Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:



1 ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ 1.Ποια χηµικά στοιχεία συµµετέχουν στην σύνθεση των µορίων των οργανισµών σε σηµαντικό βαθµό; (σελ.18) 2. Γιατί είναι σηµαντικά τα ιχνοστοιχεία;(σελ.18) 3. Ποια είναι η δοµή των αµινοξέων; Πόσα διαφορετικά είδη αµινοξέων α οτελούν συστατικά των ρωτεϊνών; (σελ.22) 4. Ποιες είναι οι τρεις σ ουδαιότερες κατηγορίες µακροµορίων και οια είναι τα µονοµερή τους;(σελ.20) 5.Τι ονοµάζεται αντίδραση συµ ύκνωσης και τι αντίδραση υδρόλυσης;(σελ.20) 6. Ποια είναι τα ε ί εδα οργάνωσης ενός ρωτεϊνικού µορίου; Τι γνωρίζετε για το καθένα; (σελ.23) 7. Σε οιες κατηγορίες διακρίνονται οι ρωτεΐνες µε κριτήριο την λειτουργικότητά τους;(σελ.25) 8. Τι είναι η µετουσίωση µιας ρωτεΐνης;(σελ.25) 9. Ποια είδη νουκλεικών οξέων γνωρίζετε;(σελ.28) 10. Α ό τι α οτελείται ένα νουκλεοτίδιο; (σελ.28) 11. Ποιες διαφορές έχουν τα νουκλεοτίδια του DNA α ό αυτά του RNA; (σελ.28) 12. Ποια η δοµή του µορίου του DNA και οιος ο βιολογικός ρόλος του; (σελ.29) 13. Ποιες διαφορές αρουσιάζουν τα µόρια του DNA και του RNA; 14. Ποια είδη RNA γνωρίζετε και τι ξέρετε γι αυτά;(σελ.32) 15. Ποιες κατηγορίες υδατανθράκων και λι ιδίων γνωρίζετε; (σελ.32-38) 16. Ποιοι είναι οι σ ουδαιότεροι ολυσακχαρίτες; (σελ. 33) 17. Ποια ιδιότητα των φωσφολι ιδίων είναι σηµαντική για τη συγκρότηση και τη λειτουργικότητα των κυτταρικών µεµβρανών;(σελ.37) 18. Τι είναι το «ρευστό µωσαϊκό»; (σελ.48) 19. Ποιες οι λειτουργίες της λασµατικής µεµβράνης;(σελ.49) 20. Ποια είναι η δοµή του υρήνα;(σελ.60,61) 21. Ποιος ο ρόλος του υρήνα για την ζωή του κυττάρου;(σελ.61) 22. Ποια οργανίδια εριλαµβάνει το ενδοµεµβρανικό σύστηµα; (σελ.61) 23. Ποιος ο ρόλος των µιτοχονδρίων και των χλωρο λαστών στα κύτταρα;(σελ.64) 24. Τι εννοούµε λέγοντας ότι τα µιτοχόνδρια και οι χλωρο λάστες αρουσιάζουν µια «σχετική γενετική αυτοδυναµία»; (σελ.64,65) 25. Ποιος ο ρόλος του µεταβολισµού και οιες διεργασίες εριλαµβάνει; (σελ.78) 26. Ποιος ο ρόλος του ATP στα κύτταρα; Γιατί ονοµάζεται ενεργειακό νόµισµα; (σελ.79) 27. Ποιες είναι οι σ ουδαιότερες ιδιότητες των ενζύµων;(σελ.84) 28. Ποιοι αράγοντες ε ηρεάζουν την δράση των ενζύµων;(σελ.85) 29. Ποιες είναι οι φάσεις του κυτταρικού κύκλου; (σελ.122) 30. Τι γνωρίζετε για το κεντρικό δόγµα της Βιολογίας; (σελ.123) 31. Πώς γίνεται η αντιγραφή του µορίου του DNA;(σελ. 124) - 1 -

2 32. Τι εννοούµε µε τον όρο µεταγραφή; Πώς γίνεται αυτή; (σελ.125) 33. Ποια είναι τα βασικά χαρακτηριστικά του γενετικού κώδικα;(σελ.126,127) 34. Τι είναι η χρωµατίνη και τα χρωµοσώµατα; (σελ.129) 35.Ποια κύτταρα ονοµάζονται α λοειδή και οια δι λοειδή; (σελ.130,131) ΑΣΚΗΣΕΙΣ - ΠΑΛΙΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΑΣΚΗΣΗ 1 Ένα µόριο DNA α οτελείται α ό νουκλεοτίδια, α ό τα ο οία εριέχουν την αζωτούχα βάση αδενίνη(α). α.) Α ό όσα νουκλεοτίδια α οτελείται η κάθε αλυσίδα αυτού του µορίου; β.) Να υ ολογισθεί ο αριθµός των νουκλεοτιδίων του µορίου, ου εριέχουν την αζωτούχα βάση γουανίνη(g). γ.) Να υ ολογισθεί ο συνολικός αριθµός των δεσµών υδρογόνου ου συνδέουν τις συµ ληρωµατικές βάσεις αυτού του µορίου. [ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 1999-Β ΛΥΚΕΙΟΥ] α. Κάθε αλυσίδα α οτελείται α ό νουκλεοτίδια (το µόριο του DNA είναι δίκλωνο) β νουκλεοτίδια της γουανίνης (G) γ. (2x4.000) + (3x6.000)= δεσµοί υδρογόνου ΑΣΚΗΣΗ 2 Ο µεταγραφόµενος κλώνος ενός τµήµατος DNA έχει την εξής ακολουθία βάσεων: -TAC-AAA-CAT-CCC-GGG-TTT-ATTα.)Να γράψετε τον συµ ληρωµατικό κλώνο DNA του αρα άνω τµήµατος. β.) Να γράψετε την ακολουθία των βάσεων του RNA ου θα ροκύψει α ό τη µεταγραφή του δοθέντος κλώνου DNA. γ.) Να υ ολογίσετε το σύνολο των δεσµών υδρογόνου ου συγκρατούν τον µεταγραφόµενο κλώνο DNA µε τον συµ ληρωµατικό του. [ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2000-Β ΛΥΚΕΙΟΥ] α. Συµ ληρωµατικός κλώνος DNA (µη µεταγραφόµενος κλώνος): -ATG-TTT-GTA- GGG-CCC-AAA-TAAβ. Ακολουθία βάσεων RNA: -AUG-UUU-GUA-GGG-CCC-UUU-UAAγ. Έχουµε 8 ζευγάρια βάσεων γουανίνης- κυτοσίνης (G-C) και 13 ζευγάρια αδενίνης θυµίνης (Α-Τ) ου συγκροτούν τους δυο κλώνους του DNA, ε οµένως ροκύ τει συνολικός αριθµός δεσµών υδρογόνου: (2x13) + (3x8)=26+24=50 δεσµοί υδρογόνου - 2 -

3 ΑΣΚΗΣΗ 3 Ένα µόριο DNA α οτελείται α ό νουκλεοτίδια, το 20% των ο οίων εριέχει την αζωτούχα βάση θυµίνη(t). α.) Πόσα νουκλεοτίδια του µορίου αυτού εριέχουν την βάση κυτοσίνη(c); β.) Πόσοι δεσµοί υδρογόνου συγκρατούν τους δυο κλώνους του DNA; γ.) Πόσοι φωσφοδιεστερικοί δεσµοί εριέχονται στο µόριο του DNA; α. Α ό τα νουκλεοτίδια και µε βάση την αρχή της συµ ληρωµατικότητας των βάσεων έχουµε: 20% θυµίνη(τ): νουκλεοτίδια 20% αδενίνη (Α): νουκλεοτίδια 30% γουανίνη (G): νουκλεοτίδια 30% κυτοσίνη (C): νουκλεοτίδια β. (2x6.000) + (3x9.000)= δεσµοί υδρογόνου γ. Κάθε κλώνος του DNA έχει νουκλεοτίδια τα ο οία συνδέονται µε = φωσφοδιεστερικούς δεσµούς. Ε οµένως και για τους δυο κλώνους του DNA έχουµε = φωσφοδιεστερικούς δεσµούς. ΑΣΚΗΣΗ 4 Μια ρωτεΐνη έχει µοριακό βάρος Μ.Β= και α οτελείται α ό 4 ολυ ε τιδικές αλυσίδες, οι ο οίες είναι ανά δυο όµοιες. Αν µια α ό αυτές έχει µοριακό βάρος και το µέσο µοριακό βάρος των αµινοξέων είναι 100, να βρείτε: α.) το µοριακό βάρος των υ όλοι ων αλυσίδων, β.) το λήθος των αµινοξέων α ό τα ο οία α οτελείται κάθε αλυσίδα. α. Έχουµε τέσσερις αλυσίδες Α,Β,Γ και. Για κάθε αλυσίδα έχουµε µοριακό βάρος: A: Μ.Β = B: Μ.Β = (είναι ίδια µε την αλυσίδα Α) Γ: Μ.Β = : Μ.Β = (είναι ίδια µε την αλυσίδα Γ) β. Ο αριθµός των αµινοξέων κάθε αλυσίδας είναι: A: /100 =100 αµινοξέα B: /100 =100 αµινοξέα Γ: /100 =150 αµινοξέα : /100 =150 αµινοξέα - 3 -

4 ΑΣΚΗΣΗ 5 Η αµυλάση του ανθρώ ινου σάλιου διασ ά το άµυλο ( ρόκειται για ολυσακχαρίτη) σε µικρότερα κοµµάτια. Στον αρακάτω ίνακα αρουσιάζεται η εξάρτηση του χρόνου διάσ ασης του αµύλου µε την θερµοκρασία. Για κάθε θερµοκρασία χρησιµο οιήθηκε η ίδια οσότητα διαλύµατος αµύλου και αµυλάσης. ΠΙΝΑΚΑΣ ΘΕΡΜΟΚΡΑΣΙΑ Θ ( C) ΧΡΟΝΟΣ ΙΑΣΠΑΣΗΣ ΑΜΥΛΟΥ t (sec) α.) Σε οια θερµοκρασία η αµυλάση λειτουργεί καλύτερα; β.) Ποιος άλλος αράγοντας µ ορεί να ε ηρεάσει την δράση της αµυλάσης; γ.) Η ταχύτητα των χηµικών αντιδράσεων συνήθως αυξάνεται µε την αύξηση της θερµοκρασίας. Γιατί στο είραµα η διάσ αση του αµύλου ελαττώνεται άνω α ό τη θερµοκρασία των 40 C; α. θ=35 C (γιατί σε αυτή τη θερµοκρασία το άµυλο διασ άται στον µικρότερο χρόνο) β. Η ταχύτητα της διάσ ασης του αµύλου ε ηρεάζεται α ό την τιµή του ph. γ. Με την αύξηση της θερµοκρασίας άνω α ό ένα όριο, η ταχύτητα της αντίδρασης µειώνεται γιατί ελλατώνεται η δραστικότητα των ενζύµων. Αυτό οφείλεται στην καταστροφή της τριτοταγής δοµής τους. ΑΣΚΗΣΗ 6 Ένα τµήµα DNA έχει 12 φωσφοδιεστερικούς δεσµούς και 18 δεσµούς υδρογόνου. Να υ ολογίσετε όσες Α, Τ, C και G εριέχει. Υ οθέτουµε ότι έχουµε x µόρια µε βάση Α, x µόρια Τ(συµ ληρωµατικά της Α), y µόρια C και y µόρια G(συµ ληρωµατικά της C). Κάθε κλώνος του DNA έχει 6 φωσφοδιεστερικούς δεσµούς και ε οµένως 6+1=7 νουκλεοτίδια. Άρα για τους δυο κλώνους του DNA έχουµε συνολικά 14 νουκλεοτίδια ( ου εριέχουν Α,Τ,C και G). Ε οµένως θα ισχύει: 2x+2y=14 (1) Ανάµεσα σε Α-Τ σχηµατίζονται 2 δεσµοί υδρογόνου και ανάµεσα σε C-G σχηµατίζονται 3 δεσµοί υδρογόνου ου συγκρατούν τους δυο κλώνους του DNA. Άρα συνολικά για τους δεσµούς υδρογόνου έχουµε: 2x+3y=18 (2) Α ό το σύστηµα των εξισώσεων (1) και (2) ροκύ τει ότι έχουµε: 3 Α, 3Τ, 4 C και 4 G

5 ΑΣΚΗΣΗ 7 Ένα τµήµα DNA α οτελείται α ό 600 νουκλεοτίδια µεταξύ των ο οίων ανα τύσσονται 700 δεσµοί υδρογόνου. Να βρεθεί ο αριθµός των αζωτούχων βάσεων. Υ οθέτουµε ότι έχουµε x µόρια µε βάση Α, x µόρια Τ(συµ ληρωµατικά της Α), y µόρια C και y µόρια G(συµ ληρωµατικά της C). Α ό το σύνολο των νουκλεοτιδίων έχουµε: : 2x+2y=600 (1) Α ό τους δεσµούς υδρογόνου έχουµε: 2x+3y=700 (2) Α ό το σύστηµα των εξισώσεων (1) και (2) ροκύ τει: 200 Α, 200Τ, 100 C και 100 G. ΑΣΚΗΣΗ 8 Αν ένα τµήµα του µη µεταγραφόµενου κλώνου ενός µορίου DNA εριέχει την ακόλουθη διαδοχή αζωτούχων βάσεων: -ATG-GCG-CCT-TTA-AAA-CGA-TCC-GTA-CAC-TCG-TGAα.) Ποιο είναι το τµήµα του mrna ου συντίθεται α ό το µεταγραφόµενο κλώνο του DNA; β.) Το ρωτεϊνικό τµήµα ου αράγεται α ό όσα αµινοξέα α οτελείται; γ.) Πώς ονοµάζεται το ρώτο κωδικόνιο του mrna και οιο αµινοξύ συνθέτει; α. AUG-GCG-CCU-UUA-AAA-CGA-UCC-GUA-CAC-UCG-UGAβ. To τελευταίο κωδικόνιο - κωδικόνιο λήξης (UGA) κωδικο οιεί και την λήξη της ε τιδικής αλυσίδας. Συνε ώς το ρωτεϊνικό τµήµα ου συντίθεται α ό το mrna θα α οτελείται α ό 11-1=10 αµινοξέα. γ. Το κωδικόνιο AUG ονοµάζεται κωδικόνιο έναρξης και συνθέτει το αµινοξύ µεθειονίνη. ΑΣΚΗΣΗ 9 Μια ρωτεΐνη µε Μ.Β= α οτελείται α ό δυο αλυσίδες Α και Β. Αν η µια αλυσίδα έχει τετρα λάσιο µοριακό βάρος α ό την άλλη και γνωρίζουµε ότι το µέσο µοριακό βάρος των αµινοξέων είναι m=100, να βρείτε: α.) Τα µοριακά βάρη των δυο αλυσίδων. β.) Ο αριθµός των αµινοξέων κάθε αλυσίδας. γ.) Τον αριθµό των µορίων νερού ου αράγονται κατά τον σχηµατισµό της ρωτείνης. α. Α ό την εκφώνηση έχουµε ότι τα µοριακά βάρη των δυο αλυσίδων ικανο οιούν την σχέση M.BA=4 M.BB (1) Το συνολικό µοριακό βάρος της ρωτεΐνης είναι: M.BA+M.BB = (2) Α ό τις εξισώσεις (1) και (2) έχουµε: M.BA= και M.BB =

6 β. Α αλυσίδα: /100=200 αµινοξέα Β αλυσίδα: 5.000/100=50 αµινοξέα γ. Κάθε αλυσίδα µε Ν αµινοξέα δηµιουργείται µε αφαίρεση Ν-1 µορίων νερού, ο ότε για την ρωτεΐνη έχουµε: (200-1)+(50-1)=199+49=248 µόρια νερού. ΑΣΚΗΣΗ 10 Μια ολυ ε τιδική αλυσίδα υδρολύεται. Κατά την λήρη µετατρο ή της σε ε τίδια α ορροφήθηκαν 1500 µόρια νερού. α.) Πότε µια αλυσίδα ονοµάζεται ολυ ε τιδική; β.) Ποιος είναι ο αριθµός των ε τιδίων ου σχηµατίζουν την αλυσίδα; γ.)πόσα µόρια νερού α οβλήθηκαν κατά τον σχηµατισµό της ολυ ε τιδικής αλυσίδας; δ.) Πόσοι ε τιδικοί (οµοιο ολικοί) δεσµοί υ άρχουν στην ολυ ε τιδική αλυσίδα; α. Όταν έχουµε ερισσότερα α ό 50 ε τίδια β =1501 ε τίδια γ µόρια νερού δ =1500 ε τιδικοί δεσµοί Σηµείωση: Κατά την σύνδεση των N ε τιδίων έχουµε την α όσ αση Ν-1 µορίων νερού και δηµιουργούνται Ν-1 οµοιο ολικοί δεσµοί µεταξύ των µορίων. ΑΣΚΗΣΗ 11 Πόσα διαφορετικά τρι ε τίδια µ ορούν να δηµιουργηθούν α ό 20 διαφορετικά αµινοξέα; Για τρι ε τίδιο της µορφής Β-D-F, µ ορούµε να ε ιλέξουµε 20 διαφορετικά αµινοξέα για το Β, 20 διαφορετικά αµινοξέα για το D και 20 διαφορετικά αµινοξέα για το F. Συνολικά έχουµε 20x20x20=20 3 =8.000 διαφορετικά τρι ε τίδια

7 ΑΣΚΗΣΗ 12 Εντο ίστηκε α ό τους ε ιστήµονες µονόκλωνο γενετικό υλικό ου α οτελείται α ό 6 διαφορετικά νουκλεοτίδια τα ο οία συνθέτουν 34 διαφορετικά αµινοξέα. Να βρείτε την µορφή του γενετικού κώδικα (.χ τριαδικός) και να εξετάσετε αν υ άρχει κωδικόνιο έναρξης και κωδικόνιο λήξης. Ο συνδυασµός ου δίνει ε αρκή αριθµό διαφορετικών αµινοξέων είναι οι δυάδες νουκλεοτιδίων, γιατί έχουµε 6 2 =36 δυνατούς συνδυασµούς διαφορετικών αµινοξέων. Η ερί τωση ό ου ένα νουκλεοτίδιο κωδικο οιεί ένα αµινοξύ α ορρί τεται γιατί δίνει µόνο 6 συνδυασµούς, για διαφορετικά αµινοξέα. Ε οµένως ο γενετικός κώδικας είναι δυαδικός. Α ό τα 36 κωδικόνια τα 34 κωδικο οιούν τα αµινοξέα, ένα το κωδικόνιο έναρξης και ένα το κωδικόνιο λήξης. ΑΣΚΗΣΗ 13 Θέλουµε να κατασκευάσουµε στο εργαστήριο 512 αντίγραφα ενός µορίου DNA. Με τη µέθοδο PCR µ ορούµε να έχουµε κάθε 30min ένα αντίγραφο των ροηγούµενων και γνωρίζουµε ότι κάθε κλώνος του αρχικού DNA α οτελείται α ό νουκλεοτίδια. α.) Σε όσο χρόνο θα έχουµε τα 512 αντίγραφα; β.)πόσα νουκλεοτίδια θα χρησιµο οιηθούν για την κατασκευή των αντιγράφων; α. Για τα 512 αντίγραφα θα χρειαστούν 2 ν =512 2 ν =2 9 ν=9 διαιρέσεις. Κάθε διαίρεση γίνεται ανά 30min, ο ότε έχουµε: 9x30min=270min=4,5h β. Το αρχικό µόριο DNA έχει 2x νουκλεοτίδια=80.000νουκλεοτίδια, άρα για 512 αντίγραφα θα έχουµε 512x80.000νουκλεοτίδια= νουκλεοτίδια. Όµως ρέ ει να αφαιρέσουµε α ό το σύνολο, τον αρχικό αριθµό των νουκλεοτιδίων του µητρικού DNA, δηλαδή = νουκλεοτίδια. ΑΣΚΗΣΗ 14 Μια ολυ ε τιδική αλυσίδα α οτελείται α ό 100 αµινοξέα. Πόσα νουκλεοτίδια έχει το τµήµα του DNA α ό το ο οίο ροήλθε; Το mrna α οτελείται α ό 100+1=101 κωδικόνια. Το κωδικόνιο ου ροσθέτουµε είναι το κωδικόνιο λήξης (το ο οίο δεν αντιστοιχεί σε αµινοξύ). Ε οµένως η µεταγραφόµενη αλυσίδα του DNA µαζί µε την συµ ληρωµατική της θα έχει 2x101=202 κωδικόνια, δηλαδή 3x202=606 νουκλεοτίδια

8 ΑΣΚΗΣΗ 15 Σε ένα µόριο DNA στη µια α ό τις δυο αλυσίδες έχουµε A + G = 0, 4. Ποια C+ T είναι η τιµή του ίδιου λόγου στην συµ ληρωµατική αλυσίδα; Με βάση την αρχή της συµ ληρωµατικότητας των βάσεων έχουµε: A+ G T+ C = 0, 4 = 0, 4 C+ T G+ A συµπληρ. Για τον λόγο ου ψάχνουµε έχουµε: A+ G 1 1 = = = 2,5 C+ T T C συµπληρ. + 0, 4 G+ A συµπληρ. ΑΣΚΗΣΗ 16 ίκλωνο µόριο DNA α οτελείται α ό 402 νουκλεοτίδια. Πόσα κωδικόνια θα έχει το mrna ου συντίθεται; Το mrna α οτελείται α ό 67 κωδικόνια. ΑΣΚΗΣΗ 17 Υ ολογίζουµε ότι κατά µέσο όρο νουκλεοτίδια συνδεδεµένα µε φωσφοδιεστερικούς δεσµούς ζυγίζουν 250g και ότι στο τέλος της µεσόφασης του κυττάρου ενός οργανισµού, η συνολική οσότητα οσότητα DNA είναι ίση µε 0, g. Ποιος είναι ο αριθµός των αζωτούχων βάσεων ου εριέχει το DNA του κυττάρου στην αρχή της µεσόφασης; Σηµείωση: Θυµίζουµε α ό την θεωρία ότι στο τέλος της µεσόφασης έχουµε δι λασιασµό του DNA (βλ. σχολικό βιβλίο σελ.122). Α ό τα δεδοµένα της εκφώνησης θα υ ολογίσουµε το σύνολο των νουκλεοτιδίων στο τέλος της µεσόφασης. Τα νουκλεοτίδια ζυγίζουν 250g y ; 0, g DNA ε οµένως για το DNA έχουµε y=10 9 νουκλεοτίδια, ου υ άρχουν στο τέλος της µεσόφασης (και αφού έχει ροηγηθεί ο δι λασιασµός του DNA). Στην αρχή της µεσόφασης θα υ άρχει ο µισός αριθµός νουκλεοτιδίων, δηλαδή 10 9 νουκλεοτίδια/2= νουκλεοτίδια

9 ΑΣΚΗΣΗ 18 Μια λήρη στροφή της έλικας του DNA έχει µήκος 3,5nm και εριλαµβάνει 10 ζεύγη συµ ληρωµατικών αζωτούχων βάσεων. Αν ε ιλέξουµε τµήµα DNA µήκους nm και το 20% των βάσεών του είναι γουανίνη(g), να υ ολογίσετε: α.) όσα ζεύγη βάσεων υ άρχουν β.) όσα νουκλεοτίδια έχει το τµήµα του DNA γ.) τον αριθµό των δεσµών υδρογόνου δ.) τον αριθµό των φωσφοδιεστερικών δεσµών α nm/3,5nm= ζεύγη βάσεων β. 2x5.000 ζεύγη βάσεων= νουκλεοτίδια γ. Για τις βάσεις έχουµε: 30% αδενίνη(a), δηλαδή % θυµίνη(t),δηλαδή % κυτοσίνη(c),δηλαδή % γουανίνη(g), δηλαδή Ε οµένως για τους δεσµούς υδρογόνου έχουµε: (2x3.000)+(3x2.000)= = δεσµοί υδρογόνου δ φωσφοδιεστερικοί δεσµοί (και για τις δυο αλυσίδες του DNA). ΑΣΚΗΣΗ 19 Μια ρωτεΐνη µε µοριακό βάρος Μ.Β= α οτελείται µόνο α ό αλυσίδες Α και Β µε µοριακά βάρη M.BA=3.000 και M.BB =5.000 αντίστοιχα. Να υ ολογίσετε τον αριθµό των αλυσίδων τύ ου Α και Β ου υ άρχουν στην ρωτεΐνη, ώστε να έχουµε τουλάχιστον µια αλυσίδα α ό κάθε τύ ο. Αναζητούµε ζευγάρια α και β ου να µας δίνουν το συνολικό µοριακό βάρος της ρωτείνης, δηλαδή α β=21.000, ό ου τα α και β ακέραιοι αριθµοί. Τα α και β αναφέρονται στον αριθµό αλυσίδων τύ ου Α και Β αντίστοιχα. Τελικά υ άρχουν 2 αλυσίδες τύ ου Α και 3 αλυσίδες τύ ου Β. ΑΣΚΗΣΗ 20 Ένα βακτήριο εριέχει αµινοξέα. Αν το µέσο µοριακό βάρος των αµινοξέων είναι m=100, να βρείτε όσες ρωτεΐνες M.B=7.500 µ ορεί να εριέχει το βακτήριο; Μια ρωτεΐνη έχει 7.500/100=75 αµινοξέα. Τα αµινοξέα του βακτηρίου µ ορούν να εριέχουν 6.150/75=82 ρωτεΐνες

10 ΠΙΝΑΚΕΣ ιαφορές µεταξύ φυτικών και ζωικών κυττάρων Φυτικά κύτταρα Ζωικά κύτταρα Έχουν κυτταρικό τοίχωµα εν έχουν κυτταρικό τοίχωµα Περιέχουν χλωρο λάστες εν έχουν κεντροσωµάτιο εν εριέχουν χλωρο λάστες Έχουν κεντροσωµάτιο ιαφορές στη δοµή και στη θέση ου βρίσκονται, µεταξύ DNA και RNA DNA RNA Περιέχει εντόζη δεσοξυριβόζη Περιέχει τις βάσεις θυµίνη (Τ),αδενίνη(Α),κυτοσίνη(C) και γουανίνη(g) Είναι δίκλωνο µόριο (γι αυτό και το DNA έχει µεγαλύτερο µοριακό βάρος α ό το RNA) Το DNA έχει ιδιότητα αυτοδι λασιασµού To DNA είναι υ εύθυνο για τη µεταβίβαση των γενετικών εντολών Το DNA βρίσκεται στον υρήνα του κυττάρου, στα µιτοχόνδρια και τους χλωρο λάστες. εν βρίσκεται στο κυτταρό λασµα (γιατί η υρηνική µεµβράνη δεν είναι δια ερατή στο DNA). Περιέχει εντόζη ριβόζη Περιέχει τις βάσεις ουρακίλη (U), αδενίνη(α),κυτοσίνη(c) και γουανίνη(g) Είναι µονόκλωνο µόριο (δηλαδή έχει µια αλυσίδα) Το RNA δεν έχει ιδιότητα αυτοδι λασιασµού Το RNA είναι υ εύθυνο για την εκτέλεση των γενετικών υλικών Βρίσκεται στον υρήνα, στα µιτοχόνδρια, στους χλωρο λάστες και στο κυτταρό λασµα. Μακροµόρια και µονοµερή Μακροµόριο ΠΡΩΤΕΪΝΗ ΝΟΥΚΛΕΙΚΑ ΟΞΕΑ ΠΟΛΥΣΑΚΧΑΡΙΤΕΣ Μονοµερές ΑΜΙΝΟΞΕΑ ΝΟΥΚΛΕΟΤΙ ΙΑ ΜΟΝΟΣΑΚΧΑΡΙΤΕΣ

11 ιαφορές µεταξύ αναβολισµού - καταβολισµού ΑΝΑΒΟΛΙΣΜΟ Στον αναβολισµό ολύ λοκες χηµικές ουσίες συντίθενται α ό α λές ΚΑΤΑΒΟΛΙΣΜΟ Στον καταβολισµό ολύ λοκες ουσίες διασ ώνται σε α λούστερες Οι αναβολικές αντιδράσεις α ορροφούν ενέργεια (ενδόθερµες αντιδράσεις) Οι καταβολικές αντιδράσεις α οδίδουν ενέργεια (εξώθερµες αντιδράσεις) ΒΑΣΙΚΕΣ ΙΑΦΟΡΕΣ ΑΝΤΙΓΡΑΦΗΣ ΜΕΤΑΓΡΑΦΗΣ ΑΝΤΙΓΡΑΦΗ Σκο ός της είναι το θυγατρικό κύτταρο να α οκτήσει το ίδιο ακριβώς γενετικό υλικό (σε οσότητα και οιότητα) µε το µητρικό κύτταρο ΜΕΤΑΓΡΑΦΗ Σκο ός της είναι η σύνθεση των α αραίτητων RNA. Συγκεκριµένα µε την µεταγραφή αράγονται mrna,trna και rrna Αντιγράφονται και οι δυο αλυσίδες του DNA Συµµετέχουν διάφορα ένζυµα.χ η DNA ολυµεράση ΙΙΙ, η ο οία διασφαλίζει την ιστότητα της αντιγραφής Τα συµ ληρωµατικά δεσοξυριβονουκλεοτίδια το οθετούνται σύµφωνα µε την αρχή της συµ ληρωµατικότητας των βάσεων. Μεταγράφεται µόνο η µια αλυσίδα Συµµετέχουν διάφορα ένζυµα.χ RNA ολυµεράση, η ο οία όµως δεν αίζει ρόλο ελεγκτή και γι αυτό τα λάθη είναι ιθανότερα στην µεταγραφή α ότι στην αντιγραφή. Α έναντι α ό κάθε δεσοξυριβονουκλεοτίδιο του µεταγραφόµενου κλώνου ου εριέχει αδενίνη, το οθετείται ένα ριβονουκλεοτίδιο ου εριέχει ουρακίλη ΚΑΤΗΓΟΡΙΕΣ Υ ΑΤΑΝΘΡΑΚΩΝ Υ ΑΤΑΝΘΡΑΚΕΣ ΜΟΝΟΣΑΚΧΑΡΙΤΕΣ ΙΣΑΚΧΑΡΙΤΕΣ ΠΟΛΥΣΑΚΧΑΡΙΤΕΣ Τριόζες Πεντόζες Εξόζες Μαλτόζη Σακχαρόζη Λακτόζη Κυτταρίνη Άµυλο Γλυκογόνο

12 ΚΑΤΗΓΟΡΙΕΣ ΠΡΩΤΕΪΝΩΝ ΚΡΙΤΗΡΙΟ ΜΟΡΦΟΛΟΓΙΑ ΛΕΙΤΟΥΡΓΙΑ ΣΥΝΘΕΣΗ ΕΙ Η ΠΡΩΤΕΪΝΩΝ ΣΦΑΙΡΙΚΕΣ ΙΝΩ ΕΙΣ ΟΜΙΚΕΣ (δοµικά συστατικά των κυττάρων) ΛΕΙΤΟΥΡΓΙΚΕΣ (συµβάλλουν στις λειτουργίες των κυττάρων) ΑΠΛΕΣ ΣΥΝΘΕΤΕΣ ΙΑΦΟΡΕΣ ΜΕΤΑΞΥ ΤΥΧΑΙΩΝ ΠΡΩΤΕΙΝΩΝ ιαφορετικό αριθµό αµινοξέων αλλά και διαφορετικά είδη αµινοξέων ου α οτελούν τις ρωτεΐνες ιαφορετικές λειτουργίες των ρωτεϊνών ιαφορετικό αριθµό ολυ ε τιδικών αλυσίδων ιαφορετική σύσταση των ρωτεινών ΚΑΤΗΓΟΡΙΕΣ ΛΙΠΙ ΙΩΝ ΛΙΠΙ ΙΑ ΟΥ ΕΤΕΡΑ ΛΙΠΗ (τριγλυκερίδια) Α οτελούνται α ό τρία µόρια λι αρών οξέων ου έχουν ενωθεί µε ένα µόριο γλυκερόλης. ιακρίνονται : Ακόρεστα λί η (φυτά) Κορεσµένα λί η(ζώα) ΦΩΣΦΟΛΙΠΙ ΙΑ Α οτελούνται α ό ένα µόριο γλυκερόλης συνδεδεµένο µε δυο µόρια λι αρών οξέων, ένα µόριο φωσφορικού οξέος και ένα µικρότερο ολικό µόριο. Α οτελούν δοµικό συστατικό των µεµβρανών. ΣΤΕΡΟΕΙ Η Χοληστερόλη (υ εύθυνη για την αρτηριοσκλήρυνση)

13 ΟΡΓΑΝΙ ΙΟ ΚΥΤΤΑΡΙΚΑ ΟΡΓΑΝΙ ΙΑ KAI ΟΜΕΣ ΖΩΙΚΩΝ ΚΑΙ ΦΥΤΙΚΩΝ ΚΥΤΤΑΡΩΝ ΦΥΤΙΚΟ ΚΥΤΤΑΡΟ ΖΩΙΚΟ ΚΥΤΤΑΡΟ Πυρήνας ΝΑΙ ΝΑΙ Κυτταρικό τοίχωµα ΝΑΙ ΟΧΙ Πλασµατική µεµβράνη ΝΑΙ ΝΑΙ Χρωµοσώµατα ΝΑΙ ΝΑΙ Ριβοσώµατα ΝΑΙ ΝΑΙ Ενδο λασµατικό δίκτυο ΝΑΙ ΝΑΙ Σύµ λεγµα Golgi ΝΑΙ ΝΑΙ Λυσοσώµατα ΟΧΙ ΝΑΙ Υ εροξειδιοσώµατα ΝΑΙ ΝΑΙ Χυµοτό ια ΝΑΙ ΟΧΙ Χλωρο λάστες ΝΑΙ ΟΧΙ Μιτοχόνδρια ΝΑΙ ΝΑΙ Κεντροσωµάτιο ΟΧΙ ΝΑΙ



Διαβάστε περισσότερα

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i..

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i.. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ «XHMIKH ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ» ΕΙΣΑΓΩΓΗ ΚΑΙ Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Όταν αναφερόμαστε στον όρο «Χημική Σύσταση του Κυττάρου», τί νομίζετε ότι

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση:

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου Ενότητα 1.1: Χημεία της ζωής Ενότητα 2.1: Μακρομόρια Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: 1. Για ποιο λόγο θεωρείται αναγκαία η σταθερότητα

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι:

Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι: 1 ΑΣΚΗΣΕΙΣ ΝΟΥΚΛΕΙΚΩΝ ΟΞΕΩΝ ΑΣΚΗΣΗ 1 Ποια είναι η δομή των νουκλεοτιδίων; Τα νουκλεοτίδια προέρχονται από τη σύνδεση με ομοιοπολικό δεσμό, τριών διαφορετικών μορίων. Μιας πεντόζης (σάκχαρο με πέντε άτομα

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ 1. Τοποθετείστε στο διάγραμμα που ακολουθεί, τους όρους: σύνθεση, υδρόλυση, μακρομόριο, μονομερή. Ερμηνεύστε το διάγραμμα. Η -Q-

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ Α ΖΗΤΗΜΑ: 1. Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; Γλυκόζη 2. Εάν δύο τέτοια μόρια ενωθούν μαζί τι θα προκύψει; Μαλτόζη 3. Πώς ονομάζεται η

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Επειδή στο σχολικό βιβλίο Βιολογία Β Γενικού Λυκείου Γενικής παιδείας πρόσφατα προστέθηκαν ερωτήσεις και άλλαξε η αρίθμηση των προϋπαρχουσών ασκήσεων,

Διαβάστε περισσότερα

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημικά στοιχεία που συνθέτουν τους οργανισμούς Ο C, το H 2, το O 2 και το N 2 είναι τα επικρατέστερα στους οργανισμούς σε ποσοστό 96% κ.β. Γιατί; Συμμετέχουν σε σημαντικό βαθμό στη σύνθεση

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 2. Δομή νουκλεϊκών οξέων ΝΟΥΚΛΕΪΚΑ ΟΞΕΑ ΣΥΣΤΑΣΗ ΟΡΓΑΝΙΣΜΩΝ ΣΕ ΟΡΓΑΝΙΚΕΣ ΕΝΩΣΕΙΣ ΜΙΚΡΟΜΟΡΙΑ ΜΑΚΡΟΜΟΡΙΑ 1. Αμινοξέα πρωτεϊνες

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΦΡΟΝΤΙΣΤΗΡΙΑ 2001 - ΟΡΟΣΗΜΟ 3 η ΕΚ ΟΣΗ 1 2 3 ΙΑΦΟΡΕΣ ΜΕΤΑΞΥ DNA και RNA DNA ίκλωνο δεξιόστροφο ελικοειδές µόριο. Με εξαίρεση τους ιούς. Α οτελείται α ό δεοξυριβονουκλεοτίδια. Α. εοξυριβόζη (σάκχαρο) Β. Α,Τ, G, C, αζωτούχες βάσεις.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής ΚΕΑΛΑΙΟ 5 ιατήρηση και συνέχεια της ζωής 5.2 H ροή της γενετικής πληροφορίας 3 Πώς βρέθηκε η δομή του DNA στο χώρο; Η ανακάλυψη της δομής του DNA πραγματοποιήθηκε το 1953 από τους Watson και Crick. Από

Διαβάστε περισσότερα


ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΕΙΣΑΓΩΓΗ Oι ζωντανοί οργανισμοί αποτελούνται από ένα ή περισσότερα κύτταρα. Χαρακτηρίζονται αντίστοιχα, μονοκύτταροι (μονοκυτταρικοί) και πολυκύτταροι (πολυκυτταρικοί)

Διαβάστε περισσότερα


ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα


ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ Ενδεικτική διδακτική προσέγγιση Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ 30 Στο τέλος της διδασκαλίας της ενότητας αυτής ο μαθητής θα πρέπει να έχει: Διαπιστώσει ότι τα χημικά στοιχεία που

Διαβάστε περισσότερα


ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ Τα προβλήματα αυτού του κεφαλαίου αναφέρονται στον υπολογισμό : 1. νουκλεοτιδίων ή αζωτούχων βάσεων ή πεντοζών ή φωσφορικών ομάδων 2. φωσφοδιεστερικών δεσμών ή μορίων

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 1 Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται

Διαβάστε περισσότερα

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 Α1. 1. δ 2. α 3. δ 4. γ 5. γ Βιολογία ΘΕΜΑ A κατεύθυνσης Α2. Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 ΘΕΜΑ Β 1.

Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ ΑΣΚΗΣΕΙΣ ΠΡΟΒΛΗΜΑΤΑ ΚΕΦ. 1 ΕΡΩΤΗΣΕΙΣ ΑΣΚΗΣΕΙΣ ΠΡΟΒΛΗΜΑΤΑ ΚΕΦ. 1 ΑΠΑΝΤΗΣΕΙΣ ΣΤΙΣ ΕΡΩΤΗΣΕΙΣ ΤΟΥ ΣXOΛΙΚΟΥ ΒΙΒΛΙΟΥ 1. Τοποθετήστε, στο διάγραμμα που ακολουθεί, τους όρους: σύνθεση, υδρόλυση, μακρομόριο, μονομερή. Ερμηνεύστε το διάγραμμα.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα


Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα


ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΚΕΦΑΛΑΙΟ 1 Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΑΣΚΗΣΕΙΣ 1. Σε ένα δίκλωνο µόριο DNA ο λόγος Α / C είναι 1/ 4. Το μήκος του είναι 20.000 ζεύγη βάσεων. Ποια η εκατοστιαία σύσταση και ποιος ο αριθµός των νουκλεοτιδίων που

Διαβάστε περισσότερα

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες;

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες; 1 ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ Το κύτταρο αποτελείται από χηµικές ενώσεις, στις οποίες περιλαµβάνονται τα µικρά βιολογικά µόρια και τα βιολογικά µακροµόρια. Στα µικρά βιολογικά µόρια ανήκουν, τα ανόργανα στοιχεία

Διαβάστε περισσότερα


Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Χηµείας Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: 1.1. Ένα υδατικό διάλυµα χαρακτηρίζεται ουδέτερο

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Ζήτηµα 1ο Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 000 Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: 1.1. Ένα υδατικό διάλυµα χαρακτηρίζεται ουδέτερο στους

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΕΡΩΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΕΦΑΛΑΙΟ: 1 1. Τι είναι τα µακροµόρια και ποια είναι η δοµή τους; (SOS) Σελίδα 20: Οι πρωτεϊνες.ονοµάζεται συµπύκνωση. ΜΑΚΡΟΜΟΡΙΑ ΟΜΙΚΟΙ ΛΙΘΟΙ ΕΝ ΙΑΜΕΣΑ ΣΥΣΤΑΤΙΚΑ 1) ΝΟΥΚΛΕΪΚΑ ΟΞΕΑ

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ.

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. ΒΙΟΛΟΓΙΑ Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. Ηλιούπολης Κεφάλαιο 1ο ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Η ΙΕΡΑΡΧΙΑ ΤΩΝ ΒΙΟΜΟΡΙΩΝ ΠΡΟΔΡΟΜΕΣ

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Οι James Watson και Francis Crick δίπλα από το μοντέλο της διπλής έλικας του DNA που τους εξασφάλισε το Βραβείο Νόμπελ. 2015 2 Β.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 1 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

ΗΝΟ 3 ΝΗ 3 Η 2 Ο Μονάδες 3 β) Ποιο από τα παραπάνω ζεύγη, στο ίδιο υδατικό διάλυµα, µπορεί να αποτελέσει ρυθµιστικό διάλυµα; Μονάδες 2 ΑΠ.

ΗΝΟ 3 ΝΗ 3 Η 2 Ο Μονάδες 3 β) Ποιο από τα παραπάνω ζεύγη, στο ίδιο υδατικό διάλυµα, µπορεί να αποτελέσει ρυθµιστικό διάλυµα; Μονάδες 2 ΑΠ. ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 12 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΕΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΘΕΜΑ 1 ο Να γράψετε στο τετράδιό σας

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα


ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

Βιολογία και αρχές Βιοδιάβρωσης Πολυμερές Μονομερές

Βιολογία και αρχές Βιοδιάβρωσης Πολυμερές Μονομερές Βιολογία και αρχές Βιοδιάβρωσης Τα χημικά στοιχεία που συνθέτουν τους οργανισμούς. Στον φλοιό της γης απαντώνται 92 στοιχεία, απαραίτητα για την ζωή είναι τα 27, από τα οποία τα πιο σημαντικά είναι τα

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4ο Γενετική

ΚΕΦΑΛΑΙΟ 4ο Γενετική ΚΕΦΑΛΑΙΟ 4ο Γενετική Ενότητα 4.1: Κύκλος ζωής του κυττάρου Ενότητα 4.2: Μοριακή γενετική. (Το κεντρικό δόγμα της βιολογίας - Αντιγραφή - Μεταγραφή - Μετάφραση του DNA - Η χρωματίνη και το χρωμόσωμα) Ενότητα

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved Κεφάλαιο 2 1 Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved ΟΡΓΑΝΙΚΗ ΜΟΡΙΑΚΗ ΔΟΜΗ ΤΩΝ ΖΩΝΤΑΝΩΝ ΟΡΓΑΝΙΣΜΩΝ «Οργανική» ένωση αναφέρεται σε ενώσεις του C Συμμετέχουν

Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Οργανική Χηµεία. Κεφάλαιο 29: Βιοµόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα

Οργανική Χηµεία. Κεφάλαιο 29: Βιοµόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα Οργανική Χηµεία Κεφάλαιο 29: Βιοµόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα 1. Γενικά-ιδιότητες Κυκλικές οργανικές ενώσεις: καρβοκυκλικές (δακτύλιος περιέχει µόνο άτοµα C) και ετεροκυκλικές (δακτύλιος

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 2/12/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΓΗ_Β_ΒΙΟ_0_14364 Β5 (ΚΕΦ. 2, 4) ΘΕΜΑ Β: ΚΕΦΑΛΑΙΟ 4 ΙΙ. Τα μιτοχόνδρια ανήκουν σε μια ευρύτερη κατηγορία οργανιδίων που μετατρέπουν την ενέργεια που προσλαμβάνουν τα κύτταρα σε αξιοποιήσιμη μορφή. α) Να

Διαβάστε περισσότερα

οµή και λειτουργία των µεγάλων βιολογικών µορίων

οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων κατηγορίες υδατάνθρακες πρωτεΐνες νουκλεϊνικά οξέα λιπίδια Οι πρωτεΐνες, υδατάνθρακες, νουκλεϊνικά οξέα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα

Οργανική Χημεία. Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα Οργανική Χημεία Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα 1. Γενικά-ιδιότητες Κυκλικές οργανικές ενώσεις: καρβοκυκλικές (δακτύλιος περιέχει μόνο άτομα C) και ετεροκυκλικές (δακτύλιος

Διαβάστε περισσότερα



Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι:

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: α. γραµµικό δίκλωνοdνα β. γραµµικό

Διαβάστε περισσότερα


ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Οι οργανισμοί εξασφαλίζουν ενέργεια, για τις διάφορες λειτουργίες τους, διασπώντας θρεπτικές ουσίες που περιέχονται στην τροφή τους. Όμως οι φωτοσυνθετικοί

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα


ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 Θέμα 2ο 2ο ΓΕΛ Χαλανδρίου Βιολογία Β Λυκείου Περιεχόμενα ΘΕΜΑ 14306... 2 ΘΕΜΑ 14351... 2 ΘΕΜΑ 14360... 3 ΘΕΜΑ 14363... 3 ΘΕΜΑ 14364... 4 ΘΕΜΑ 14366... 5 ΘΕΜΑ 14367... 5 ΘΕΜΑ 14369...

Διαβάστε περισσότερα


ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΣΣΑΛΟΝΙΚΗ ΣΧΟΛΙΚΟ ΕΤΟΣ 2012-2013 Σελίδα 2 από 35 Ενότητα πρώτη Η χημεία της ζωής Ενότητα πρώτη Η χημεία της ζωής Α. Σύντομη παρουσίαση της θεωρίας Χαρακτηριστικά

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Το νερό και οι ιδιότητές του Οι µοναδικές φυσικοχηµικές ιδιότητες του νερού οφείλονται στο ότι:

Το νερό και οι ιδιότητές του Οι µοναδικές φυσικοχηµικές ιδιότητες του νερού οφείλονται στο ότι: Το νερό και οι ιδιότητές του Οι µοναδικές φυσικοχηµικές ιδιότητες του νερού οφείλονται στο ότι: το µόριο του είναι πολύ µικρό, είναι πολικό και µεταξύ των µορίων του σχηµατίζονται δεσµοί υδρογόνου. Οι

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. σελ.13: Το 1928 ο Griffith πως γίνεται αυτό. Β2. σελ.101: Τέλος, βλάβες στους επιδιορθωτικά

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1- α Α2- δ Α3- γ Α4- β Α5- β ΘΕΜΑ Β. Β1. Βλέπε σελ. 13 σχολικού βιβλίου: από «Το 1928 ο Griffith» μέχρι «αλλά δεν μπόρεσε να

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία(Γενικής(Παιδείας Β Λυκείου

Βιολογία(Γενικής(Παιδείας Β Λυκείου Βιολογία(Γενικής(Παιδείας Β Λυκείου Ελληνογαλλική Σχολή Jeanne D Arc 2011-2012 Δημοσθένης Καρυοφύλλης email: dkariofi@e-biology.gr www.ibrain.gr Κεφ. 1 ο Χημική σύσταση του κυττάρου Χαρακτηριστικά των

Διαβάστε περισσότερα


Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα