Y 1142 gacattctttaccagtatagttcggaagaattgaagaactcgggt 90

91 D I L Y Q Y S S E E L K N S G 1187 ctgtcagtggatgaatcaatggagtgtattcgaacagaaacaaca L S V D E S M E C I R T E T T 1232 aggcgtgtgttcttccgaaagaaaaagaaagtcagtactgaatgc R R V F F R K K K K V S T E C 1277 atcacaaacaagatgactgtgaaacatgacggttccattttggag I T N K M T V K H D G S I L E 1322 tcagcagaacggtcagtctcactggtcaaaggtggcagatcagag S A E R S V S L V K G G R S E 1367 tacgcagcagctctggcctgggagaaaaagggggcttttccgggg Y A A A L A W E K K G A F P G 1412 aacacaatctttacaaactggctggaatcgaccaaggataatcct N T I F T N W L E S T K D N P 1457 gtggtgattgactttgaggtgtcgtctattgttgacctggtgaag V V I D F E V S S I V D L V K 1502 aacatgccttgtgccgtgaccaggcgacgcaacctgagaagggcc N M P C A V T R R R N L R R A 1547 ctgagggaatatgcaggcaggtttgacccatgtcagtgtgcccca L R E Y A G R F D P C Q C A P 1592 tgccccaacaatggcaggcctgtgctttctgggacagagtgcctc C P N N G R P V L S G T E C L 1637 tgcttgtgccaggctggcacctacggcacaaactgtgagatccga C L C Q A G T Y G T N C E I R 1682 gctccaggttatgagtcagttgctgtagatggtcgctggagttgc A P G Y E S V A V D G R W S C 1727 tggtctgaatggagctcatgtgatgcttctttcaagagaagaagg W S E W S S C D A S F K R R R 1772 acccgggagtgtaataacccatccccaataaatggtggaaaaccc T R E C N N P S P I N G G K P 1817 tgcaagggtgaacgggaagaagaggaggactgttatgtctctgtg C K G E R E E E E D C Y V S V 1862 ttcatggacaatggagctccttgtattaatgacgatgaagcaaaa F M D N G A P C I N D D E A K 1907 agtgaactggatattgtggttggtgtgcttgagactggatgctcc S E L D I V V G V L E T G C S 1952 aggccagacccaccagaaaatggttttatcaggaatgaaaagaac R P D P P E N G F I R N E K N 1997 cagtatgcggtaggggaagaagctgaaattgcctgtgtgagcggt Q Y A V G E E A E I A C V S G 2042 cacgtcctcatcggctatcagttccttcggtgtttgcctgatcaa H V L I G Y Q F L R C L P D Q 2087 acttggacacaacaacctgttgaatgccaaccctcattatgcctg T W T Q Q P V E C Q P S L C L 2132 aggccaccaacatctgacagtgttgaaatttccccatttaagcta R P P T S D S V E I S P F K L 2177 cactacaacattggtgaaactgtgaagctaagctgtcgagctggg H Y N I G E T V K L S C R A G 91

92 tttgtagtcactggtcaaacacaatatacttgtggaaaagatctg F V V T G Q T Q Y T C G K D L 2267 tcctggtttccttctattctgaggtctattacatgtgaaaaagat S W F P S I L R S I T C E K D 2312 gagcaagctaagattagaggagtttgcaatccaggacaaaaacag E Q A K I R G V C N P G Q K Q 2357 gttgggtctgagtgtgtctgtatgaatccagaagaagattgtggc V G S E C V C M N P E E D C G 2402 cactactcagaagacatctgtgtgctacatgctctttctgaacag H Y S E D I C V L H A L S E Q 2447 catgtgacgaagcccagctgtcagttttcagctgaaaagtgcctt H V T K P S C Q F S A E K C L 2492 ggagagcagtcatttcatttcttgcatgctggcccttgccacagt G E Q S F H F L H A G P C H S 2537 acttccagcgtacactgggctattgaaagggcaaagctctctgca T S S V H W A I E R A K L S A 2582 aacagcttgaagaaagtgccctgtggctatgacacctgctatgac N S L K K V P C G Y D T C Y D 2627 tgggaggaatgtccagaatcacagatgcagtgctcctgcctaatg W E E C P E S Q M Q C S C L M 2672 ccttaccagtgccccagagaagagagccagcttcactgcatccgg P Y Q C P R E E S Q L H C I R 2717 atggagtcaacagggagaaggaagagagtcagtcactgtgtgctg M E S T G R R K R V S H C V L 2762 gcagccatgaaatgtgctggcatcggactggaggtgctggaggag A A M K C A G I G L E V L E E 2807 gggagctgcctggggtaaatcagtggctctctcagtgcccaccac G S C L G * 2852 tgtcatcgcaccacaaatg gggtgagccgccatagggaaagctc 2897 aactggttataaaag gacaaaggaa ctcaaaaagg atgcaat 2942 aat aataataatg ttaaaaatga gctaatttaa tggg Δηθόλα 3.8. Ζ πιήξεο λνπθιενηηδηθή αιιεινπρία ηνπ γνληδίνπ C6 ηεο φξληζαο (2974bp), θαζψο θαη ε ζπλαγφκελε ακηλνμηθή αιιεινπρία ηνπ (935 ακηλνμέα). Ζ θσδηθή πεξηνρή ηνπ γνληδίνπ απνηειείηαη απφ ηα λνπθιενηίδηα εκεηψλνληαη κε θφθθηλν ρξψκα, ε αιιεινπρία Kozak (ζηελ 5 UTR), ην θσδηθφλην έλαξμεο θαη ηα δχν πηζαλά ζήκαηα πνιπαδελπιίσζεο ζηελ 3 UTR Υυλογενετική ανάλυςη των πρωτεΰνών τησ οικογένειασ MACPF. Με βάζε ηηο νκνινγίεο πνπ πξνέθπςαλ χζηεξα απφ ζχγθξηζε ησλ ηειηθψλ ιπηηθψλ ζπζηαηηθψλ δηαθφξσλ νξγαληζκψλ, ζρεδηάζηεθε έλα θπινγελεηηθφ δέληξν, ην νπνίν απεηθνλίδεη ηελ ηζρπξή ζπληήξεζε ησλ ζπζηαηηθψλ ηνπ MAC θαηά ηε δηάξθεηα ηεο

93 93 εμέιημεο. Δπίζεο θαίλνληαη θαη νη ζπζρεηίζεηο φισλ ησλ ζπζηαηηθψλ ηεο ιπηηθήο νδνχ ηνπ ζπκπιεξψκαηνο, απφ δηαθνξεηηθνχο νξγαληζκνχο, ζηνπο νπνίνπο γλσξίδνπκε ηελ πιήξε λνπθιενηηδηθή θαη επνκέλσο ηε ζπλαγφκελε ακηλνμηθή αιιεινπρία. Χο outgroup ρξεζηκνπνηήζεθε ε πεξθνξίλε ηεο φξληζαο. Δηθόλα Φπινγελεηηθή αλάιπζε ησλ πξσηετλψλ ηεο νηθνγέλεηαο MACPF ηνπ ηειηθνχ ζπκπιφθνπ ιχζεο απφ δηάθνξνπο νξγαληζκνχο. Οη ζρέζεηο κεηαμχ ησλ ζπζηαηηθψλ αλαιχζεθαλ κε ηε κέζνδν Neighbour-Joining algorithm κέζσ ηνπ ινγηζκηθνχ MEGA (Molecular Evolutionary Genetic Analysis) έθδνζε 4. Οη νξγακηζκνί ησλ νπνίσλ ηα νξζφινγα

94 94 ρξεζηκνπνηήζεθαλ ήηαλ νη εμήο: Tetraodon nigroviridis (Tn), Oncorhynchus mykiss (Om), Danio rerio (Dr), Xenopus laevis (Xl), Xenopus tropicalis (Xt), Gallus gallus (Gg), Rattus norvegius (Rn), Monodelphis domestica (Md), Rattus norvegicus (Rn), Mus musculus (Mm), Homo sapiens (Hs), Pan troglodytes (Pn), Pongo pygmaeus (Pp), Macaca mulatta (Mam), Felis catus (Cf), Equus caballus (Ec), Bos taurus (Bb), Sus scrofa (Ss) Μελέτη τησ ιςτικήσ-αναπτυξιακήσ έκφραςησ, ςε επίπεδο mrna, των γονιδίων του ςυμπληρώματοσ ςτην βρνιθα. ηνρεχνληαο ζηελ αλάιπζε ηεο έθθξαζεο ησλ παξαπάλσ γνληδίσλ ζηελ φξληζα, ρξεζηκνπνηήζεθε ε κέζνδνο ηεο εκηπνζνηηθήο αλάιπζεο ηεο RT-PCR ζε δχν βήκαηα. Καηά ην πξψην βήκα, 2,5 κg νιηθνχ mrna απφ εγθέθαιν, θαξδηά, έληεξν, λεθξφ, ήπαξ, πλεχκνλα, ζπιήλα θαη ζηφκαρν ελήιηθεο φξληζαο απνκνλψζεθαλ θαη ρξεζηκνπνηήζεθαλ ζε αληίδξαζε αληίζηξνθεο κεηαγξαθάζεο γηα ηελ παξαγσγή cdna κε ηπραίνπο εθθηλεηέο. Οη λνεκαηηθνί θαη αληηλνεκαηηθνί εθθηλεηέο νη νπνίνη ρξεζηκνπνηήζεθαλ ζηελ αληίδξαζε PCR θαηά ην δεχηεξν βήκα, ην κέγεζνο ησλ αλακελφκελσλ πξντφλησλ ηνπο, θαζψο θαη ε ζεξκνθξαζία πβξηδνπνίεζεο πνπ ρξεζηκνπνηήζεθε, αλαγξάθνληαη ζην ζπγθεληξσηηθφ Πίλαθα 2.1. Ζ αληίδξαζε PCR πξαγκαηνπνηήζεθε κε ην εμήο πξφγξακκα: 94 ν C γηα 2 min, 40 θχθινη: {94 ν C γηα 30 sec, Tan ν C γηα 30 sec, 72 ν C γηα 30 sec} θαη ηειηθή επηκήθπλζε ζηνπο 72 ν C γηα 10 min. γηα ηα ζπζηαηηθά ηνπ ζπκπιφθνπ MAC, ελψ γηα ηα ξπζκηζηηθά κφξηα ηνπ ζπκπιφθνπ (CD59, CLU, VTN), ην πξφγξακκα πνπ αθνινπζήζεθε ήηαλ: 94 ν C γηα 2 min, 30 θχθινη: {94 ν C γηα 30 sec, Tan ν C γηα 30 sec, 72 ν C γηα 30} sec θαη ηειηθή επηκήθπλζε ζηνπο 72 ν C γηα 10 min. Δπίζεο, ζηηο αληηδξάζεηο RT-PCR ρξεζηκνπνηήζεθε σο κάξηπξαο ην γνλίδην GAPDH (Glyceraldehyde 3-phosphate dehydrogenase), θαζψο ε έθθξαζή ηνπ είλαη αλεμάξηεηε ηνπ ηζηνχ πνπ κειεηάκε θαη έηζη παξέρεηαη ε δπλαηφηεηα ειέγρνπ ηεο πνζφηεηαο θαη ηεο πνηφηεηαο ηνπ ππνζηξψκαηνο RNA. Σα δχν δεχγε ησλ εθθηλεηψλ ηνπ γνληδίνπ GAPDH ρξεζηκνπνηήζεθαλ ζε αληίδξαζε PCR, κε κήηξα 1κl cdna, κε βάζε ην παξαθάησ πξφγξακκα: 94 ν C γηα 2 min, {94 ν C γηα 30 sec, 56 ν C γηα 30 sec, 72 ν C γηα 30 sec} (30 θχθινη) θαη ηειηθή επηκήθπλζε ζηνπο 72 ν C γηα 10 min. Όια ηα πξντφληα ειεθηξνθνξήζεθαλ ζε πήθησκα αγαξφδεο 1.5%, καδί κε DNA κάξηπξα ηνλ λx PVUII.

95 95 Ζ ζρεηηθή πνζνηηθνπνίεζε πνπ αθνινχζεζε έγηλε έπεηηα απφ θαλνληθνπνίεζε κε ηα επίπεδα έθθξαζεο m-rna ηνπ γνληδίνπ GAPDH θαη πξαγκαηνπνηήζεθε κε ηε ρξήζε ηνπ ινγηζκηθνχ πξνγξάκκαηνο Scion Image Μελέτη τησ αναπτυξιακήσ έκφραςησ, ςε επίπεδο mrna, του γονιδίου C3 ςτην βρνιθα. χκθσλα κε ηελ εηθφλα 3.11, ην γνλίδην C3, εθθξάδεηαη ζε φια ηα αλαπηπμηαθά ζηάδηα, παξνπζηάδνληαο κηα κηθξή αχμεζε ζην ήπαξ κεηά ηε γέλλεζε ζε νιηθφ έκβξπν 4 θαη 6 εκεξψλ, ζε ήπαξ εκβξχνπ 12 θαη 17 εκεξψλ θαη ζε λενγέλλεην άηνκν 2 θαη 5 εκεξψλ. Δηθόλα 3.11: Ζιεθηξνθφξεζε πξντφλησλ RT-PCR αληηδξάζεσλ γηα ην γνλίδην C3 ζε πήθησκα αγαξφδεο 1.5% ζε νιηθφ έκβξπν 4 θαη 6 εκεξψλ (Δ4, Δ6), ζε ήπαξ εκβξχνπ 12 θαη 17 εκεξψλ (Δ12, Δ17) θαη ζε ήπαξ λενγέλλεηνπ αηφκνπ 2 θαη 5 εκεξψλ (D2, D5) θαη ζρεηηθή πνζνηηθνπνίεζε ησλ απνηειεζκάησλ, έπεηηα απφ θαλνληθνπνίεζε βαζηδφκελε ζηα επίπεδα mrna ηνπ γνληδίνπ GAPDH, ην νπνίν ρξεζηκνπνηήζεθε σο εζσηεξηθφο κάξηπξαο ηεο αληίδξαζεο.

96 Μελέτη ιςτικήσ και αναπτυξιακήσ έκφραςησ, ςε επίπεδο mrna των δομικών γονιδίων του ςυμπλβκου MAC ςτην βρνιθα. Α)Μειέηε ηεο ηζηηθήο έθθξαζεο χκθσλα κε ηελ Δηθφλα 3.12 ην γνλίδην C6 εθθξάδεηαη θαηά θχξην ιφγν ζην ήπαξ θαη ζην λεθξφ, ελψ είλαη κηθξφηεξε ε έθθξαζε ηνπ γνληδίνπ ζηνλ εγθέθαιν, ηελ θαξδηά, ην έληεξν θαη ηνλ πλεχκνλα. Δηθόλα 3.12: Ζιεθηξνθφξεζε πξντφλησλ αληηδξάζεσλ RT-PCR γηα ην γνλίδην C6 ζε πήθησκα αγαξφδεο 1.5% θαη ζρεηηθή πνζνηηθνπνίεζε ησλ απνηειεζκάησλ, έπεηηα απφ θαλνληθνπνίεζε βαζηδφκελε ζηα επίπεδα mrna ηνπ γνληδίνπ GAPDH, ην νπνίν ρξεζηκνπνηήζεθε σο εζσηεξηθφο κάξηπξαο ηεο αληίδξαζεο. χκθσλα κε ηελ Δηθφλα 3.13, ην γνλίδην C7 εθθξάδεηαη θαηά θχξην ιφγν ζην λεθξφ θαη ζηνλ πλεχκνλα, ελψ αθνινπζνχλ ε θαξδηά, ν εγθέθαινο θαη πλεχκνλαο, κε ρακειφηεξα επίπεδα έθθξαζεο.

97 97 Δηθόλα 3.13: Ζιεθηξνθφξεζε πξντφλησλ αληηδξάζεσλ RT-PCR γηα ην γνλίδην C7 ζε πήθησκα αγαξφδεο 1.5% θαη ζρεηηθή πνζνηηθνπνίεζε ησλ απνηειεζκάησλ, έπεηηα απφ θαλνληθνπνίεζε βαζηδφκελε ζηα επίπεδα mrna ηνπ γνληδίνπ GAPDH, ην νπνίν ρξεζηκνπνηήζεθε σο εζσηεξηθφο κάξηπξαο ηεο αληίδξαζεο. χκθσλα κε ηελ Δηθφλα 3.14, ην γνλίδην C8α παξνπζηάδεη ηε κέγηζηε έθθξαζε ζην ήπαξ θαη ζηνλ πλεχκνλα, ελψ αθνινπζνχλ ην λεθξφ, ην έληεξν, ε θαξδηά, ν εγθέθαινο θαη ν ζηφκαρνο.

98 98 Δηθόλα 3.14: Ζιεθηξνθφξεζε πξντφλησλ RT-PCR αληηδξάζεσλ γηα ην γνλίδην C8α ζε πήθησκα αγαξφδεο 1.5% θαη ζρεηηθή πνζνηηθνπνίεζε ησλ απνηειεζκάησλ, έπεηηα απφ θαλνληθνπνίεζε βαζηδφκελε ζηα επίπεδα mrna ηνπ γνληδίνπ GAPDH, ην νπνίν ρξεζηκνπνηήζεθε σο εζσηεξηθφο κάξηπξαο ηεο αληίδξαζεο. χκθσλα κε ηελ Δηθφλα 3.15, ην γνλίδην C8β εθθξάδεηαη ζην ήπαξ θαη ζηνλ πλεχκνλα, ελψ αθνινπζνχλ ην λεθξφ, ε θαξδηά, θαη ν εγθέθαινο.

99 99 Δηθόλα 3.15: Ζιεθηξνθφξεζε πξντφλησλ αληηδξάζεσλ RT-PCR γηα ην γνλίδην C8β ζε πήθησκα αγαξφδεο 1.5% θαη ζρεηηθή πνζνηηθνπνίεζε ησλ απνηειεζκάησλ, έπεηηα απφ θαλνληθνπνίεζε βαζηδφκελε ζηα επίπεδα mrna ηνπ γνληδίνπ GAPDH, ην νπνίν ρξεζηκνπνηήζεθε σο εζσηεξηθφο κάξηπξαο ηεο αληίδξαζεο. Σέινο, ζχκθσλα κε ηελ Δηθφλα 3.16, ην γνλίδην C8γ, παξνπζηάδεη ηε κεγαιχηεξε έθθξαζε ζην ήπαξ θαη δεπηεξεπφλησο ζηνλ εγθέθαιν, ζηνλ πλεχκνλα, ζηελ θαξδηά, ζην ζηφκαρν θαη ζηε ζπιήλα.

100 100 Δηθόλα 3.16: Ζιεθηξνθφξεζε πξντφλησλ αληηδξάζεσλ RT-PCR γηα ην γνλίδην C8γ ζε πήθησκα αγαξφδεο 1.5% θαη ζρεηηθή πνζνηηθνπνίεζε ησλ απνηειεζκάησλ, έπεηηα απφ θαλνληθνπνίεζε βαζηδφκελε ζηα επίπεδα mrna ηνπ γνληδίνπ ηνπ GAPDH γγκριςη τησ έκφραςησ των ςυςτατικών του ςυμπλβκου MAC μεταξγ τησ πέςτροφασ (Oncorynchus mykiss), τησ βρνιθασ (Gallus gallus) και του ανθρώπου (Homo sapiens). Ηζηόο Δγθέθαινο Καξδηά Έληεξν Νεθξόο Ήπαξ πιήλαο ηόκαρνο Πλεύκνλαο Γνλίδην/ Οξγαλη ζκόο C6 C7 C8α C8β C8γ Σ C H T C H Σ C H T C H Σ C H T C H C H C H /

101 101 Πίλαθαο 3.1: πγθξηηηθή παξνπζίαζε, ζηεο ηζηηθήο έθθξαζεο, ζε επίπεδν mrna ησλ δνκηθψλ γνληδίσλ ηνπ ζπκπιφθνπ MAC γηα ηνπο νξγαληζκνχο ηεο ηξηδίδνπζαο πέζηξνθαο (trout, Σ), ηεο φξληζαο (chicken, C) θαη ηνπ αλζξψπνπ (human, H). Β) Μειέηε ηεο αλαπηπμηαθήο έθθξαζεο χκθσλα κε ηελ Δηθφλα 3.17, ην γνλίδην C6 εθθξάδεηαη ζε ήπαξ εκβξχνπ 12 θαη 17 εκεξψλ ελψ δελ εθθξάδεηαη ζε νιηθφ έκβξπν 6 εκεξψλ θαη ζε λενγέλλεην άηνκν 2 εκεξψλ. Δηθόλα 3.17: Ζιεθηξνθφξεζε πξντφλησλ RT-PCR αληηδξάζεσλ γηα ην γνλίδην C6 ζε πήθησκα αγαξφδεο 1.5% MAC ζε νιηθφ έκβξπν 6 εκεξψλ (Δ6), ζε ήπαξ εκβξχνπ 12 θαη 17 εκεξψλ (Δ12, Δ17) θαη ζε ήπαξ λενγέλλεηνπ αηφκνπ 2 εκεξψλ (D2) θαη ζρεηηθή πνζνηηθνπνίεζε ησλ απνηειεζκάησλ, έπεηηα απφ θαλνληθνπνίεζε βαζηδφκελε ζηα επίπεδα mrna ηνπ γνληδίνπ GAPDH, ην νπνίν ρξεζηκνπνηήζεθε σο εζσηεξηθφο κάξηπξαο ηεο αληίδξαζεο. χκθσλα κε ηελ Δηθφλα 3.18, ην γνλίδην C7 εθθξάδεηαη ζε ήπαξ εκβξχνπ 12 θαη 17 εκεξψλ ζε ελψ δελ εθθξάδεηαη ζε νιηθφ έκβξπν 6 εκεξψλ θαη ζε λενγέλλεην άηνκν 2 εκεξψλ.

102 102 Δηθόλα 3.18: Ζιεθηξνθφξεζε πξντφλησλ RT-PCR αληηδξάζεσλ γηα ην γνλίδην C7 ζε πήθησκα αγαξφδεο 1.5% ζε νιηθφ έκβξπν 6 εκεξψλ (Δ6), ζε ήπαξ εκβξχνπ 12 θαη 17 εκεξψλ (Δ12, Δ17) θαη ζε ήπαξ λενγέλλεηνπ αηφκνπ 2 εκεξψλ (D2) θαη ζρεηηθή πνζνηηθνπνίεζε ησλ απνηειεζκάησλ, έπεηηα απφ θαλνληθνπνίεζε βαζηδφκελε ζηα επίπεδα mrna γνληδίνπ GAPDH, ην νπνίν ρξεζηκνπνηήζεθε σο εζσηεξηθφο κάξηπξαο ηεο αληίδξαζεο. χκθσλα κε ηελ Δηθφλα 3.19, ην γνλίδην C8α εθθξάδεηαη ζε ήπαξ εκβξχνπ 12 θαη 17 εκεξψλ ζε ελψ δελ εθθξάδεηαη ζε νιηθφ έκβξπν 6 εκεξψλ θαη ζε λενγέλλεην άηνκν 2 εκεξψλ.

103 103 Δηθόλα 3.19: Ζιεθηξνθφξεζε πξντφλησλ RT-PCR αληηδξάζεσλ γηα ην γνλίδην C8α ζε πήθησκα αγαξφδεο 1.5% ζε νιηθφ έκβξπν 6 εκεξψλ (Δ6), ζε ήπαξ εκβξχνπ 12 θαη 17 εκεξψλ (Δ12, Δ17) θαη ζε ήπαξ λενγέλλεηνπ αηφκνπ 2 εκεξψλ (D2) θαη ζρεηηθή πνζνηηθνπνίεζε ησλ απνηειεζκάησλ, έπεηηα απφ θαλνληθνπνίεζε βαζηδφκελε ζηα επίπεδα mrna ηνπ γνληδίνπ GAPDH, ην νπνίν ρξεζηκνπνηήζεθε σο εζσηεξηθφο κάξηπξαο ηεο αληίδξαζεο. χκθσλα κε ηελ Δηθφλα 3.20, ην γνλίδην C8β επίζεο εθθξάδεηαη ζε ήπαξ εκβξχνπ 12 θαη 17 εκεξψλ ζε ελψ δελ εθθξάδεηαη ζε νιηθφ έκβξπν 6 εκεξψλ θαη ζε λενγέλλεην άηνκν 2 εκεξψλ.

104 104 Δηθόλα 3.20: Ζιεθηξνθφξεζε πξντφλησλ RT-PCR αληηδξάζεσλ γηα ην γνλίδην C8β ζε πήθησκα αγαξφδεο 1.5% ζε νιηθφ έκβξπν 6 εκεξψλ (Δ6), ζε ήπαξ εκβξχνπ 12 θαη 17 εκεξψλ (Δ12, Δ17) θαη ζε ήπαξ λενγέλλεηνπ αηφκνπ 2 εκεξψλ (D2) θαη ζρεηηθή πνζνηηθνπνίεζε ησλ απνηειεζκάησλ, έπεηηα απφ θαλνληθνπνίεζε βαζηδφκελε ζηα επίπεδα mrna ηνπ γνληδίνπ GAPDH, ην νπνίν ρξεζηκνπνηήζεθε σο εζσηεξηθφο κάξηπξαο ηεο αληίδξαζεο. Σέινο, ην γνλίδην C8γ, φπσο θαη φια ηα ππφινηπα ζπζηαηηθά ηνπ ζπκπιφθνπ MAC, ζχκθσλα κε ηελ Δηθφλα 3.21, εθθξάδεηαη ζε ήπαξ εκβξχνπ 12 θαη 17 εκεξψλ ζε ελψ δελ εθθξάδεηαη ζε νιηθφ έκβξπν 6 εκεξψλ θαη ζε λενγέλλεην άηνκν 2 εκεξψλ.

105 105 Δηθόλα 3.21: Ζιεθηξνθφξεζε πξντφλησλ RT-PCR αληηδξάζεσλ γηα ην γνλίδην C8γ ζε πήθησκα αγαξφδεο 1.5% ζε νιηθφ έκβξπν 6 εκεξψλ (Δ6), ζε ήπαξ εκβξχνπ 12 θαη 17 εκεξψλ (Δ12, Δ17) θαη ζε ήπαξ λενγέλλεηνπ αηφκνπ 2 εκεξψλ (D2) θαη ζρεηηθή πνζνηηθνπνίεζε ησλ απνηειεζκάησλ, έπεηηα απφ θαλνληθνπνίεζε βαζηδφκελε ζηα επίπεδα mrna ηνπ γνληδίνπ GAPDH, ην νπνίν ρξεζηκνπνηήζεθε σο εζσηεξηθφο κάξηπξαο ηεο αληίδξαζεο Μελέτη αναπτυξιακήσ έκφραςησ, ςε επίπεδο mrna, των ρυθμιςτικών γονιδίων του ςυμπλβκου MAC ςτην βρνιθα. χκθσλα κε ηελ Δηθφλα 3.22, ην γνλίδην ηεο βηηξνλεθηίλεο (VTN) εθθξάδεηαη ζε φια ηα αλαπηπμηαθά ζηάδηα, ζε νιηθφ έκβξπν 4 θαη 6 εκεξψλ, ζε ήπαξ εκβξχνπ 12 θαη 17 εκεξψλ θαη ζε λενγέλλεην άηνκν 2 θαη 5 εκεξψλ.

106 106 Δηθόλα 3.22: Ζιεθηξνθφξεζε πξντφλησλ RT-PCR αληηδξάζεσλ γηα ην γνλίδην VTN ζε πήθησκα αγαξφδεο 1.5% ζε νιηθφ έκβξπν 4 θαη 6 εκεξψλ (Δ4, Δ6), ζε ήπαξ εκβξχνπ 12 θαη 17 εκεξψλ (Δ12, Δ17) θαη ζε ήπαξ λενγέλλεηνπ αηφκνπ 2 θαη 5 εκεξψλ (D2, D5) θαη ζρεηηθή πνζνηηθνπνίεζε ησλ απνηειεζκάησλ, έπεηηα απφ θαλνληθνπνίεζε βαζηδφκελε ζηα επίπεδα mrna ηνπ γνληδίνπ GAPDH, ην νπνίν ρξεζηκνπνηήζεθε σο εζσηεξηθφο κάξηπξαο ηεο αληίδξαζεο. Όκνην πξφηππν έθθξαζεο παξνπζηάδεη θαη ην γνλίδην ηεο θιαζηεξίλεο (CLU), ζχκθσλα κε ηελ Δηθφλα 3.23, θαζψο εθθξάδεηαη ζε φια ηα αλαπηπμηαθά ζηάδηα, ζε νιηθφ έκβξπν 4 θαη 6 εκεξψλ, ζε ήπαξ εκβξχνπ 12 θαη 17 εκεξψλ θαη ζε λενγέλλεην άηνκν 2 θαη 5 εκεξψλ.

107 107 Δηθόλα 3.23: Ζιεθηξνθφξεζε πξντφλησλ RT-PCR αληηδξάζεσλ γηα ην γνλίδην CLU ζε πήθησκα αγαξφδεο 1.5% ζε νιηθφ έκβξπν 4 θαη 6 εκεξψλ (Δ4, Δ6), ζε ήπαξ εκβξχνπ 12 θαη 17 εκεξψλ (Δ12, Δ17) θαη ζε ήπαξ λενγέλλεηνπ αηφκνπ 2 θαη 5 εκεξψλ (D2, D5) θαη ζρεηηθή πνζνηηθνπνίεζε ησλ απνηειεζκάησλ, έπεηηα απφ θαλνληθνπνίεζε βαζηδφκελε ζηα επίπεδα mrna ηνπ γνληδίνπ GAPDH, ην νπνίν ρξεζηκνπνηήζεθε σο εζσηεξηθφο κάξηπξαο ηεο αληίδξαζεο. Σέινο παξαηεξείηαη φκνην πξφηππν έθθξαζεο θαη γηα ην γνλίδην CD59, θαζψο ζχκθσλα κε ηελ Δηθφλα 3.24 εθθξάδεηαη ζε φια ηα αλαπηπμηαθά ζηάδηα, ζε νιηθφ έκβξπν 4 θαη 6 εκεξψλ, ζε ήπαξ εκβξχνπ 12 θαη 17 εκεξψλ θαη ζε λενγέλλεην άηνκν 2 θαη 5 εκεξψλ.

ΑΛΛΑΓΗ ΟΝΟΜΑΣΟ ΚΑΙ ΟΜΑΔΑ ΕΡΓΑΙΑ, ΚΟΙΝΟΥΡΗΣΟΙ ΦΑΚΕΛΟΙ ΚΑΙ ΕΚΣΤΠΩΣΕ ΣΑ WINDOWS XP

ΑΛΛΑΓΗ ΟΝΟΜΑΣΟ ΚΑΙ ΟΜΑΔΑ ΕΡΓΑΙΑ, ΚΟΙΝΟΥΡΗΣΟΙ ΦΑΚΕΛΟΙ ΚΑΙ ΕΚΣΤΠΩΣΕ ΣΑ WINDOWS XP ΑΛΛΑΓΗ ΟΝΟΜΑΣΟ ΚΑΙ ΟΜΑΔΑ ΕΡΓΑΙΑ, ΚΟΙΝΟΥΡΗΣΟΙ ΦΑΚΕΛΟΙ ΚΑΙ ΕΚΣΤΠΩΣΕ ΣΑ WINDOWS XP ηότοι εργαζηηρίοσ ην πιαίζην ηνπ ζπγθεθξηκέλνπ εξγαζηεξίνπ ζα παξνπζηαζηνύλ βαζηθέο ιεηηνπξγίεο ησλ Windows XP πνπ ζρεηίδνληαη

Διαβάστε περισσότερα

Η απνξξόθεζε ηνπ νξαηνύ θσηόο γίλεηαη κέζσ ρξσζηηθώλ νπζηώλ πνπ νλνκάδνληαη τλωροθύλλες.

Η απνξξόθεζε ηνπ νξαηνύ θσηόο γίλεηαη κέζσ ρξσζηηθώλ νπζηώλ πνπ νλνκάδνληαη τλωροθύλλες. ΦΩΣΟΤΝΘΔΗ Δλαιιαθηηθή δηεξγαζία παξαγσγήο ελέξγεηαο Υξεζηκνπνηείηαη από ηνπο νλνκαδόκελνπο θσηνζπλζεηηθνύο νξγαληζκνύο Οπζηαζηηθά ε αληίζηξνθε δηεξγαζία ηεο αλαπλνήο πλίζηαηαη ζηελ δέζκεπζε ειηαθήο ελέξγεηαο

Διαβάστε περισσότερα

Γιπθόδε + Ομπγόλν Δηνμείδην ηνπ άλζξαθα + Νεξό + Ελέξγεηα

Γιπθόδε + Ομπγόλν Δηνμείδην ηνπ άλζξαθα + Νεξό + Ελέξγεηα 4. ΑΝΑΠΝΟΗ Η δηάζπαζε ηεο γιπθόδεο γίλεηαη κέζα ζηα θύηηαξα, νλνκάδεηαη θπηηαξηθή αλαπλνή θαη εμαζθαιίδεη ηελ ελέξγεηα πνπ είλαη απαξαίηεηε ζην θύηηαξν. Η δηάζπαζε γίλεηαη κε ηελ παξνπζία νμπγόλνπ θαη

Διαβάστε περισσότερα

H ΜΑΓΕΙΑ ΤΩΝ ΑΡΙΘΜΩΝ

H ΜΑΓΕΙΑ ΤΩΝ ΑΡΙΘΜΩΝ H ΜΑΓΕΙΑ ΤΩΝ ΑΡΙΘΜΩΝ Φξεζηκόηεηα καζεκαηηθώλ Αξρή θαηακέηξεζεο Όζα έδσζαλ νη Έιιελεο... Τξίγσλνη αξηζκνί Τεηξάγσλνη αξηζκνί Δπηκήθεηο αξηζκνί Πξώηνη αξηζκνί Αξηζκνί κε μερσξηζηέο ηδηόηεηεο Γίδπκνη πξώηνη

Διαβάστε περισσότερα

Μεραληζκνί ξχζκηζεο ηεο ελαιιαθηηθήο νδνχ ηνπ ζπκπιεξψκαηνο

Μεραληζκνί ξχζκηζεο ηεο ελαιιαθηηθήο νδνχ ηνπ ζπκπιεξψκαηνο Μεραληζκνί ξχζκηζεο ηεο ελαιιαθηηθήο νδνχ ηνπ ζπκπιεξψκαηνο Βειηίσζε ηεο ζηαζεξφηεηαο ηνπ ζεξαπεπηηθνχ αλαζηνιέα ηνπ ζπκπιεξψκαηνο Compstatin Mechanisms of regulation of the alternative complement pathway

Διαβάστε περισσότερα

ΤΑΞΙΝΟΜΗΣΗ ΤΩΝ ΤΔΡΗΓΟΝΙΚΩΝ ΒΛΑΒΩΝ ΚΑΤΑ ΤΑ ICDAS II ΚΡΙΤΗΡΙΑ ΜΔ ΒΑΣΗ ΤΗ ΚΛΙΝΙΚΗ ΔΞΔΤΑΣΗ

ΤΑΞΙΝΟΜΗΣΗ ΤΩΝ ΤΔΡΗΓΟΝΙΚΩΝ ΒΛΑΒΩΝ ΚΑΤΑ ΤΑ ICDAS II ΚΡΙΤΗΡΙΑ ΜΔ ΒΑΣΗ ΤΗ ΚΛΙΝΙΚΗ ΔΞΔΤΑΣΗ ΤΑΞΙΝΟΜΗΣΗ ΤΩΝ ΤΔΡΗΓΟΝΙΚΩΝ ΒΛΑΒΩΝ ΚΑΤΑ ΤΑ ICDAS II ΚΡΙΤΗΡΙΑ ΜΔ ΒΑΣΗ ΤΗ ΚΛΙΝΙΚΗ ΔΞΔΤΑΣΗ Κιηληθή ηαμηλόκεζε ηνπ βαζκνύ ηεξεδνληθήο βιάβεο ηωλ νπώλ θαη ζρηζκώλ καζεηηθώλ επηθαλεηώλ θαηά ICDAS 1 νο Βαζκόο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ ΘΕΜΑ 1 Ο Να γράψετε στο τετράδιό σας τον αριθµό της καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 εως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

ΤΠΟΓΟΥΔΑ Σ-ΛΔΜΦΟΚΤΣΣΑΡΟΤ

ΤΠΟΓΟΥΔΑ Σ-ΛΔΜΦΟΚΤΣΣΑΡΟΤ ΤΠΟΓΟΥΔΑ Σ-ΛΔΜΦΟΚΤΣΣΑΡΟΤ 6 Τα Τ-ιεκθνθύηηαξα παίδνπλ ζεκαληηθό ξόιν ζηελ αλνζηαθή απάληεζε έλαληη ηωλ πξωηεϊληθώλ αληηγόλωλ. Από ηε ζηηγκή πνπ όινη νη παζνγόλνη κηθξννξγαληζκνί πεξηέρνπλ πξωηεΐλεο, ηα

Διαβάστε περισσότερα

Σημεία Ασύπματηρ Ππόσβασηρ (Hot-Spots)

Σημεία Ασύπματηρ Ππόσβασηρ (Hot-Spots) Σημεία Ασύπματηρ Ππόσβασηρ (Hot-Spots) 1.1 Σςνοπτική Πεπιγπαυή Hot Spots Σα ζεκεία αζύξκαηεο πξόζβαζεο πνπ επηιέρζεθαλ αλαθέξνληαη ζηνλ επόκελν πίλαθα θαη παξνπζηάδνληαη αλαιπηηθά ζηηο επόκελεο παξαγξάθνπο.

Διαβάστε περισσότερα

ΣΔΥΝΟΛΟΓΙΚΟ ΠΑΝΔΠΙΣΗΜΙΟ ΚΤΠΡΟΤ ΥΟΛΗ ΓΔΩΣΔΥΝΙΚΩΝ ΔΠΙΣΗΜΩΝ ΚΑΙ ΓΙΑΥΔΙΡΙΗ ΠΔΡΙΒΑΛΟΝΣΟ. Πτυχιακή διατριβή ΟΛΟΚΛΗΡΩΜΔΝΗ ΑΠΟΡΡΤΠΑΝΗ ΚΑΤΑΔΡΙΩΝ ΠΛΟΙΩΝ

ΣΔΥΝΟΛΟΓΙΚΟ ΠΑΝΔΠΙΣΗΜΙΟ ΚΤΠΡΟΤ ΥΟΛΗ ΓΔΩΣΔΥΝΙΚΩΝ ΔΠΙΣΗΜΩΝ ΚΑΙ ΓΙΑΥΔΙΡΙΗ ΠΔΡΙΒΑΛΟΝΣΟ. Πτυχιακή διατριβή ΟΛΟΚΛΗΡΩΜΔΝΗ ΑΠΟΡΡΤΠΑΝΗ ΚΑΤΑΔΡΙΩΝ ΠΛΟΙΩΝ ΣΔΥΝΟΛΟΓΙΚΟ ΠΑΝΔΠΙΣΗΜΙΟ ΚΤΠΡΟΤ ΥΟΛΗ ΓΔΩΣΔΥΝΙΚΩΝ ΔΠΙΣΗΜΩΝ ΚΑΙ ΓΙΑΥΔΙΡΙΗ ΠΔΡΙΒΑΛΟΝΣΟ Πτυχιακή διατριβή ΟΛΟΚΛΗΡΩΜΔΝΗ ΑΠΟΡΡΤΠΑΝΗ ΚΑΤΑΔΡΙΩΝ ΠΛΟΙΩΝ Αργσρώ Ιωάννοσ Λεμεσός 2012 ΣΔΥΝΟΛΟΓΙΚΟ ΠΑΝΔΠΙΣΗΜΙΟ ΚΤΠΡΟΤ

Διαβάστε περισσότερα

Απνηειέζκαηα Εξσηεκαηνινγίνπ 2o ηεηξάκελν 2011-12

Απνηειέζκαηα Εξσηεκαηνινγίνπ 2o ηεηξάκελν 2011-12 Απνηειέζκαηα Εξσηεκαηνινγίνπ 2o ηεηξάκελν 11-12 Project 6: Ταμίδη κε ηε Μεραλή ηνπ Φξόλνπ Υπεύζπλνη Καζεγεηέο: Ε. Μπηιαλάθε Φ. Αλησλάηνο Δρώηηζη 3: Πνηα από ηα παξαθάησ ΜΜΕ ηεξαξρείηε από πιεπξάο ζεκαζίαο;

Διαβάστε περισσότερα

ΘΔΚΑ ΡΖΠ ΑΛΑΓΛΩΟΗΠΖΠ

ΘΔΚΑ ΡΖΠ ΑΛΑΓΛΩΟΗΠΖΠ ΘΔΚΑ ΡΖΠ ΑΛΑΓΛΩΟΗΠΖΠ 1.Απηόο πνπ ζα αλαγλσξηζηεί απνπζηάδεη γηα πνιύ θαηξό. 2.Δπηζηξέθεη κε πιαζηή ηαπηόηεηα ή κεηακνξθσκέλνο. 3.Απνκνλώλνληαη ηα δύν πξόζσπα 4.Άξζε κεηακόξθσζεο 5.Απνθάιπςε 6.Ακθηβνιίεο-απνδεηθηηθά

Διαβάστε περισσότερα

Παιχνίδι γλωζζικής καηανόηζης με ζχήμαηα!

Παιχνίδι γλωζζικής καηανόηζης με ζχήμαηα! Cpyright 2013 Λόγος & Επικοινωνία // All rights Reserved Παιχνίδι γλωζζικής καηανόηζης με ζχήμαηα! Αυηό ηο παιχνίδι έχει ζηόχους: 1. ηελ εθγύκλαζε ηεο αθνπζηηθήο κλήκεο ησλ παηδηώλ 2. ηελ εμάζθεζε ζηελ

Διαβάστε περισσότερα

ΑΓΩΜΘΡΘΙΞΘ ΤΩΠΞΘ ΡΘΡ ΛΘΙΠΕΡ ΗΚΘΙΘΕΡ ΛΘΤΑΗΚΘΔΗΡ Τ.

ΑΓΩΜΘΡΘΙΞΘ ΤΩΠΞΘ ΡΘΡ ΛΘΙΠΕΡ ΗΚΘΙΘΕΡ ΛΘΤΑΗΚΘΔΗΡ Τ. ΑΓΩΜΘΡΘΙΞΘ ΤΩΠΞΘ ΡΘΡ ΛΘΙΠΕΡ ΗΚΘΙΘΕΡ ΟΑIΤΜΘΔΘ ΡΕ ΛΕΓΑΚΞ ΓΗΟΕΔΞ 11V11 ΗΚΘΙΘΑ 6-10 ΤΠΞΜΩΜ ΛΕΘΞΜΕΙΗΛΑΑ ΞΣ ΟΑΘΤΜΘΔΘΞΣ ΡΕ ΛΕΓΑΚΞ ΓΗΟΕΔΞ ΓΘΑ ΟΑΘΙΕΡ ΗΚΘΙΘΑΡ 6-10 ΕΩΜ Η ΔΘΑΔΠΞΛΗ ΑΟΞ Η ΛΘΑ ΕΡΘΑ ΡΗΜ ΑΚΚΗ ΕΘΜΑΘ ΛΕΓΑΚΗ

Διαβάστε περισσότερα

Δξγαιεία Καηαζθεπέο 1 Σάμε Σ Δ.Κ.Φ.Δ. ΥΑΝΙΧΝ ΠΡΧΣΟΒΑΘΜΙΑ ΔΚΠΑΙΓΔΤΗ. ΔΝΟΣΗΣΑ 11 ε : ΦΧ ΔΡΓΑΛΔΙΑ ΚΑΣΑΚΔΤΔ. Καηαζθεπή 1: Φαθόο κε ζσιήλα.

Δξγαιεία Καηαζθεπέο 1 Σάμε Σ Δ.Κ.Φ.Δ. ΥΑΝΙΧΝ ΠΡΧΣΟΒΑΘΜΙΑ ΔΚΠΑΙΓΔΤΗ. ΔΝΟΣΗΣΑ 11 ε : ΦΧ ΔΡΓΑΛΔΙΑ ΚΑΣΑΚΔΤΔ. Καηαζθεπή 1: Φαθόο κε ζσιήλα. Δξγαιεία Καηαζθεπέο 1 Δ.Κ.Φ.Δ. ΥΑΝΙΧΝ ΠΡΧΣΟΒΑΘΜΙΑ ΔΚΠΑΙΓΔΤΗ ΔΝΟΣΗΣΑ 11 ε : ΦΧ ΔΡΓΑΛΔΙΑ ΚΑΣΑΚΔΤΔ Καηαζθεπή 1: Φαθόο κε ζσιήλα Γηαθξάγκαηα Δξγαιεία Καηαζθεπέο 2 Η θαηαζθεπή πεξηγξάθεηαη ζηελ αληίζηνηρε ελόηεηα

Διαβάστε περισσότερα

Κεθάλαιο 1. Ενόηηηα 2 Πλάνο Μάρκεηινγκ. Εξγαιεία Μάξθεηηλγθ. Dr. Andrea Grimm Dr. Astin Malschinger

Κεθάλαιο 1. Ενόηηηα 2 Πλάνο Μάρκεηινγκ. Εξγαιεία Μάξθεηηλγθ. Dr. Andrea Grimm Dr. Astin Malschinger Κεθάλαιο 1 Ενόηηηα 2 Πλάνο Μάρκεηινγκ Εξγαιεία Μάξθεηηλγθ Dr. Andrea Grimm Dr. Astin Malschinger ΠΕΡΙΕΧΟΜΕΝΑ ΕΝΟΤΗΤΑ 2 ΠΛΑΝΟ ΜΑΡΚΕΤΙΝΓΚ Κεθάιαην 1: Εξγαιεία Μάξθεηηλγθ Σπγγξαθείο: Δξ. Andrea Grimm, Δξ.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΔΙΣ ΓΙΚΤΥΑ ΥΠΟΛΟΓΙΣΤΩΝ II ΔΠΑΛ

ΑΠΑΝΤΗΣΔΙΣ ΓΙΚΤΥΑ ΥΠΟΛΟΓΙΣΤΩΝ II ΔΠΑΛ ΑΠΑΝΤΗΣΔΙΣ ΓΙΚΤΥΑ ΥΠΟΛΟΓΙΣΤΩΝ II ΔΠΑΛ ΘΔΜΑ Α Α1. α. Σ β. Σ γ. Λ δ. Λ ε. Λ ζη. Σ Α2. Γ Α3. 1. γ 2. ε 3. δ 4. α Β1. ΘΔΜΑ Β Οη ηειηθνί ππνινγηζηέο παίξλνπλ απνθάζεηο δξνκνιόγεζεο κόλν γηα ηα δηθά ηνπο απηνδύλακα

Διαβάστε περισσότερα

ΑΝΤΗΛΙΑΚΑ. Η Μηκή ζθέθηεθε έλαλ ηξόπν, γηα λα ζπγθξίλεη κεξηθά δηαθνξεηηθά αληειηαθά πξντόληα. Απηή θαη ν Νηίλνο ζπλέιεμαλ ηα αθόινπζα πιηθά:

ΑΝΤΗΛΙΑΚΑ. Η Μηκή ζθέθηεθε έλαλ ηξόπν, γηα λα ζπγθξίλεη κεξηθά δηαθνξεηηθά αληειηαθά πξντόληα. Απηή θαη ν Νηίλνο ζπλέιεμαλ ηα αθόινπζα πιηθά: ΑΝΤΗΛΙΑΚΑ Η Μηκή θαη ν Νηίλνο αλαξσηήζεθαλ πνην αληειηαθό πξντόλ παξέρεη ηελ θαιύηεξε πξνζηαζία ζην δέξκα ηνπο. Τα αληειηαθά πξντόληα έρνπλ έλα δείθηε αληειηαθήο πξνζηαζίαο (SPF), ν νπνίνο δείρλεη πόζν

Διαβάστε περισσότερα

Κόληξα πιαθέ ζαιάζζεο κε δηαζηάζεηο 40Υ40 εθ. Καξθηά 3 θηιά πεξίπνπ κε κήθνο ηξηπιάζην από ην πάρνο ηνπ μύινπ θπξί κεγάιν θαη ππνκνλή

Κόληξα πιαθέ ζαιάζζεο κε δηαζηάζεηο 40Υ40 εθ. Καξθηά 3 θηιά πεξίπνπ κε κήθνο ηξηπιάζην από ην πάρνο ηνπ μύινπ θπξί κεγάιν θαη ππνκνλή Δξγαιεία Καηαζθεπέο 1 Δ.Κ.Φ.Δ. ΥΑΝΙΩΝ ΠΡΩΣΟΒΑΘΜΙΑ ΔΚΠΑΙΓΔΤΗ ΔΝΟΣΗΣΑ 10 ε : ΜΗΥΑΝΙΚΗ ΜΔΡΟ Β ΠΙΔΗ ΔΡΓΑΛΔΙΑ ΚΑΣΑΚΔΤΔ Καηαζθεπή 1: Καξέθια θαθίξε Όξγαλα Τιηθά Κόληξα πιαθέ ζαιάζζεο κε δηαζηάζεηο 40Υ40 εθ.

Διαβάστε περισσότερα

A. Αιιάδνληαο ηε θνξά ηνπ ξεύκαηνο πνπ δηαξξέεη ηνλ αγωγό.

A. Αιιάδνληαο ηε θνξά ηνπ ξεύκαηνο πνπ δηαξξέεη ηνλ αγωγό. ΤΠΟΤΡΓΔΙΟ ΠΑΙΓΔΙΑ ΚΑΙ ΠΟΛΙΣΙΜΟΤ ΛΔΤΚΩΙΑ ΦΤΛΛΟ ΔΡΓΑΙΑ Μειέηε ηωλ παξαγόληωλ από ηνπο νπνίνπο εμαξηάηαη ε ειεθηξνκαγλεηηθή δύλακε. Τιηθά - πζθεπέο: Ηιεθηξνληθή δπγαξηά, ηξνθνδνηηθό ηάζεο, ξννζηάηεο, ακπεξόκεηξν,

Διαβάστε περισσότερα

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου ΥΟΛΕΙΟ..

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου ΥΟΛΕΙΟ.. ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου έλαξμεο 09.30 ιήμεο 09.45 Σην παξαθάησ ζρήκα θαίλεηαη ηκήκα ελόο πνιενδνκηθνύ ζρεδίνπ κηαο πόιεο. Οη ζθηαζκέλεο

Διαβάστε περισσότερα

Constructors and Destructors in C++

Constructors and Destructors in C++ Constructors and Destructors in C++ Σύνθεζη Πνιύ ζπρλά ζηε C++ κία θιάζε κπνξεί λα πεξηέρεη ζαλ κέιεδεδνκέλα αληηθείκελα άιισλ θιάζεσλ. Πνηα είλαη ε ζεηξά κε ηελ νπνία δεκηνπξγνύληαη θαη θαηαζηξέθνληαη

Διαβάστε περισσότερα

Α. Εηζαγσγή ηεο έλλνηαο ηεο ηξηγσλνκεηξηθήο εμίζσζεο κε αξρηθό παξάδεηγκα ηελ εκx = 2

Α. Εηζαγσγή ηεο έλλνηαο ηεο ηξηγσλνκεηξηθήο εμίζσζεο κε αξρηθό παξάδεηγκα ηελ εκx = 2 ΣΡΙΓΩΝΟΜΔΣΡΙΚΔ EΞΙΩΔΙ Πνηα παξαδείγκαηα εμηζώζεσλ ή θαη πξνβιεκάησλ πηζηεύεηαη όηη είλαη θαηάιιεια γηα ηελ επίιπζε ηνπο θαηά ηελ δηάξθεηα ηεο δηδαθηηθήο δηαδηθαζίαο κέζα ζηελ ηάμε; 1 ε ΓΙΓΑΚΣΙΚΗ ΩΡΑ Α.

Διαβάστε περισσότερα

Αζθήζεηο 5 νπ θεθαιαίνπ Crash course Step by step training. Dipl.Biol.cand.med. Stylianos Kalaitzis

Αζθήζεηο 5 νπ θεθαιαίνπ Crash course Step by step training. Dipl.Biol.cand.med. Stylianos Kalaitzis Αζθήζεηο 5 νπ θεθαιαίνπ Crash course Step by step training Dipl.Biol.cand.med. Stylianos Kalaitzis Stylianos Kalaitzis Μνλνϋβξηδηζκνο 1 Γπν γνλείο, εηεξόδπγνη γηα ηνλ αιθηζκό θάλνπλ παηδηά. Πνία ε πηζαλόηεηα

Διαβάστε περισσότερα

Σύνθεζη ηαλανηώζεων. Έζησ έλα ζώκα πνπ εθηειεί ηαπηόρξνλα δύν αξκνληθέο ηαιαληώζεηο ηεο ίδηαο ζπρλόηεηαο πνπ πεξηγξάθνληαη από ηηο παξαθάησ εμηζώζεηο:

Σύνθεζη ηαλανηώζεων. Έζησ έλα ζώκα πνπ εθηειεί ηαπηόρξνλα δύν αξκνληθέο ηαιαληώζεηο ηεο ίδηαο ζπρλόηεηαο πνπ πεξηγξάθνληαη από ηηο παξαθάησ εμηζώζεηο: Σύνθεζη ηαλανηώζεων Α. Σύλζεζε δύν α.α.η ηεο ίδιας ζστνόηηηας Έζησ έλα ζώκα πνπ εθηειεί ηαπηόρξνλα δύν αξκνληθέο ηαιαληώζεηο ηεο ίδηαο ζπρλόηεηαο πνπ πεξηγξάθνληαη από ηηο παξαθάησ εμηζώζεηο: Η απνκάθξπλζε

Διαβάστε περισσότερα

Γηαηάμεηο Αλίρλεπζεο Γηαξξνώλ (λεξνύ θαπζίκωλ ρεκηθώλ )

Γηαηάμεηο Αλίρλεπζεο Γηαξξνώλ (λεξνύ θαπζίκωλ ρεκηθώλ ) Γηαηάμεηο Αλίρλεπζεο Γηαξξνώλ (λεξνύ θαπζίκωλ ρεκηθώλ ) Τν πξόβιεκα - Γηαξξνή λεξνύ Αθόκε θαη κηα κηθξή δηαξξνή λεξνύ κπνξεί λα πξνθαιέζεη θαηαζηξνθή αλ δελ αληρλεπζεί εγθαίξσο Δηαξξνή κπνξεί λα πξνέιζεη

Διαβάστε περισσότερα

Βηνινγία Γεληθήο Παηδείαο Γ Δληαίνπ Λπθείνπ ΑΝΘΡΩΠΟ & ΥΓΕΙΑ ΕΡΩΣΗΕΙ -ΑΠΑΝΣΗΕΙ. Γεκήηξεο παλφο

Βηνινγία Γεληθήο Παηδείαο Γ Δληαίνπ Λπθείνπ ΑΝΘΡΩΠΟ & ΥΓΕΙΑ ΕΡΩΣΗΕΙ -ΑΠΑΝΣΗΕΙ. Γεκήηξεο παλφο Βηνινγία Γεληθήο Παηδείαο Γ Δληαίνπ Λπθείνπ ΑΝΘΡΩΠΟ & ΥΓΕΙΑ ΕΡΩΣΗΕΙ -ΑΠΑΝΣΗΕΙ Γεκήηξεο παλφο 2 ΠΔΡΗΔΥΟΜΔΝΑ 1.1 ΠΑΡΑΓΟΝΣΔ ΠΟΤ ΔΠΖΡΔΑΕΟΤΝ ΣΖΝ ΤΓΔΗΑ ΣΟΤ ΑΝΘΡΩΠΟΤ 4 1.2. ΜΗΚΡΟΟΡΓΑΝΗΜΟΗ 5 1.2.1. ΚΑΣΗΓΟΡΙΔ ΠΑΘΟΓΟΝΩΝ

Διαβάστε περισσότερα

ΠΑΡΑΡΣΗΜΑ Δ. ΔΤΡΔΗ ΣΟΤ ΜΔΣΑΥΗΜΑΣΙΜΟΤ FOURIER ΓΙΑΦΟΡΩΝ ΗΜΑΣΩΝ

ΠΑΡΑΡΣΗΜΑ Δ. ΔΤΡΔΗ ΣΟΤ ΜΔΣΑΥΗΜΑΣΙΜΟΤ FOURIER ΓΙΑΦΟΡΩΝ ΗΜΑΣΩΝ ΠΑΡΑΡΣΗΜΑ Δ. ΔΤΡΔΗ ΣΟΤ ΜΔΣΑΥΗΜΑΣΙΜΟΤ FOURIER ΓΙΑΦΟΡΩΝ ΗΜΑΣΩΝ Εδώ ζα ππνινγίζνπκε ην κεηαζρεκαηηζκό Fourier κεξηθώλ αθόκα ζεκάησλ, πξνζπαζώληαο λα μεθηλήζνπκε από ην κεηαζρεκαηηζκό Fourier γλσζηώλ ζεκάησλ

Διαβάστε περισσότερα

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΤΙΚΗ ΣΚΥΤΑΛΟΓΡΟΜΙΑ 2015 ΓΙΑ ΤΟ ΓΥΜΝΑΣΙΟ Τεηάπηη 28 Ιανουαπίου 2015 ΛΔΥΚΩΣΙΑ Τάξη: Α Γυμναζίου

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΤΙΚΗ ΣΚΥΤΑΛΟΓΡΟΜΙΑ 2015 ΓΙΑ ΤΟ ΓΥΜΝΑΣΙΟ Τεηάπηη 28 Ιανουαπίου 2015 ΛΔΥΚΩΣΙΑ Τάξη: Α Γυμναζίου ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΤΙΚΗ ΣΚΥΤΑΛΟΓΡΟΜΙΑ 2015 ΓΙΑ ΤΟ ΓΥΜΝΑΣΙΟ Τεηάπηη 28 Ιανουαπίου 2015 ΛΔΥΚΩΣΙΑ Τάξη: Α Γυμναζίου ΠΡΟΒΛΗΜΑ Σε έλα ηνπξλνπά βόιετ δήισζαλ ζπκκεηνρή νκάδεο Γπκλαζίσλ ηεο Κύπξνπ.

Διαβάστε περισσότερα

Δπαστηπιότητα 1 - ανάπτςξη, μεταγλώττιση, αποσυαλμάτωση και. εκτέλεση ππογπάμματορ

Δπαστηπιότητα 1 - ανάπτςξη, μεταγλώττιση, αποσυαλμάτωση και. εκτέλεση ππογπάμματορ 1 Δπαστηπιότητα 1 - ανάπτςξη, μεταγλώττιση, αποσυαλμάτωση και εκτέλεση ππογπάμματορ Κάζε πξσί ν Karel μππλάεη ζην θξεβάηη ηνπ όηαλ έλα ξνκπόη-εθεκεξηδνπώιεο ηνπ πεηάεη ηελ εθεκεξίδα, πνπ αλαπαξηζηάλεηαη

Διαβάστε περισσότερα

ΔΠΙΚΣΗΣΗ ΑΝΟΙΑ. Δπίθηεηε αλνζία είλαη ε ηθαλόηεηα ηνπ αλζξώπνπ λα αλαπηύζζεη εηδηθή αληίζηαζε ζε ζπγθεθξηκέλνπο εηζβνιείο

ΔΠΙΚΣΗΣΗ ΑΝΟΙΑ. Δπίθηεηε αλνζία είλαη ε ηθαλόηεηα ηνπ αλζξώπνπ λα αλαπηύζζεη εηδηθή αληίζηαζε ζε ζπγθεθξηκέλνπο εηζβνιείο ΔΠΙΚΣΗΣΗ ΑΝΟΙΑ Δπίθηεηε αλνζία είλαη ε ηθαλόηεηα ηνπ αλζξώπνπ λα αλαπηύζζεη εηδηθή αληίζηαζε ζε ζπγθεθξηκέλνπο εηζβνιείο 1.Υπκηθή αλνζία γηα ηελ νπνία ππεύζπλα είλαη ηα Β-Λεκθνθύηηαξα θαη ηελ 2.Θπηηαξηθή

Διαβάστε περισσότερα

Μονοψϊνιο. Αγνξά κε ιίγνπο αγνξαζηέο. Δύναμη μονοψωνίος Η ηθαλόηεηα πνπ έρεη ν αγνξαζηήο λα επεξεάζεη ηελ ηηκή ηνπ αγαζνύ.

Μονοψϊνιο. Αγνξά κε ιίγνπο αγνξαζηέο. Δύναμη μονοψωνίος Η ηθαλόηεηα πνπ έρεη ν αγνξαζηήο λα επεξεάζεη ηελ ηηκή ηνπ αγαζνύ. Μονοψϊνιο Ολιγοψώνιο Αγνξά κε ιίγνπο αγνξαζηέο. Δύναμη μονοψωνίος Η ηθαλόηεηα πνπ έρεη ν αγνξαζηήο λα επεξεάζεη ηελ ηηκή ηνπ αγαζνύ. Οπιακή αξία Δπηπξόζζεηα νθέιε από ηελ ρξήζε/θαηαλάισζε κηαο επηπξόζζεηε

Διαβάστε περισσότερα

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου ΥΟΛΕΙΟ..

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου ΥΟΛΕΙΟ.. ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου έλαξμεο 09.30 ιήμεο 09.45 Σην παξαθάησ ζρήκα θαίλεηαη ηκήκα ελόο πνιενδνκηθνύ ζρεδίνπ κηαο πόιεο. Οη ζθηαζκέλεο

Διαβάστε περισσότερα

TOOLBOOK (μάθημα 2) Δεκηνπξγία βηβιίνπ θαη ζειίδσλ ΠΡΟΑΡΜΟΓΗ: ΒΑΛΚΑΝΙΩΣΗ ΔΗΜ. ΕΚΠΑΙΔΕΤΣΙΚΟ ΠΕ19 1 TOOLBOOK ΜΑΘΗΜΑ 2

TOOLBOOK (μάθημα 2) Δεκηνπξγία βηβιίνπ θαη ζειίδσλ ΠΡΟΑΡΜΟΓΗ: ΒΑΛΚΑΝΙΩΣΗ ΔΗΜ. ΕΚΠΑΙΔΕΤΣΙΚΟ ΠΕ19 1 TOOLBOOK ΜΑΘΗΜΑ 2 TOOLBOOK (μάθημα 2) Δεκηνπξγία βηβιίνπ θαη ζειίδσλ ΕΚΠΑΙΔΕΤΣΙΚΟ ΠΕ19 1 Δημιουργία σελίδων και βιβλίων Έλα θαηλνύξην βηβιίν πεξηέρεη κία άδεηα ζειίδα κε έλα άδεην background. Δελ κπνξνύκε λα μερσξίζνπκε

Διαβάστε περισσότερα

Οργάνωση και Δομή Παρουσιάσεων

Οργάνωση και Δομή Παρουσιάσεων Οργάνωση και Δομή Παρουσιάσεων Οη παξνπζηάζεηο κε βνήζεηα ηνπ ππνινγηζηή γίλνληαη κε πξνγξάκκαηα παξνπζηάζεσλ, όπσο ην OpenOffice.org Impress [1] θαη ην Microsoft Office PowerPoint [2]. Απηά ηα πξνγξάκκαηα

Διαβάστε περισσότερα

Βάσεις Δεδομέμωμ. Εξγαζηήξην V. Τκήκα Πιεξνθνξηθήο ΑΠΘ 2015-2016

Βάσεις Δεδομέμωμ. Εξγαζηήξην V. Τκήκα Πιεξνθνξηθήο ΑΠΘ 2015-2016 Βάσεις Δεδομέμωμ Εξγαζηήξην V Τκήκα Πιεξνθνξηθήο ΑΠΘ 2015-2016 2 Σκοπός του 5 ου εργαστηρίου Σθνπόο απηνύ ηνπ εξγαζηεξίνπ είλαη: ε κειέηε ζύλζεησλ εξσηεκάησλ ζύλδεζεο ζε δύν ή πεξηζζόηεξεο ζρέζεηο ε κειέηε

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 4 ΣΥΝΔΥΑΣΤΙΚΑ ΚΥΚΛΩΜΑΤΑ

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 4 ΣΥΝΔΥΑΣΤΙΚΑ ΚΥΚΛΩΜΑΤΑ ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 4 ΣΥΝΔΥΑΣΤΙΚΑ ΚΥΚΛΩΜΑΤΑ 1. ρεδίαζε πλδπαζηηθνύ Κπθιώκαηνο Έλα ζπλδπαζηηθό θύθισκα (Κ) έρεη ηξεηο εηζόδνπο A, B θαη C θαη κία έμνδν Y Y=A B+AC Να θαηαζθεπάζεηε ην ράξηε Karnaugh. B 0

Διαβάστε περισσότερα

ΥΡΙΣΟΤΓΔΝΝΙΑΣΙΚΔ ΚΑΣΑΚΔΤΔ

ΥΡΙΣΟΤΓΔΝΝΙΑΣΙΚΔ ΚΑΣΑΚΔΤΔ ΥΡΙΣΟΤΓΔΝΝΙΑΣΙΚΔ ΚΑΣΑΚΔΤΔ 1) Υξηζηνπγελληάηηθα ειαηάθηα θάξηα ή θαδξάθη θάξηα ή θαδξάθη Τιηθά πνπ ζα ρξεηαζηνύκε: Υαξηί θάλζνλ καύξν γηα ην θόλην, πξάζηλν γηα ηα ειαηάθηα, θόθθηλν γηα ηα αζηεξάθηα Απιό

Διαβάστε περισσότερα

Οδηγίες τρήζης για λειηοσργία μεηαθοράς καναλιών ζε υηθιακό δέκηη OST-7060 HD

Οδηγίες τρήζης για λειηοσργία μεηαθοράς καναλιών ζε υηθιακό δέκηη OST-7060 HD Οδηγίες τρήζης για λειηοσργία μεηαθοράς καναλιών ζε υηθιακό δέκηη OST-7060 HD Γηα ηε δηεπθόιπλζή ζαο θαηά ην switch-off ηεο πεξηνρήο ηεο Πεινπνλλήζνπ έρνπκε πξνζζέζεη ζηνπο ςεθηαθνύο καο δέθηεο κία λέα,

Διαβάστε περισσότερα

Δπηιέγνληαο ην «Πξνεπηινγή» θάζε θνξά πνπ ζα ζπλδέεζηε ζηελ εθαξκνγή ζα βξίζθεζηε ζηε λέα ρξήζε.

Δπηιέγνληαο ην «Πξνεπηινγή» θάζε θνξά πνπ ζα ζπλδέεζηε ζηελ εθαξκνγή ζα βξίζθεζηε ζηε λέα ρξήζε. ΑΝΟΙΓΜΑ ΝΔΑ ΥΡΗΗ 1. Γεκηνπξγείηε ηε λέα ρξήζε από ηελ επηινγή «Παξάκεηξνη/Παξάκεηξνη Δηαηξίαο/Γηαρείξηζε Δηαηξηώλ». Πιεθηξνινγείηε ηνλ θσδηθό ηεο εηαηξίαο ζαο θαη παηάηε Enter. Σηελ έλδεημε «Υξήζεηο» παηάηε

Διαβάστε περισσότερα

Case Study. Παξαθάηω παξνπζηάδνπκε βήκα - βήκα κε screenshots έλα παξάδεηγκα ππνβνιήο κηαο εξγαζίαο θαη ηελ παξαγωγή ηνπ Originality Report.

Case Study. Παξαθάηω παξνπζηάδνπκε βήκα - βήκα κε screenshots έλα παξάδεηγκα ππνβνιήο κηαο εξγαζίαο θαη ηελ παξαγωγή ηνπ Originality Report. Case Study Παξαθάηω παξνπζηάδνπκε βήκα - βήκα κε screenshots έλα παξάδεηγκα ππνβνιήο κηαο εξγαζίαο θαη ηελ παξαγωγή ηνπ Originality Report. Βήκα 1 ο : Login ζηο Turnitin. Κάλεηε είζνδν ζην Turnitin κε

Διαβάστε περισσότερα

1 η Εργαζηηριακή Άζκηζη Ειζαγωγή

1 η Εργαζηηριακή Άζκηζη Ειζαγωγή 1 η Εργαζηηριακή Άζκηζη Ειζαγωγή A. Σσζκεσές Εργαζηηρίοσ Ηλεκηρονικής Ο πιηθόο εμνπιηζκόο ηνπ εξγαζηεξίνπ ειεθηξνληθήο πεξηιακβάλεη ηηο αθόινπζεο ζπζθεπέο: 1. Παικνγξάθνπο: Protec 6502 θαη Peak Tech 2020N

Διαβάστε περισσότερα

Απαντήσεις θέματος 2. Παξαθάησ αθνινπζεί αλαιπηηθή επίιπζε ησλ εξσηεκάησλ.

Απαντήσεις θέματος 2. Παξαθάησ αθνινπζεί αλαιπηηθή επίιπζε ησλ εξσηεκάησλ. Απαντήσεις θέματος 2 Απηά πνπ έπξεπε λα γξάςεηε (δελ ρξεηαδόηαλ δηθαηνιόγεζε εθηόο από ην Γ) Α return a*b; Β 0:acegf2, 1: acegf23, 2: acegf234, 3:acegf2345, 4:acegf23456, 5:acegf234567, 6:acegf2345678,

Διαβάστε περισσότερα

Η επιζκόπηζη ηης έμμιζθης ενηολής ζηην Αλλοδαπή. Καηεξίλα Γαιαλνπνύινπ, Intellectual Property Manager, Microsoft Ειιάο Α.Ε.

Η επιζκόπηζη ηης έμμιζθης ενηολής ζηην Αλλοδαπή. Καηεξίλα Γαιαλνπνύινπ, Intellectual Property Manager, Microsoft Ειιάο Α.Ε. Η επιζκόπηζη ηης έμμιζθης ενηολής ζηην Αλλοδαπή Καηεξίλα Γαιαλνπνύινπ, Intellectual Property Manager, Microsoft Ειιάο Α.Ε. Παξάκεηξνη πξνο αμηνιόγεζε Ννκνζεηηθή ζσξάθηζε Κνηλόο Σύιινγνο Ακνηβή Καηαγγειία/Λύζε

Διαβάστε περισσότερα

7. ΚΑΤΑΧΩΡΗΤΕΣ ΕΡΩΤΗΣΕΙΣ ΑΣΚΗΣΕΙΣ. 3. Έλαο θαηαρσξεηήο SISO ησλ 4 bits έρεη: α) Μία είζνδν, β) Δύν εηζόδνπο, γ) Σέζζεξεηο εηζόδνπο.

7. ΚΑΤΑΧΩΡΗΤΕΣ ΕΡΩΤΗΣΕΙΣ ΑΣΚΗΣΕΙΣ. 3. Έλαο θαηαρσξεηήο SISO ησλ 4 bits έρεη: α) Μία είζνδν, β) Δύν εηζόδνπο, γ) Σέζζεξεηο εηζόδνπο. 7. ΚΑΤΑΧΩΡΗΤΕΣ ΕΡΩΤΗΣΕΙΣ ΑΣΚΗΣΕΙΣ 1. Ση είλαη έλαο θαηαρσξεηήο; O θαηαρσξεηήο είλαη κηα νκάδα από flip-flop πνπ κπνξεί λα απνζεθεύζεη πξνζσξηλά ςεθηαθή πιεξνθνξία. Μπνξεί λα δηαηεξήζεη ηα δεδνκέλα ηνπ

Διαβάστε περισσότερα

6 η Εργαζηηριακή Άζκηζη Επαλήθεσζη Λειηοσργίας Βαζικών Φλιπ-Φλοπ

6 η Εργαζηηριακή Άζκηζη Επαλήθεσζη Λειηοσργίας Βαζικών Φλιπ-Φλοπ 6 η Εργαζηηριακή Άζκηζη Επαλήθεσζη Λειηοσργίας Βαζικών Φλιπ-Φλοπ Σηα πιαίζηα ηεο έθηεο εξγαζηεξηαθήο άζθεζεο ζα ρξεζηκνπνηεζεί απνθιεηζηηθά ην πεξηβάιινλ αλάπηπμεο νινθιεξσκέλσλ θπθισκάησλ IDL-800 Digital

Διαβάστε περισσότερα

Φιεγκνλψδεηο ππξνδνηεηέο ζε θιηληθά κνληέια Μειέηε ηνπ ξπζκηζηηθνχ ξφινπ ηεο αλαθπιαηνμίλεο C5a

Φιεγκνλψδεηο ππξνδνηεηέο ζε θιηληθά κνληέια Μειέηε ηνπ ξπζκηζηηθνχ ξφινπ ηεο αλαθπιαηνμίλεο C5a Φιεγκνλψδεηο ππξνδνηεηέο ζε θιηληθά κνληέια Μειέηε ηνπ ξπζκηζηηθνχ ξφινπ ηεο αλαθπιαηνμίλεο C5a Inflammatory mediators in clinical models Σhe regulatory role of C5a anaphylatoxin ΓΗΓΑΚΣΟΡΗΚΖ ΓΗΑΣΡΗΒΖ ΗΩΑΝΝΖ

Διαβάστε περισσότερα

Μορθές Κακόβοσλοσ Κώδικα (Malicious Code)

Μορθές Κακόβοσλοσ Κώδικα (Malicious Code) Μορθές Κακόβοσλοσ Κώδικα (Malicious Code) Page 1 Υποπλοίαρτος Ν. Πεηράκος ΠΝ Αηδένηα Γνύξεηνη Ίππνη (Trojan Horses) Ινί (Viruses) Worms Root-kit Page 2 Γνύξεηνο Ίππνο (Trojan Horse) Οξηζκόο: Πξόγξακκα

Διαβάστε περισσότερα

ΡΤΘΜΙΕΙ ΔΙΚΣΤΟΤ ΣΑ WINDOWS

ΡΤΘΜΙΕΙ ΔΙΚΣΤΟΤ ΣΑ WINDOWS ηότοι εργαζηηρίοσ ΡΤΘΜΙΕΙ ΔΙΚΣΤΟΤ ΣΑ WINDOWS ην πιαίζην ηνπ ζπγθεθξηκέλνπ εξγαζηεξίνπ ζα παξνπζηαζηεί ε δηαδηθαζία ηωλ ξπζκίζεωλ δηθηύνπ ζε ιεηηνπξγηθό ζύζηεκα Windows XP. Η δηαδηθαζία ζε γεληθέο γξακκέο

Διαβάστε περισσότερα

ΠΕΤΡΕΛΑΙΟ ΧΑΡΑΛΑΜΠΟΤ ΜΑΡΙΑ ΣΖΑΜΟΤΡΑΝΗ ΕΛΕΝΗ ΟΤΣΖΙΟΤ ΑΤΓΕΡΙΝΗ ΧΑΙΔΕΜΕΝΑΚΗ ΝΑΣΑΛΙΑ

ΠΕΤΡΕΛΑΙΟ ΧΑΡΑΛΑΜΠΟΤ ΜΑΡΙΑ ΣΖΑΜΟΤΡΑΝΗ ΕΛΕΝΗ ΟΤΣΖΙΟΤ ΑΤΓΕΡΙΝΗ ΧΑΙΔΕΜΕΝΑΚΗ ΝΑΣΑΛΙΑ 1 ΠΕΤΡΕΛΑΙΟ ΧΑΡΑΛΑΜΠΟΤ ΜΑΡΙΑ ΣΖΑΜΟΤΡΑΝΗ ΕΛΕΝΗ ΟΤΣΖΙΟΤ ΑΤΓΕΡΙΝΗ ΧΑΙΔΕΜΕΝΑΚΗ ΝΑΣΑΛΙΑ ΝΟΗΠΚΝΠ 2 Τν πεηξέιαην, πνπ κεξηθέο θνξέο ζηελ θαζεκεξηλή γιώζζα απνθαιείηαη θαη μαύπορ σπςσόρ ή τσάι τος Ρέξαρ, είλαη

Διαβάστε περισσότερα

iii. iv. γηα ηελ νπνία ηζρύνπλ: f (1) 2 θαη

iii. iv. γηα ηελ νπνία ηζρύνπλ: f (1) 2 θαη ΔΠΑΝΑΛΗΠΣΙΚΑ ΘΔΜΑΣΑ ΣΟ ΓΙΑΦΟΡΙΚΟ ΛΟΓΙΜΟ Μάρτιος 0 ΘΔΜΑ Να ππνινγίζεηε ηα όξηα: i ii lim 0 0 lim iii iv lim e 0 lim e 0 ΘΔΜΑ Γίλεηαη ε άξηηα ζπλάξηεζε '( ) ( ) γηα θάζε 0 * : R R γηα ηελ νπνία ηζρύνπλ:

Διαβάστε περισσότερα

B-Δέλδξα. Τα B-δέλδξα ρξεζηκνπνηνύληαη γηα ηε αλαπαξάζηαζε πνιύ κεγάισλ ιεμηθώλ πνπ είλαη απνζεθεπκέλα ζην δίζθν.

B-Δέλδξα. Τα B-δέλδξα ρξεζηκνπνηνύληαη γηα ηε αλαπαξάζηαζε πνιύ κεγάισλ ιεμηθώλ πνπ είλαη απνζεθεπκέλα ζην δίζθν. B-Δέλδξα Τα B-δέλδξα ρξεζηκνπνηνύληαη γηα ηε αλαπαξάζηαζε πνιύ κεγάισλ ιεμηθώλ πνπ είλαη απνζεθεπκέλα ζην δίζθν. Δέλδξα AVL n = 2 30 = 10 9 (πεξίπνπ). 30

Διαβάστε περισσότερα

ΠΟΛΤΜΕΡΙΜΟ - ΠΕΣΡΟΥΗΜΙΚΑ

ΠΟΛΤΜΕΡΙΜΟ - ΠΕΣΡΟΥΗΜΙΚΑ ΠΟΛΤΜΕΡΙΜΟ - ΠΕΣΡΟΥΗΜΙΚΑ ΠΑΡΑΔΕΙΓΜΑΣΑ Ο πολσμεριζμός Πολσμεριζμός είναι η τημική ανηίδραζη καηά ηην οποία πολλά μόρια ίδιων ή διαθορεηικών οργανικών ενώζεων, ποσ ονομάζονηαι μονομερή, ενώνονηαι και ζτημαηίζοσν

Διαβάστε περισσότερα

Δξγαιεία Καηαζθεπέο 1 Σάμε Δ Δ.Κ.Φ.Δ. ΥΑΝΗΩΝ ΠΡΩΣΟΒΑΘΜΗΑ ΔΚΠΑΗΓΔΤΖ. ΔΝΟΣΖΣΑ 2 ε : ΤΛΗΚΑ ΩΜΑΣΑ ΔΡΓΑΛΔΗΑ ΚΑΣΑΚΔΤΔ. Καηαζθεπή 1: Ογθνκεηξηθό δνρείν

Δξγαιεία Καηαζθεπέο 1 Σάμε Δ Δ.Κ.Φ.Δ. ΥΑΝΗΩΝ ΠΡΩΣΟΒΑΘΜΗΑ ΔΚΠΑΗΓΔΤΖ. ΔΝΟΣΖΣΑ 2 ε : ΤΛΗΚΑ ΩΜΑΣΑ ΔΡΓΑΛΔΗΑ ΚΑΣΑΚΔΤΔ. Καηαζθεπή 1: Ογθνκεηξηθό δνρείν Δξγαιεία Καηαζθεπέο 1 Δ.Κ.Φ.Δ. ΥΑΝΗΩΝ ΠΡΩΣΟΒΑΘΜΗΑ ΔΚΠΑΗΓΔΤΖ ΔΝΟΣΖΣΑ 2 ε : ΤΛΗΚΑ ΩΜΑΣΑ ΔΡΓΑΛΔΗΑ ΚΑΣΑΚΔΤΔ Καηαζθεπή 1: Ογθνκεηξηθό δνρείν Καηαζθεπάδνπκε έλα νγθνκεηξηθό δνρείν από πιαζηηθό κπνπθάιη λεξνύ

Διαβάστε περισσότερα

Πολυεπίπεδα/Διασυμδεδεμέμα Δίκτυα

Πολυεπίπεδα/Διασυμδεδεμέμα Δίκτυα Πολυεπίπεδα/Διασυμδεδεμέμα Δίκτυα Κοιμωμικά δίκτυα (multiplex network) Έρεηε ινγαξηαζκό ζην Facebook? Έρεηε ινγαξηαζκό ζην LinkedIn? Έρεηε ινγαξηαζκό ζην Twitter? Αεροπορικές γραμμές της Ευρώπης(multiplex

Διαβάστε περισσότερα

ΥΔΣΙΚΟΣΗΣΑ Μεηαζρεκαηηζκνί Γαιηιαίνπ. (Κιαζηθή ζεώξεζε) v t. αθνύ ζύκθσλα κε ηα πεηξάκαηα Mickelson-Morley είλαη c =c.

ΥΔΣΙΚΟΣΗΣΑ Μεηαζρεκαηηζκνί Γαιηιαίνπ. (Κιαζηθή ζεώξεζε) v t. αθνύ ζύκθσλα κε ηα πεηξάκαηα Mickelson-Morley είλαη c =c. ΥΔΣΙΚΟΣΗΣΑ Μεηαζρεκαηηζκνί Γαιηιαίνπ. (Κιαζηθή ζεώξεζε) y y z z t t Σν νπνίν νδεγεί ζην όηη = - π.(άηνπν), αθνύ ζύκθσλα κε ηα πεηξάκαηα Mikelson-Morley είλαη =. Δπίζεο y = y, z = z, t = t Σν νπνίν ( t

Διαβάστε περισσότερα

ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ

ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ ΜΑΘΗΜΑ : ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ Α/Α : 0_1382/153 1. Καη όηαλ έγηλε ε ππνρώξεζε αξγά ην απόγεπκα, επεηδή θνβήζεθαλ νη νιηγαξρηθνί κήπσο νη δεκνθξαηηθνί, αθνύ θάλνπλ επίζεζε, θαηαιάβνπλ

Διαβάστε περισσότερα

Σπληήξεζε ηξνθίκσλ ρσξίο ρεκηθά πξόζζεηα PROJECT B ΛΥΚΕΙΟΥ 2 014-15

Σπληήξεζε ηξνθίκσλ ρσξίο ρεκηθά πξόζζεηα PROJECT B ΛΥΚΕΙΟΥ 2 014-15 Σπληήξεζε ηξνθίκσλ ρσξίο ρεκηθά πξόζζεηα PROJECT B ΛΥΚΕΙΟΥ 2 014-15 Εηζαγσγή Οη ηερληθέο ζπληήξεζεο ηξνθίκσλ έρνπλ ζθνπό : α) λα παξεκπνδίζνπλ αλεπηζύκεηεο κεηαβνιέο ζηα ραξαθηεξηζηηθά (γεύζε - ρξώκα -

Διαβάστε περισσότερα

ΑΞΙΟΘΕΑΣΑ ΣΟΤ ΥΩΡΙΟΤ ΜΑ

ΑΞΙΟΘΕΑΣΑ ΣΟΤ ΥΩΡΙΟΤ ΜΑ ΑΞΙΟΘΕΑΣΑ ΣΟΤ ΥΩΡΙΟΤ ΜΑ α. Η ΕΚΚΛΗΙΑ ΣΟΤ ΥΩΡΙΟΤ ΜΑ β. ΣΟ ΠΝΕΤΜΑΣΙΚΟ ΜΑ ΚΕΝΣΡΟ γ. Η ΠΑΝΟΡΑΜΙΚΗ ΘΕΗ ΣΟΤ ΥΩΡΙΟΤ ΜΑ α. Η ΕΚΚΛΗΙΑ ΣΟΤ ΥΩΡΙΟΤ ΜΑ. Η Εθθιεζία ηνπ ρσξηνύ καο, ε Αγία Άλλα, είλαη θηηζκέλε πξηλ πνιιά

Διαβάστε περισσότερα

Πως να δημιουργήσετε ένα Cross-Over καλώδιο

Πως να δημιουργήσετε ένα Cross-Over καλώδιο Πως να δημιουργήσετε ένα Cross-Over καλώδιο Τν crossover καλώδιο ρξεζηκνπνηείηαη γηα λα ζπλδεζνύλ δπν ππνινγηζηέο κεηαμύ ηνπο θαη αλ θηηάμνπλ έλα κηθξό ηνπηθό δίθηπν(lan). Έλα LAN κπνξεί λα είλαη ηόζν

Διαβάστε περισσότερα

Τηλζφωνο: 99543321 Ε-mail: savvas_email@yahoo.com Ώρες διδασκαλίας: 16:00 19:15 μμ

Τηλζφωνο: 99543321 Ε-mail: savvas_email@yahoo.com Ώρες διδασκαλίας: 16:00 19:15 μμ ΠΑΙΓΑΓΩΓΙΚΟ ΙΝΣΙΣΟΤΣΟ ΚΤΠΡΟΤ Πξόγξακκα Δπηκόξθσζεο Τπνςεθίσλ Καζεγεηώλ Σερλνινγίαο Γελάξεο 2011 ΗΛΔΚΣΡΟΝΙΚΑ Ι (Ύιε Γπκλαζίνπ) Διδάσκων: Σαββίδης Σάββας Τηλζφωνο: 99543321 Ε-mail: savvas_email@yahoo.com

Διαβάστε περισσότερα

Λεκηική έκθραζη, κριηική, οικειόηηηα και ηύπος δεζμού ζηις ζηενές διαπροζωπικές ζτέζεις

Λεκηική έκθραζη, κριηική, οικειόηηηα και ηύπος δεζμού ζηις ζηενές διαπροζωπικές ζτέζεις Λεκηική έκθραζη, κριηική, οικειόηηηα και ηύπος δεζμού ζηις ζηενές διαπροζωπικές ζτέζεις Μαξία-Ησάλλα Αξγπξνπνύινπ Βαζίιεο Παπιόπνπινο Τνκέαο Ψπρνινγίαο, Παλεπηζηήκην Αζελώλ Αλαθνίλσζε ζην 5 ν Παλειιήλην

Διαβάστε περισσότερα

5 η Δργαζηηριακή Άζκηζη Κσκλώμαηα Γσαδικού Αθροιζηή/Αθαιρέηη

5 η Δργαζηηριακή Άζκηζη Κσκλώμαηα Γσαδικού Αθροιζηή/Αθαιρέηη 5 η Δργαζηηριακή Άζκηζη Κσκλώμαηα Γσαδικού Αθροιζηή/Αθαιρέηη Σηα πιαίζηα ηεο πέκπηεο εξγαζηεξηαθήο άζθεζεο ζα ρξεζηκνπνηεζεί απνθιεηζηηθά ην πεξηβάιινλ αλάπηπμεο νινθιεξσκέλσλ θπθισκάησλ IDL-800 Digital

Διαβάστε περισσότερα

ΜΑΘΗΜΑΣΑ ΦΩΣΟΓΡΑΦΙΑ. Ειζαγωγή ζηη Φωηογραθία. Χριζηάκης Σαζεΐδης EFIAP

ΜΑΘΗΜΑΣΑ ΦΩΣΟΓΡΑΦΙΑ. Ειζαγωγή ζηη Φωηογραθία. Χριζηάκης Σαζεΐδης EFIAP ΜΑΘΗΜΑΣΑ ΦΩΣΟΓΡΑΦΙΑ Ειζαγωγή ζηη Φωηογραθία Χριζηάκης Σαζεΐδης EFIAP 1 ΜΑΘΗΜΑ 6 ο Προγράμμαηα θωηογραθικών μηχανών Επιλογέας προγραμμάηων Μαο δίλεη ηε δπλαηόηεηα λα ειέγμνπκε ην άλνηγκα δηαθξάγκαηνο θαη

Διαβάστε περισσότερα

Τάπηα με ππάζo, bacon και θέηα by Madame Ginger

Τάπηα με ππάζo, bacon και θέηα by Madame Ginger Τάπηα με ππάζo, bacon και θέηα by Madame Ginger 1 θύιιν ζθνιηάηαο 2 πξάζα 150 γξ. bacon 150 γξ. θέηα ΓΧΓΧΝΗ 100 γξ. γξαβηέξα ΓΧΓΧΝΗ 1 θ.ζ. ειαηόιαδν Κόβνπκε ηα πξάζα ζε ιεπηέο ξνδέιεο. Κόβνπκε ην bacon

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΗΛΕΚΤΡΟΛΟΓΙΑ/Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 08/09/2014

ΜΑΘΗΜΑ / ΤΑΞΗ : ΗΛΕΚΤΡΟΛΟΓΙΑ/Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 08/09/2014 ΔΙΑΓΩΝΙΣΜΑ ΕΚΠ. ΕΤΟΥΣ 204-205 ΜΑΘΗΜΑ / ΤΑΞΗ : ΗΛΕΚΤΡΟΛΟΓΙΑ/Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 08/09/204 A ΟΜΑΓΑ Οδηγία: Να γράυεηε ζηο ηεηράδιο ζας ηον αριθμό κάθε μιας από ηις παρακάηφ ερφηήζεις Α.-Α.8 και

Διαβάστε περισσότερα

ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ

ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ Α/Α : 0_1379/50 1. Όηαλ ινηπόλ ήξζαλ [νη πξέζβεηο ζηελ Αζήλα], αθνύ ζπλέιαβαλ νη Αζελαίνη θαη ηνπο πξέζβεηο σο ππνθηλεηέο ζηάζεο θαη όζνπο έπεηζαλ [νη πξέζβεηο], ηνπο ζπγθέληξσζαλ γηα αζθάιεηα ζηελ Αίγηλα.

Διαβάστε περισσότερα

ΠΡΩΣΟΚΟΛΛΑ ΓΙΑΥΔΙΡΗΗ ΣΩΝ ΣΔΡΗΓΟΝΙΚΩΝ ΒΛΑΒΩΝ Δ ΔΝΗΛΙΚΔ

ΠΡΩΣΟΚΟΛΛΑ ΓΙΑΥΔΙΡΗΗ ΣΩΝ ΣΔΡΗΓΟΝΙΚΩΝ ΒΛΑΒΩΝ Δ ΔΝΗΛΙΚΔ ΠΡΩΣΟΚΟΛΛΑ ΓΙΑΥΔΙΡΗΗ ΣΩΝ ΣΔΡΗΓΟΝΙΚΩΝ ΒΛΑΒΩΝ Δ ΔΝΗΛΙΚΔ Σν ζύγρξνλν πξόηππν αληηκεηώπηζεο ηεο ηεξεδόλαο ελειίθσλ δελ εζηηάδεηαη κόλν ζηελ απνθαηάζηαζε ησλ ηεξεδνληθώλ βιαβώλ πνπ έρνπλ εθδεισζεί, αιιά έρεη

Διαβάστε περισσότερα

ΠΑΡΔΜΒΑΔΙ ΔΤΑΙΘΗΣΟΠΟΙΗΗ ΚΑΙ ΠΡΟΛΗΨΗ ΓΙΑ ΣΟΝ HIV/AIDS ΣΗΝ ΑΚΣΟΓΡΑΜΜΗ ΣΩΝ ΠΔΡΙΦΔΡΔΙΑΚΩΝ ΔΝΟΣΗΣΩΝ ΣΗ ΚΔΝΣΡΙΚΗ ΜΑΚΔΓΟΝΙΑ ΑΤΓΟΤΣΟ 2014

ΠΑΡΔΜΒΑΔΙ ΔΤΑΙΘΗΣΟΠΟΙΗΗ ΚΑΙ ΠΡΟΛΗΨΗ ΓΙΑ ΣΟΝ HIV/AIDS ΣΗΝ ΑΚΣΟΓΡΑΜΜΗ ΣΩΝ ΠΔΡΙΦΔΡΔΙΑΚΩΝ ΔΝΟΣΗΣΩΝ ΣΗ ΚΔΝΣΡΙΚΗ ΜΑΚΔΓΟΝΙΑ ΑΤΓΟΤΣΟ 2014 ΠΑΡΔΜΒΑΔΙ ΔΤΑΙΘΗΣΟΠΟΙΗΗ ΚΑΙ ΠΡΟΛΗΨΗ ΓΙΑ ΣΟΝ HIV/AIDS ΣΗΝ ΑΚΣΟΓΡΑΜΜΗ ΣΩΝ ΠΔΡΙΦΔΡΔΙΑΚΩΝ ΔΝΟΣΗΣΩΝ ΣΗ ΚΔΝΣΡΙΚΗ ΜΑΚΔΓΟΝΙΑ ΑΤΓΟΤΣΟ 2014 Σν ΚΔ.ΔΛ.Π.ΝΟ., Γξαθείν Θεζζαινλίθεο θαη ε Γηεύζπλζε Γεκόζηαο Τγείαο ηεο

Διαβάστε περισσότερα

Βηνινγία Γεληθήο Παηδείαο Γ Δληαίνπ Λπθείνπ ΑΝΘΡΩΠΟ & ΤΓΕΙΑ. Γεκήηξεο παλφο

Βηνινγία Γεληθήο Παηδείαο Γ Δληαίνπ Λπθείνπ ΑΝΘΡΩΠΟ & ΤΓΕΙΑ. Γεκήηξεο παλφο Βηνινγία Γεληθήο Παηδείαο Γ Δληαίνπ Λπθείνπ ΑΝΘΡΩΠΟ & ΤΓΕΙΑ Γεκήηξεο παλφο ΑΝΘΡΩΠΟ ΚΑΙ ΤΓΔΙΑ - 2 - ΠΔΡΗΔΥΟΜΔΝΑ ΠΑΡΑΓΟΝΣΔ ΠΟΤ ΔΠΖΡΔΑΕΟΤΝ ΣΖΝ ΤΓΔΗΑ ΣΟΤ ΑΝΘΡΩΠΟΤ... - 4 - ΜΗΚΡΟΟΡΓΑΝΗΜΟΗ... - 5 - ΚΑΣΖΓΟΡΗΔ

Διαβάστε περισσότερα

ΜΕΛΕΣΗ E.O.K. ΜΕ ΑΙΘΗΣΗΡΑ ΘΕΗ

ΜΕΛΕΣΗ E.O.K. ΜΕ ΑΙΘΗΣΗΡΑ ΘΕΗ ΜΕΛΕΣΗ E.O.K. ΜΕ ΑΙΘΗΣΗΡΑ ΘΕΗ ΦΤΛΛΟ ΕΡΓΑΙΑ (Θεοδώρα Γιώηη, Νικόλας Καραηάζιος- Τπεύθσνη εκ/κος Λ. Παπαηζίμπα) ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ:.., ΗΜΕΡΟΜΗΝΙΑ:.// Σε ακαμίδην πνπ κπνξεί λα θηλείηαη ρσξίο ηξηβέο πάλσ

Διαβάστε περισσότερα

ΣΟ ΤΣΖΜΑ ΔΛΑΣΖΡΗΟ - ΩΜΑ

ΣΟ ΤΣΖΜΑ ΔΛΑΣΖΡΗΟ - ΩΜΑ ΣΟ ΤΣΖΜΑ ΔΛΑΣΖΡΗΟ - ΩΜΑ Σε όια ηα πξνβιήκαηα πνπ ζα αληηκεηωπίζνπκε, ην ειαηήξην ζα είλαη αβαξέο θαη ζα ηθαλνπνηεί ην λόκν ηνπ Hooke (ηδαληθό ειαηήξην), δειαδή ε δύλακε πνπ αζθεί έλα ηδαληθό ειαηήξην έρεη

Διαβάστε περισσότερα

Διαηιμήζεις για Αιολικά Πάρκα. Κώδικες 28, 78 και 84

Διαηιμήζεις για Αιολικά Πάρκα. Κώδικες 28, 78 και 84 Διαηιμήζεις για Αιολικά Πάρκα Κώδικες 28, 78 και 84 Διαηιμήζεις για Αιολικά Πάρκα Οη Διαηιμήζεις για Αιολικά Πάρκα εθαξκόδνληαη γηα ηελ απνξξνθνύκελε ελέξγεηα από Αηνιηθά Πάξθα πνπ είλαη ζπλδεδεκέλα ζην

Διαβάστε περισσότερα

ΓΔΧΜΔΣΡΙΑ ΓΙΑ ΟΛΤΜΠΙΑΓΔ

ΓΔΧΜΔΣΡΙΑ ΓΙΑ ΟΛΤΜΠΙΑΓΔ ΒΑΓΓΔΛΗ ΦΤΥΑ 2009 ελίδα 2 από 9 ΔΤΘΔΙΔ SIMSON 1 ΒΑΙΚΔ ΠΡΟΣΑΔΙ 1.1 ΔΤΘΔΙΑ SIMSON Γίλεηαη ηξίγσλν AB θαη ηπρόλ ζεκείν ηνπ πεξηγεγξακκέλνπ θύθινπ ηνπ. Αλ 1, 1 θαη 1 είλαη νη πξνβνιέο ηνπ ζηηο επζείεο πνπ

Διαβάστε περισσότερα

Διάλεξη 2 Εηζαγωγή ζηελ Επεμεξγαζία Υγξώλ Απνβιήηωλ Σηάδηα Επεμεξγαζίαο

Διάλεξη 2 Εηζαγωγή ζηελ Επεμεξγαζία Υγξώλ Απνβιήηωλ Σηάδηα Επεμεξγαζίαο Διάλεξη 2 Εηζαγωγή ζηελ Επεμεξγαζία Υγξώλ Απνβιήηωλ Σηάδηα Επεμεξγαζίαο Σηάδηα επεμεξγαζίαο πγξψλ απνβιήησλ Πξσηνβάζκηα ή Μεραληθή Δπεμεξγαζία Γεπηεξνβάζκηα ή Βηνινγηθή Δπεμεξγαζία Τξηηνβάζκηα ή Χεκηθή

Διαβάστε περισσότερα

Αντισταθμιστική ανάλυση

Αντισταθμιστική ανάλυση Θεσξήζηε έλαλ αιγόξηζκν Α πνπ ρξεζηκνπνηεί κηα δνκή δεδνκέλσλ Γ : Καηά ηε δηάξθεηα εθηέιεζεο ηνπ Α ε Γ πξαγκαηνπνηεί κία αθνινπζία από πξάμεηο. Παξάδεηγκα: Θπκεζείηε ην πξόβιεκα ηεο εύξεζεο-έλσζεο Δίρακε

Διαβάστε περισσότερα

ΞΟΝΠΔΓΓΗΕΥ ΡΝ ΞΑΗΓΗ ΓΗΑ ΡΝ ΞΔΛΘΝΠ. ΝΗ ΓΗΔΟΓΑΠΗΔΠ ΡΝ ΞΔΛΘΝΠ.

ΞΟΝΠΔΓΓΗΕΥ ΡΝ ΞΑΗΓΗ ΓΗΑ ΡΝ ΞΔΛΘΝΠ. ΝΗ ΓΗΔΟΓΑΠΗΔΠ ΡΝ ΞΔΛΘΝΠ. ΞΟΝΠΔΓΓΗΕΥ ΡΝ ΞΑΗΓΗ ΓΗΑ ΡΝ ΞΔΛΘΝΠ. ΝΗ ΓΗΔΟΓΑΠΗΔΠ ΡΝ ΞΔΛΘΝΠ. ΓΑΘΡΙΑ Π. 1,2, ΓΑΘΡΙΑΠ Θ. 1, ΚΖΡΠΗΝ- ΓΑΘΡΙΑ Γ. 1,3,4, ΘΑΡΠΗΑΟΓΑΛΖΠ Ι. 1,5, Α ΛΑΠΡΑΠΗΝ Α. 1,4,6, ΛΗΘΝΙΑΝΠ ΠΘΔΛΡΔΟΖΠ 6. 1. Δ Ρ Α Η Ο Δ Η Α Φ Ο

Διαβάστε περισσότερα

ΑΠΛΟΠΟΙΗΗ ΛΟΓΙΚΩΝ ΤΝΑΡΣΗΕΩΝ ΜΕ ΠΙΝΑΚΕ KARNAUGH

ΑΠΛΟΠΟΙΗΗ ΛΟΓΙΚΩΝ ΤΝΑΡΣΗΕΩΝ ΜΕ ΠΙΝΑΚΕ KARNAUGH ΑΠΛΟΠΟΙΗΗ ΛΟΓΙΚΩΝ ΤΝΑΡΣΗΕΩΝ ΜΕ ΠΙΝΑΚΕ KRNUGH Γηα λα θάλνπκε απινπνίεζε κηαο ινγηθήο ζπλάξηεζεο κε πίλαθα (ή ράξηε) Karnaugh αθνινπζνύκε ηα παξαθάησ βήκαηα:. Η ινγηθή ζπλάξηεζε ζα πξέπεη λα είλαη ζε πιήξε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΔΝΙΚΗΣ ΠΑΙΓΔΙΑΣ

ΒΙΟΛΟΓΙΑ ΓΔΝΙΚΗΣ ΠΑΙΓΔΙΑΣ 1 ΘΔΜΑ Α ΒΙΟΛΟΓΙΑ ΓΔΝΙΚΗΣ ΠΑΙΓΔΙΑΣ Να γπάτεηε ζηο ηεηπάδιό ζαρ ηον απιθμό καθεμιάρ από ηιρ παπακάηυ ημιηελείρ πποηάζειρ Α1 υρ Α5 και δίπλα ηο γπάμμα πος ανηιζηοισεί ζηη λέξη ή ηη θπάζη, πος ζςμπληπώνει

Διαβάστε περισσότερα

Η. ΣΟΗΥΔΗΑ ΠΟΤ ΓΗΑΣΖΡΟΤΝΣΑΗ

Η. ΣΟΗΥΔΗΑ ΠΟΤ ΓΗΑΣΖΡΟΤΝΣΑΗ Αγαπεηέ αξρεγέ, Τν λέν ζύζηεκα ησλ playoff πνπ πηινηηθά ζα εθαξκνζηεί ζηε θεηηλή πεξίνδν 2013 14 απνηειεί κηα βειηίσζε ηνπ πθηζηάκελνπ ζπζηήκαηνο πνπ κε επηηπρία εθαξκόζηεθε ζηηο πξώηεο έμη δηνξγαλώζεηο

Διαβάστε περισσότερα

Άζκηζη ζτέζης κόζηοσς-τρόνοσ (Cost Time trade off) Καηαζκεσαζηική ΑΔ

Άζκηζη ζτέζης κόζηοσς-τρόνοσ (Cost Time trade off) Καηαζκεσαζηική ΑΔ Άζκηζη ζτέζης κόζηοσς-τρόνοσ (Cost Time trade off) Καηαζκεσαζηική Δίζηε μησανικόρ διοίκηζηρ μεγάληρ καηαζκεςαζηικήρ εηαιπείαρ και καλείζηε να ςλοποιήζεηε ηο έπγο πος πεπιγπάθεηαι από ηον Πίνακα 1. Κωδ.

Διαβάστε περισσότερα

Βιομησανικόρ ζσεδιαζμόρ πποϊόνηων από ανακςκλωμένερ ζςζκεςαζίερ

Βιομησανικόρ ζσεδιαζμόρ πποϊόνηων από ανακςκλωμένερ ζςζκεςαζίερ Βιομησανικόρ ζσεδιαζμόρ πποϊόνηων από ανακςκλωμένερ ζςζκεςαζίερ ΤΕΙ Δσηικής Μακεδονίας Τμήμα Βιομητανικού Στεδιαζμού Εργαζηήριο C 3 www.c3.teiwm.gr C 3 LAB www.c3.teiwm.gr 1 Εηζαγσγή Πεπιεσόμενα ύκβνια

Διαβάστε περισσότερα

Ζ ύιε εκθαλίδεηαη ζε ηξεηο θαηαζηάζεηο: ζηελ ζηεξεή, ζηελ πγξή θαη ζηελ αέξηα.

Ζ ύιε εκθαλίδεηαη ζε ηξεηο θαηαζηάζεηο: ζηελ ζηεξεή, ζηελ πγξή θαη ζηελ αέξηα. Καηαζηάζεηο ηεο ύιεο 1 ΔΚΦΔ ΥΑΝΗΧΝ ΠΡΧΣΟΒΑΘΜΗΑ ΔΚΠΑΗΓΔΤΖ ΟΗ ΦΤΗΚΔ ΔΠΗΣΖΜΔ ΣΖΝ ΠΡΟΥΟΛΗΚΖ ΑΓΧΓΖ ΔΝΟΣΖΣΑ 1: ΔΗΑΓΧΓΖ ΚΔΦΑΛΑΗΟ 4: ΚΑΣΑΣΑΔΗ ΣΖ ΤΛΖ ΚΑΣΑΣΑΔΗ ΣΖ ΤΛΖ Ζ ύιε εκθαλίδεηαη ζε ηξεηο θαηαζηάζεηο: ζηελ

Διαβάστε περισσότερα

Ο ΔΡΟΜΟ ΠΡΟ ΣΟ «ΑΕΙΦΟΡΟ ΧΟΛΕΙΟ» ένα φωτογπαφικό ταξίδι

Ο ΔΡΟΜΟ ΠΡΟ ΣΟ «ΑΕΙΦΟΡΟ ΧΟΛΕΙΟ» ένα φωτογπαφικό ταξίδι Ο ΔΡΟΜΟ ΠΡΟ ΣΟ «ΑΕΙΦΟΡΟ ΧΟΛΕΙΟ» ένα φωτογπαφικό ταξίδι ηα Δθπαηδεπηήξηα Πάλνπ ππνζηεξίδνπκε ηελ άπνςε όηη ην «αεηθόξν ζρνιείν» είλαη έλα όξακα εθηθηό. Η εθπαίδεπζε γηα ηελ αεηθνξία δελ είλαη κάζεκα, αιιά

Διαβάστε περισσότερα

Σ Δ Υ Ν Ι Κ Η Δ Κ Θ Δ Η Π Ρ Ο Μ Η Θ Δ Ι Α Ο Ι Κ Ο Γ Ο Μ Ι Κ Ω Ν Τ Λ Ι Κ Ω Ν Γ Η Μ Ο Τ Β Ο Λ Β Η

Σ Δ Υ Ν Ι Κ Η Δ Κ Θ Δ Η Π Ρ Ο Μ Η Θ Δ Ι Α Ο Ι Κ Ο Γ Ο Μ Ι Κ Ω Ν Τ Λ Ι Κ Ω Ν Γ Η Μ Ο Τ Β Ο Λ Β Η Σ Δ Υ Ν Ι Κ Η Δ Κ Θ Δ Η Π Ρ Ο Μ Η Θ Δ Ι Α Ο Ι Κ Ο Γ Ο Μ Ι Κ Ω Ν Τ Λ Ι Κ Ω Ν Γ Η Μ Ο Τ Β Ο Λ Β Η ΠΔΡΙΔΥΟΜΔΝΑ 1. Τερληθή Έθζεζε 2. Δλδεηθηηθφο Πξνυπνινγηζκφο 3. Έληππν νηθνλνκηθήο πξνζθνξάο ΘΔΜΑ : Πξνκήζεηα

Διαβάστε περισσότερα

ΑΣΚΗΣΔΙΣ ΦΥΣΙΚΗΣ ΚΑΤΑΣΤΑΣΗΣ ΣΤΟ ΓΗΠΔΓΟ

ΑΣΚΗΣΔΙΣ ΦΥΣΙΚΗΣ ΚΑΤΑΣΤΑΣΗΣ ΣΤΟ ΓΗΠΔΓΟ Α. Αεπόβια ικανόηηηα: ΑΣΚΗΣΔΙΣ ΦΥΣΙΚΗΣ ΚΑΤΑΣΤΑΣΗΣ ΣΤΟ ΓΗΠΔΓΟ 1. Φόλλοος ζηα δύο καλάθια: νη αζιεηέο είλαη απέλαληη από ηα ηακπιώ ζε δπν γξακκέο. Οη πξώηνη έρνπλ από κηα κπάια. Με ην ζύλζεκα θάλνπλ θόιιννπ

Διαβάστε περισσότερα

ΙNCOFRUIT - (HELLAS).

ΙNCOFRUIT - (HELLAS). Πξνο ΟΛΑ ΤΑ ΜΔΛΗ Κε Σπλάδειθε Θέκα: Ιζπαλία & Γεξκαλία 5 ε ΔΒΓΟΜΑΓΑ 2011 (31 Ιαλ έσο 30 Φεβξ.2011) Παξαζέηνπκε θαησηέξσ: Αλαζθόπεζε ηεο 4 εο εβδνκάδνο 2011 κε ηηο ηηκέο ησλ εζπεξηδνεηδώλ πνπ δηακνξθώζεθαλ

Διαβάστε περισσότερα

ΛΙΜΝΗ ΤΣΑΝΤ. Σρήκα 1. Σρήκα 2

ΛΙΜΝΗ ΤΣΑΝΤ. Σρήκα 1. Σρήκα 2 ΛΙΜΝΗ ΤΣΑΝΤ Τν Σρήκα 1 δείρλεη ηελ αιιαγή ηεο ζηάζκεο ηεο Λίκλεο Τζαλη, ζηε Σαράξα ηεο Βόξεηαο Αθξηθήο. Η Λίκλε Τζαλη εμαθαλίζηεθε ηειείσο γύξσ ζην 20.000 π.χ., θαηά ηε δηάξθεηα ηεο ηειεπηαίαο επνρήο ησλ

Διαβάστε περισσότερα

Άμεσοι Αλγόριθμοι: Προσπέλαση Λίστας (list access)

Άμεσοι Αλγόριθμοι: Προσπέλαση Λίστας (list access) Έρνπκε απνζεθεύζεη κηα ζπιινγή αξρείσλ ζε κηα ζπλδεδεκέλε ιίζηα, όπνπ θάζε αξρείν έρεη κηα εηηθέηα ηαπηνπνίεζεο. Μηα εθαξκνγή παξάγεη κηα αθνινπζία από αηηήκαηα πξόζβαζεο ζηα αξρεία ηεο ιίζηαο. Γηα λα

Διαβάστε περισσότερα

ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ

ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ Α/Α : 0_3207/391 1. Τελ άιιε κέξα νη Τξηάθνληα, πνιύ ηαπεηλσκέλνη θαη ληώζνληαο εγθαηαιειεηκκέλνη, ζπγθεληξώζεθαλ ζην ρώξν ησλ ζπλεδξηάζεσλ παξάιιεια, νη «ηξεηο ρηιηάδεο», ζε όια ηα ζεκεία όπνπ είραλ ηνπνζεηεζεί,

Διαβάστε περισσότερα

ΔΛΔΓΥΟ ΔΜΒΟΛΙΑΣΙΚΗ ΚΑΛΤΦΗ Δ ΠΑΙΓΙΑ ΠΡΟΥΟΛΙΚΗ ΚΑΙ ΥΟΛΙΚΗ ΗΛΙΚΙΑ ΣΟΤ ΝΟΜΟΤ ΚΔΡΚΤΡΑ

ΔΛΔΓΥΟ ΔΜΒΟΛΙΑΣΙΚΗ ΚΑΛΤΦΗ Δ ΠΑΙΓΙΑ ΠΡΟΥΟΛΙΚΗ ΚΑΙ ΥΟΛΙΚΗ ΗΛΙΚΙΑ ΣΟΤ ΝΟΜΟΤ ΚΔΡΚΤΡΑ ΔΛΔΓΥΟ ΔΜΒΟΛΙΑΣΙΚΗ ΚΑΛΤΦΗ Δ ΠΑΙΓΙΑ ΠΡΟΥΟΛΙΚΗ ΚΑΙ ΥΟΛΙΚΗ ΗΛΙΚΙΑ ΣΟΤ ΝΟΜΟΤ ΚΔΡΚΤΡΑ 24 ο ΠΑΝΔΛΛΗΝΙΟ ΤΝΔΓΡΙΟ ΔΛΛΗΝΙΚΗ ΔΣΑΙΡΔΙΑ ΚΟΙΝΧΝΙΚΗ ΠΑΙΓΙΑΣΡΙΚΗ ΚΑΙ ΠΡΟΑΓΧΓΗ ΣΗ ΤΓΔΙΑ ΠΙΝΟΤΛΑ ΔΤΡΤΓΙΚΗ ΒΑΡΚΑΡΗ ΠΟΛΤΚΡΙΣΗ

Διαβάστε περισσότερα

T A E K W O N D O. Δ. ΠπθαξΨο. ΔπΫθνπξνο ΘαζεγεηΪο ΑζιεηηθΪο ΦπζηθνζεξαπεΫαο ΡΔΦΑΑ - ΑΞΘ

T A E K W O N D O. Δ. ΠπθαξΨο. ΔπΫθνπξνο ΘαζεγεηΪο ΑζιεηηθΪο ΦπζηθνζεξαπεΫαο ΡΔΦΑΑ - ΑΞΘ T A E K W O N D O Δ. ΠπθαξΨο ΔπΫθνπξνο ΘαζεγεηΪο ΑζιεηηθΪο ΦπζηθνζεξαπεΫαο ΡΔΦΑΑ - ΑΞΘ ΦΠΗΘΝΘΔΟΑΞΔΗΑ Ο Ρ Ι Μ Ο Φπζη(θ)νζεξαπεΫα εϋλαη ε επηζηϊκε, ε νπνϋα κόλν κε θπζηθψ κωζα θαη κεζόδνπο πξνζπαζεϋ λα ζεξαπεύζεη

Διαβάστε περισσότερα

ΙΣΤΟΡΙΑ ΤΟΥ ΑΡΧΑΙΟΥ ΚΟΣΜΟΥ

ΙΣΤΟΡΙΑ ΤΟΥ ΑΡΧΑΙΟΥ ΚΟΣΜΟΥ ΙΣΤΟΡΙΑ ΤΟΥ ΑΡΧΑΙΟΥ ΚΟΣΜΟΥ Α ΛΤΚΕΙΟΤ ΓΕΝΙΚΗ ΠΑΙΔΕΙΑ Σχολικό έτος: 2011-2012 Καθηγήτριες: Κεφαλληνού Λουκία- Καλλία Αθηνά ΙΙ. ΟΙ ΑΧΑΙΟΙ ΕΛΛΗΝΕΣ ΑΠΟ ΣΟΤ ΠΡΟΙΣΟΡΙΚΟΤ ΥΡΟΝΟΤ ΕΩ ΚΑΙ ΣΟ Μ. ΑΛΕΞΑΝΔΡΟ 1. ΕΛΛΗΝΙΚΗ

Διαβάστε περισσότερα

Έλαο πίνακας σσμβόλων ππνζηεξίδεη δύν βαζηθέο ιεηηνπξγίεο:

Έλαο πίνακας σσμβόλων ππνζηεξίδεη δύν βαζηθέο ιεηηνπξγίεο: Πίνακες Σσμβόλων Έλαο πίνακας σσμβόλων ππνζηεξίδεη δύν βαζηθέο ιεηηνπξγίεο: Εηζαγσγή ελόο ζηνηρείνπ Αλαδήηεζε ζηνηρείνπ κε δεδνκέλν θιεηδί Άιιεο ρξήζηκεο ιεηηνπξγίεο είλαη: Δηαγξαθή ελόο θαζνξηζκέλνπ ζηνηρείνπ

Διαβάστε περισσότερα

γηα ηνλ Άξε Κσλζηαληηλίδε

γηα ηνλ Άξε Κσλζηαληηλίδε γηα ηνλ Άξε Κσλζηαληηλίδε γηα «ην θνηλό θαη ην θύξην» (Γ.νισκόο) γηα λα ρηίδω πάληα κε ηνλ ίδηνλε ηξόπν, κε ηηο ίδηεο θαηαζθεπαζηηθέο θαη πιαζηηθέο πξννπηηθέο, κε ηελ ίδηαλε πάληνηε πίζηε θαη αγάπε.. Α.Κ.

Διαβάστε περισσότερα

Γενεηική Καρδιαγγειακών Παθήζεων

Γενεηική Καρδιαγγειακών Παθήζεων Γενεηική Καρδιαγγειακών Παθήζεων Νίκορ Ππωτονοτάπιορ, MD, FESC, Νάξορ Η γελεηηθή ησλ θαξδηαγγεηαθώλ παζήζεσλ έρεη εμειηρζεί νπζηαζηηθά θαηά ηα ηειεπηαία είθνζη ρξόληα. Σε απηό ην ρξνληθό δηάζηεκα εμειίρζεθε

Διαβάστε περισσότερα

ΔΕΟ 13. Ποσοτικές Μέθοδοι. θαη λα ππνινγίζεηε ην θόζηνο γηα 10000 παξαγόκελα πξντόληα. Να ζρεδηαζηεί γηα εύξνο πξντόλησλ έσο 30000.

ΔΕΟ 13. Ποσοτικές Μέθοδοι. θαη λα ππνινγίζεηε ην θόζηνο γηα 10000 παξαγόκελα πξντόληα. Να ζρεδηαζηεί γηα εύξνο πξντόλησλ έσο 30000. ΔΕΟ 13 Ποσοτικές Μέθοδοι Σσνάρηηζη Κόζηοσς C(), μέζο κόζηος C()/. Παράδειγμα 1 Μηα εηαηξεία δαπαλά γηα θάζε πξντόλ Α πνπ παξάγεη 0.0 λ.κ. Τα πάγηα έμνδα ηεο εηαηξείαο είλαη 800 λ.κ. Ζεηείηαη 1) Να πεξηγξάςεηε

Διαβάστε περισσότερα

Α Ο Κ Η Α Μ Α Ζ Η Η Ρ Η ( S E A R C H )

Α Ο Κ Η Α Μ Α Ζ Η Η Ρ Η ( S E A R C H ) Ξ G O O G L E S C H O L A R Α Ο Ξ Ε Κ Ε Θ Λ Θ Α Λ Η Τ Α Μ Η Α Μ Α Ζ Η Η Ρ Η Ρ Οξαγκαηνπνηώληαο αλαδήηεζε ζην GoogleScholar (http://scholar.google.com/) ν ρξήζηεο κπνξεί λα εληνπίζεη πιηθό αθαδεκαϊθνύ θαη

Διαβάστε περισσότερα

ΑΝΣΙΓΡΑΦΗ-ΔΚΦΡΑΗ-ΡΤΘΜΙΗ ΣΗ ΓΔΝΔΣΙΚΗ ΠΛΗΡΟΦΟΡΙΑ

ΑΝΣΙΓΡΑΦΗ-ΔΚΦΡΑΗ-ΡΤΘΜΙΗ ΣΗ ΓΔΝΔΣΙΚΗ ΠΛΗΡΟΦΟΡΙΑ ΣΗ ΓΔΝΔΣΙΚΗ ΠΛΗΡΟΦΟΡΙΑ 1. ΑΝΣΙΓΡΑΦΗ ΣΟΤ DNA A. Ηκηζπληεξεηηθόο κεραληζκόο αληηγξαθήο = ηα 2 ζπγαηξηθά κόξηα DNA είλαη παλνκνηόηππα κε ην κεηξηθό θαη θαζέλα απνηειείηαη από 1 παιηά & 1 λέα αιπζίδα B. Πξνθαξπωηηθνί

Διαβάστε περισσότερα

ΑΡΥΔ ΟΙΚΟΝΟΜΙΚΗ ΘΔΩΡΙΑ ΛΤΔΙ ΓΙΑΓΩΝΙΜΑΣΟ ΚΔΦΑΛΑΙΟΤ 2

ΑΡΥΔ ΟΙΚΟΝΟΜΙΚΗ ΘΔΩΡΙΑ ΛΤΔΙ ΓΙΑΓΩΝΙΜΑΣΟ ΚΔΦΑΛΑΙΟΤ 2 ΑΥΔ ΟΙΚΟΝΟΜΙΚΗ ΘΔΩΙΑ ΛΤΔΙ ΙΑΩΝΙΜΑΣΟ ΚΔΦΑΛΑΙΟΤ 2 1: Λάζος (είλαη ηζνζθειήο ππεξβνιή) Α2: Λάζος (ην ζεηηθό πξόζεκν ζεκαίλεη όηη ε Πνζνζηηαία Μεηαβνιή Δηζνδήκαηνο θαη ε Πνζνζηηαία Μεηαβνιή Πνζόηεηαο ήηαλ

Διαβάστε περισσότερα