Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:




2 ΘΕΜΑ Α Α1: Να ση)ειώσετε στο γρα1τό σας δί1λα α1ό τον αριθ)ό καθε)ιάς α1ό τις 1αρακάτω η)ιτελείς 1ροτάσεις 1 εως 5 το γρά))α 1ου αντιστοιχεί στη λέξη ή τη φράση, η ο1οία συ)1ληρώνει σωστά την 1ρόταση: 1. Ποιο α%ό τα %αρακάτω α%οτελείται α%ό DNA; Α) Οι 1εταγραφικοί %αράγοντες Β) Ο υ%οκινητής Γ) Το %ρι1όσω1α ) Η DNA %ολυ1εράση 2. εν είναι φαρ1ακευτικές %ρωτεΐνες: Α) τα καρκινικά αντιγόνα Β) οι ιντερφερόνες Γ) η αυξητική ορ1όνη ) η ινσουλίνη 3. Το κλωνο%οιη1ένο %ρόβατο Dolly διαθέτει: Α) Ό1οιο 1ιτοχονδριακό και %υρηνικό DNA 1ε το %ρόβατο α%ό το ο%οίο %ροέρχεται ο %υρήνας του σω1ατικού κυττάρου Β) Ό1οιο 1ιτοχονδριακό DNA 1ε το %ρόβατο α%ό το ο%οίο %ροέρχεται ο %υρήνας του σω1ατικού κυττάρου Γ) Ό1οιο %υρηνικό DNA 1ε το %ρόβατο α%ό το ο%οίο %ροέρχεται ο %υρήνας του σω1ατικού κυττάρου και ό1οιο 1ιτοχονδριακό DNA 1ε το %ρόβατο α%ό το ο%οίο %ροέρχεται το ωάριο στο ο%οίο το%οθετήθηκε ο %υρήνας ) Κανένα α%ό τα %αρα%άνω 4. Μια %ερί%τωση κατά την ο%οία ο γονότυ%ος φανερώνει το φαινότυ%ο είναι: Α) Ετερόζυγο άτο1ο %ου διαθέτει ένα ε%ικρατές και ένα υ%ολει%ό1ενο αλληλό1ορφο γονίδιο Β) Ο1όζυγο άτο1ο %ου διαθέτει δύο ε%ικρατή αλληλό1ορφα Γ) Θυληκό άτο1ο ετερόζυγο 1ε ένα φυλοσύνδετο ε%ικρατές και ένα φυλοσύνδετο υ%ολει%ό1ενο αλληλό1ορφο ) Ετερόζυγο άτο1ο %ου διαθέτει δύο συνε%ικρατή αλληλό1ορφα γονίδια 5. Η ινσουλίνη α%οτελείται α%ό 51 α1ινοξέα και διαθέτει: Α) 50 %ε%τιδικούς δεσ1ούς Β) 49 %ε%τιδικούς δεσ1ούς Γ) 51 %ε%τιδικούς δεσ1ούς ) 151 %ε%τιδικούς δεσ1ούς Μονάδες 15 Β. Να χαρακτηρίσετε )ε Σωστό (Σ) ή Λάθος (Λ) τις 1αρακάτω 1ροτάσεις: 1. Κατά τη γονιδιακή θερα%εία κληρονο1είται η διόρθωση της γενετικής βλάβης 2. Το ανασυνδυασ1ένο DNA υ%οχρεωτικά %εριέχει γονίδια %ου %ροέρχονται α%ό δύο το %ολύ οργανισ1ούς

3 3. Γυναίκες 1ε %ολλα%λές α%οβολές θα %ρέ%ει να υ%οβάλλονται σε %ρογεννητικό έλεγχο, %ριν την κύηση 4. Το %λασ1ίδιο Ti χρησι1ο%οιείται στη δη1ιουργία διαγονιδιακών φυτών 5. Στη συνεχή καλλιέργεια οι 1ικροοργανισ1οί %εθαίνουν 1ετά τη συσσώρευση των τοξικών %ροϊόντων του 1εταβολισ1ού τους Μονάδες 10 ΘΕΜΑ Β Β1. Να δώσετε τους ορισ1ούς: σιω%ηλές 1εταλλάξεις, ουδέτερες 1εταλλάξεις, αυτό1ατες 1εταλλάξεις. Μόναδες 3 Β2. Να συ1%ληρώσετε τον %ίνακα 1ε δεδο1ένο ότι αφορά κύτταρα του ανθρώ%ου: Κύτταρο Ζεύγη βάσεων Χρωμοσώματα Χρωματίδες Μόρια DNA Ινίδια χρωματίνης Σωματικό στην αρχή της μεσόφασης Σωματικό στη μετάφαση Γαμέτης Μονάδες 6 Β3. Να %εριγράψετε 1ια διαδικασία %αραγωγής διαγονιδιακών φυτών 1ε ανθεκτικότητα στα έντο1α. Ποιές κατηγορίες φυτών γνωρίζετε στις ο%οίες ήδη έχει εφαρ1οστεί η 1έθοδος αυτή; Β4. Αναφέρετε 1ε συντο1ία 1ηχανισ1ούς της καρκινογένεσης. Ποιες θερα%είες χρησι1ο%οιούνται για την αντι1ετώ%ιση του καρκίνου και %οιές θα 1%ορούσαν να χρησι1ο%οιηθούν; Μονάδες 7 Β5. Να αναφέρετε δύο λόγους για τους ο%οίους 1%ορού1ε να χρησι1ο%οιήσου1ε βακτήρια για να %αράγου1ε ανθρώ%ινες %ρωτεΐνες. ΘΕΜΑ Γ Γ1. Ένα ο%ερόνιο %εριλα1βάνει δύο χειριστές %ου υ%όκεινται στην ε%ίδραση του ίδιου καταστολέα. Ο καταστολέας συνίσταται α%ό 1ια %ε%τιδική αλυσίδα. Α) Πόσα ρυθ1ιστικά γονίδια υ%άρχουν, %όσοι υ%οκινητές και %όσες ο1άδες 1ε δο1ικά γονίδια; Β) Πόσα διαφορετικά mrna %αράγονται;

4 Γ2. Στις α1οιβαίες 1ετατο%ίσεις συ1βαίνει ανταλλαγή γενετικού υλικού 1εταξύ τ1η1άτων 1η ο1όλογων χρω1οσω1άτων, κατά τις ο%οίες συνήθως δε χάνεται γενετικό υλικό κσι δεν %ροκαλείται αλλαγή στο φαινότυ%ο του ατό1ου %ου φέρει τις αλλαγές. Είναι ό1ως %ιθανό, α%ό τα άτο1α αυτά να γεννηθούν α%όγονοι 1ε χρω1οσω1ικές ανω1αλίες. Να εξηγήσετε. Γ3. Στον %υρήνα κυττάρου εντο%ίζου1ε γονίδιο %ου α%οτελείται α%ό 1000 ζεύγη βάσεων. Το %ρόδρο1ο mrna %ου %ροκύ%τει α%ό τη 1εταγραφή του γονιδίου %εριέχει τέσσερα εσώνια συνολικού 1ήκους 200 αζωτούχων βάσεων. Το 90% του 1ήκους του ώρι1ου mrna αντιστοιχεί σε α1ινοξέα. Α) Ποια τ1ή1ατα αντιστοιχούν στο 10% του 1ήκους του ώρι1ου mrna %ου δεν 1εταφράζεται και α%ό %όσες βάσεις συνολικά α%οτελούνται; Β) εδο1ένου ότι κατά την τρο%ο%οιήση της %ολυ%ε%τιδικής αλυσίδας 1ετά τη σύνθεση της α%ο1ακρύνονται εννέα α1ινοξέα, %οιός είναι ο αριθ1ός των α1ινοξέων στο 1όριο της λειτουργικής %ρωτεΐνης %ου %ροκύ%τει α%ό το γονίδιο; Γ4. Προτού ε%ιχειρηθεί 1ια 1ετα1όσχευση έγινε έλεγχος των αντιγόνων (%ιο ακριβές: αντιγονικών καθοριστών) 5 διαθέσι1ων οργάνων και του υ%οψήφιου δέκτη. Προέκυψαν τα α%οτελέσ1ατα του %αρακάτω %ίνακα (το + ση1αίνει ότι το αντίσω1α αντέδρασε 1ε το αντιγόνο): Αντίσωμα Όργανο Α Όργανο Β Όργανο Γ Όργανο Δ Όργανο Ε Δέκτης 1ο ο ο ο ο ο ο Α) Ποιο α%ό τα όργανα είναι το καταλληλότερο; Β) Σε %όσα αντιγόνα διαφέρει ο δέκτης α%ό τα υ%όλοι%α όργανα; Γ) Να ταξινο1ήσετε τα υ%ολοι%ά όργανα ανάλογα 1ε το βαθ1ό συ1βατότητας τους 1ε το δέκτη. ) Πως %αρήχθησαν τα αντισώ1ατα %ου χρησι1ο%οιήθηκαν στον έλεγχο;

5 ΘΕΜΑ 1. Α%ό τη διασταύρωση κερα1ιδόγατων 1ε φουντωτές ουρές 1ε γάτες 1ε ουρές λε%τές (όχι φουντωτές), %ροκύ%τουν 1ίσες γατές 1ε φουντωτές ουρές και 1ισές γάτες 1ε λε%τές ουρές. Η διασταύρωση ατό1ων 1ε φουντωτή ουρά 1ε άτο1α 1ε λε%τή ουρά δίνει α%ογόνους 2 φουντωτή : 1 λε%τη. Να γράψετε τις διασταυρώσεις και να εξηγήσετε. 2. Σε δείγ1ατα γενετικού υλικού α%ό δύο διαφορετικά άτο1α %ου είχαν το σύνδρο1ο Klinefelter έγιναν ορισ1ένες εργαστηριακές δοκι1ές 1ε τη χρήση της %εριοριστικής ενδονουκλεάσης EcoRI. Η ε%ίδραση της EcoRI στα 1όρια DNA α%ό τα Χ χρω1οσώ1ατα είχε ως α%οτέλεσ1α: α) στο %ρώτο άτο1ο, το ένα Χ να διασ%αστεί σε %ερί%ου κο11άτια και το δεύτερο σε %ερί%ου β) στο δεύτερο άτο1ο, και τα δυο Χ να διασ%αστούν σε %ερί%ου κο11άτια το καθένα. Α) Πώς 1%ορεί να εξηγηθεί το γεγονός ότι στο ένα άτο1ο το %λήθος των κο11ατιών είναι το ίδιο, ενώ στο δευτερο είναι διαφορετικό; Β) Πώς 1%ορεί να εξηγηθεί το γεγονός ότι το %λήθος των κο11ατιών των δύο ατό1ων είναι διαφορετικό; Γ) Να ανα%αρασταθεί ο τρό%ος 1ε τον ο%οίο %ροέκυψαν τα σφάλ1ατα %ου οδήγησαν στη δη1ιουργία αυτών των δύο ατό1ων %ου εκδηλώνουν το σύνδρο1ο Klinefelter. 3. Ασθενής 1ε κυστική ίνωση υ%οβάλλεται σε γονιδιακή θερα%εία και δείχνει σαφή βελτίωση στην κλινική του εικόνα (υ%οχώρηση συ1%τω1άτων). Να βρείτε την %ιθανότητα να α%οκτήσει %αιδί %ου να %άσχει α%ό κυστική ίνωση. 4. Έστω αλληλουχία: 5 AATTATTACTTCTCCTCAGGAGTCAGATGCACCATCTATT 3 3 TTAATAATGAAGAGGAGTCCTCAGTCTACGTGGTAGATAA 5 H αλληλουχία 5GACTCC3 είναι εσώνιο %ου φέρει το γονίδιο στο εσωτερικό του. Να υ%οδείξετε %άνω στην αλληλουχία (αφού τη 1εταφέρετε στο τετράδιο σας) %ου βρίσκεται ο υ%οκινητής του γονιδίου. (1%ορείτε να χρησι1ο%οιήσετε γρά11ατα για να συ1βολίσετε την αλληλουχία του υ%οκινητή).



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ. Επιμέλεια: Βουδούρη Καλλιρρόη. Ριζηνίας 69 & Λασαίας 21 τηλ

ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ. Επιμέλεια: Βουδούρη Καλλιρρόη. Ριζηνίας 69 & Λασαίας 21 τηλ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ Επιμέλεια: Βουδούρη Καλλιρρόη ΘΕΜΑ Α Α1. Να ση)ειώσετε στο γρα1τό σας δί1λα α1ό τον αριθ)ό καθε)ιάς α1ό τις 1αρακάτω η)ιτελείς 1ροτάσεις 1 εως 5 το γρά))α 1ου

Διαβάστε περισσότερα


ΟΙ ΔΙΑΦΟΡΕΤΙΚΕΣ ΜΕΘΟΔΟΙ ΜΕΛΕΤΗΣ ΤΗΣ ΠΑΡΑΓΩΓΗΣ ΤΩΝ ΛΕΞΕΩΝ ΟΙ ΔΙΑΦΟΡΕΤΙΚΕΣ ΜΕΘΟΔΟΙ ΜΕΛΕΤΗΣ ΤΗΣ ΠΑΡΑΓΩΓΗΣ ΤΩΝ ΛΕΞΕΩΝ Οι #έθοδοι (ου (αρουσιάζονται χωρίζονται σε δύο κατηγορίες: Εκείνες (ου βασίζονται στην ανάλυση των (αραγωγών ( off-line ) (λάθη (αραγωγής, φαινό#ενο

Διαβάστε περισσότερα

Θεωρία γλωσσικής σχετικότητας

Θεωρία γλωσσικής σχετικότητας Γλώσσα και σκέψη Συμπεριφορισμός Watson: υ"οστήριξε ότι η σκέψη είναι 3ια 3η φωνού3ενη γλώσσα και ε"ο3ένως όταν οι άνθρω"οι σκέφτονται, δεν κάνουν τί"οτε άλλο α"ό το να 3ιλούν εσωτερικά στον εαυτό τους.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Επίπεδα επεξεργασίας στην κατονομασία λέξεων

Επίπεδα επεξεργασίας στην κατονομασία λέξεων Επίπεδα επεξεργασίας στην κατονομασία λέξεων Λεξική 'ρόσβαση: 'ρόσβαση στις λέξεις, ανάκτηση α'ό τη 4νή4η Πρόβλη4α: Πώς 'αράγονται σε 'ραγ4ατικό χρόνο οι κατάλληλες γλωσσολογικές 4ονάδες για την έκφραση

Διαβάστε περισσότερα

Άσκηση 9 Ένα Υ+όδειγ&α Α+οτα&ιεύσεων ύο Περιόδων και το Ισοζύγιο Πληρω&ών

Άσκηση 9 Ένα Υ+όδειγ&α Α+οτα&ιεύσεων ύο Περιόδων και το Ισοζύγιο Πληρω&ών Οικονο&ικό Πανε+ιστή&ιο Αθηνών Τ"ή"α Οικονο"ικής Ε,ιστή"ης Καθηγητής Γιώργος Αλογοσκούφης 473 ιεθνής Οικονο"ική Εαρινό Εξά"ηνο 204-5 Άσκηση 9 Ένα Υ+όδειγ&α Α+οτα&ιεύσεων ύο Περιόδων και το Ισοζύγιο Πληρω&ών

Διαβάστε περισσότερα

Τα αυξηµένα επίπεδα του microrna-146a υποστηρίζουν το σηµαντικό ρόλο του οξειδωτικού στρες κατά την αρχική φάση του εµφράγµατος του µυοκαρδίου

Τα αυξηµένα επίπεδα του microrna-146a υποστηρίζουν το σηµαντικό ρόλο του οξειδωτικού στρες κατά την αρχική φάση του εµφράγµατος του µυοκαρδίου Τα αυξηµένα επίπεδα του microrna-146a υποστηρίζουν το σηµαντικό ρόλο του οξειδωτικού στρες κατά την αρχική φάση του εµφράγµατος του µυοκαρδίου Μέτρηση του microrna - 208α για τη διάγνωση του εµφράγµατος

Διαβάστε περισσότερα

Διαδραστική συζήτηση: Ρεαλισµός και υπερβολές στη διατροφή του Σακχαρώδη Διαβήτη

Διαδραστική συζήτηση: Ρεαλισµός και υπερβολές στη διατροφή του Σακχαρώδη Διαβήτη Ε"ιστη'ονική Η'ερίδα για ιαιτολόγους- ιατροφολόγους της Ελληνικής Εταιρείας Μελέτης και Εκ"αίδευσης για τον Σακχαρώδη ιαβήτη, 28/1/2017, Θεσσαλονίκη Διαδραστική συζήτηση: Ρεαλισµός και υπερβολές στη διατροφή

Διαβάστε περισσότερα

Η χρήση της Λεβοσιµεντάνης κατά τη διαδικασία τιτλοποίησης των β- αποκλειστών σε ασθενείς µε καρδιακή ανεπάρκεια

Η χρήση της Λεβοσιµεντάνης κατά τη διαδικασία τιτλοποίησης των β- αποκλειστών σε ασθενείς µε καρδιακή ανεπάρκεια Η χρήση της Λεβοσιµεντάνης κατά τη διαδικασία τιτλοποίησης των β- αποκλειστών σε ασθενείς µε καρδιακή ανεπάρκεια Ι. Λαγός, Ι. Αλευρούδης, Α. εληγιαννίδης, Π. Φαλιάγκας, Θ. Μουλατζίκος, Τζ. αδούς, Ι. Κανονίδης.

Διαβάστε περισσότερα

Άσκηση 2 Το Υ+όδειγ&α των Εξειδικευ&ένων Συντελεστών

Άσκηση 2 Το Υ+όδειγ&α των Εξειδικευ&ένων Συντελεστών 7 Οικονο&ικό Πανε+ιστή&ιο Αθηνών Τ"ή"α Οικονο"ικής Ε,ιστή"ης Καθηγητής Γιώργος Αλογοσκούφης 1473 ιεθνής Οικονο"ική Εαρινό Εξά"ηνο 2014-15 Άσκηση 2 Το Υ+όδειγ&α των Εξειδικευ&ένων Συντελεστών Θεωρείστε

Διαβάστε περισσότερα

Μονάδες 5 1.2.α. Να γράψετε στο τετράδιό σας τον παρακάτω πίνακα σωστά συµπληρωµένο.


Διαβάστε περισσότερα

Άσκηση 4 Το Πρότυ+ο Ανταγωνιστικό Υ+όδειγ&α του ιεθνούς Ε&+ορίου

Άσκηση 4 Το Πρότυ+ο Ανταγωνιστικό Υ+όδειγ&α του ιεθνούς Ε&+ορίου 7 Οικονο&ικό Πανε+ιστή&ιο Αθηνών Τ"ή"α Οικονο"ικής Ε,ιστή"ης Καθηγητής Γιώργος Αλογοσκούφης 1473 ιεθνής Οικονο"ική Εαρινό Εξά"ηνο 2014-15 Άσκηση 4 Το Πρότυ+ο Ανταγωνιστικό Υ+όδειγ&α του ιεθνούς Ε&+ορίου

Διαβάστε περισσότερα

Προγραμματιστική Εργασία

Προγραμματιστική Εργασία ΗΥ-240 ο%ές εδο%ένων Προγραμματιστική Εργασία Αντώνης Πα)αϊωάννου Μέρος A Διαδικάστικά Παράδοση: Δευτέρα, 3 Απριλίου 2017, ώρα 23:59. Compile και run σε μηχανήματα της σχολής Μέρος της βαθμολογίας Τρόπος

Διαβάστε περισσότερα

Ψυχογλωσσολογία. Ανακάλυψη και ερ-ηνεία των ψυχολογικών διαδικασιών 7ου κάνουν δυνατή την α7όκτηση, εξέλιξη και χρήση της γλώσσας

Ψυχογλωσσολογία. Ανακάλυψη και ερ-ηνεία των ψυχολογικών διαδικασιών 7ου κάνουν δυνατή την α7όκτηση, εξέλιξη και χρήση της γλώσσας Η Φύση της γλώσσας Ψυχογλωσσολογία Ανακάλυψη και ερ-ηνεία των ψυχολογικών διαδικασιών 7ου κάνουν δυνατή την α7όκτηση, εξέλιξη και χρήση της γλώσσας Τρεις τομείς ενδιαφέροντος Πώς οι άνθρω7οι κατανοούν

Διαβάστε περισσότερα

Προγραμματιστική Εργασία

Προγραμματιστική Εργασία ΗΥ-240 ο%ές εδο%ένων Προγραμματιστική Εργασία Αντώνης Πα)αϊωάννου Μέρος A Διαδικάστικά Παράδοση: Σάββατο, 14 Νοεμβρίου 2016, ώρα 23:59. Compile και run σε μηχανήματα της σχολής Μέρος της βαθμολογίας Τρόπος

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Φυσικών της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Φυσικών της Ώθησης ΕΘΝΚΕΣ ΕΞΕΤΣΕΣ ΠΝΤΗΣΕΣ Ειμέλεια: Ομάδα Φυσικών της Ώθησης ΕΘΝΚΕΣ ΕΞΕΤΣΕΣ Παρασκευή, ουνίου Γ ΛΥΚΕΟΥ ΚΤΕΥΘΥΝΣΗΣ ΗΛΕΚΤΡΟΛΟΓ ΟΜΔ ΠΡΩΤΗ. Για τις ημιτελείς ροτάσεις. και. να γράψετε στο τετράδιό σας τον αριθμό

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ενδοκαρδιακά εµφυτεύσιµα ασύρµατα συστήµατα βηµατοδότησης: Μια τεχνολογία που απευθύνεται σε λίγους ή αποτελεί το µέλλον της καρδιακής βηµατοδότησης;

Ενδοκαρδιακά εµφυτεύσιµα ασύρµατα συστήµατα βηµατοδότησης: Μια τεχνολογία που απευθύνεται σε λίγους ή αποτελεί το µέλλον της καρδιακής βηµατοδότησης; Ενδοκαρδιακά εµφυτεύσιµα ασύρµατα συστήµατα βηµατοδότησης: Μια τεχνολογία που απευθύνεται σε λίγους ή αποτελεί το µέλλον της καρδιακής βηµατοδότησης; Βασιλάκη Ανδρονίκη MSc Γ.Ν.Α «ΙΠΠΟΚΡΑΤΕΙΟ» Πόρτση Αντωνία

Διαβάστε περισσότερα

Γιάννης Ι. Πασσάς. Γλώσσα. Οι λειτουργίες της γλώσσας Η γλωσσική 4εταβολή και ο δανεισ4ός

Γιάννης Ι. Πασσάς. Γλώσσα. Οι λειτουργίες της γλώσσας Η γλωσσική 4εταβολή και ο δανεισ4ός Γιάννης Ι. Πασσάς Γλώσσα Οι λειτουργίες της γλώσσας Η γλωσσική 4εταβολή και ο δανεισ4ός Αρχή πάντων ορισµός εστί Γλώσσα: Κώδικας ση4είων ορισ4ένης 4ορφής (γλωσσικής), 4ε τα ο

Διαβάστε περισσότερα

Άσκηση 1 Το Υ+όδειγ&α του Ricardo και το Συγκριτικό Πλεονέκτη&α

Άσκηση 1 Το Υ+όδειγ&α του Ricardo και το Συγκριτικό Πλεονέκτη&α Οικονο&ικό Πανε+ιστή&ιο Αθηνών Τ"ή"α Οικονο"ικής Ε,ιστή"ης Καθηγητής Γιώργος Αλογοσκούφης 1473 ιεθνής Οικονο"ική Εαρινό Εξά"ηνο 2014-15 Άσκηση 1 Το Υ+όδειγ&α του Ricardo και το Συγκριτικό Πλεονέκτη&α Θεωρείστε

Διαβάστε περισσότερα

ΑΣΕΠ 2000 ΑΣΕΠ 2000 Εμπορική Τράπεζα 1983 Υπουργείο Κοιν. Υπηρ. 1983

ΑΣΕΠ 2000 ΑΣΕΠ 2000 Εμπορική Τράπεζα 1983 Υπουργείο Κοιν. Υπηρ. 1983 20 Φεβρουαρίου 2010 ΑΣΕΠ 2000 1. Η δεξαμενή βενζίνης ενός πρατηρίου υγρών καυσίμων είναι γεμάτη κατά τα 8/9. Κατά τη διάρκεια μιας εβδομάδας το πρατήριο διέθεσε τα 3/4 της βενζίνης αυτής και έμειναν 4000

Διαβάστε περισσότερα


ΤΑΞΙΝΟΜΗΣΗ ΟΡΓΑΝΙΣΜΩΝ ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ 1α ΤΑΞΙΝΟΜΗΣΗ ΟΡΓΑΝΙΣΜΩΝ Οι επιστήμονες ταξινομούν τους οργανισμούς σε ομάδες ανάλογα με τα κοινά τους χαρακτηριστικά. Τα πρώτα συστήματα ταξινόμησης βασιζόταν αποκλειστικά στα μορφολογικά

Διαβάστε περισσότερα

Γενικό Λύκειο Μαραθοκάμπου Σάμου. Άλγεβρα Β λυκείου. 13 Οκτώβρη 2016

Γενικό Λύκειο Μαραθοκάμπου Σάμου. Άλγεβρα Β λυκείου. 13 Οκτώβρη 2016 Γενικό Λύκειο Μαραθοκάμπου Σάμου Άλγεβρα Β λυκείου Εργασία2 η : «Συναρτήσεις» 13 Οκτώβρη 2016 Ερωτήσεις Θεωρίας 1.Πότελέμεότιμιασυνάρτησηfείναιγνησίωςάυξουσασεέναδιάστημα του πεδίου ορισμού της; 2.Πότελέμεότιμιασυνάρτησηfείναιγνησίωςφθίνουσασεέναδιάστημα

Διαβάστε περισσότερα

Ενδεικτικά Θέ+ατα για τις Εξετάσεις Φεβρουαρίου 2015

Ενδεικτικά Θέ+ατα για τις Εξετάσεις Φεβρουαρίου 2015 Οικονο&ικό Πανε+ιστή&ιο Αθηνών Τ"ή"α Οικονο"ικής Ε,ιστή"ης Μετα+τυχιακό Πρόγρα&&α Ειδίκευσης στην Οικονο&ική Θεωρία Μακροοικονο"ική Θεωρία Καθ. Γιώργος Αλογοσκούφης Φθινο,ωρινό Εξά"ηνο 2014-15 Θέ+α 1 Ενδεικτικά

Διαβάστε περισσότερα

Αλλεργία στο σιτάρι Μάριος Μ. Πα)αδό)ουλος Παιδοαλλεργιολόγος - Παιδο)νευ1ονολόγος 8/17/15

Αλλεργία στο σιτάρι Μάριος Μ. Πα)αδό)ουλος Παιδοαλλεργιολόγος - Παιδο)νευ1ονολόγος  8/17/15 Αλλεργία στο σιτάρι Μάριος Μ. Πα)αδό)ουλος Παιδοαλλεργιολόγος - Παιδο)νευ1ονολόγος www.pedoallergo.gr 8/17/15 ΠΗΓΕΣ: American Academy of Pediatrics American Academy of Allergy Asthma and Immunology European

Διαβάστε περισσότερα

Αποδεικτικές Διαδικασίες και Μαθηματική Επαγωγή.

Αποδεικτικές Διαδικασίες και Μαθηματική Επαγωγή. Αποδεικτικές Διαδικασίες και Μαθηματική Επαγωγή. Mαθηματικό σύστημα Ένα μαθηματικό σύστημα αποτελείται από αξιώματα, ορισμούς, μη καθορισμένες έννοιες και θεωρήματα. Η Ευκλείδειος γεωμετρία αποτελεί ένα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο DNA των μιτοχονδρίων περιέχονται πληροφορίες για:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο DNA των μιτοχονδρίων περιέχονται πληροφορίες για: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑΣ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 05/03/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1.

Διαβάστε περισσότερα

ΣΤΟ ΦΑΡΜΑΚΕΙΟ. Με την πιστοποίηση του έχει πρόσβαση στο περιβάλλον του φαρμακείου που παρέχει η εφαρμογή.

ΣΤΟ ΦΑΡΜΑΚΕΙΟ. Με την πιστοποίηση του έχει πρόσβαση στο περιβάλλον του φαρμακείου που παρέχει η εφαρμογή. ΣΤΟ ΦΑΡΜΑΚΕΙΟ Ο ασθενής έχοντας μαζί του το βιβλιάριο υγείας του και την τυπωμένη συνταγή από τον ιατρό, η οποία αναγράφει τον μοναδικό κωδικό της, πάει στο φαρμακείο. Το φαρμακείο αφού ταυτοποιήσει το

Διαβάστε περισσότερα

Δαρβινισμός 2.0 Η Μοντέρνα Σύνθεση. Iστορία της Bιολογίας Mάθη.α 14 02/06/2016

Δαρβινισμός 2.0 Η Μοντέρνα Σύνθεση. Iστορία της Bιολογίας Mάθη.α 14 02/06/2016 Δαρβινισμός 2.0 Η Μοντέρνα Σύνθεση Iστορία της Bιολογίας Mάθη.α 14 02/06/2016 Biology at the present time is embarking upon a phase of synthesis after a period in which new disciplines were taken up in

Διαβάστε περισσότερα

Το Ερευνητικό Μετρό. Το ερευνητικόό µμετρόό του ΕΙΕ ταξιδεύύει στις «γραµμµμέές» σχεδιασµμούύ και ανακάάλυψης φαρµμάάκων.

Το Ερευνητικό Μετρό. Το ερευνητικόό µμετρόό του ΕΙΕ ταξιδεύύει στις «γραµμµμέές» σχεδιασµμούύ και ανακάάλυψης φαρµμάάκων. Το Ερευνητικό Μετρό Το ερευνητικόό µμετρόό του ΕΙΕ ταξιδεύύει στις «γραµμµμέές» σχεδιασµμούύ και ανακάάλυψης φαρµμάάκων. Αθήήνα 2015 Πού συναντά*ε τους *ικροοργανισ*ούς; Παντού!!! Οι 2ιο γνωστές «κρυψώνες»

Διαβάστε περισσότερα

ΣΤΟ ΙΑΤΡΕΙΟ. Με την πιστοποίηση του αποκτά πρόσβαση στο περιβάλλον του ιατρού που παρέχει η εφαρμογή.

ΣΤΟ ΙΑΤΡΕΙΟ. Με την πιστοποίηση του αποκτά πρόσβαση στο περιβάλλον του ιατρού που παρέχει η εφαρμογή. ΣΤΟ ΙΑΤΡΕΙΟ Ο ιατρός αφού διαπιστώσει εάν το πρόσωπο που προσέρχεται για εξέταση είναι το ίδιο με αυτό που εικονίζεται στο βιβλιάριο υγείας και ελέγξει ότι είναι ασφαλιστικά ενήμερο (όπως ακριβώς γίνεται

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑΣ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 05/03/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ : ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 21/09/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Για το γονιδίωμα της γάτας

Διαβάστε περισσότερα


ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

ΣΟΦΟΚΛΕΟΥΣ ΑΝΤΙΓΟΝΗ Κείµενο από το πρωτότυπο (701-718)


Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 28/02/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα

Προτεινόμενα θέματα στο μάθημα. Αρχές Οικονομικής Θεωρίας ΟΜΑΔΑ Α. Στις προτάσεις από Α.1. μέχρι και Α10 να γράψετε στο τετράδιό σας τον αριθμό της

Προτεινόμενα θέματα στο μάθημα. Αρχές Οικονομικής Θεωρίας ΟΜΑΔΑ Α. Στις προτάσεις από Α.1. μέχρι και Α10 να γράψετε στο τετράδιό σας τον αριθμό της Προτεινόμενα θέματα στο μάθημα Αρχές Οικονομικής Θεωρίας ΟΜΑΔΑ Α Στις προτάσεις από Α.1. μέχρι και Α10 να γράψετε στο τετράδιό σας τον αριθμό της καθεμιάς και δίπλα σε κάθε αριθμό την ένδειξη Σωστό, αν

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου 2012 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Η διπλά έλικα του DNA ξετυλίγεται κατά την μεταγραφή

Διαβάστε περισσότερα

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών»

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών» Βιολογία Κατεύθυνσης Γ Λυκείου Απαντήσεις 2012 Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β ΘΕΜΑ Α Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο

Διαβάστε περισσότερα

O Gregor Mendel & η επανανακάλυψη της μεντελιανής γενετικής. Iστορία της Bιολογίας Mάθη.α 12 02/06/2016

O Gregor Mendel & η επανανακάλυψη της μεντελιανής γενετικής. Iστορία της Bιολογίας Mάθη.α 12 02/06/2016 O Gregor Mendel & η επανανακάλυψη της μεντελιανής γενετικής Iστορία της Bιολογίας Mάθη.α 12 02/06/2016 Experience of artificial fertilisation, such as is effected with ornamental plants in order to obtain

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

Εntwicklungsmechanik - η μηχανική της ανάπτυξης. Iστορία της Bιολογίας Mάθη.α 11 02/06/2016

Εntwicklungsmechanik - η μηχανική της ανάπτυξης. Iστορία της Bιολογίας Mάθη.α 11 02/06/2016 Εntwicklungsmechanik - η μηχανική της ανάπτυξης Iστορία της Bιολογίας Mάθη.α 11 02/06/2016 -η /ειρα.ατική ε.βρυολογία (ή ανα/τυξιακή.ηχανική Entwicklungsmechanik) αναδύθηκε τη δεκαετία του 1880. -> ο σκο/ός

Διαβάστε περισσότερα

Λινναίος & Jussieu. H αναζήτηση του Φυσικού Συστή/ατος. Iστορία της Bιολογίας Mάθη/α 1 3/3/2016

Λινναίος & Jussieu. H αναζήτηση του Φυσικού Συστή/ατος. Iστορία της Bιολογίας Mάθη/α 1 3/3/2016 Λινναίος & Jussieu H αναζήτηση του Φυσικού Συστή/ατος Iστορία της Bιολογίας Mάθη/α 1 3/3/2016 Εισαγωγή -> Η ανά;τυξη της ταξινο/ίας α;ό τον Λινναίο ως τον αρβίνο -> Τι είναι η Ταξινο/ία; Η ε;ιστή/η η ο;οία

Διαβάστε περισσότερα

Κείµενο διδαγµένο Κείµενο από το πρωτότυπο

Κείµενο διδαγµένο Κείµενο από το πρωτότυπο ΤΡΙΤΗ 29 ΙΟΥΝΙΟΥ 1999 ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κείµενο διδαγµένο Κείµενο από το πρωτότυπο Θουκυδίδη Ιστορία Γ, 70 Καὶ (ἦν γὰρ Πειθίας ἐθελοπρόξενός τε τῶν Ἀθηναίων καὶ τοῦ δήµου προειστήκει)

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

Αναγνώριση Προτύπων. Σήμερα! Λόγος Πιθανοφάνειας Πιθανότητα Λάθους Κόστος Ρίσκο Bayes Ελάχιστη πιθανότητα λάθους για πολλές κλάσεις

Αναγνώριση Προτύπων. Σήμερα! Λόγος Πιθανοφάνειας Πιθανότητα Λάθους Κόστος Ρίσκο Bayes Ελάχιστη πιθανότητα λάθους για πολλές κλάσεις Αναγνώριση Προτύπων Σήμερα! Λόγος Πιθανοφάνειας Πιθανότητα Λάθους Πιθανότητα Λάθους Κόστος Ρίσκο Bayes Ελάχιστη πιθανότητα λάθους για πολλές κλάσεις 1 Λόγος Πιθανοφάνειας Ας υποθέσουμε ότι θέλουμε να ταξινομήσουμε

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 2/12/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Πότε στέλνω τον ασθενή

Πότε στέλνω τον ασθενή Πότε στέλνω τον ασθενή µου για κατάλυση ΥΚΤ Θε#ιστοκλής Μαούνης 1νάσειο ΚΧΚ Πανελλήνιο Καρδιολογικό Συνέδριο Αθήνα, 21.10.2016 Υπερκοιλιακή ταχυκαρδία 2015 AHA/ACC/HRS Guidelines Ταχυκαρδία αbό εbανείσοδο

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Έννοια. Η αποδοχή της κληρονομίας αποτελεί δικαίωμα του κληρονόμου, άρα δεν

Έννοια. Η αποδοχή της κληρονομίας αποτελεί δικαίωμα του κληρονόμου, άρα δεν 1 1. Αποδοχή κληρονομίας Έννοια. Η αποδοχή της κληρονομίας αποτελεί δικαίωμα του κληρονόμου, άρα δεν μπορεί να ασκηθεί από τους δανειστές του κληρονόμου, τον εκτελεστή της διαθήκης, τον κηδεμόνα ή εκκαθαριστή

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΣΟΦΟΚΛΕΟΥΣ ΑΝΤΙΓΟΝΗ Κείμενο από το πρωτότυπο (στίχοι )


Διαβάστε περισσότερα

2. Κατάθεσε κάποιος στην Εθνική Τράπεζα 4800 με επιτόκιο 3%. Μετά από πόσο χρόνο θα πάρει τόκο 60 ; α) 90 ημέρες β) 1,5 έτη γ) 5 μήνες δ) 24 μήνες

2. Κατάθεσε κάποιος στην Εθνική Τράπεζα 4800 με επιτόκιο 3%. Μετά από πόσο χρόνο θα πάρει τόκο 60 ; α) 90 ημέρες β) 1,5 έτη γ) 5 μήνες δ) 24 μήνες 20 Φεβρουαρίου 2010 1. Ένας έμπορος αγόρασε 720 κιλά κρασί προς 2 το κιλό. Πρόσθεσε νερό, το πούλησε προς 2,5 το κιλό και κέρδισε 500. Το νερό που πρόσθεσε ήταν σε κιλά: α) 88 β) 56 γ) 60 δ) 65 2. Κατάθεσε

Διαβάστε περισσότερα

Σύλλογος Αρχαίας Ελληνικής Φιλοσοφίας συν Αθηνά 1o Συνέδριο Επιστημολογίας «Αναζητώντας την χαμένη ενότητα της γνώσης»

Σύλλογος Αρχαίας Ελληνικής Φιλοσοφίας συν Αθηνά 1o Συνέδριο Επιστημολογίας «Αναζητώντας την χαμένη ενότητα της γνώσης» Σύλλογος Αρχαίας Ελληνικής Φιλοσοφίας συν Αθηνά 1o Συνέδριο Επιστημολογίας «Αναζητώντας την χαμένη ενότητα της γνώσης» Κοινωνική Ανθρωπολογία: επαναπροσδιορίζοντας την ετερότητα και την πολιτισμική ταυτότητα

Διαβάστε περισσότερα

Making Performance. Forced Entertainment-Interactions. Direction/Edit - Tim Etchells, Terry O Connor, Helen Russell

Making Performance. Forced Entertainment-Interactions. Direction/Edit - Tim Etchells, Terry O Connor, Helen Russell Making Performance Forced Entertainment-Interactions Direction/Edit - Tim Etchells, Terry O Connor, Helen Russell Το κεί&ενο είναι &ετάφραση του ντοκυ&αντέρ force entertainment Making Performance &έσα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


2 Η ΠΑΓΚΥΠΡΙΑ ΟΛΥΜΠΙΑ Α ΦΥΣΙΚΗΣ Γ ΓΥΜΝΑΣΙΟΥ ΕΝΩΣΗ ΚΥΠΡΙΩΝ ΦΥΣΙΚΩΝ 2 Η ΠΑΓΚΥΠΡΙΑ ΟΛΥΜΠΙΑ Α ΦΥΣΙΚΗΣ Γ ΓΥΜΝΑΣΙΟΥ Κυριακή, 16 Απριλίου, 2006 Ώρα: 10:30-13:00 Οδηγίες: 1) Το δοκίµιο αποτελείται από τρία (3) µέρη µε σύνολο δώδεκα (12) θέµατα. 2) Επιτρέπεται

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ: ΒΙΟΛΟΓΙΑ ΟΠ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ & ΧΕΙΜΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 22/10/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα

H εξελικτική σκέψη στον 19ο αιώνα

H εξελικτική σκέψη στον 19ο αιώνα Lamarck H εξελικτική σκέψη στον 19ο αιώνα Iστορία της Bιολογίας Σταύρος Ιωαννίδης, ΜΙΘΕ/ΕΚΠΑ Mάθη6α 4 27/4/2017 Εξέλιξη και ΕBανάσταση -Ο Λα6άρκ (1744-1829) γεννήθηκε σε 6ια αριστοκρατική αλλά φτωχή οικογένεια

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Τι είναι η (ατρίδα,ας

Τι είναι η (ατρίδα,ας Müller, Vincent C. (2005), Τι είναι η πατρίδα μας; [What is our fatherland?], Cogito, 3, 8-10. [This is the original draft. The published version is shorter and polished.] http://www.nnet.gr/cogito/cogitoindex.htm

Διαβάστε περισσότερα

Ας υποθέσουμε ότι ο παίκτης Ι διαλέγει πρώτος την τυχαιοποιημένη στρατηγική (x 1, x 2 ), x 1, x2 0,

Ας υποθέσουμε ότι ο παίκτης Ι διαλέγει πρώτος την τυχαιοποιημένη στρατηγική (x 1, x 2 ), x 1, x2 0, Οικονομικό Πανεπιστήμιο Αθηνών Τμήμα Στατιστικής Εισαγωγή στην Επιχειρησιακή Ερευνα Εαρινό Εξάμηνο 2015 Μ. Ζαζάνης Πρόβλημα 1. Να διατυπώσετε το παρακάτω παίγνιο μηδενικού αθροίσματος ως πρόβλημα γραμμικού

Διαβάστε περισσότερα


ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΚΕΦΑΛΑΙΟ 1 Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΑΣΚΗΣΕΙΣ 1. Σε ένα δίκλωνο µόριο DNA ο λόγος Α / C είναι 1/ 4. Το μήκος του είναι 20.000 ζεύγη βάσεων. Ποια η εκατοστιαία σύσταση και ποιος ο αριθµός των νουκλεοτιδίων που

Διαβάστε περισσότερα

ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ. ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής.

ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ. ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. 1 ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. 1. Γραμμικό μόριο DNA θα βρούμε: Α. Σε πλασμίδια Β. Στο κύριο μόριο DNA του βακτηρίου. Γ. Σε

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ: Α. Από το κείµενο που σας δίνεται να µεταφράσετε στο τετράδιό σας τους στίχους 31-38 (Τοιαῦτά φασι... ἐσθλῶν κακή).


Διαβάστε περισσότερα

23/2/07 Sleep out Πλατεία Κλαυθμώνος

23/2/07 Sleep out Πλατεία Κλαυθμώνος 23/2/07 Sleep out Πλατεία Κλαυθμώνος Μια βραδιά στο λούκι με τους αστέγους «Έχετε ποτέ σκεφτεί να κοιμηθείτε μια χειμωνιάτικη νύχτα στο δρόμο;» Με αυτό το ερώτημα απευθύναμε και φέτος την πρόσκληση στους

Διαβάστε περισσότερα

Ενδεικτικά Θέ&ατα Προετοι&ασίας για τις Εξετάσεις στο &άθη&α ιεθνής Οικονο&ική

Ενδεικτικά Θέ&ατα Προετοι&ασίας για τις Εξετάσεις στο &άθη&α ιεθνής Οικονο&ική Οικονο&ικό Πανε+ιστή&ιο Αθηνών Τ3ή3α Οικονο3ικής Ε8ιστή3ης Καθηγητής Γιώργος Αλογοσκούφης Ιούνιος 2014 Ενδεικτικά Θέ&ατα Προετοι&ασίας για τις Εξετάσεις στο &άθη&α ιεθνής Οικονο&ική Θέ&α 1 Θεωρείστε ότι

Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα

Διαταραχές καλίου από τη χρήση διουρητικών. Μαρία Τσιάτσιου Ε-ι.ελήτρια Β Γενικό Νοσοκο.είο Χαλκιδικής

Διαταραχές καλίου από τη χρήση διουρητικών. Μαρία Τσιάτσιου Ε-ι.ελήτρια Β Γενικό Νοσοκο.είο Χαλκιδικής Διαταραχές καλίου από τη χρήση διουρητικών Μαρία Τσιάτσιου Ε-ι.ελήτρια Β Γενικό Νοσοκο.είο Χαλκιδικής Κο#οτηνή, 23 Σε*τε#βρίου 2016 Περιεχόμενα Νεφρική ρύθ.ιση ο.οιόστασης του Κ + Εγγύς εσ-ειρα.ένο Αγκύλη

Διαβάστε περισσότερα

Φιλοσοφία της Βιολογίας

Φιλοσοφία της Βιολογίας Φιλοσοφία της Βιολογίας Γενικές πληροφορίες Δευτέρα 12.30-15.00, Aίθουσα Δ (ΜΙΘΕ) Διδάσκων: Σταύρος Ιωαννίδης Ώρες γραφείου: Τρίτη 11.00-12.00 (κτήριο γραµµατείας, γραφείο αριστερά στο βάθος) Εmail: stavros.ioannidis.phil@gmail.com

Διαβάστε περισσότερα


ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ ΜΑΘΗΜΑ: ΕΡΩΤΗΣΕΙΣ ΟΙΚΟΝΟΜΙΚΗΣ ΘΕΩΡΙΑΣ ΜΑΘΗΜΑ: ΕΡΩΤΗΣΕΙΣ ΟΙΚΟΝΟΜΙΚΗΣ ΘΕΩΡΙΑΣ Tα Πανεπιστημιακά Φροντιστήρια «ΚΟΛΛΙΝΤΖΑ» προετοιμάζοντας σε ολιγομελείς ομίλους τους υποψήφιους για τον επικείμενο διαγωνισμό του Υπουργείου Οικονομικών, με κορυφαίο

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ: ΒΙΟΛΟΓΙΑ ΟΠ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 22/10/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Η εκατοστιαία

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

Κεφάλαιο 9 Ο κυτταρικός κύκλος

Κεφάλαιο 9 Ο κυτταρικός κύκλος Κεφάλαιο 9 Ο κυτταρικός κύκλος Γ. Ρήγας Α. Αθανασίου 127 ΕΙΣΑΓΩΓΗ Κάθε ζωντανός οργανισμός αποτελείται από μονάδες που ονομάζονται κύτταρα, τα οποία συγκροτούν ομάδες, τα όργανα, που με την σειρά τους

Διαβάστε περισσότερα


3 ΩΡΕΣ. Σελίδα 1 από 3 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ ΙΑΡΚΕΙΑ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΡΚΕΙΑ 3 ΩΡΕΣ ΘΕΜΑ 1 Ο Στις ερωτήσεις 1-5, να γράψετε τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Από τη διασταύρωση

Διαβάστε περισσότερα


ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ Τα προβλήματα αυτού του κεφαλαίου αναφέρονται στον υπολογισμό : 1. νουκλεοτιδίων ή αζωτούχων βάσεων ή πεντοζών ή φωσφορικών ομάδων 2. φωσφοδιεστερικών δεσμών ή μορίων

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο τετράδιό σας τον αριθμό

Διαβάστε περισσότερα



Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΦΥΛΛΑ ΕΡΓΑΣΙΑΣ. Διδακτική ενότητα

ΦΥΛΛΑ ΕΡΓΑΣΙΑΣ. Διδακτική ενότητα ΜΑΘΗΜΑ: ΑΡΧΑΙΑ ΙΣΤΟΡΙΑ ΤΑΞΗ: Α ΓΥΜΝΑΣΙΟΥ ΕΚΠΑΙΔΕΥΤΙΚΟ ΛΟΓΙΣΜΙΚΟ ΙΣΤΟΡΙΑ Α, Β, Γ, ΓΥΜΝΑΣΙΟΥ ΦΥΛΛΑ ΕΡΓΑΣΙΑΣ Διδακτική ενότητα Στόχος μας είναι: Να ανακαλύψετε τους παράγοντες που οδήγησαν στην εμφάνιση και

Διαβάστε περισσότερα

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 Α1. 1. δ 2. α 3. δ 4. γ 5. γ Βιολογία ΘΕΜΑ A κατεύθυνσης Α2. Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 ΘΕΜΑ Β 1.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα


ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ ΜΑΘΗΜΑ: ΟΙΚΟΝΟΜΙΚΗ ΘΕΩΡΙΑ ΜΑΘΗΜΑ: ΟΙΚΟΝΟΜΙΚΗ ΘΕΩΡΙΑ Την ευθύνη του εκπαιδευτικού υλικού έχει ο επιστημονικός συνεργάτης των Πανεπιστημιακών Φροντιστηρίων «ΚOΛΛΙΝΤΖΑ», οικονομολόγος συγγραφέας θεμάτων ΑΣΕΠ, Παναγιώτης Βεργούρος.

Διαβάστε περισσότερα

Κεφάλαιο 2 Ιική καρκινογένεση

Κεφάλαιο 2 Ιική καρκινογένεση Κεφάλαιο 2 Ιική καρκινογένεση Σ. Δ. Κοτταρίδης ΕΙΣΑΓΩΓΗ H επιστήμη της ιολογίας συμπεριλαμβάνει μελέτες που στοχεύουν το μηχανισμό με τον οποίο οι ιοί προκαλούν νόσους καθώς επίσης τη χρήση των ιών ως

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ ΜΙΤΩΣΗ. Ζαρφτζιάν Μαριλένα Πειραματικό Σχολείο Πανεπιστημίου Μακεδονίας

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ ΜΙΤΩΣΗ. Ζαρφτζιάν Μαριλένα Πειραματικό Σχολείο Πανεπιστημίου Μακεδονίας ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ ΜΙΤΩΣΗ Τι σχέση έχουν η μονογονική αναπαραγωγή Κυτταρική διαίρεση η ανάπτυξη η αμφιγονική αναπαραγωγή η αντικατάσταση των κυττάρων Η σημασία της μίτωσης Η μίτωση ευνοεί την κυτταρική

Διαβάστε περισσότερα

β) Σχολικό βιβλίο σελ. 96: «Αν κατά τη διάρκεια της µείωσης...τρισωµία», σελ. 97: «Η έλλειψη είναι η απώλεια γενετικού

β) Σχολικό βιβλίο σελ. 96: «Αν κατά τη διάρκεια της µείωσης...τρισωµία», σελ. 97: «Η έλλειψη είναι η απώλεια γενετικού ΠΡΟΣΟΜΟΙΩΣΗ ΑΠΟΛΥΤΗΡΙΩΝ ΕΞΕΤΑΣΕΩΝ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΥΡΙΑΚΗ 4 ΜΑΪΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. α, Α2. β, Α3. δ, Α4. β, Α5. β ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα



Διαβάστε περισσότερα

τεσσάρων βάσεων δεδομένων που θα αντιστοιχούν στους συνδρομητές

τεσσάρων βάσεων δεδομένων που θα αντιστοιχούν στους συνδρομητές Σ Υ Π Τ Μ Α 8 Ιουνίου 2010 Άσκηση 1 Μια εταιρία τηλεφωνίας προσπαθεί να βρει πού θα τοποθετήσει τις συνιστώσες τηλεφωνικού καταλόγου που θα εξυπηρετούν τους συνδρομητές της. Η εταιρία εξυπηρετεί κατά βάση

Διαβάστε περισσότερα