Research Article. Authentication of Shark Derived Material in Food Using. SYBR Green Fluorescence Real-Time PCR. : SYBR Green PCR; ; PCR,

Μέγεθος: px

Εμφάνιση ξεκινά από τη σελίδα:

Download "Research Article. Authentication of Shark Derived Material in Food Using. SYBR Green Fluorescence Real-Time PCR. : SYBR Green PCR; ; PCR,"

Ματθίας Αβραμίδης
7 χρόνια πριν
Προβολές:

1 GUO Yun -xia,et al: Authentication of Shark Derived Material in Food Using SYBR Green PCR 1,2 *1,, 1, 1, 3, 2, 3 (1., ; 2., ; 3., ) :, SYBR Green PCR SYBR Green PCR 9 48,9, (84±1.5) ;, (84±1.5) ng/μl DNA 0.01% 20 PCR,,, : SYBR Green PCR; ; :Q 789 :A : (2012) Authentication of Shark Derived Material in Food Using GUO Yun-xia 1,2, ZHANG Shu-ya *1, CHEN Hong-chao 1, REN Shuo 1, HUANG Wen-sheng 3, BAO Jian-qiang 2, CHEN Ying 3 (1.Shanghai Entry -Exit Inspection and Quarantine,Shanghai ,China;2.College of Food Science and Technology,Shanghai Ocean University,Shanghai ,China; 3.Chinese Academy of Inspection and Quarantine,Beijing ,China) Abstract: A specific and sensitive SYBR Green real-time fluorescence PCR method was developed to determine of the shark derived material in food. The specificity and sentivity of this method was examined. The results showed 9 kinds of shark samples displayed theamplified curves and the highest point of melt curves at (84±1.5),whereas other 48 kinds of common plants and animals displayed no amplified curves and the highest point of melt curves at temperatures out of (84±1.5). The detection limit of the method was ng/μl DNA and 0.01% shark meat powder. The 20 commercial shark products samples were analysized by SYBR Green PCR and all the products : : (2010IK191) * : (1978 ),,,,, zhangshuya@shciq.gov.cn 1300

2 , : SYBR Green PCR indicated existence of shark DNA except the artifical shark fin and shark liver oil. The results indicated that the detection method is highly specific and sensitive,and can be used to the identification of shark derived material in food. Keywords: SYBR green real-time fluorescence PCR, food, shark derived material, authentication, [1] DNA: [2-6],, [7],,, [8], EPA 48 [9] DHA :,, 5 :,,, ;2 : SYBR Green(SG), ;4 : DNA, PCR DNA SYBR Green, DNA, ; 1 000, : PCR DNA [10] PCR, 60, 95, ; :, [11] 1.2, SYBR Green PCR DNA, h [12-13] GenBank PCR, 10% 1% 0.1% 0.01% SYBR Green PCR, DNA 1.3 DNA ; : ; : ; : :, :DP324; DNA : : DP323; DNA

3 GUO Yun -xia,et al: Authentication of Shark Derived Material in Food Using : :DP305; DNA 40 s s 35 ;95 15 s s BioPhotometer plus s 64 (Eppendorf) DNA, , Blast GenBank, 2 g/dl Primer5 PCR, :Primer1:5 - CACCTTTAGGCAAACCAGCAC -3 ; Primer2:5 - GGGCCAGGGTCGAATCTCT PCR 18S rrna, DNA PCR, DNA PCR, DNA 18S rrna :5 -TCTGCCCTATCA ACT TTCGATGGTA-3 5 -AATTTGCGCGCCTGC TGCCTTCCTT-3 PCR :1 PCR,2.5 mmol/l Mg 2 +,1 U Taq,200 μmol/l 2.2 dntps, 100 nmol/l, 50~100 ng, SYBR Green PCR 9 25 μl :94 3 min,94 20 s,54 40 s,72 40 s,40 SYBR Green PCR DNA (ABI 7300 PCR ), :12.5 μl SYBY Green Pre Mix,1 μl Primer1 (5 μmol/l),1 μl Primer2 (5 μmol/l), 8.5 μl,2 μl DNA,, SYBR Green PCR 25 μl :95 10 min s PCR 10 μl 18S rrna, 1 μl 10, SrRNA 18S rrna 137 bp, DNA, DNA PCR DNA,, 1 (84±1.5), 2 48 DNA PCR,, 3 (84± 1.5), 4 9 Fig.1 1 PCR Specific detection of real-time PCR for shark 1302

4 , : SYBR Green PCR Fig.2 2 DNA SG-PCR SG-PCR melting curves of PCR product from shark Fig.4 3 SYBR Green PCR,10% 1% 3 48 PCR 0.1% 0.01% DNA Fig.3 Specific detection of real-time PCR for non-shark materials,0.001%, SG-PCR SG-PCR melting curves of PCR product from nonshark materials TE DNA ng/μl, SYBR Green PCR, 3, : ng/μl DNA, 10-4 ng/μl, 5 10% 1% 0.1% 0.01% 0.001%, DNA Fig.5 5 DNA PCR Amplification curves generated by serial dilution of shark DNA

5 GUO Yun -xia,et al: Authentication of Shark Derived Material in Food Using Fig.6 6 (W/W) PCR Amplification curves generated by different shark percentage content 2.4 7, (84± : 1.5) ( 8), ; DNA,, (84±1.5), DNA Fig.7 7 PCR Amplification curves generated by commercial shark products 1304

6 , : SYBR Green PCR Fig SG-PCR SG -PCR melting curves generated by commercial shark products,dna [14] SYBR Green PCR, [15-17] SYBR Green DNA,, [18] PCR,, DNA SYBT Green PCR DNA, 18S rrna,dna DNA PCR, 10-4 ng/μl, 0.01%,,, : [ 1 ],. [J].,2007,42(5): ZHU Jiang-feng,DAI Xiao-jie. Biological research situation of shark resource in China and the protection countermeasure[j]. Bulletin of Biology,2007,42(5): (in Chinese) [ 2 ],. [J].,2006,41(9): ZHAGN Shi-yu,WU Yu-ming. Sharks[J]. Bulletin of Biology,2006,41(9): (in Chinese) [ 3 ] Clarke S C,Magnussen J E,Abercrombie D L,et al. Identification of shark species composition and proportion in the Hong Kong shark fin market based on molecular genetics and trade records[j]. Conversation Biology,2005,20: [ 4 ] Fong Q SW,Anderson J L. International shark fin markets and shark management:an integrated market preference -cohort analysis of the blacktip shark[j]. Ecological Economics,2002,40: [ 5 ] Hosmilloa M,Jeonga Y,Kim H,et al. Development of universal SYBR Green real-time RT-PCR for the rapid detection and quantitation of bovine and porcine toroviruses[j]. Journal of Virological Methods,2010,168: [ 6 ] ZHENG Jiang,GUAN Rui-zhang,HUANG Shi-yu. Comparative studies on the characteristics of the fourier-transform infrared spectra between sturgeon and shark chondroitin sulfates [J]. Spectroscopy and Spectral Analysis,2008,28 (1): (in Chinese) [ 7 ] Miter R,Cheminade C,Allaume P,et al. Oral intake of shark liver oil modifies lipid composition and improves motility and velocity of boar sperm[j]. Theriogenology,2004,62: [ 8 ] Amer H M,Almajhdi F N. Development of a SYBR Green I based real-time RT-PCR assay for detection and quantification of bovine corona virus[j]. Molecular and Cellular Probes,2011,25: [ 9 ] Parka S,Parka D,Saif L J,et al. Development of SYBR green real-time RT-PCR for rapid detection,quantization and diagnosis of unclassified bovine enteric calicivirus[j]. Journal of Viological Methods,2009,159: [10] Akalar E S,Abas1yan1k M F. The development of duplex real -time PCR based on SYBR green florescence for rapid identification of ruminant and poultry origins in food stuff[j]. Food Chemistry,2012,130: [11],,,. SYBR Green PCR [J].,2010,46(17):

7 GUO Yun -xia,et al: Authentication of Shark Derived Material in Food Using ZHANG Hui-xia,ZONG Hui,WU Jian-ping,et al. The detection of common quail derived elements through the melt curve of SYBR Green I real-time PCR[J]. Chinese Journal of Animal Science,2010,46(17): (in Chinese) [13] CHEN Jian,LIU Ye-bing,ZHANG Zhi-gang,et al. Establishment of SYBR Green real-time PCR assay for the detection of porcine parvovirus[j]. Chinese Journal of Veterinary Medicine,2011,47 (8):6-8. (in Chinese) [14],,,. SYBR Green [J].,2011,389 (2): BAN Fu-guo,LIU Hong-wei,GAO Yan-ling,et al. Research of SYBR Green melting curve tetection for derived materials in feed in bovine and sheep[j]. China Animal Husbandry & Veterinary Medicine,2011,389(2): (in Chinese) [15] McIntosh K A,Tumber A,Harding J C S,et al. Development and validation of a SYBR green real -time PCR for the quantification of porcine circovirus type 2 in serum,buffy coat,feces,and multiple tissues [J]. Veterinary Microbiology, detection in food samples[j]. Journal of Food Science and Biotechnology,2011,30(5): (in Chinese) [12],,,. - [J].,2002,21(5): BAO Lun-jun,YANG Jian-cheng,HE Zheng-hua,et al. Determination of chondroitin sulfate in shark s fins by Enzymolysis- HPLC[J]. Journal of Instrumental Analysis,2002,21(5): (in Chinese) 2009,133: [16],,. PCR [J].,2011,30(5): WU Chen-lu,SHI Chun-lei,ZHOU Min,et al. Development and evaluation of a real-time PCR system for Enterococcus spp. [17],,,. PCR [J].,2009,28(4): ZHAO Wen-jing,LI Yan,GAO Peng-fei,et al. Application of real-time fluorescent quantitative PCR in quantitative detection of lactic acid bacteria[j]. Journal of Food Science and Biotechnology,2009,28(4): (in Chinese) [18] Hosmilloa M D T,Jeonga Y,Kim H,et al. Development of universal SYBR Green real-time RT-PCR for the rapid detection and quantitation of bovine and porcine toroviruses[j]. Journal of Virological Methods,2010,168:

Σχετικά έγγραφα

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson, 31 2003 8 (FENXI HUAXUE) 8 Chinese Journal of Analytical Chemistry 976 980 22( 82 252 272 )21,82 23,62 3 (, 510631) 22(82 252 272 )21,82 23,62 (BSA), 8Q5SAC BSA 298K, 35 40 6. 1 10 5 LΠmol 8Q5SAC, ph =