ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΜΑΔΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Γ ΛΥΚΕΙΟΥ

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΜΑΔΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Γ ΛΥΚΕΙΟΥ"

Transcript

1 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΜΑΔΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Γ ΛΥΚΕΙΟΥ Επιμέλεια: Βουδούρη Καλλιρρόη

2 ΙΑΓ%ΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΟΝΟΜΑ:.. ΘΕΜΑ Α Α. Να ση)ειώσετε στο γρα1τό σας δί1λα α1ό τον αριθ)ό καθε)ιάς α1ό τις 1αρακάτω η)ιτελείς 1ροτάσεις 1 έως 5 το γρά))α 1ου αντιστοιχεί στη λέξη ή τη φράση, η ο1οία συ)1ληρώνει σωστά την 1ρόταση. 1. Η οριστική ε:ιβεβαίωση ότι το DNA είναι το γενετικό υλικό ήρθε: A. Α:ό το :είραfα του Griffith B. Α:ό το :είραfα των Avery, Mc-Leod και McCarty C. Α:ό το :είραfα των Hersey και Chase D. Ισχύουν τα Α και C 2. H Μενδελική κληρονοfικότητα δεν ισχύει για: A. θνησιγόνα γονίδια B. ατελώς ε:ικρατή γονίδια C. Fονογονιδιακούς χαρακτήρες D. Fιτοχονδριακά γονίδια 3. ΈνζυFο :ου δεν καταλύει τη δηfιουργία φωσφοδιεστερικού δεσfού είναι: A. Η DNA :ολυfεράση B. Η RNA :ολυfεράση C. Η DNA ελικάση D. Η DNA δεσfάση 4. Η :οικιλία των γαfετών :ου :αράγονται α:ό ένα άτοfο στο ο:οίο :αρατηρείται Fετατό:ιση είναι σε σχέση Fε αυτήν ενός φυσιολογικού: A. Fεγαλύτερη B. Fικρότερη C. ίδια D. άλλοτε Fεγαλύτερη, άλλοτε Fικρότερη ανάλογα Fε το σε :οιο χρωfόσωfα :αρατηρείται η Fετατό:ιση 5. Σε όλες τις καλλιέργειες χρησιfο:οιείται/ χρησιfο:οιούνται: A. νερό B. άγαρ C. :ηγή νιτρικών ιόντων D. όλα τα :ροηγούfενα Μονάδες 15 Β. Να χαρακτηρίσετε τις 1αρακάτω 1ροτάσεις )ε Σωστό (Σ) ή Λάθος (Λ). 1. Ο όρος ζύfωση χρησιfο:οιείται για να :εριγράψει Fόνο αναερόβιες διαδικασίες. 2. Τα διαγονιδιακά ζώα δεν F:ορούν να κλωνο:οιηθούν. 3. Τα γαfετικά κύτταρα ενός ανθρώ:ου, είναι α:λοειδή και :εριέχουν όλα την ίδια ακριβώς :οσότητα DNA.

3 4. Τα ριβονουκλεο:ρωτεϊνικά σωfατίδια :ου βοηθούν στη διαδικασία της ωρίfανσης λέγονται :ριfοσώfατα. 5. Τα κωδικόνια :ου κωδικο:οιούν τη λήξη είναι συνώνυfα. Μονάδες 10 ΘΕΜΑ Β Β1. Να γράψετε ορισfούς για τα :αρακάτω: :εριοριστικές ενδονουκλεάσες, FετασχηFατισFός, ε:ικρατές αλληλόfορφο, FονοϋβριδισFός. Ποιός είναι ο φυσιολογικός ρόλος των :εριοριστικών ενδονουκλεασών και α:ό :ου :αράγονται; Μονάδες 10 Β2. Να συf:ληρώσετε τον :αρακάτω :ίνακα για ένα σωfατικό κύτταρο φυσιολογικού ατόfου και ενός ατόfου Fε σύνδροfο Down. Φάση Χρωμοσώματα Μόρια DNA Αρχή μεσόφασης (G1) Τέλος μεσόφασης (G2) Μετάφαση Τέλος μίτωσης Φυσιολογικό Down Φυσιολογικό Down Μονάδες 4 B3. Το βακτήριο E.coli ανα:τύσσεται :αρουσία γλυκόζης. Πώς ε:ιτυγχάνει το βακτήριο την καταστολή της :αραγωγής των ενζύfων :ου χρησιfο:οιεί για να Fεταβολίσει τη λακτόζη; Β4. Ποιούς τρό:ους διάγνωσης γενετικών ασθενειών γνωρίζετε; Να αναφέρετε για κάθε τρό:ο διάγνωσης Fια γενετική ασθένεια, :ου F:ορούFε να διαγνώσουfε Fε τη χρήση του.

4 ΘΕΜΑ Γ Γ1. Να εξηγήσετε γιατί η γενετική τρο:ο:οίηση κατά τη δηfιουργία διαγονιδιακών ζώων έχει ως α:οτέλεσfα τη Fεταβίβαση των ιδιοτήτων στους α:ογόνους, ενώ η γονιδιακή θερα:εία όχι. Γ2. Σε ένα είδος Fύγας α:ό τη διασταύρωση δύο :ράσινων εντόfων :ήραfε τους :αρακάτω α:ογόνους. 120 θηλυκά Fε :ράσινο χρώfα 121 αρσενικά Fε :ράσινο χρώfα 43 θηλυκά Fε καφέ χρώfα 40 αρσενικά Fε καφέ χρώfα Το ίδιο αρσενικό διασταυρώθηκε Fε ένα άλλο θηλυκό :ου ήταν ε:ίσης :ράσινο, τα α:οτελέσfατα αυτή τη φορά, ήταν τα εξής: 62 θηλυκά Fε :ράσινο χρώfα 22 θηλυκά Fε καφέ χρώfα 33 αρσενικά Fε :ράσινο χρώfα 10 αρσενικά Fε καφέ χρώfα Ι. Με :οιόν τρό:ο κληρονοfείται ο χαρακτήρας χρώfα του σώfατος στα συγκεκριfένα έντοfα; Μονάδες 8 ΙΙ. ΠαρατηρούFε ότι υ:άρχει διαφορο:οιήση στα α:οτελέσfατα των δύο διασταυρώσεων; Πώς εξηγείται αυτό; Γ3. Περιγράψτε τη διαδικασία :ου θα ακολουθούσατε για να θερα:εύσετε γονιδιακά ένα άτοfο :ου :άσχει α:ό β-θαλασσαιfία. ΘΕΜΑ 1. Σε ένα είδος :οντικιών υ:άρχει ένα ζεύγος ατελώς ε:ικρατών φυλοσύνδετων αλληλόfορφων γονιδίων Α1, Α2 :ου ελέγχει το Fήκος της ουράς. Το Α1 είναι υ:εύθυνο για Fακριά ουρά, το Α2 για κοντή, ενώ ο ετερόζυγος γονότυ:ος εfφανίζει Fεσαίο Fήκος ουράς. Α:ό διασταύρωση αρσενικού ατόfου Fε κοντή ουρά Fε θηλυκό Fε Fεσαία σ:άνια F:ορεί :ροκύψει άτοfο θηλυκό και στείρο Fε Fακριά ουρά. Να :ροτείνετε Fια :ιθανή εξήγηση. 2. Η ακόλουθη αλληλουχία DNA :ου δίνεται αντιγράφεται Fε συνεχή τρό:ο και είναι τfήfα ενός :ρωτο- ογκογονιδίου. 5 CAATTAAACTAAGGGGATAAGGGATTATCCATGCGGATTAG 3

5 I. Αν το :ρωταρχικό τfήfα :ου συντίθεται κατά την αντιγραφή της α:οτελείται α:ό 6 νουκλεοτίδια, να γράψετε την αλληλουχία του :ρωταρχικού τfήfατος σηfειώνοντας τα άκρα του. Να αιτιολογήσετε την α:άντηση σας. II. Η ακόλουθη αλληλουχία :εριλαfβάνεται στο εσωτερικό της αρχικής α:οτελεί τη Fία α:ό τις δύο αλυσίδες γονιδίου: 5 ΑΑΑCTAAGGGGATAAGGGATTATCCATGCGG 3 Το γονίδιο :εριέχει ένα εσώνιο και κωδικο:οιεί το ολιγο:ε:τίδιο met-asp-asn-pro-pro, α:ό το ο:οίο δεν α:οfακρύνονται αfινοξέα Fετά τη σύνθεση του. Να γράψετε την αλληλουχία του mrna :ου :αράγεται αfέσως Fετά τη Fεταγραφή του γονιδίου, την αλληλουχία βάσεων στο 5 και 3 άκρο του ώριfου mrna (σηfειώνοντας τα άκρα τους) και τα αντικωδικόνια του trna Fε τη σειρά :ου χρησιfο:οιούνται. Μονάδες 8 ΙΙΙ. Αν στο 10 νουκλεοτίδιο α:ό το 5 άκρο συfβεί γονιδιακή Fετάλλαξη (αντικατάσταση G α:ό C) τι συνέ:ειες αναfένονται στο γονιδιακό :ροϊόν; Υ:άρχουν :ροεκτάσεις στον ανθρώ:ινο οργανισfό, Fε βάση τα :αρόντα δεδοfένα;

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5)

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Στις ερωτήσεις 1 5, να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Μονάδες 5 1.2.α. Να γράψετε στο τετράδιό σας τον παρακάτω πίνακα σωστά συµπληρωµένο.

Μονάδες 5 1.2.α. Να γράψετε στο τετράδιό σας τον παρακάτω πίνακα σωστά συµπληρωµένο. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 12 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ ΣΕΛΙ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Φυσικών της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Φυσικών της Ώθησης ΕΘΝΚΕΣ ΕΞΕΤΣΕΣ ΠΝΤΗΣΕΣ Ειμέλεια: Ομάδα Φυσικών της Ώθησης ΕΘΝΚΕΣ ΕΞΕΤΣΕΣ Παρασκευή, ουνίου Γ ΛΥΚΕΟΥ ΚΤΕΥΘΥΝΣΗΣ ΗΛΕΚΤΡΟΛΟΓ ΟΜΔ ΠΡΩΤΗ. Για τις ημιτελείς ροτάσεις. και. να γράψετε στο τετράδιό σας τον αριθμό

Διαβάστε περισσότερα

Το Ερευνητικό Μετρό. Το ερευνητικόό µμετρόό του ΕΙΕ ταξιδεύύει στις «γραµμµμέές» σχεδιασµμούύ και ανακάάλυψης φαρµμάάκων.

Το Ερευνητικό Μετρό. Το ερευνητικόό µμετρόό του ΕΙΕ ταξιδεύύει στις «γραµμµμέές» σχεδιασµμούύ και ανακάάλυψης φαρµμάάκων. Το Ερευνητικό Μετρό Το ερευνητικόό µμετρόό του ΕΙΕ ταξιδεύύει στις «γραµμµμέές» σχεδιασµμούύ και ανακάάλυψης φαρµμάάκων. Αθήήνα 2015 Πού συναντά*ε τους *ικροοργανισ*ούς; Παντού!!! Οι 2ιο γνωστές «κρυψώνες»

Διαβάστε περισσότερα

Οι γέφυρες του ποταμού... Pregel (Konigsberg)

Οι γέφυρες του ποταμού... Pregel (Konigsberg) Οι γέφυρες του ποταμού... Pregel (Konigsberg) Β Δ Β Δ Γ Γ Κύκλος του Euler (Euler cycle) είναι κύκλος σε γράφημα Γ που περιέχει κάθε κορυφή του γραφήματος, και κάθε ακμή αυτού ακριβώς μία φορά. Για γράφημα

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΑΡΧΕΣ ΟΙΚΟΝΟΜΙΚΗΣ ΘΕΩΡΙΑΣ ΜΑΘΗΜΑ ΕΠΙΛΟΓΗΣ Γ ΛΥΚΕΙΟΥ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΑΡΧΕΣ ΟΙΚΟΝΟΜΙΚΗΣ ΘΕΩΡΙΑΣ ΜΑΘΗΜΑ ΕΠΙΛΟΓΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΑΡΧΕΣ ΟΙΚΟΝΟΜΙΚΗΣ ΘΕΩΡΙΑΣ ΜΑΘΗΜΑ ΕΠΙΛΟΓΗΣ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: ΕΠΩΝΥΜΟ: ΟΝΟΜΑ: ΟΜΑΔΑ Α Για τις προτάσεις Α1 μέχρι και Α6 να

Διαβάστε περισσότερα

Αποδεικτικές Διαδικασίες και Μαθηματική Επαγωγή.

Αποδεικτικές Διαδικασίες και Μαθηματική Επαγωγή. Αποδεικτικές Διαδικασίες και Μαθηματική Επαγωγή. Mαθηματικό σύστημα Ένα μαθηματικό σύστημα αποτελείται από αξιώματα, ορισμούς, μη καθορισμένες έννοιες και θεωρήματα. Η Ευκλείδειος γεωμετρία αποτελεί ένα

Διαβάστε περισσότερα

Προγραμματιστική Εργασία

Προγραμματιστική Εργασία ΗΥ-240 ο%ές εδο%ένων Προγραμματιστική Εργασία Αντώνης Πα)αϊωάννου Μέρος A Διαδικάστικά Παράδοση: Σάββατο, 14 Νοεμβρίου 2016, ώρα 23:59. Compile και run σε μηχανήματα της σχολής Μέρος της βαθμολογίας Τρόπος

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 16 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Στις ερωτήσεις 1 5, να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Γιάννης Ι. Πασσάς. Γλώσσα. Οι λειτουργίες της γλώσσας Η γλωσσική 4εταβολή και ο δανεισ4ός

Γιάννης Ι. Πασσάς. Γλώσσα. Οι λειτουργίες της γλώσσας Η γλωσσική 4εταβολή και ο δανεισ4ός Γιάννης Ι. Πασσάς Γλώσσα Οι λειτουργίες της γλώσσας Η γλωσσική 4εταβολή και ο δανεισ4ός Αρχή πάντων ορισµός εστί Γλώσσα: Κώδικας ση4είων ορισ4ένης 4ορφής (γλωσσικής), 4ε τα ο

Διαβάστε περισσότερα

ΣΤΟ ΦΑΡΜΑΚΕΙΟ. Με την πιστοποίηση του έχει πρόσβαση στο περιβάλλον του φαρμακείου που παρέχει η εφαρμογή.

ΣΤΟ ΦΑΡΜΑΚΕΙΟ. Με την πιστοποίηση του έχει πρόσβαση στο περιβάλλον του φαρμακείου που παρέχει η εφαρμογή. ΣΤΟ ΦΑΡΜΑΚΕΙΟ Ο ασθενής έχοντας μαζί του το βιβλιάριο υγείας του και την τυπωμένη συνταγή από τον ιατρό, η οποία αναγράφει τον μοναδικό κωδικό της, πάει στο φαρμακείο. Το φαρμακείο αφού ταυτοποιήσει το

Διαβάστε περισσότερα

Ας υποθέσουμε ότι ο παίκτης Ι διαλέγει πρώτος την τυχαιοποιημένη στρατηγική (x 1, x 2 ), x 1, x2 0,

Ας υποθέσουμε ότι ο παίκτης Ι διαλέγει πρώτος την τυχαιοποιημένη στρατηγική (x 1, x 2 ), x 1, x2 0, Οικονομικό Πανεπιστήμιο Αθηνών Τμήμα Στατιστικής Εισαγωγή στην Επιχειρησιακή Ερευνα Εαρινό Εξάμηνο 2015 Μ. Ζαζάνης Πρόβλημα 1. Να διατυπώσετε το παρακάτω παίγνιο μηδενικού αθροίσματος ως πρόβλημα γραμμικού

Διαβάστε περισσότερα

Άσκηση 1 Το Υ+όδειγ&α του Ricardo και το Συγκριτικό Πλεονέκτη&α

Άσκηση 1 Το Υ+όδειγ&α του Ricardo και το Συγκριτικό Πλεονέκτη&α Οικονο&ικό Πανε+ιστή&ιο Αθηνών Τ"ή"α Οικονο"ικής Ε,ιστή"ης Καθηγητής Γιώργος Αλογοσκούφης 1473 ιεθνής Οικονο"ική Εαρινό Εξά"ηνο 2014-15 Άσκηση 1 Το Υ+όδειγ&α του Ricardo και το Συγκριτικό Πλεονέκτη&α Θεωρείστε

Διαβάστε περισσότερα

Τι είναι η (ατρίδα,ας

Τι είναι η (ατρίδα,ας Müller, Vincent C. (2005), Τι είναι η πατρίδα μας; [What is our fatherland?], Cogito, 3, 8-10. [This is the original draft. The published version is shorter and polished.] http://www.nnet.gr/cogito/cogitoindex.htm

Διαβάστε περισσότερα

2 Η ΠΑΓΚΥΠΡΙΑ ΟΛΥΜΠΙΑ Α ΦΥΣΙΚΗΣ Γ ΓΥΜΝΑΣΙΟΥ

2 Η ΠΑΓΚΥΠΡΙΑ ΟΛΥΜΠΙΑ Α ΦΥΣΙΚΗΣ Γ ΓΥΜΝΑΣΙΟΥ ΕΝΩΣΗ ΚΥΠΡΙΩΝ ΦΥΣΙΚΩΝ 2 Η ΠΑΓΚΥΠΡΙΑ ΟΛΥΜΠΙΑ Α ΦΥΣΙΚΗΣ Γ ΓΥΜΝΑΣΙΟΥ Κυριακή, 16 Απριλίου, 2006 Ώρα: 10:30-13:00 Οδηγίες: 1) Το δοκίµιο αποτελείται από τρία (3) µέρη µε σύνολο δώδεκα (12) θέµατα. 2) Επιτρέπεται

Διαβάστε περισσότερα

Προτεινόμενα θέματα στο μάθημα. Αρχές Οικονομικής Θεωρίας ΟΜΑΔΑ Α. Στις προτάσεις από Α.1. μέχρι και Α10 να γράψετε στο τετράδιό σας τον αριθμό της

Προτεινόμενα θέματα στο μάθημα. Αρχές Οικονομικής Θεωρίας ΟΜΑΔΑ Α. Στις προτάσεις από Α.1. μέχρι και Α10 να γράψετε στο τετράδιό σας τον αριθμό της Προτεινόμενα θέματα στο μάθημα Αρχές Οικονομικής Θεωρίας ΟΜΑΔΑ Α Στις προτάσεις από Α.1. μέχρι και Α10 να γράψετε στο τετράδιό σας τον αριθμό της καθεμιάς και δίπλα σε κάθε αριθμό την ένδειξη Σωστό, αν

Διαβάστε περισσότερα

ΣΤΟ ΙΑΤΡΕΙΟ. Με την πιστοποίηση του αποκτά πρόσβαση στο περιβάλλον του ιατρού που παρέχει η εφαρμογή.

ΣΤΟ ΙΑΤΡΕΙΟ. Με την πιστοποίηση του αποκτά πρόσβαση στο περιβάλλον του ιατρού που παρέχει η εφαρμογή. ΣΤΟ ΙΑΤΡΕΙΟ Ο ιατρός αφού διαπιστώσει εάν το πρόσωπο που προσέρχεται για εξέταση είναι το ίδιο με αυτό που εικονίζεται στο βιβλιάριο υγείας και ελέγξει ότι είναι ασφαλιστικά ενήμερο (όπως ακριβώς γίνεται

Διαβάστε περισσότερα

ΠΑΡΑ ΕΙΓΜΑΤΑ ΚΡΙΤΗΡΙΩΝ ΑΞΙΟΛΟΓΗΣΗΣ

ΠΑΡΑ ΕΙΓΜΑΤΑ ΚΡΙΤΗΡΙΩΝ ΑΞΙΟΛΟΓΗΣΗΣ ΠΑΡΑ ΕΙΓΜΑΤΑ ΚΡΙΤΗΡΙΩΝ ΑΞΙΟΛΟΓΗΣΗΣ 1. Κριτήριο για ολιγόλεπτη εξέταση 91 (15 ) Στοιχεία µαθητή Ονοµατεπώνυµο:... Εξεταζόµενο µάθηµα: Αρχαία Ελληνική Γραµµατεία (µάθηµα κατεύθυνσης) Τάξη:... Ηµεροµηνία

Διαβάστε περισσότερα

ΣΟΦΟΚΛΕΟΥΣ ΑΝΤΙΓΟΝΗ Κείμενο από το πρωτότυπο (στίχοι )

ΣΟΦΟΚΛΕΟΥΣ ΑΝΤΙΓΟΝΗ Κείμενο από το πρωτότυπο (στίχοι ) ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ Β ΤΑΞΗΣ ΠΕΜΠΤΗ 29 ΜΑΪΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΗ ΓΛΩΣΣΑ ΚΑΙ ΓΡΑΜΜΑΤΕΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ ΣΟΦΟΚΛΕΟΥΣ

Διαβάστε περισσότερα

Κείµενο διδαγµένο Κείµενο από το πρωτότυπο

Κείµενο διδαγµένο Κείµενο από το πρωτότυπο ΤΡΙΤΗ 29 ΙΟΥΝΙΟΥ 1999 ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κείµενο διδαγµένο Κείµενο από το πρωτότυπο Θουκυδίδη Ιστορία Γ, 70 Καὶ (ἦν γὰρ Πειθίας ἐθελοπρόξενός τε τῶν Ἀθηναίων καὶ τοῦ δήµου προειστήκει)

Διαβάστε περισσότερα

23/2/07 Sleep out Πλατεία Κλαυθμώνος

23/2/07 Sleep out Πλατεία Κλαυθμώνος 23/2/07 Sleep out Πλατεία Κλαυθμώνος Μια βραδιά στο λούκι με τους αστέγους «Έχετε ποτέ σκεφτεί να κοιμηθείτε μια χειμωνιάτικη νύχτα στο δρόμο;» Με αυτό το ερώτημα απευθύναμε και φέτος την πρόσκληση στους

Διαβάστε περισσότερα

Αναγνώριση Προτύπων. Σήμερα! Λόγος Πιθανοφάνειας Πιθανότητα Λάθους Κόστος Ρίσκο Bayes Ελάχιστη πιθανότητα λάθους για πολλές κλάσεις

Αναγνώριση Προτύπων. Σήμερα! Λόγος Πιθανοφάνειας Πιθανότητα Λάθους Κόστος Ρίσκο Bayes Ελάχιστη πιθανότητα λάθους για πολλές κλάσεις Αναγνώριση Προτύπων Σήμερα! Λόγος Πιθανοφάνειας Πιθανότητα Λάθους Πιθανότητα Λάθους Κόστος Ρίσκο Bayes Ελάχιστη πιθανότητα λάθους για πολλές κλάσεις 1 Λόγος Πιθανοφάνειας Ας υποθέσουμε ότι θέλουμε να ταξινομήσουμε

Διαβάστε περισσότερα

HY 280. θεμελιακές έννοιες της επιστήμης του υπολογισμού ΑΣΚΗΣΕΙΣ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΥΠΟΛΟΓΙΣΤΩΝ. Γεώργιος Φρ.

HY 280. θεμελιακές έννοιες της επιστήμης του υπολογισμού ΑΣΚΗΣΕΙΣ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΥΠΟΛΟΓΙΣΤΩΝ. Γεώργιος Φρ. HY 280 «ΘΕΩΡΙΑ ΥΠΟΛΟΓΙΣΜΟΥ» θεμελικές έννοιες της επιστήμης του υπολογισμού ΑΣΚΗΣΕΙΣ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΥΠΟΛΟΓΙΣΤΩΝ Γεώργιος Φρ. Γεωργκόπουλος μέρος Α Εισγωγή, κι η σική θεωρί των πεπερσμένων

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Β ΤΑΞΗ ΚΕΙΜΕΝΟ. Πέµπτη 19 Νοεµβρίου 1942. Αγαπητή Κίττυ,

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Β ΤΑΞΗ ΚΕΙΜΕΝΟ. Πέµπτη 19 Νοεµβρίου 1942. Αγαπητή Κίττυ, ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 6 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ: ΝΕΑ ΕΛΛΗΝΙΚΗ ΓΛΩΣΣΑ ΚΑΙ ΓΡΑΜΜΑΤΕΙΑ ΕΚΦΡΑΣΗ - ΕΚΘΕΣΗ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) Αγαπητή

Διαβάστε περισσότερα

2. Κατάθεσε κάποιος στην Εθνική Τράπεζα 4800 με επιτόκιο 3%. Μετά από πόσο χρόνο θα πάρει τόκο 60 ; α) 90 ημέρες β) 1,5 έτη γ) 5 μήνες δ) 24 μήνες

2. Κατάθεσε κάποιος στην Εθνική Τράπεζα 4800 με επιτόκιο 3%. Μετά από πόσο χρόνο θα πάρει τόκο 60 ; α) 90 ημέρες β) 1,5 έτη γ) 5 μήνες δ) 24 μήνες 20 Φεβρουαρίου 2010 1. Ένας έμπορος αγόρασε 720 κιλά κρασί προς 2 το κιλό. Πρόσθεσε νερό, το πούλησε προς 2,5 το κιλό και κέρδισε 500. Το νερό που πρόσθεσε ήταν σε κιλά: α) 88 β) 56 γ) 60 δ) 65 2. Κατάθεσε

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. Διδαγμένο κείμενο Αριστοτέλους Πολιτικά Θ 2.1 4

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. Διδαγμένο κείμενο Αριστοτέλους Πολιτικά Θ 2.1 4 ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Διδαγμένο κείμενο Αριστοτέλους Πολιτικά Θ 2.1 4 Α. Μετάφραση Είναι λοιπόν φανερό ότι πρέπει να θεσπίσουμε νόμους για την παιδεία

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

ΕΛΛΗΝΙΚΟ ΑΝΟΙΚΤΟ ΠΑΝΕΠΙΣΤΗΜΙΟ. Πρώτη Γραπτή Εργασία. Εισαγωγή στους υπολογιστές Μαθηματικά

ΕΛΛΗΝΙΚΟ ΑΝΟΙΚΤΟ ΠΑΝΕΠΙΣΤΗΜΙΟ. Πρώτη Γραπτή Εργασία. Εισαγωγή στους υπολογιστές Μαθηματικά ΕΛΛΗΝΙΚΟ ΑΝΟΙΚΤΟ ΠΑΝΕΠΙΣΤΗΜΙΟ Πρόγραμμα Σπουδών: ΙΟΙΚΗΣΗ ΕΠΙΧΕΙΡΗΣΕΩΝ και ΟΡΓΑΝΙΣΜΩΝ Θεματική Ενότητα: ΕΟ-13 Ποσοτικές Μέθοδοι Ακαδημαϊκό Έτος: 2012-13 Πρώτη Γραπτή Εργασία Εισαγωγή στους υπολογιστές Μαθηματικά

Διαβάστε περισσότερα

21/11/2005 Διακριτά Μαθηματικά. Γραφήματα ΒΑΣΙΚΗ ΟΡΟΛΟΓΙΑ : ΜΟΝΟΠΑΤΙΑ ΚΑΙ ΚΥΚΛΟΙ Δ Ι. Γεώργιος Βούρος Πανεπιστήμιο Αιγαίου

21/11/2005 Διακριτά Μαθηματικά. Γραφήματα ΒΑΣΙΚΗ ΟΡΟΛΟΓΙΑ : ΜΟΝΟΠΑΤΙΑ ΚΑΙ ΚΥΚΛΟΙ Δ Ι. Γεώργιος Βούρος Πανεπιστήμιο Αιγαίου Γραφήματα ΒΑΣΙΚΗ ΟΡΟΛΟΓΙΑ : ΜΟΝΟΠΑΤΙΑ ΚΑΙ ΚΥΚΛΟΙ A Ε B Ζ Η Γ K Θ Δ Ι Ορισμός Ένα (μη κατευθυνόμενο) γράφημα (non directed graph) Γ, είναι μία δυάδα από σύνολα Ε και V και συμβολίζεται με Γ=(Ε,V). Το σύνολο

Διαβάστε περισσότερα

Κληρονομικότητα. Σήμερα! Κλάση Βάσης Παράγωγη κλάση Απλή κληρονομικότητα Protected δεδομένα Constructors & Destructors overloading

Κληρονομικότητα. Σήμερα! Κλάση Βάσης Παράγωγη κλάση Απλή κληρονομικότητα Protected δεδομένα Constructors & Destructors overloading Κληρονομικότητα Σήμερα! Κλάση Βάσης Παράγωγη κλάση Απλή κληρονομικότητα Protected δεδομένα Constructors & Destructors overloading 2 1 Κλάση Βάση/Παράγωγη Τα διάφορα αντικείμενα μπορούν να έχουν μεταξύ

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

ΣΟΦΟΚΛΕΟΥΣ ΑΝΤΙΓΟΝΗ Κείµενο από το πρωτότυπο (701-718)

ΣΟΦΟΚΛΕΟΥΣ ΑΝΤΙΓΟΝΗ Κείµενο από το πρωτότυπο (701-718) ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 16 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ : ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΣΟΦΟΚΛΕΟΥΣ ΑΝΤΙΓΟΝΗ Κείµενο από

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ ΜΑΘΗΜΑ: ΕΡΩΤΗΣΕΙΣ ΟΙΚΟΝΟΜΙΚΗΣ ΘΕΩΡΙΑΣ

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ ΜΑΘΗΜΑ: ΕΡΩΤΗΣΕΙΣ ΟΙΚΟΝΟΜΙΚΗΣ ΘΕΩΡΙΑΣ ΜΑΘΗΜΑ: ΕΡΩΤΗΣΕΙΣ ΟΙΚΟΝΟΜΙΚΗΣ ΘΕΩΡΙΑΣ Tα Πανεπιστημιακά Φροντιστήρια «ΚΟΛΛΙΝΤΖΑ» προετοιμάζοντας σε ολιγομελείς ομίλους τους υποψήφιους για τον επικείμενο διαγωνισμό του Υπουργείου Οικονομικών, με κορυφαίο

Διαβάστε περισσότερα

Ημέρα 3 η. (α) Aπό την εργασιακή διαδικασία στη διαδικασία παραγωγής (β) Αξία του προϊόντος και αξία της εργασιακής δύναμης

Ημέρα 3 η. (α) Aπό την εργασιακή διαδικασία στη διαδικασία παραγωγής (β) Αξία του προϊόντος και αξία της εργασιακής δύναμης Ημέρα 3 η. (α) Aπό την εργασιακή διαδικασία στη διαδικασία παραγωγής (β) Αξία του προϊόντος και αξία της εργασιακής δύναμης Η εργασιακή διαδικασία και τα στοιχεία της. Η κοινωνική επικύρωση των ιδιωτικών

Διαβάστε περισσότερα

Έννοια. Η αποδοχή της κληρονομίας αποτελεί δικαίωμα του κληρονόμου, άρα δεν

Έννοια. Η αποδοχή της κληρονομίας αποτελεί δικαίωμα του κληρονόμου, άρα δεν 1 1. Αποδοχή κληρονομίας Έννοια. Η αποδοχή της κληρονομίας αποτελεί δικαίωμα του κληρονόμου, άρα δεν μπορεί να ασκηθεί από τους δανειστές του κληρονόμου, τον εκτελεστή της διαθήκης, τον κηδεμόνα ή εκκαθαριστή

Διαβάστε περισσότερα

Διδαγμένο κείμενο Αριστοτέλους, Ηθικά Νικομάχεια Β6, 4 10

Διδαγμένο κείμενο Αριστοτέλους, Ηθικά Νικομάχεια Β6, 4 10 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Διδαγμένο κείμενο Αριστοτέλους, Ηθικά Νικομάχεια Β6, 4 10 Ἐν παντί δή συνεχεῖ καί διαιρετῷ ἔστι λαβεῖν τό μέν πλεῖον τό δʹ ἔλαττον τό δʹ ἴσον,

Διαβάστε περισσότερα

ΗΛΕΚΤΡΙΚΗ ΕΝΕΡΓΕΙΑ ΣΤΗ ΚΡΗΤΗ

ΗΛΕΚΤΡΙΚΗ ΕΝΕΡΓΕΙΑ ΣΤΗ ΚΡΗΤΗ ΗΛΕΚΤΡΙΚΗ ΕΝΕΡΓΕΙΑ ΣΤΗ ΚΡΗΤΗ ΑΝΤΙΟΠΗ ΓΙΓΑΝΤΙ ΟΥ Τοµεάρχης Λειτουργίας Κέντρων Ελέγχου Συστηµάτων Μεταφοράς ιεύθυνσης ιαχείρισης Νησιών ΗΛΕΚΤΡΙΚΟ ΣΥΣΤΗΜΑ ΚΡΗΤΗΣ 2009 Εγκατεστηµένη Ισχύς (Ατµοµονάδες, Μονάδες

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

ΣΥΝΟΛΑ (προσέξτε τα κοινά χαρακτηριστικά των παρακάτω προτάσεων) Οι άνθρωποι που σπουδάζουν ΤΠ&ΕΣ και βρίσκονται στην αίθουσα

ΣΥΝΟΛΑ (προσέξτε τα κοινά χαρακτηριστικά των παρακάτω προτάσεων) Οι άνθρωποι που σπουδάζουν ΤΠ&ΕΣ και βρίσκονται στην αίθουσα ΣΥΝΟΛΑ (προσέξτε τα κοινά χαρακτηριστικά των παρακάτω προτάσεων) Οι άνθρωποι που σπουδάζουν ΤΠ&ΕΣ και βρίσκονται στην αίθουσα Τα βιβλία διακριτών μαθηματικών του Γ.Β. Η/Υ με επεξεργαστή Pentium και χωρητικότητα

Διαβάστε περισσότερα

Pointers. Σημερινό Μάθημα! Χρήση pointer Τελεστής * Τελεστής & Γενικοί δείκτες Ανάκληση Δέσμευση μνήμης new / delete Pointer σε αντικείμενο 2

Pointers. Σημερινό Μάθημα! Χρήση pointer Τελεστής * Τελεστής & Γενικοί δείκτες Ανάκληση Δέσμευση μνήμης new / delete Pointer σε αντικείμενο 2 Pointers 1 Σημερινό Μάθημα! Χρήση pointer Τελεστής * Τελεστής & Γενικοί δείκτες Ανάκληση Δέσμευση μνήμης new / delete Pointer σε αντικείμενο 2 1 Μνήμη μεταβλητών Κάθε μεταβλητή έχει διεύθυνση Δεν χρειάζεται

Διαβάστε περισσότερα

- 1 - Ποιοι κερδίζουν από το εμπόριο αγαθών και υπηρεσιών; Γιατί η άμεση ανταλλαγή αγαθών, ορισμένες φορές, είναι δύσκολο να

- 1 - Ποιοι κερδίζουν από το εμπόριο αγαθών και υπηρεσιών; Γιατί η άμεση ανταλλαγή αγαθών, ορισμένες φορές, είναι δύσκολο να - 1 - Ο παράξενος πραματευτής Ανθολόγιο Ε & Στ τάξης: 277-279 Οικονομικές έννοιες Ανταλλαγή Αντιπραγματισμός Εμπόριο Ερωτήσεις Ποιοι κερδίζουν από το εμπόριο αγαθών και υπηρεσιών; Γιατί η άμεση ανταλλαγή

Διαβάστε περισσότερα

Αναγνώριση Προτύπων. Σημερινό Μάθημα

Αναγνώριση Προτύπων. Σημερινό Μάθημα Αναγνώριση Προτύπων Σημερινό Μάθημα Bias (απόκλιση) και variance (διακύμανση) Ελεύθεροι Παράμετροι Ελεύθεροι Παράμετροι Διαίρεση dataset Μέθοδος holdout Cross Validation Bootstrap Bias (απόκλιση) και variance

Διαβάστε περισσότερα

Κεφάλαιο 9 Ο κυτταρικός κύκλος

Κεφάλαιο 9 Ο κυτταρικός κύκλος Κεφάλαιο 9 Ο κυτταρικός κύκλος Γ. Ρήγας Α. Αθανασίου 127 ΕΙΣΑΓΩΓΗ Κάθε ζωντανός οργανισμός αποτελείται από μονάδες που ονομάζονται κύτταρα, τα οποία συγκροτούν ομάδες, τα όργανα, που με την σειρά τους

Διαβάστε περισσότερα

Ι, 30-32. Α. Ερωτήσεις ανοικτού τύπου ή ελεύθερης ανάπτυξης

Ι, 30-32. Α. Ερωτήσεις ανοικτού τύπου ή ελεύθερης ανάπτυξης Ι, 30-32 1. Παραδείγµατα ερµηνευτικών ερωτήσεων Α. Ερωτήσεις ανοικτού τύπου ή ελεύθερης ανάπτυξης 1. Σε ποιες ενέργειες προβαίνει ο Λύσανδρος σύµφωνα µε τη διήγηση του Ξενοφώντα σ αυτές τις παραγράφους;

Διαβάστε περισσότερα

Σχέσεις και ιδιότητές τους

Σχέσεις και ιδιότητές τους Σχέσεις και ιδιότητές τους Διμελής (binary) σχέση Σ από σύνολο Χ σε σύνολο Υ είναι ένα υποσύνολο του καρτεσιανού γινομένου Χ Υ. Αν (χ,ψ) Σ, λέμε ότι το χ σχετίζεται με το ψ και σημειώνουμε χσψ. Στην περίπτωση

Διαβάστε περισσότερα

ΣΥΜΦΡΑΣΤΙΚΟΣ ΠΙΝΑΚΑΣ ΛΕΞΕ0Ν ΓΙ0ΡΓΟΥ ΣΕΦΕΡΗ

ΣΥΜΦΡΑΣΤΙΚΟΣ ΠΙΝΑΚΑΣ ΛΕΞΕ0Ν ΓΙ0ΡΓΟΥ ΣΕΦΕΡΗ 3 Kazazis, Ioannis N; Müller, Vincent C. and Sistakou, Evina (eds.) (2003), Συμφραστικός πίνακας λέξεων στο ποιητικό έργο του Γιώργου Σεφέρη [A concordance to the poems of Georgios Seferis] (Thessaloniki:

Διαβάστε περισσότερα

Α) Ανάλογα με τη φύση των κονδυλίων που περιλαμβάνουν οι προϋπολογισμοί διακρίνονται σε:

Α) Ανάλογα με τη φύση των κονδυλίων που περιλαμβάνουν οι προϋπολογισμοί διακρίνονται σε: Ο διαγωνισμός της Εθνικής Σχολής Δημόσιας Διοίκησης προϋποθέτει, ως γνωστόν, συνδυασμό συνδυαστικής γνώσης της εξεταστέας ύλης και θεμάτων πολιτικής και οικονομικής επικαιρότητας. Tα Πανεπιστημιακά Φροντιστήρια

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

πράγματα και με τον σχέση με υπερβολή επαινείτα το μέσον τρόπο (γι της αρετής; Να γνώρισμα μεσότητα Β1. Συχνά διάσταση κείμενο.

πράγματα και με τον σχέση με υπερβολή επαινείτα το μέσον τρόπο (γι της αρετής; Να γνώρισμα μεσότητα Β1. Συχνά διάσταση κείμενο. ΜΑΘΗΜΑΑ / ΤΑΞΗ : ΗΜΕΡΟΜΗΝΙΑ: ΑΡΧΑΙΑΑ ΕΛΛΗΝΙΚΑΑ Γ ΛΥΚΕΙΟΥ 28/2/2016 ΑΠΑΝΤΗΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ Α1. Μετάφραση ΔΙΔΑΓΜΕΝΟ ΚΕΙΜΕΝΟ Όμως το να αισθανθεί κανείς αυτά τη στιγμή που πρέπει και σε σχέση με τα πράγματα

Διαβάστε περισσότερα

Εξαναγκασμένες ταλαντώσεις, Ιδιοτιμές με πολλαπλότητα, Εκθετικά πινάκων. 9 Απριλίου 2013, Βόλος

Εξαναγκασμένες ταλαντώσεις, Ιδιοτιμές με πολλαπλότητα, Εκθετικά πινάκων. 9 Απριλίου 2013, Βόλος ιαφορικές Εξισώσεις Εξαναγκασμένες ταλαντώσεις, Ιδιοτιμές με πολλαπλότητα, Ατελείς ιδιοτιμές Εκθετικά πινάκων Μανόλης Βάβαλης Τμήμα Μηχανικών Η/Υ Τηλεπικοινωνιών και ικτύων Πανεπιστήμιο Θεσσαλίας 9 Απριλίου

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 2/12/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

ΠΑΡΑ ΕΙΓΜΑΤΑ ΚΡΙΤΗΡΙΩΝ ΑΞΙΟΛΟΓΗΣΗΣ

ΠΑΡΑ ΕΙΓΜΑΤΑ ΚΡΙΤΗΡΙΩΝ ΑΞΙΟΛΟΓΗΣΗΣ ΠΑΡΑ ΕΙΓΜΑΤΑ ΚΡΙΤΗΡΙΩΝ ΑΞΙΟΛΟΓΗΣΗΣ 1. Κριτήριο για ολιγόλεπτη εξέταση 60 (15 ) Στοιχεία µαθητή Ονοµατεπώνυµο:... Εξεταζόµενο µάθηµα: Αρχαία Ελληνική Γραµµατεία (µάθηµα κατεύθυνσης) Τάξη:... Ηµεροµηνία

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα

ΕΚΘΕΣΕΙΣ ΑΠΟΛΟΓΙΣΜΟΥ

ΕΚΘΕΣΕΙΣ ΑΠΟΛΟΓΙΣΜΟΥ ΕΚΘΕΣΕΙΣ ΑΠΟΛΟΓΙΣΜΟΥ ΥΠΟΒΟΛΗ ΑΠΟΔΟΧΗ ΑΞΙΟΛΟΓΗΣΗ Αθήνα, 16 Οκτωβρίου 2009 Παναγιάρη Μαρία, Πολυμερή Σχέδια «Μεταφορά Καινοτομίας» ΥΠΟΒΟΛΗ ΕΚΘΕΣΕΩΝ ΑΠΟΛΟΓΙΣΜΟΥ (1) ΠΟΤΕ; Στη μέση της υλοποίησης (άρθρο V

Διαβάστε περισσότερα

Τρίτη, 05 Ιουνίου 2001 ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΑΝΑΠΤΥΞΗ ΕΦΑΡΜΟΓΩΝ ΣΕ ΠΡΟΓΡΑΜΜΑΤΙΣΤΙΚΟ ΠΕΡΙΒΑΛΛΟΝ

Τρίτη, 05 Ιουνίου 2001 ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΑΝΑΠΤΥΞΗ ΕΦΑΡΜΟΓΩΝ ΣΕ ΠΡΟΓΡΑΜΜΑΤΙΣΤΙΚΟ ΠΕΡΙΒΑΛΛΟΝ Τρίτη, 05 Ιουνίου 2001 ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΑΝΑΠΤΥΞΗ ΕΦΑΡΜΟΓΩΝ ΣΕ ΠΡΟΓΡΑΜΜΑΤΙΣΤΙΚΟ ΠΕΡΙΒΑΛΛΟΝ ΘΕΜΑ 1 Α. Να µεταφέρετε στο τετράδιό σας και να συµπληρώσετε τον παρακάτω πίνακα αλήθειας δύο προτάσεων

Διαβάστε περισσότερα

Φροντιστήριο 2: Ανάλυση Αλγόριθμου. Νικόλας Νικολάου ΕΠΛ432: Κατανεμημένοι Αλγόριθμοι 1 / 10

Φροντιστήριο 2: Ανάλυση Αλγόριθμου. Νικόλας Νικολάου ΕΠΛ432: Κατανεμημένοι Αλγόριθμοι 1 / 10 Φροντιστήριο 2: Ανάλυση Αλγόριθμου Εκλογής Προέδρου με O(nlogn) μηνύματα Νικόλας Νικολάου ΕΠΛ432: Κατανεμημένοι Αλγόριθμοι 1 / 10 Περιγραφικός Αλγόριθμος Αρχικά στείλε μήνυμα εξερεύνησης προς τα δεξιά

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 24 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΥ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΗΛΕΚΤΡΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ : ΕΞΙ

Διαβάστε περισσότερα

{ i f i == 0 and p > 0

{ i f i == 0 and p > 0 ΟΙΚΟΝΟΜΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ - ΤΜΗΜΑ ΠΛΗΡΟΦΟΡΙΚΗΣ ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΕΠΙΣΤΗΜΗΣ ΥΠΟΛΟΓΙΣΤΩΝ Σχεδίαση και Ανάλυση Αλγορίθμων Διδάσκων: Ε. Μαρκάκης, Φθινοπωρινό εξάμηνο 014-015 Λύσεις 1ης Σειράς Ασκήσεων

Διαβάστε περισσότερα

ΕΚΦΡΑΣΗ ΕΚΘΕΣΗ Α ΛΥΚΕΙΟΥ. www.epignosi.edu.gr. Επιμέλεια θεμάτων και απαντήσεων: Μεταξά Ελευθερία. Κείμενο

ΕΚΦΡΑΣΗ ΕΚΘΕΣΗ Α ΛΥΚΕΙΟΥ. www.epignosi.edu.gr. Επιμέλεια θεμάτων και απαντήσεων: Μεταξά Ελευθερία. Κείμενο ΕΚΦΡΑΣΗ ΕΚΘΕΣΗ Α ΛΥΚΕΙΟΥ Επιμέλεια θεμάτων και απαντήσεων: Μεταξά Ελευθερία Κείμενο Θα μου ειπήτε. «Και πώς! Μας είναι τόσο χρήσιμες και τόσο ευεργετικές οι ξένες γλώσσες; Η γλωσσομάθεια, το ασφαλισμένον

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 04/09/2016 ΘΕΜΑ Α Α.1. β. Α.2. β. Α.3. γ. Α.4. δ. ΑΠΑΝΤΗΣΕΙΣ Α.5. β. Μονάδες 25 ΘΕΜΑ Β Β. 1. Ιχνηθέτηση. είναι η σήμανση χημικών

Διαβάστε περισσότερα

ΑΣΕΠ 2000 ΑΣΕΠ 2000 Εμπορική Τράπεζα 1983 Υπουργείο Κοιν. Υπηρ. 1983

ΑΣΕΠ 2000 ΑΣΕΠ 2000 Εμπορική Τράπεζα 1983 Υπουργείο Κοιν. Υπηρ. 1983 20 Φεβρουαρίου 2010 ΑΣΕΠ 2000 1. Η δεξαμενή βενζίνης ενός πρατηρίου υγρών καυσίμων είναι γεμάτη κατά τα 8/9. Κατά τη διάρκεια μιας εβδομάδας το πρατήριο διέθεσε τα 3/4 της βενζίνης αυτής και έμειναν 4000

Διαβάστε περισσότερα

Το κύτταρο. Μαυροματάκης Γιώργος - Βιολόγος

Το κύτταρο. Μαυροματάκης Γιώργος - Βιολόγος Το κύτταρο Κυτταρική θεωρία 1. Το κύτταρο είναι η θεμελιώδης μονάδα της ζωής 2. Κάθε κύτταρο προέρχεται από διαίρεση προϋπάρχοντος κυττάρου Κυτταρικές διαιρέσεις Μίτωση, κατασκευάζουμε νέα σωματικά κύτταρα,

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΕΛΛΗΝΙΚΟ ΑΝΟΙΚΤΟ ΠΑΝΕΠΙΣΤΗΜΙΟ. Τρίτη Γραπτή Εργασία στη Στατιστική

ΕΛΛΗΝΙΚΟ ΑΝΟΙΚΤΟ ΠΑΝΕΠΙΣΤΗΜΙΟ. Τρίτη Γραπτή Εργασία στη Στατιστική ΕΛΛΗΝΙΚΟ ΑΝΟΙΚΤΟ ΠΑΝΕΠΙΣΤΗΜΙΟ Πρόγραμμα Σπουδών: ΔΙΟΙΚΗΣΗ ΕΠΙΧΕΙΡΗΣΕΩΝ και ΟΡΓΑΝΙΣΜΩΝ Θεματική Ενότητα: ΔΕΟ-13 Ποσοτικές Μέθοδοι Ακαδημαϊκό Έτος: 2011-12 Τρίτη Γραπτή Εργασία στη Στατιστική Γενικές οδηγίες

Διαβάστε περισσότερα

ΘΕΩΡΙΑ ΣΥΝΟΛΩΝ: μια σύνοψη των θεμελιακών χαρακτηριστικών.

ΘΕΩΡΙΑ ΣΥΝΟΛΩΝ: μια σύνοψη των θεμελιακών χαρακτηριστικών. ΘΕΩΡΙ ΣΥΝΟΛΩΝ: μια σύνοψη των θεμελιακών χαρακτηριστικών. 1. ΣΥΝΟΛ: το σκεπτικό. σύνολο = πολλά στοιχεία ως «ένα», ως «μία» ολότητα. τα στοιχεία ανήκουν στο σύνολο, ή είναι μέλη του συνόλου το σύνολο περιέχει

Διαβάστε περισσότερα

ιδαγμένο κείμενο Ἀριστοτέλους, Ἠθικὰ Νικομάχεια Β6, 4-10

ιδαγμένο κείμενο Ἀριστοτέλους, Ἠθικὰ Νικομάχεια Β6, 4-10 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 29 ΜΑÏΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ιδαγμένο κείμενο Ἀριστοτέλους,

Διαβάστε περισσότερα

ΜΑΘΗΜΑ: ΠΟΛΙΤΙΚΗ ΟΙΚΟΝΟΜΙΑ-ΔΗΜΟΣΙΑ ΟΙΚΟΝΟΜΙΚΗ

ΜΑΘΗΜΑ: ΠΟΛΙΤΙΚΗ ΟΙΚΟΝΟΜΙΑ-ΔΗΜΟΣΙΑ ΟΙΚΟΝΟΜΙΚΗ ΜΑΘΗΜΑ: ΠΟΛΙΤΙΚΗ ΟΙΚΟΝΟΜΙΑ-ΔΗΜΟΣΙΑ ΟΙΚΟΝΟΜΙΚΗ Σύνταξη: Παπαδόπουλος Θεοχάρης, Οικονομολόγος, MSc, PhD Candidate Κατηγορίες οφέλους και κόστους που προέρχονται από τις δημόσιες δαπάνες Για την αξιολόγηση

Διαβάστε περισσότερα

ΑΠΑΝΣΗΕΙ ΣΟΤ ΔΙΑΓΩΝΙΜΑΣΟ ΔΙΔΑΓΜΕΝΟ ΚΕΙΜΕΝΟ

ΑΠΑΝΣΗΕΙ ΣΟΤ ΔΙΑΓΩΝΙΜΑΣΟ ΔΙΔΑΓΜΕΝΟ ΚΕΙΜΕΝΟ ΑΠΑΝΣΗΕΙ ΣΟΤ ΔΙΑΓΩΝΙΜΑΣΟ ΔΙΔΑΓΜΕΝΟ ΚΕΙΜΕΝΟ Α. Από το κείμενο που σας δίνεται να μεταφράσετε τα αποσπάσματα: «Ἐξ οὗ καὶ δῆλον< ἄλλως ἂν ἐθισθείη» και «Μαρτυρεῖ δὲ< πολιτείας ἀγαθὴ φαύλης». Βλέπετε βιβλίο

Διαβάστε περισσότερα

ΤΙΜΕΣ DISNEYLAND RESORT PARIS

ΤΙΜΕΣ DISNEYLAND RESORT PARIS ΤΙΜΕΣ DISNEYLAND RESORT PARIS 09 Νοεµβρίου 2009 01 Απριλίου 2010 DISNEYLAND 4 3 2 1 4 3 2 1 4 3 2 1 CHD ΠΑΚΕΤΟ 2N/3Μ 350 419 558 973 392 475 641 1140 491 607 840 1538 117 ΠΑΚΕΤΟ 3N/4Μ 464 562 760 1353

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

ΣΟΦΟΚΛΕΟΥΣ ΑΝΤΙΓΟΝΗ Κείμενο από το πρωτότυπο (στίχοι 672-691)

ΣΟΦΟΚΛΕΟΥΣ ΑΝΤΙΓΟΝΗ Κείμενο από το πρωτότυπο (στίχοι 672-691) ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ Β ΤΑΞΗΣ ΠΕΜΠΤΗ 29 ΜΑΪΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΗ ΓΛΩΣΣΑ ΚΑΙ ΓΡΑΜΜΑΤΕΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΣΟΦΟΚΛΕΟΥΣ ΑΝΤΙΓΟΝΗ Κείμενο από το πρωτότυπο (στίχοι

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Αστρολογία. Σύντομο ιστορικό. Βασικές γνώσεις της αστρολογίας

Αστρολογία. Σύντομο ιστορικό. Βασικές γνώσεις της αστρολογίας Αφιερώνεται α) στις ευειδείς(;) Αστρολόγες, που μας βομβαρδίζουν μέσω καναλιών, εφημερίδων και περιοδικών από πρωίας μέχρι νυκτός με αστρολογικές «προβλέψεις» υποβολές συμπεριφορών και β) στους πνευματικά

Διαβάστε περισσότερα

ΑΡΙΣΤΟΤΕΛΗΣ, ΒΙΟΣ ΚΑΙ ΕΡΓΑ σελ.139 149 ΕΡΩΤΗΣΕΙΣ ΑΠΑΝΤΗΣΕΙΣ ΕΙΣΑΓΩΓΗΣ ΣΧΟΛΙΚΟΥ ΒΙΒΛΙΟΥ

ΑΡΙΣΤΟΤΕΛΗΣ, ΒΙΟΣ ΚΑΙ ΕΡΓΑ σελ.139 149 ΕΡΩΤΗΣΕΙΣ ΑΠΑΝΤΗΣΕΙΣ ΕΙΣΑΓΩΓΗΣ ΣΧΟΛΙΚΟΥ ΒΙΒΛΙΟΥ ΑΡΙΣΤΟΤΕΛΗΣ, ΒΙΟΣ ΚΑΙ ΕΡΓΑ σελ.139 149 ΕΡΩΤΗΣΕΙΣ ΑΠΑΝΤΗΣΕΙΣ ΕΙΣΑΓΩΓΗΣ ΣΧΟΛΙΚΟΥ ΒΙΒΛΙΟΥ 1. Πότε έφτασε ο Αριστοτέλης στην Αθήνα για πρώτη φορά και γιατί επέλεξε την Ακαδημία για τις σπουδές του; Σελίδα

Διαβάστε περισσότερα

ΔΙΚΑΙΩΜΑΤΑ ΠΡΟΣΟΡΜΙΣΗΣ, ΠΑΡΑΒΟΛΗΣ, ΠΡΥΜΝΟΔΕΤΗΣΗΣ ΚΑΙ ΕΛΛΙΜΕΝΙΣΜΟΥ ΣΚΑΦΩΝ ΣΕ ΘΑΛΑΣΣΙΕΣ ΠΕΡΙΟΧΕΣ. (ΛΙΜΑΝΙΑ κ.λπ.) ΤΟΠΙΚΗΣ ΑΡΜΟΔΙΟΤΗΤΑΣ ΛΙΜΕΝΙΚΩΝ

ΔΙΚΑΙΩΜΑΤΑ ΠΡΟΣΟΡΜΙΣΗΣ, ΠΑΡΑΒΟΛΗΣ, ΠΡΥΜΝΟΔΕΤΗΣΗΣ ΚΑΙ ΕΛΛΙΜΕΝΙΣΜΟΥ ΣΚΑΦΩΝ ΣΕ ΘΑΛΑΣΣΙΕΣ ΠΕΡΙΟΧΕΣ. (ΛΙΜΑΝΙΑ κ.λπ.) ΤΟΠΙΚΗΣ ΑΡΜΟΔΙΟΤΗΤΑΣ ΛΙΜΕΝΙΚΩΝ ΔΙΚΑΙΩΜΑΤΑ ΠΡΟΣΟΡΜΙΣΗΣ, ΠΑΡΑΒΟΛΗΣ, ΠΡΥΜΝΟΔΕΤΗΣΗΣ ΚΑΙ ΕΛΛΙΜΕΝΙΣΜΟΥ ΣΚΑΦΩΝ ΣΕ ΘΑΛΑΣΣΙΕΣ ΠΕΡΙΟΧΕΣ (ΛΙΜΑΝΙΑ κ.λπ.) ΤΟΠΙΚΗΣ ΑΡΜΟΔΙΟΤΗΤΑΣ ΛΙΜΕΝΙΚΩΝ ΤΑΜΕΙΩΝ ΚΑΙ ΔΗΜΟΤΙΚΩΝ ΛΙΜΕΝΙΚΩΝ ΤΑΜΕΙΩΝ Επιμέλεια Άγγελου Αργυρακόπουλου

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι:

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: α. γραµµικό δίκλωνοdνα β. γραµµικό

Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα

O Gregor Mendel & η επανανακάλυψη της μεντελιανής γενετικής. Iστορία της Bιολογίας Mάθη.α 12 02/06/2016

O Gregor Mendel & η επανανακάλυψη της μεντελιανής γενετικής. Iστορία της Bιολογίας Mάθη.α 12 02/06/2016 O Gregor Mendel & η επανανακάλυψη της μεντελιανής γενετικής Iστορία της Bιολογίας Mάθη.α 12 02/06/2016 Experience of artificial fertilisation, such as is effected with ornamental plants in order to obtain

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 1 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

Εγκύκλιος Ε.Φ.Ο.Τ. 2013/1

Εγκύκλιος Ε.Φ.Ο.Τ. 2013/1 Εγκύκλιος Ε.Φ.Ο.Τ. 2013/1 Θέμα : Βαθμολογούμενοι Αγώνες, Τρόπος Βαθμολόγησης. Οι βαθμολογούμενοι αγώνες για το έτος 2013 είναι οι κάτωθι : - Πανελλήνιο Πρωτάθλημα 2x18μ. - Ανοιχτό Πρωτάθλημα 2x70μ. για

Διαβάστε περισσότερα

ΣΟΦΟΚΛΕΟΥΣ ΑΝΤΙΓΟΝΗ Κείµενο από το πρωτότυπο (στ.471-490) ΧΟΡΟΣ ηλοῖ τὸ γέννηµ' ὠµὸν ἐξ ὠµοῦ πατρὸς 471 τῆς παιδὸς εἴκειν δ'οὐκ ἐπίσταται κακοῖς.

ΣΟΦΟΚΛΕΟΥΣ ΑΝΤΙΓΟΝΗ Κείµενο από το πρωτότυπο (στ.471-490) ΧΟΡΟΣ ηλοῖ τὸ γέννηµ' ὠµὸν ἐξ ὠµοῦ πατρὸς 471 τῆς παιδὸς εἴκειν δ'οὐκ ἐπίσταται κακοῖς. ΑΡΧΗ ΜΗΝΥΜΑΤΟΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 24 ΙΟΥΝΙΟΥ 1999 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΣΟΦΟΚΛΕΟΥΣ ΑΝΤΙΓΟΝΗ Κείµενο από το πρωτότυπο

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

Εκφωνήσεις και Λύσεις των Θεμάτων

Εκφωνήσεις και Λύσεις των Θεμάτων ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΜΑΘΗΜΑΤΙΚΑ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Δευτέρα 8 Μαΐου 0 Εκφωνήσεις και Λύσεις των Θεμάτων

Διαβάστε περισσότερα

Ταξινόμηση των μοντέλων διασποράς ατμοσφαιρικών ρύπων βασισμένη σε μαθηματικά κριτήρια.

Ταξινόμηση των μοντέλων διασποράς ατμοσφαιρικών ρύπων βασισμένη σε μαθηματικά κριτήρια. ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ Ταξινόμηη των μοντέλων διαποράς ατμοφαιρικών ρύπων βαιμένη ε μαθηματικά κριτήρια. Μοντέλο Ελεριανά μοντέλα (Elerian) Λαγκρατζιανά μοντέλα (Lagrangian) Επιπρόθετος διαχωριμός Μοντέλα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 B ΦΑΣΗ. ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Τετάρτη 4 Μαΐου 2016 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ÏÅÖÅ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 B ΦΑΣΗ. ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Τετάρτη 4 Μαΐου 2016 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ÏÅÖÅ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Τετάρτη 4 Μαΐου 2016 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από

Διαβάστε περισσότερα

Ο τύπος του Itô. f (s) ds (12.1) f (g(s)) dg(s). (12.2) t f (B s ) db s + 1 2

Ο τύπος του Itô. f (s) ds (12.1) f (g(s)) dg(s). (12.2) t f (B s ) db s + 1 2 12 Ο τύπος του Itô Για συνάρτηση f : R R με συνεχή παράγωγο, έχουμε d f (s) = f (s) ds που σε ολοκληρωτική μορφή σημαίνει f (b) f (a) = b a f (s) ds (12.1) για κάθε a < b. Αν επιπλέον και η g : R R έχει

Διαβάστε περισσότερα

ΑΡΧΑΙΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΑΡΧΑΙΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Διδαγμένο κείμενο Ἀριστοτέλους Ἠθικά Νικομάχεια Β 6, 12 16 Ἡ δ ἀρετὴ περὶ πάθη καὶ πράξεις ἐστίν, ἐν οἷς ἡ μὲν ὑπερβολὴ ἁμαρτάνεται καὶ ψέγεται καὶ ἡ ἔλλειψις, τὸ δὲ μέσον ἐπαινεῖται καὶ κατορθοῦται ταῦτα

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

ΤΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΣΥΣΤΗΜΑ

ΤΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΣΥΣΤΗΜΑ 1 ΤΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΣΥΣΤΗΜΑ Οι τάξεις της Β και Γ Λυκείου είναι χωρισμένες σε τρείς Κατευθύνσεις Θεωρητική, Θετική, Τεχνολογική Οι Σχολές είναι ταξινομημένες σε πέντε επιστημονικά πεδία 1 ο ΕΠΙΣΤΗΜΟΝΙΚΟ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

ιδαγµένο κείµενο 'Αριστοτέλους 'Ηθικά Νικοµάχεια (Β6, 4-10)

ιδαγµένο κείµενο 'Αριστοτέλους 'Ηθικά Νικοµάχεια (Β6, 4-10) ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 29 ΜΑΪΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ιδαγµένο κείµενο 'Αριστοτέλους 'Ηθικά

Διαβάστε περισσότερα

Ημέρα 4 η (α) Αγορά και πώληση της εργασιακής δύναμης. (β) Η απόλυτη υπεραξία. Αγορά και πώληση της εργασιακής δύναμης

Ημέρα 4 η (α) Αγορά και πώληση της εργασιακής δύναμης. (β) Η απόλυτη υπεραξία. Αγορά και πώληση της εργασιακής δύναμης Ημέρα 4 η (α) Αγορά και πώληση της εργασιακής δύναμης (β) Η απόλυτη υπεραξία Αγορά και πώληση της εργασιακής δύναμης Στο κεφάλαιο για την αγορά και την πώληση της εργατικής δύναμης (ελληνική έκδοση: τόμος

Διαβάστε περισσότερα

Οι Τρείς «Διαστάσεις» για το Σώμα (Eugene T. Gendlin)

Οι Τρείς «Διαστάσεις» για το Σώμα (Eugene T. Gendlin) Οι Τρείς «Διαστάσεις» για το Σώμα (Eugene T. Gendlin) Εισαγωγή: Θα ξεκινήσουμε με την ερώτηση: Πού στηρίζεται θεωρητικά η Διαδικασία Εστίασης (ΔΕ); και στην συνέχεια θα προσπαθήσουμε να εξηγήσουμε πώς

Διαβάστε περισσότερα

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την

Διαβάστε περισσότερα

17 Μαρτίου 2013, Βόλος

17 Μαρτίου 2013, Βόλος Συνήθεις ιαφορικές Εξισώσεις 1ης Τάξης Σ Ε 1ης τάξης, Πεδία κατευθύνσεων, Υπαρξη και μοναδικότητα, ιαχωρίσιμες εξισώσεις, Ολοκληρωτικοί παράγοντες, Αντικαταστάσεις, Αυτόνομες εξισώσεις Μανόλης Βάβαλης

Διαβάστε περισσότερα