οµή και λειτουργία των πρωτεϊνών TÚÈÙÔÙ Á ÔÌ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "οµή και λειτουργία των πρωτεϊνών TÚÈÙÔÙ Á ÔÌ"

Transcript

1 οµή και λειτουργία των πρωτεϊνών Κρύσταλλοι ανθρώπινης ινσουλίνης. Η ινσουλίνη είναι µια πρωτεϊνική ορ- µόνη, απολύτως απαραίτητη για τη διατήρηση των επιπέδων του σακχάρου στο αίµα. (Κάτω) Αυτό που προσδιορίζει µια πρωτεΐνη όπως η ινσουλίνη είναι οι αλυσίδες αµινοξέων σε συγκεκριµένη αλληλουχία (πρωτοταγής δοµή). Οι αλυσίδες αυτές αναδιπλώνονται σε απόλυτα συγκεκριµένες δοµές (τριτοταγής δοµή) που, στην περίπτωση αυτή, αποτελούν ένα µόριο ινσουλίνης. Αυτές οι τριτοταγείς δοµές ενώνονται µεταξύ τους και σχηµατίζουν σύµπλοκα, όπως φαίνεται στο άκρο δεξιά, που στην περίπτωση της ινσουλίνης αποτελούνται από έξι µόρια τριτοταγούς δοµής. Αυτά τα σύµπλοκα µπορούν συχνά να σχηµατίσουν σαφώς καθορισµένους κρυστάλλους, όπως στη φωτογραφία αριστερά. Mελετώντας τους κρυστάλλους µπορούµε να προσδιορίσουµε τις λεπτοµέρειες της δοµής αυτής. [(Αριστερά): Alfred Pasieka/ Peter Arnold.] ΚΕΦΑΛΑΙΟ 3 Leu Leu Tyr Gln Leu Glu Glu Asn Tyr ÚˆÙÔÙ Á ÔÌ Â ÙÂÚÔÙ Á ÔÌ TÚÈÙÔÙ Á ÔÌ TÂÙ ÚÙÔÙ Á ÔÌ Οι πρωτεΐνες είναι τα πιο πολυδύναµα µακροµόρια στους ζώντες οργανισµούς και εξυπηρετούν βασικές λειτουργίες σε όλες σχεδόν τις βιολογικές διεργασίες. Λειτουργούν ως καταλύτες, µεταφορείς και αποθηκευτές άλλων µορίων, όπως το οξυγόνο, παρέχουν µηχανική στήριξη και ανοσοπροστασία, δηµιουργούν κίνηση, διαβιβάζουν νευρικές ώσεις και ρυθµίζουν την ανάπτυξη και τη διαφοροποίηση. Πράγµατι, ένα µεγάλο µέρος του κεφαλαίου αυτού είναι αφιερωµένο στην κατανόηση των λειτουργιών των πρωτεϊνών αλλά και των µηχανισµών που επιτρέπουν στις πρωτεΐνες να είναι τα κατάλληλα µακροµόρια για τις λειτουργίες αυτές. ιάφορες βασικές ιδιότητες επιτρέπουν στις πρωτεΐνες να συµµετέχουν σε ένα τόσο ευρύ φάσµα λειτουργιών. 1. Οι πρωτεΐνες είναι γραµµικά πολυµερή δοµούµενα από µονο- µερή αµινοξέων. Η δηµιουργία µεγάλων αλυσίδων µακροµορίων που δοµούνται από περιορισµένο αριθµό µονοµερών είναι κάτι που απαντά συχνά στη βιοχηµεία. Με ποιον τρόπο η λειτουργία µιας πρωτεΐνης εξαρτάται από τη γραµµική αλληλουχία των αµινοξέων της; Η λειτουργία µιας πρωτεΐνης εξαρτάται άµεσα από την τριδιάστατη δοµή της (Eικόνα 3.1). Το εντυπωσιακό είναι ότι οι πρωτεΐνες αναδιπλώνονται αυτόµατα σε τριδιάστατες δοµές που καθορίζονται από την αλληλουχία των αµινοξέων του πρωτεϊνικού πολυµερούς. Επο- µένως, οι πρωτεΐνες αντιπροσωπεύουν τη µετάβαση από τον µονοδιάστατο κόσµο των αλληλουχιών στον τριδιάστατο κόσµο των µορίων που παρουσιάζουν µεγάλο εύρος λειτουργιών. ΠΕΡΙΓΡΑΜΜΑ 3.1 Οι πρωτεΐνες δοµούνται από ένα σύνολο 20 αµινοξέων 3.2 Πρωτοταγής δοµή: Τα αµινοξέα συνδέονται µε πεπτιδικούς δεσµούς για να σχηµατίσουν πολυπεπτιδικές αλυσίδες 3.3 ευτεροταγής δοµή: Οι πολυπεπτιδικές αλυσίδες µπορούν να αναδιπλώνονται σε κανονικές δοµές όπως η α-έλικα, η β-πτυχωτή επιφάνεια, οι στροφές και οι θηλιές 3.4 Τριτοταγής δοµή: Οι υδατοδιαλυτές πρωτεΐνες αναδιπλώνονται σε συµπαγείς δο- µές µε µη πολικά κέντρα 3.5 Τεταρτοταγής δοµή: Οι πολυπεπτιδικές αλυσίδες µπορούν να συγκροτήσουν δοµές πολλών υποµονάδων 3.6 Η αλληλουχία αµινοξέων µιας πρωτεΐνης καθορίζει την τριδιάστατη δοµή της

2 46 ΚΕΦΑΛΑΙΟ 3 οµή και λειτουργία των πρωτεϊνών EIKA 3.1 Η δοµή καθορίζει τη λειτουργία. Ένα πρωτεϊνικό συστατικό του µηχανισµού αντιγραφής του DA περιβάλλει µια περιοχή της διπλής έλικας του DA. Η δοµή της πρωτεΐνης επιτρέπει σε ένα µεγάλο τµήµα του DA να αντιγραφεί χωρίς να αποµακρυνθεί ο µηχανισµός από το DA. 2. Οι πρωτεΐνες περιέχουν µια µεγάλη σειρά λειτουργικών οµάδων. Οι οµάδες αυτές περιλαµβάνουν αλκοόλες, θειόλες, θειοαιθέρες, καρβοξυλικές οµάδες, καρβαµίδια και ποικιλία βασικών οµάδων. Όταν συνδυάζονται σε διάφορες αλληλουχίες, οι λειτουργικές αυτές οµάδες ερµηνεύουν το φάσµα των λειτουργιών των πρωτεϊνών. Παραδείγµατος χάριν, η χηµική αντιδραστικότητα που οφείλεται στις οµάδες αυτές είναι απαραίτητη για τη λειτουργία των ενζύµων, των πρωτεϊνών οι οποίες καταλύουν ειδικές χηµικές αντιδράσεις στα βιολογικά συστήµατα (βλ. Κεφάλαια 8-10). 3. Οι πρωτεΐνες µπορούν να αλληλεπιδράσουν µεταξύ τους και µε άλλα βιολογικά µακροµόρια, για να δηµιουργήσουν πολύπλοκα συσσωµατώµατα. Μέσα στα συσσωµατώµατα αυτά, οι πρωτεΐνες µπορούν να δράσουν συνεργειακά και να εµφανίσουν ιδιότητες που δεν προϋπήρχαν στα ανεξάρτητα µακροµόρια (Eικόνα 3.2). Στα συσσωµατώµατα περιλαµβάνονται µακροµοριακές µηχανές που επιτυγχάνουν την ακριβή αντιγραφή του DA, τη µεταγωγή σήµατος µέσα στο κύτταρο, αλλά και πολλές άλλες απαραίτητες διεργασίες. EIKA 3.2 Ένα πολύπλοκο συσσωµάτωµα πρωτεΐνης. Μια ηλεκτρονιοµικρογραφία τοµής ιστού εντόµου εµφανίζει εξαγωνική διάταξη που οφείλεται σε δύο πρωτεϊνικά νηµάτια. [Ευγενική προσφορά Dr. Michael Reedy]. 4. Μερικές πρωτεΐνες είναι σχεδόν άκαµπτες, ενώ υπάρχουν άλλες που εµφανίζουν µια σχετική ευκαµψία. Οι άκαµπτες µονάδες µπορούν να λειτουργήσουν ως δο- µικά στοιχεία του κυτταρικού σκελετού ή του συνδετικού ιστού. Τα τµήµατα των πρωτεϊνών που παρουσιάζουν περιορισµένη ευκαµψία µπορούν να χρησιµοποιηθούν ως αρθρωτά τµήµατα, ελατήρια ή µοχλοί απαραίτητα για την πρωτεϊνική λειτουργία, για τη σύνδεση πρωτεϊνών µεταξύ τους και µε άλλα µόρια σε πολύπλοκα σύµπλοκα και για τη µεταβίβαση πληροφοριών µεταξύ κυττάρων αλλά και µέσα στα κύτταρα (Eικόνα 3.3). EIKA 3.3 Ευκαµψία και λειτουργία. Η πρωτεΐνη λακτοφερρίνη όταν δεσµεύει σίδηρο αλλάζει δοµή, επιτρέποντας έτσι σε άλλα µόρια να ξεχωρίσουν το µόριο που έχει σίδηρο από εκείνο που δεν έχει. ËÚÔ Iron

3 3.1 ΟΙ ΠΡΩΤΕΪΝΕΣ ΟΜΟΥΝΤΑΙ ΑΠΟ ΕΝΑ ΣΥΝΟΛΟ 20 ΑΜΙΝΟΞΕΩΝ 47 Σύνολο 20 αµινοξέων Τα αµινοξέα είναι οι δοµικές µονάδες των πρωτεϊνών. Ένα α-αµινοξύ αποτελείται από ένα κεντρικό άτοµο άνθρακα, που λέγεται α-άνθρακας, συνδεδεµένο µε µια αµινική οµάδα, µια καρβοξυλική οµάδα, ένα άτοµο υδρογόνου και µια χαρακτηριστική οµάδα R. Η οµάδα R πολλές φορές ονοµάζεται και πλευρική αλυσίδα. Έχοντας τέσσερις διαφορετικές οµάδες συνδεδεµένες στο τετράεδρο του ατόµου του α-άνθρακα, τα α-αµινοξέα είναι χειρόµορφα (chiral). Τα δύο κατοπτρικά είδωλα ονοµάζονται L- και D-ισοµερές (Eικόνα 3.4). 3 + a R - - R a 3 + Σηµείωση για τη διάκριση των στερεοµερών Στους τέσσερις διαφορετικούς υποκαταστάτες ενός ασύµµετρου ατόµου άνθρακα καθορίζεται προτεραιότητα ανάλογα µε τον ατοµικό αριθµό τους. Ο υποκαταστάτης µε τη µικρότερη προτεραιότητα, συνήθως το Η, είναι ο πιο αποµακρυσµένος από τον παρατηρητή. Η διαµόρφωση γύρω από τον άνθρακα ονοµάζεται και R, από τις λατινικές λέξεις sinister αριστερός και rectus δεξιός. ιαµόρφωση είναι εκείνη στην οποία η πρόοδος από τη µεγαλύτερη προς τη µικρότερη προτεραιότητα είναι αντίθετη προς τη φορά των δεικτών του ρολογιού, ενώ διαµόρφωση R είναι εκείνη στην οποία η πρόοδος ακολουθεί τη φορά των δεικτών του ρολογιού. IÛÔÌÂÚ L IÛÔÌÂÚ D EIKA 3.4 Τα ισοµερή των αµινοξέων είναι D και L. Το σύµβολο R σηµαίνει οποιαδήποτε πλευρική αλυσίδα. Τα D και L είναι εναντιοµερή, δηλαδή αποτελούν αντίστροφες εικόνες το ένα του άλλου. Μόνο L-αµινοξέα απαντούν στις πρωτεΐνες. Για όλα σχεδόν τα αµινοξέα, το L-ισοµερές έχει διαµόρφωση και όχι R (Eικόνα 3.5). Αν και έχουν γίνει πολλές προσπάθειες να εξηγηθεί γιατί τα αµινοξέα των πρωτεϊνών έχουν αυτήν την απόλυτη διαµόρφωση, δεν υπάρχει ακόµη ικανοποιητική εξήγηση. Ίσως η επιλογή του L-ισοµερούς σε σχέση µε το D να έγινε τυχαία αλλά νωρίς στην εξέλιξη και στη συνέχεια, αφού έγινε, παρέµεινε σταθερή. Τα αµινοξέα σε διάλυµα που έχει ουδέτερο p συµπεριφέρονται σαν δίπολα ιόντα (που ονοµάζονται και αµφοτερικά ιόντα, zwitterions). Στη διπολική µορφή η αµινική οµάδα είναι πρωτονιωµένη ( ΝΗ 3 + ) και η καρβοξυλική οµάδα είναι αποπρωτονιωµένη ( ). Ο βαθµός ιοντισµού ενός αµινοξέος ποικίλλει ανάλογα µε το p (Eικόνα 3.6). Σε όξινο διάλυµα (π.χ. p 1), η αµινική οµάδα είναι πρωτονιωµένη ( 3 + ) και η καρβοξυλική οµάδα είναι ανέπαφη ( ). Καθώς αυξάνεται το p, η πρώτη οµάδα που απελευθερώνει + R +3 R + R (1) 3 + R α (3) (4) (2) EIKA 3.5 Στις πρωτεΐνες απαντούν µόνο L- αµινοξέα. Όλα σχεδόν τα L-αµινοξέα έχουν απόλυτη διαµόρφωση (από το λατινικό sinister που σηµαίνει αριστερός). Το βέλος δείχνει την πρόοδο από τη µεγαλύτερη προς τη µικρότερη προτεραιότητα, η οποία είναι αντίθετη προς τη φορά των δεικτών του ρολογιού και εποµένως το χειρόµορφο κέντρο έχει διαµόρφωση ÁÎ ÓÙÚˆÛË MÔÚÊ ÌÊÔÙÂÚÈÎÔ ÈfiÓÙÔ È Ô ÔÌ Â Â Ó È appleúˆùôóèˆì Ó p È Ô ÔÌ Â Â Ó È appleôappleúˆùôóèˆì Ó EIKA 3.6 Η κατάσταση ιοντισµού των αµινοξέων σχετίζεται µε το p. Η κατάσταση ιοντισµού των αµινοξέων αλλάζει όταν αλλάζει το pη. Η µορφή αµφοτερικού ιόντος υπερισχύει όταν το η τιµή του pη βρίσκεται κοντά στη φυσιολογική.

4 48 ΚΕΦΑΛΑΙΟ 3 οµή και λειτουργία των πρωτεϊνών Ï Î ÓË (Gly, G) AÏ Ó ÓË (Ala, A) 3 EIKA 3.7 Η δοµή της γλυκίνης και της αλανίνης. (Επάνω) Τα µοντέλα µε σφαίρες και ράβδους δείχνουν τη διάταξη των ατόµων και των δεσµών στον χώρο. (Μέσον) Στερεοχηµικώς ρεαλιστικοί τύποι δείχνουν τη γεωµετρική διάταξη των δεσµών γύρω από τα άτοµα (βλ. Κεφάλαιο 1-Παράρτηµα). (Κάτω) Προβολές Fischer που δείχνουν όλους τους δεσµούς κάθετους για απλούστευση της απεικόνισης (βλ. Κεφάλαιο 1- Παράρτηµα) Ï Î ÓË (Gly, G) AÏ Ó ÓË (Ala, A) B Ï ÓË (Val, V) Â Î ÓË (Leu, L) IÛÔÏÂ Î ÓË (Ile, I) MÂıÂÈÔÓ ÓË (Met, M) * B Ï ÓË (Val, V) Â Î ÓË (Leu, L) IÛÔÏÂ Î ÓË (Ile, I) MÂıÂÈÔÓ ÓË (Met, M) EIKA 3.8 Αµινοξέα µε αλειφατικές πλευρικές αλυσίδες. Το δεύτερο χειρόµορφο άτοµο άνθρακα της ισολευκίνης σηµειώνεται µε αστερίσκο.

5 πρωτόνιο είναι η καρβοξυλική οµάδα, εφόσον το pk a για αυτήν είναι κοντά στο 2. Η διπολική µορφή συνεχίζεται µέχρι το p να πλησιάζει το 9, όταν η πρωτονιωµένη αµινική οµάδα χάνει ένα πρωτόνιο. Για µια επανάληψη των εννοιών οξέος - βάσης και του pη, βλέπε το παράρτηµα του κεφαλαίου αυτού. Υπάρχουν είκοσι είδη πλευρικών αλυσίδων στις πρωτεΐνες, που διαφέρουν µεταξύ τους ως προς το µέγεθος, το σχήµα, το φορτίο, τη δεσµευτική συγγένεια υδρογόνου, την υδροφοβικότητα και τη χηµική αντιδραστικότητα. Πράγµατι, όλες οι πρωτεΐνες, σε όλα τα είδη βακτηριακές, αρχαϊκές και ευκαρυωτικές είναι δοµηµένες από τα ίδια 20 αµινοξέα. Αυτό το βασικό αλφάβητο των πρωτεϊνών δηµιουργήθηκε πριν από αρκετά δισεκατοµµύρια χρόνια. Η καταπληκτική ποικιλία πρωτεϊνικών λειτουργιών είναι αποτέλεσµα της ποικιλότητας και ποικιλοµορφίας αυτών των 20 δοµικών στοιχείων. Η κατανόηση της χρήσης του αλφαβήτου στη δηµιουργία των πολύπλοκων τριδιάστατων δοµών που επιτρέπουν στις πρωτεΐνες να συµµετέχουν σε τόσες βιολογικές διεργασίες είναι ένα συναρπαστικό τµήµα της βιοχηµείας και θα το αναλύσουµε στο Υποκεφάλαιο 3.6. Ας παρατηρήσουµε τώρα αυτά τα 20 αµινοξέα. Το απλούστερο είναι η γλυκίνη, που έχει µόνο ένα άτοµο υδρογόνου ως πλευρική αλυσίδα. Έχοντας δύο άτοµα υδρογόνου συνδεδεµένα µε ένα άτοµο α-άνθρακα, η γλυκίνη είναι µοναδική διότι δεν είναι χειρόµορφη. Η αλανίνη, που είναι το επόµενο απλούστερο αµινοξύ, έχει µια µεθυλική οµάδα ( 3 ) για πλευρική αλυσίδα (Eικόνα 3.7) Μεγαλύτερες αλυσίδες υδατανθράκων υπάρχουν στη βαλίνη, τη λευκίνη και την ισολευκίνη (Eικόνα 3.8). Η µεθειονίνη έχει µια πλευρική αλυσίδα που είναι κυρίως αλειφατική και περιλαµβάνει έναν θειοαιθέρα ( ). Στην ισολευκίνη η πλευρική αλυσίδα περιλαµβάνει ένα ακόµη χειρόµορφο κέντρο, στις πρωτεΐνες όµως υπάρχει µόνο το ισοµερές της Εικόνας 3.8. Οι µεγαλύτερες αλειφατικές πλευρικές αλυσίδες είναι υδρόφοβες έχουν την τάση δηλαδή να δη- µιουργούν συσσωµατώµατα µεταξύ τους παρά να έρχονται σε επαφή µε το νερό. Η τριδιάστατη δοµή των υδατοδιαλυτών πρωτεϊνών σταθεροποιείται από την τάση των υδρόφοβων οµάδων να βρίσκονται κοντά η µία στην άλλη, τάση που ονοµάζεται φαινόµενο υδροφοβικότητας (Εδάφιο 1.3.4). Επειδή τα µεγέθη και τα σχήµατα των υδρόφοβων οµάδων είναι διαφορετικά, τα συµπαγή κέντρα που δηµιουργούνται από αυτές αφήνουν µερικούς κενούς χώρους που µοιάζουν µε τρύπες. Η προλίνη έχει επίσης αλειφατική πλευρική αλυσίδα, διαφέρει όµως από τα άλλα 20 αµινοξέα διότι η πλευρική αλυσίδα της συνδέεται και µε το άτοµο του αζώτου και µε το άτοµο του α-άνθρακα (Eικόνα 3.9). Η προλίνη µπορεί να επηρεάσει ιδιαίτερα την πρωτεϊνική αρχιτεκτονική διότι ο δακτύλιος της δοµής της την κάνει πιο άκαµπτη από ό,τι τα άλλα αµινοξέα. 49 Σύνολο 20 αµινοξέων ÚÔÏ ÓË (Pro, P) EIKA 3.9 Κυκλικές δοµές προλίνης. Η πλευρική αλυσίδα συνδέεται και µε το άτοµο του α- άνθρακα και µε την αµινική οµάδα. Στο βασικό σύνολο των αµινοξέων περιλαµβάνονται και τρία αµινοξέα µε απλές αρωµατικές πλευρικές αλυσίδες (Eικόνα 3.10). Η φαινυλαλανίνη, όπως δηλώνει και το όνοµά της, περιέχει έναν φαινολικό δακτύλιο συνδεδεµένο στη θέση ενός από τα υδρογόνα της αλανίνης. Ο αρωµατικός δακτύλιος της τυροσίνης περιέχει υδροξύλιο. Το υδροξύλιο αυτό εµφανίζει αντιδραστικότητα, σε αντίθεση µε τις πλευρικές αλυσίδες άλλων αµινοξέων που συζητήσαµε ώς τώρα, οι οποίες είναι µάλλον αδρανείς. Η θρυπτοφάνη έχει έναν ινδολικό δακτύ-

6 50 ΚΕΦΑΛΑΙΟ 3 οµή και λειτουργία των πρωτεϊνών º ÈÓ Ï Ï Ó ÓË (Phe, F) T ÚÔÛ ÓË (Tyr, Y) Ú appleùôê ÓË (Trp, W) EIKA 3.10 Αµινοξέα µε αρωµατικές πλευρικές αλυσίδες. Η φαινυλαλανίνη, η τυροσίνη και η θρυπτοφάνη έχουν υδρόφοβο χαρακτήρα. Η τυροσίνη και η θρυπτοφάνη έχουν επίσης υδρόφιλες ιδιότητες διότι έχουν πλευρικές οµάδες ΟΗ και ΝΗ, αντίστοιχα º ÈÓ Ï Ï Ó ÓË (Phe, F) + 3 T ÚÔÛ ÓË (Tyr, Y) Ú appleùôê ÓË (Trp, W) ÓÙÂÏÂÛÙ applefiû ÂÛË (M 1 cm 1 ) Trp Tyr 280 M ÎÔ Î Ì ÙÔ (nm) λιο συνδεδεµένο µε µια µεθυλενική ( 2 ) οµάδαø η ινδολική οµάδα αποτελείται από δύο συνδεδεµένους δακτύλιους και µία οµάδα ΝΗ. Η φαινυλαλανίνη είναι καθαρά υδρόφοβη, ενώ η τυροσίνη και η θρυπτοφάνη είναι λιγότερο υδρόφοβες λόγω των οµάδων υδροξυλίου και. Ο αρωµατικός δακτύλιος της θρυπτοφάνης και της τυροσίνης περιέχει απεντοπισµένα ηλεκτρόνια π που απορροφούν έντονα την υπεριώδη ακτινοβολία (Eικόνα 3.11). Η ικανότητα µιας ένωσης να απορροφά φως περιγράφεται από τον συντελεστή απόσβεσης (extinction coefficient). Ο νόµος του Beer δίνει την απορροφητικότητα (A) του φωτός για ένα συγκεκριµένο µήκος κύµατος: A = cl Νόµος του Beer όπου είναι ο συντελεστής απόσβεσης [σε µονάδες που είναι το αντίστροφο της γραµµοµοριακότητας κατ όγκο και της απόστασης σε εκατοστόµετρα (M 1 cm 1 )], c είναι η συγκέντρωση της ουσίας που απορροφά (σε µονάδες γραµ EIKA 3.11 Φάσµατα απορρόφησης των αρωµατικών αµινοξέων θρυπτοφάνη (κόκκινο) και τυροσίνη (µπλε). Αυτά είναι τα µόνα αµινοξέα που απορροφούν έντονα γύρω στα 280 nm. [Ευγενική προσφορά Gregory J. Gatto.]

7 ÂÚ ÓË (er, ) ÚÂÔÓ ÓË (Thr, T) 51 Σύνολο 20 αµινοξέων * ÂÚ ÓË (er, ) + 3 ÚÂÔÓ ÓË (Thr, T) 3 EIKA 3.12 Αµινοξέα που περιέχουν αλειφατικές υδροξυλικές οµάδες. Η σερίνη και η θρεονίνη περιέχουν υδροξυλικές οµάδες που τις κάνουν υδρόφιλες. Το πρόσθετο χειρόµορφο κέντρο στη θρεονίνη σηµειώνεται µε αστερίσκο. µοµοριακότητας κατ όγκο, M) και l είναι το µήκος που διανύει το φως (σε µονάδες εκατοστοµέτρων). Για τη θρυπτοφάνη, το µέγιστο απορρόφησης είναι στα 280 nm και ο συντελεστής απόσβεσης 3400 M 1 cm 1, ενώ για την τυροσίνη η απορρόφηση έχει µέγιστο στα 276 nm και ο συντελεστής απόσβεσης είναι µικρότερος, 1400 M 1 cm 1. Η φαινυλαλανίνη απορροφά φως λιγότερο έντονα και σε µικρότερα µήκη κύµατος. Η απορρόφηση του φωτός στα 280 nm µπορεί να χρησιµοποιηθεί για τον υπολογισµό της συγκέντρωσης µιας πρωτεΐνης στο διάλυµα, αν είναι γνωστός ο αριθµός των καταλοίπων τυροσίνης και θρυπτοφάνης που υπάρχουν στην πρωτεΐνη. ύο αµινοξέα, η σερίνη και η θρεονίνη, περιέχουν αλειφατικές υδροξυλικές οµάδες (Eικόνα 3.12). Η σερίνη µπορεί να θεωρηθεί µια υδροξυλιωµένη αλανίνη, ενώ η θρεονίνη µοιάζει µε τη βαλίνη µε µια υδροξυλική οµάδα στη θέση µιας µεθυλικής οµάδας της βαλίνης. Τα υδροξύλια της σερίνης και της θρεονίνης έχουν ως αποτέλεσµα τα αµινοξέα αυτά να είναι πολύ πιο υδρόφιλα και εύκολα στο να αντιδρούν σε σχέση µε την αλανίνη και τη βαλίνη. Η θρεονίνη, όπως η ισολευκίνη, περιέχει συµπληρωµατικά ασύµµετρα κέντραø πάλι όµως µόνον ένα ισοµερές εµφανίζεται στις πρωτεΐνες. Η κυστεΐνη είναι δοµικώς όµοια µε τη σερίνη αλλά περιέχει µια σουλφυδρυλική, ή θειολική ( ) οµάδα, στη θέση της υδροξυλικής οµάδας ( ) (Eικόνα 3.13). Η υδροξυλική οµάδα είναι πολύ πιο δραστική. Τα ζεύγη των σουλφυδρυλικών οµάδων µπορεί να ενωθούν για να δώσουν δισουλφιδικούς δεσµούς, που είναι ιδιαίτερα σηµαντικοί στη σταθεροποίηση µερικών πρωτεϊνών, όπως θα δούµε σύντοµα K ÛÙÂ ÓË (ys, ) EIKA 3.13 οµή της κυστεΐνης.

8 52 ΚΕΦΑΛΑΙΟ 3 οµή και λειτουργία των πρωτεϊνών Û ÓË (Lys, K) AÚÁÈÓ ÓË (Arg, R) IÛÙÈ ÓË (is, ) EIKA 3.14 Τα βασικά αµινοξέα λυσίνη, αργινίνη και ιστιδίνη. Û ÓË (Lys, K) AÚÁÈÓ ÓË (Arg, R) IÛÙÈ ÓË (is, ) Ô ÓÈ ÈÓÈÎ ÔÌ IÌÈ fiïèô EIKA 3.15 Ο ιοντισµός της ιστιδίνης. Η ιστιδίνη µπορεί να δεσµεύει και να απελευθερώνει πρωτόνια κοντά στο φυσιολογικό pη. Ας πάµε τώρα σε αµινοξέα µε ιδιαίτερα πολικές πλευρικές αλυσίδες που τα καθιστούν ιδιαίτερα υδρόφιλα. Η λυσίνη και η αργινίνη έχουν σχετικά µακριές πλευρικές αλυσίδες που τελειώνουν µε οµάδες θετικά φορτισµένες σε ουδέτερο p. Η λυσίνη τελειώνει σε αµινική οµάδα και η αργινίνη σε οµάδα γουανιδίνης. Η ιστιδίνη περιέχει µια οµάδα ιµιδαζολίου, έναν αρωµατικό δακτύλιο που µπορεί να φορτιστεί (Eικόνα 3.14). Με pk a κοντά στο 6, η οµάδα του ιµιδαζολίου µπορεί να είναι ή φορτισµένη θετικά ή αφόρτιστη σε ουδέτερο p ανάλογα από το µικροπεριβάλλον στο οποίο θα βρεθεί (Eικόνα 3.15). Πράγµατι, πολύ συχνά απαντά ιστιδίνη στο ενεργό κέντρο των ενζύµων, όπου το ιµιδαζόλιο µπορεί να δεσµεύει και να απελευθερώνει πρωτόνια κατά τη διάρκεια των ενζυµικών αντιδράσεων. Η οµάδα των αµινοξέων περιέχει και δύο µέλη µε όξινες πλευρικές αλυσίδες: το ασπαραγινικό οξύ και το γλουταµινικό οξύ (Eικόνα 3.16). Τα αµινοξέα αυτά λέγονται συνήθως ασπαραγινικό και γλουταµινικό για να τονιστεί ότι οι πλευ-

9 AÛapple Ú ÁÈÓÈÎfi (Asp, D) ÏÔ Ù ÌÈÓÈÎfi (Glu, E) AÛapple Ú Á ÓË (Asn, ) ÏÔ Ù Ì ÓË (Gln, Q) 53 Σύνολο 20 αµινοξέων AÛapple Ú ÁÈÓÈÎfi (Asp, D) ÏÔ Ù ÌÈÓÈÎfi (Glu, E) AÛapple Ú Á ÓË (Asn, ) ÏÔ Ù Ì ÓË (Gln, Q) EIKA 3.16 Αµινοξέα που έχουν καρβοξύλια και καρβοξυλαµίδια στις πλευρικές αλυσίδες τους. ρικές αλυσίδες τους είναι τις πιο πολλές φορές αρνητικά φορτισµένες σε φυσιολογικό p. Παρ όλα αυτά, σε µερικές πρωτεΐνες αυτές οι πλευρικές αλυσίδες δέχονται πρωτόνια, και αυτή η ικανότητά τους είναι συχνά ιδιαίτερα ση- µαντική από λειτουργική άποψη. Η οµάδα αυτή διαθέτει επίσης µη φορτισµένα παράγωγα του ασπαραγινικού και του γλουταµινικού την ασπαραγίνη και τη γλουταµίνη που περιέχουν τελική οµάδα καρβοξυλαµιδίου αντί καρβοξυλίου (Eικόνα 3.16) Επτά από τα 20 αµινοξέα έχουν πλευρικές αλυσίδες που εύκολα ιοντίζονται. Αυτά τα 7 αµινοξέα εύκολα δίνουν και δέχονται πρωτόνια, διευκολύνοντας αντιδράσεις ή τη δηµιουργία ιοντικών δεσµών. Ο Πίνακας 3.1 περιλαµβάνει τις µορφές ισορροπίας και το pk a ιοντισµού των πλευρικών αλυσίδων τυροσίνης, κυστεΐνης, αργινίνης, λυσίνης, ιστιδίνης, ασπαραγινικού και γλουταµινικού στις πρωτεΐνες. ύο άλλες οµάδες στις πρωτεΐνες η α-αµινο-τελική οµάδα και η α-καρβοξυ-τελική οµάδα µπορούν να ιοντιστούν. Στον Πίνακα 3.1 περιλαµβάνονται επίσης τα τυπικά pk a και για τις οµάδες αυτές. Τα αµινοξέα συχνά χαρακτηρίζονται µε ένα ή µε τρία γράµµατα (Πίνακας 3.2). Οι συντοµογραφίες των τριών γραµµάτων χρησιµοποιούν τα τρία πρώτα γράµµατα του ονόµατός τους στην αγγλική, εκτός από την ασπαραγίνη (Asn), τη γλουταµίνη (Gln), την ισολευκίνη (Ile) και τη θρυπτοφάνη (Trp). Τα σύµβολα ενός γράµµατος για πολλά αµινοξέα αντιστοιχούν στο πρώτο γράµµα του ονόµατός τους (π.χ. G για τη γλυκίνη, L για τη λευκίνη). Τα υπόλοιπα γράµ- µατα συµφωνήθηκαν µε σύµβαση. Τα σύµβολα αυτά και οι συντοµογραφίες είναι βασικά στοιχεία του λεξιλογίου της βιοχηµείας. Πώς αυτά ειδικά τα 20 αµινοξέα έγιναν τα δοµικά στοιχεία των πρωτεϊνών; Πρώτον, έχουν ποικιλότηταø τα δοµικά και τα χηµικά χαρα-

10 54 ΚΕΦΑΛΑΙΟ 3 οµή και λειτουργία των πρωτεϊνών ΠIAKAΣ 3.1 Tυπικές τιµές pk a ιοντιζόµενων οµάδων στις πρωτεΐνες. µάδα ξύ Bάση Tυπικό pk a * Tελική α-καρβοξυλοµάδα 3,1 Aσπαραγινικό οξύ Γλουταµινικό οξύ 4,1 Iστιδίνη + 6,0 Tελική α-αµινοµάδα + 8,0 Kυστεΐνη 8,3 Tυροσίνη 10,9 Λυσίνη + 10,8 Aργινίνη + 12,5 * ι τιµές pk a εξαρτώνται από τη θερµοκρασία, την ιοντική ισχύ και το µικροπεριβάλλον της ιοντιζόµενης οµάδας. ΠΙΝΑΚΑΣ 3.2 Συντοµογραφίες και σύµβολα για αµινοξέα. Συντοµογραφία Συντοµογραφία Αµινοξύ τριών γραµµάτων ενός γράµµατος Αλανίνη Ala A Αργινίνη Arg R Ασπαραγίνη Asn Ασπαραγινικό οξύ Asp D Βαλίνη Val V Γλουταµίνη Gln Q Γλουταµινικό οξύ Glu E Γλυκίνη Gly G Θρεονίνη Thr T Θρυπτοφάνη Trp W Ισολευκίνη Ile I Ιστιδίνη is Συντοµογραφία Συντοµογραφία Αµινοξύ τριών γραµµάτων ενός γράµµατος Κυστεΐνη ys Λευκίνη Leu L Λυσίνη Lys K Μεθειονίνη Met M Προλίνη Pro P Σερίνη er Τυροσίνη Tyr Y Φαινυλαλανίνη Phe F Ασπαραγίνη ή Asx B ασπαραγινικό οξύ Γλουταµίνη ή Glx Z γλουταµινικό οξύ

11 κτηριστικά τους καλύπτουν ένα πολύ ευρύ φάσµα, καθιστώντας τις πρωτεΐνες ικανές να αντεπεξέρχονται σε πολλούς διαφορετικούς λειτουργικούς ρόλους. εύτερον, όπως αναφέρθηκε στο Εδάφιο 2.1.1, πολλά από τα αµινοξέα αυτά πιθανώς υπήρχαν ήδη από τις προβιοτικές αντιδράσεις. Τελικά, ίσως άλλα πιθανά αµινοξέα να εξαφανίστηκαν διότι εµφάνιζαν έντονη εγγενή αντιδραστικότητα. Παραδείγµατος χάριν, αµινοξέα όπως η οµοσερίνη και η οµοκυστεΐνη έχουν την τάση να δηµιουργούν πενταµελείς κυκλικές δοµές που περιορίζουν τη χρήση τους στις πρωτεΐνες, ενώ αντίθετα τα εναλλακτικά αµινοξέα που απαντούν στις πρωτεΐνες η σερίνη και η κυστεΐνη δεν κυκλοποιούνται εύκολα διότι οι δακτύλιοι στην περίπτωση αυτή είναι πολύ µικροί (Eικόνα 3.17). 55 Πρωτοταγής δοµή ÌÔÛÂÚ ÓË ÂÚ ÓË X X X X EIKA 3.17 Ανεπιθύµητη αντιδραστικότητα σε αµινοξέα. Μερικά αµινοξέα δεν είναι κατάλληλα για να συµπεριληφθούν σε πρωτεϊνικές δο- µές διότι έχουν την τάση να κυκλοποιούνται. Η οµοσερίνη σχηµατίζει σταθερές δοµές δακτυλίων που αποτελούνται από πέντε άτοµα άνθρακα και αυτό έχει ως συνέπεια τη διάσπαση του πεπτιδικού δεσµού. Η κυκλοποίηση της σερίνης θα δη- µιουργούσε έναν πιεσµένο δακτύλιο τεσσάρων ατόµων άνθρακα, άρα δεν ευνοείται στην περίπτωση αυτή. Το Χ στη δοµή συµβολίζει αµινική οµάδα από ένα γειτονικό αµινοξύ ή κάποια άλλη οµάδα που έχει τη δυνατότητα να αποµακρυνθεί. 3.2 ΠΡΩΤΟΤΑΓΗΣ ΟΜΗ: ΤΑ ΑΜΙΝΟΞΕΑ ΣΥΝ ΕΟΝΤΑΙ ΜΕ ΠΕΠΤΙ ΙΚΟΥΣ ΕΣΜΟΥΣ ΓΙΑ ΝΑ ΣΧΗΜΑΤΙΣΟΥΝ ΠΟΛΥΠΕΠΤΙ ΙΚΕΣ ΑΛΥΣΙ ΕΣ Οι πρωτεΐνες είναι γραµµικά πολυµερή που δηµιουργούνται δεσµεύοντας την α- καρβοξυλική οµάδα ενός αµινοξέος στην α-αµινική οµάδα ενός άλλου αµινοξέος µε έναν πεπτιδικό δεσµό (που λέγεται και αµιδικός δεσµός). Η δηµιουργία ενός διπεπτιδίου από δύο αµινοξέα συνοδεύεται από την απώλεια ενός µορίου ύδατος (Eικόνα 3. 18). Η ισορροπία της αντίδρασης βρίσκεται µάλλον προς την πλευρά της υδρόλυσης παρά της σύνθεσης. Εποµένως, η βιοσύνθεση του πεπτιδικού δεσµού χρειάζεται την προσθήκη ελεύθερης ενέργειας. Παρ όλα αυτά οι πεπτιδικοί δεσµοί είναι αρκετά σταθεροί κινητικάø η διάρκεια ζωής ενός πεπτιδικού δεσµού σε υδάτινο διάλυµα, όταν δεν υπάρχει καταλύτης, πλησιάζει τα 1000 χρόνια. Μια σειρά αµινοξέων που ενώνονται µε πεπτιδικούς δεσµούς δηµιουργούν µια πολυπεπτιδική αλυσίδα, και κάθε µονάδα αµινοξέος στο πολυπεπτίδιο ονο- µάζεται κατάλοιπο. Μια πολυπεπτιδική αλυσίδα έχει πολικότητα διότι τα δύο άκρα της είναι διαφορετικά: µια α-αµινική οµάδα στο ένα άκρο, µια α-καρβοξυλική οµάδα στο άλλο άκρο. Συµβατικά, έχουµε δεχθεί ότι το αµινο-τελικό άκρο θεωρείται η αρχή της πολυπεπτιδικής αλυσίδας και εποµένως η αλληλουχία των αµινοξέων σε µια πολυπεπτιδική αλυσίδα γράφεται αρχίζοντας µε το αµινο-τελι- + 3 R R R 1 R EIKA 3.18 Η δηµιουργία πεπτιδικού δεσµού. Η σύνδεση δύο αµινοξέων συνοδεύεται από την απώλεια ενός µορίου ύδατος. ÂappleÙÈ ÈÎfi ÂÛÌfi

12 56 ΚΕΦΑΛΑΙΟ 3 οµή και λειτουργία των πρωτεϊνών 3 3 EIKA 3.19 Η αλληλουχία αµινοξέων διαβάζεται προς µία µόνο κατεύθυνση. Η εικόνα του πενταπεπτιδίου Tyr-Gly-Gly-Phe-Leu (YGGFL) δείχνει την αλληλουχία από το αµινο-τελικό προς το καρβοξυ-τελικό άκρο. Αυτό το πενταπεπτίδιο, η λευκινο-εγκεφαλίνη, είναι ένα ενδογενές οπιοειδές που τροποποιεί την αντίληψη του πόνου από τον εγκέφαλο. Το αντίθετο πενταπεπτίδιο, το Leu-Gly-Gly-Tyr (LFGGY), είναι ένα διαφορετικό µόριο χωρίς καµία λειτουργία στον εγκέφαλο Tyr AÌÈÓÔ-ÙÂÏÈÎfi Î Ù ÏÔÈappleÔ Gly Gly 2 Phe 2 Leu K Ú ÔÍ -ÙÂÏÈÎfi Î Ù ÏÔÈappleÔ κό κατάλοιπο. Έτσι, στο πενταπεπτίδιο Tyr Gly Gly Phe Leu (YGGFL), η τυροσίνη είναι το αµινο-τελικό κατάλοιπο και η λευκίνη το καρβοξυ-τελικό κατάλοιπο (Eικόνα 3.19). Το Leu Phe Gly Gly Tyr (FGGY) είναι ένα άλλο πενταπεπτίδιο, µε διαφορετικές χηµικές ιδιότητες. Μια πολυπεπτιδική αλυσίδα αποτελείται από ένα σταθερά επαναλαµβανό- µενο τµήµα, που ονοµάζεται κύρια αλυσίδα ή κορµός, και ένα µεταβλητό τµή- µα, που αποτελείται από τις διαφορετικές πλευρικές αλυσίδες (Eικόνα 3.20). Ο κορµός του πολυπεπτιδίου έχει πολλές δυνατότητες δηµιουργίας δεσµών υδρογόνου. Κάθε κατάλοιπο έχει µια καρβονυλική οµάδα, που είναι καλός δέκτης δεσµών υδρογόνου και µια αµιδική οµάδα (εκτός από την προλίνη), που είναι καλός δότης δεσµών υδρογόνου. Αυτές οι οµάδες αλληλεπιδρούν µεταξύ τους και µε λειτουργικές οµάδες των πλευρικών αλυσίδων και έτσι σταθεροποιούνται συγκεκριµένες δοµές για κάθε πολυπεπτιδική αλυσίδα, όπως θα αναλύσουµε στη συνέχεια. EIKA 3.20 Τα τµήµατα της πολυπεπτιδικής αλυσίδας. Η πολυπεπτιδική αλυσίδα αποτελείται από έναν σταθερό κορµό (µαύρο χρώµα) και ποικιλία πλευρικών αλυσίδων (πράσινο χρώµα). R 1 R 2 R 3 R 4 R 5 Dalton Μονάδα µάζας ίση περίπου µε τη µάζα του υδρογόνου. Ονοµάστηκε προς τιµήν του John Dalton ( ), που ανέπτυξε την ατο- µική θεωρία της ύλης. Kilodalton (kd) Μονάδα µάζας ίση µε 1000 dalton Οι περισσότερες φυσικές πολυπεπτιδικές αλυσίδες περιέχουν από 50 έως 2000 κατάλοιπα αµινοξέων και συνήθως ονοµάζονται πρωτεΐνες. Τα πεπτίδια που έχουν µικρότερο αριθµό αµινοξέων ονοµάζονται ολιγοπεπτίδια ή απλώς πεπτίδια. Το µέσο µοριακό βάρος ενός αµινοξέος είναι περίπου 110 και έτσι το µοριακό βάρος των περισσότερων πρωτεϊνών είναι µεταξύ 5500 και Μπορούµε να αναφερθούµε επίσης στη µάζα µιας πρωτεΐνης, που εκφράζεται σε µονάδες dalton, όπου ένα dalton ισούται µε τη µονάδα ατοµικής µάζας. Μια πρωτεΐνη µοριακού βάρους έχει µάζα dalton ή 50 kd (kilodalton). Σε µερικές πρωτεΐνες, υπάρχουν διασυνδέσεις στη γραµµική πολυπεπτιδική αλυσίδα. Οι πιο κοινές διασυνδέσεις είναι δισουλφιδικοί δεσµοί, που σχη- µατίζονται από την οξείδωση ενός ζεύγους καταλοίπων κυστεΐνης (Eικόνα 3.21). Το αποτέλεσµα της σύνδεσης των δύο κυστεϊνών είναι µια µονάδα κυστίνης. Οι εξωκυτταρικές πρωτεΐνες συχνά έχουν αρκετούς δισουλφιδικούς δεσµούς, στις ενδοκυτταρικές πρωτεΐνες όµως οι δεσµοί συνήθως απουσιάζουν. Σπανίως, µη δισουλφιδικές διασυνδέσεις που προέρχονται από άλλες πλευρικέ αλυσίδες υπάρχουν σε µερικές πρωτεΐνες. Παραδείγµατος χάριν, οι κολ-

13 Πρωτοταγής δοµή K ÛÙ ÓË 2 K ÛÙ ÓË Í ˆÛË AÓ ÁˆÁ 2 K ÛÙ ÓË e EIKA 3.21 ιασυνδέσεις. Ο σχηµατισµός δισουλφιδικού δεσµού από δύο κατάλοιπα κυστεΐνης είναι οξειδωτική αντίδραση. λαγόνες ίνες του συνδετικού ιστού και το ινώδες που συµµετέχει στην πήξη του αίµατος ενισχύουν τη δοµή τους µε διασυνδέσεις µεταξύ των καταλοίπων τους Οι πρωτεΐνες έχουν µοναδικές αλληλουχίες αµινοξέων που καθορίζονται από γονίδια Το 1953 ο Frederick anger προσδιόρισε την αλληλουχία αµινοξέων της ινσουλίνης, που είναι πρωτεϊνική ορµόνη (Eικόνα 3.22). Η εργασία αυτή αποτελεί ορόσηµο για τη βιοχηµεία διότι απέδειξε για πρώτη φορά ότι µια πρωτεΐνη έχει µια απόλυτα καθορισµένη αλληλουχία αµινοξέων. Έδειξε ακόµη ότι η ινσουλίνη αποτελείται µόνον από L-αµινοξέα που συνδέονται µε πεπτιδικούς δεσµούς µεταξύ της α-αµινικής οµάδας και της α-καρβοξυλικής οµάδας. Αυτό το επίτευγµα πυροδότησε και τις µελέτες προσδιορισµού της αλληλουχίας πολλών πρωτεϊνών από άλλους επιστήµονες. Σήµερα γνωρίζουµε ολόκληρη την αλληλουχία για περισσότερες από πρωτεΐνες. Το εντυπωσιακό είναι ότι η κάθε πρωτεΐνη έχει µια µοναδική και απόλυτα καθορισµένη αλληλουχία αµινοξέων. Η αλληλουχία αµινοξέων της πρωτεΐνης συχνά ονοµάζεται πρωτοταγής δοµή. Μια σειρά από αναλυτικές µελέτες στα τέλη του 1950 και στις αρχές του 1960 αποκάλυψαν ότι οι αλληλουχίες στις πρωτεΐνες καθορίζονται γενετικά. Η αλληλουχία νουκλεοτιδίων του DA, που είναι το µόριο κληρονοµικότητας, προσδιορίζει τη συµπληρωµατική αλληλουχία νουκλεοτιδίων στο RA, που µε τη σειρά του καθορίζει την αλληλουχία των αµινοξέων µιας πρωτεΐνης. Για την ακρίβεια, το κάθε ένα από τα 20 αµινοξέα της οµάδας κωδικεύεται από µία ή περισσότερες ειδικές αλληλουχίες τριών νουκλεοτιδίων (Yποκεφάλαιο 5.5). Η γνώση των αλληλουχιών αµινοξέων είναι σηµαντική για αρκετούς λόγους. Πρώτον, η γνώση της αλληλουχίας µιας πρωτεΐνης είναι συνήθως απαραίτητη για την κατανόηση του µηχανισµού δράσης της (π.χ. στην περίπτωση της καταλυτικής δράσης των ενζύµων). Ακόµη, τροποποιώντας την αλληλουχία γνωστών πρωτεϊνών µπορούµε να δηµιουργήσουµε πρωτεΐνες µε νέες ιδιότητες. εύτερον, η γνώση της αλληλουχίας των αµινοξέων καθορίζει την AÏ Û A Gly-Ile-Val-Glu-Gln-ys-ys-Ala-er-Val-ys-er-Leu-Tyr-Gln-Leu-Glu-Asn-Tyr-ys-Asn EIKA 3.22 Η αλληλουχία αµινοξέων βόειας ινσουλίνης. AÏ Û B Phe-Val-Asn-Gln-is-Leu-ys-Gly-er-is-Leu-Val-Glu-Ala-Leu-Tyr-Leu-Val-ys-Gly-Glu-Arg-Gly-Phe-Phe-Tyr-Thr-Pro-Lys-Ala

14 τριδιάστατη δοµή των πρωτεϊνών. Η αλληλουχία των αµινοξέων είναι ο συνδετικός κρίκος µεταξύ της γενετικής πληροφορίας του DA και της τριδιάστατης δοµής που καθορίζει τη βιολογική λειτουργία µιας πρωτεΐνης. Οι αναλύσεις της σχέσης µεταξύ αλληλουχίας αµινοξέων και τριδιάστατης δοµής µιας πρωτεΐνης αποκαλύπτουν τους κανόνες που καθορίζουν την αναδίπλωση των πολυπεπτιδικών αλυσίδων. Τρίτον, ο προσδιορισµός της αλληλουχίας αποτελεί στόχο και για τη µοριακή παθολογία, µια ειδικότητα της ιατρικής που αναπτύσσεται ραγδαία. Τροποποιήσεις στην αλληλουχία αµινοξέων µιας πρωτεΐνης µπορεί να οδηγήσουν σε ανώµαλη δράση της και ασθένεια. Σοβαρότατες και πολλές φορές θανατηφόρες ασθέ- EIKA 3.23 Ο πεπτιδικός δεσµός είναι επίπεδος. Στο ζεύγος συνδεδεµένων αµινοξέων και τα έξι άτοµα (a,,,, και 6) βρίσκονται στο ίδιο επίπεδο. Οι πλευρικές αλυσίδες έχουν πράσινο χρώµα στο σχήµα. νειες, όπως π.χ. η δρεπανοκυτταρική αναιµία και η κυστική ίνωση, µπορεί να είναι και αποτέλεσµα σηµειακής µεταλλαγής στην αλληλουχία µιας πρωτεΐνης. Τέταρτον, η αλληλουχία µιας πρωτεΐνης αποκαλύπτει πολλά και για την εξελικτική ιστορία της (Κεφάλαιο 7). Οι πρωτεΐνες µοιάζουν µεταξύ τους σε αλληλουχία µόνο αν έχουν κοινό πρόγονο. Συνεπώς, τα µοριακά γεγονότα της εξέλιξης είναι δυνατόν να αποκαλυφθούν από τη µελέτη των αλληλουχιών των αµινοξέων και η µοριακή παλαιοντολογία αποτελεί ένα αναπτυσσόµενο πεδίο έρευνας Οι πολυπεπτιδικές αλυσίδες είναι εύκαµπτες αλλά έχουν και καθορισµένη στερεοδιάταξη Η εξέταση της γεωµετρίας του πρωτεϊνικού κορµού αποκαλύπτει αρκετά ση- µαντικά στοιχεία. Πρώτον, ο πεπτιδικός δεσµός είναι βασικά επίπεδος (Eικόνα 3.23). Έτσι, λοιπόν, για κάθε ζεύγος αµινοξέων τα οποία συνδέονται µε πεπτιδικό δεσµό υπάρχουν έξι άτοµα που βρίσκονται στο ίδιο επίπεδο: το άτο- µο α-άνθρακα και η οµάδα του πρώτου αµινοξέος καθώς και η οµάδα και το άτοµο α-άνθρακα του δεύτερου αµινοξέος. Η εξήγηση αυτής της γεω- µετρικής προτίµησης βρίσκεται στη φύση του χηµικού δεσµού του πεπτιδίου. Ο πεπτιδικός δεσµός έχει, εν µέρει, χαρακτήρα διπλού δεσµού ο οποίος αποτρέπει την περιστροφή γύρω από τον εαυτό του. + ÔÌ Û ÓÙÔÓÈÛÌÔ ÙÔ appleâappleùè ÈÎÔ ÂÛÌÔ α 1,51 Å 1,32 Å 1,24 Å 1,45 Å EIKA 3.24 Τυπικές αποστάσεις µεταξύ των πεπτιδικών οµάδων. Μια πεπτιδική οµάδα εµφανίζεται εδώ σε διαµόρφωση trans (ετερόπλευρη). 1,0 Å α Το γεγονός ότι ο δεσµός δεν περιστρέφεται περιορίζει τις στερεοδιατάξεις του πεπτιδικού κορµού και εξηγεί την επίπεδη φύση του δεσµού. Αυτός ο χαρακτήρας διπλού δεσµού εκφράζεται και στην απόσταση µεταξύ των οµάδων και. Η απόσταση σε έναν πεπτιδικό δεσµό είναι 1,32 Å, δηλαδή µια τιµή που βρίσκεται µεταξύ των αναµενόµενων για έναν απλό δεσµό (1,49 Å) και έναν διπλό δεσµό = (1,27 Å), όπως φαίνεται στην Εικόνα Τέλος, ο πεπτιδικός δεσµός δεν έχει φορτίο, επιτρέποντας έτσι στα πολυµερή των αµινοξέων που συνδέονται µε πεπτιδικούς δεσµούς να δη- µιουργήσουν σφαιρικές κατασκευές χωρίς ενδιάµεσα κενά. Υπάρχουν δύο δυνατές διαµορφώσεις για έναν επίπεδο πεπτιδικό δεσµό. Στη διαµόρφωση trans τα δύο άτοµα α-άνθρακα βρίσκονται απέναντι, ενώ στη διαµόρφωση cis βρίσκονται

15 59 Πρωτοταγής δοµή Trans is EIKA 3.25 Οι πεπτιδικοί δεσµοί trans και cis. Η µορφή trans είναι προτιµητέα διότι στη µορφή cis υπάρχουν προβλήµατα χωροδιάταξης. στην ίδια πλευρά του πεπτιδικού δεσµού. Όλοι σχεδόν οι πεπτιδικοί δεσµοί των πρωτεϊνών είναι trans. Αυτή η προτίµηση της διαµόρφωσης trans σε σχέση µε τη διαµόρφωση cis εξηγείται από το γεγονός ότι οι στερικές αλληλοεπικαλύψεις των οµάδων που συνδέονται στα άτοµα α-άνθρακα παρεµποδίζουν τη δια- µόρφωση cis αλλά αφήνουν ελεύθερη την trans (Eικόνα 3.25). Οι πιο κοινές περιπτώσεις δεσµών cis αφορούν το αµινοξύ Χ και την προλίνη (X-Pro). Οι δεσµοί αυτοί της προλίνης έχουν διαµόρφωση cis αντί trans διότι το άζωτο της προλίνης είναι δεσµευµένο σε δύο τετρασθενή άτοµα άνθρακα, γεγονός που περιορίζει ουσιαστικά τις στερικές διαφοροποιήσεις µεταξύ µορφών trans και cis (Eικόνα 3.26). ίεδρη γωνία Είναι το µέγεθος µέτρησης της ικανότητας στροφής γύρω από έναν δεσµό, που συνήθως βρίσκεται µεταξύ 180 και Οι δίεδρες γωνίες µερικές φορές λέγονται και γωνίες στρέψης. EIKA 3.26 Trans και is Χ-Ρro. Στην περίπτωση αυτή, η ενέργεια είναι περίπου ίδια διότι υπάρχουν αντίστοιχα προβλήµατα χωροδιάταξης και για τις δύο µορφές. Trans is Σε αντίθεση µε τον πεπτιδικό δεσµό, οι δεσµοί που ενώνουν τις αµινικές οµάδες µε το άτοµο α-άνθρακα και τις καρβονυλικές οµάδες µε το άτοµο α-άνθρακα είναι καθαροί απλοί δεσµοί. Τα δύο γειτονικά άκαµπτα πεπτιδικά επίπεδα µπορούν εποµένως να περιστραφούν γύρω από τους δεσµούς αυτούς αποκτώντας διάφορους προσανατολισµούς. Η ελευθερία περιστροφής γύρω από τους δύο δεσµούς κάθε αµινοξέος επιτρέπει στις πρωτεΐνες να αναδιπλωθούν µε πολλούς και διάφορους τρόπους. Οι περιστροφές γύρω από τους δεσµούς είναι δυνατόν να προσδιοριστούν από τις δίεδρες γωνίες (Eικόνα 3.27). Η γωνία περιστροφής γύρω από τον δεσµό µεταξύ των ατόµων αζώτου και α-άνθρακα ονοµάζεται φ. Η γωνία περιστροφής γύρω από τον δεσµό ατόµου α-άνθρακα και της καρβονυλικής οµάδας ονοµάζεται ψ. Για οποιονδήποτε από τους δεσµούς η περιστροφή κατά τη φορά των δεικτών του ρολογιού (κοιτώντας από πίσω προς τα εµπρός) αντιστοιχεί σε θετική τιµή. Οι γωνίες φ και ψ καθορίζουν την κατεύθυνση της πολυπεπτιδικής αλυσίδας. (A) R φ R ψ R (B) ( ) φ φ = 80Æ ψ ψ = +85Æ EIKA 3.27 Η περιστροφή γύρω από τους δεσµούς ενός πολυπεπτιδίου. Η δοµή κάθε αµινοξέος σε ένα πολυπεπτίδιο µπορεί να ρυθµιστεί από την περιστροφή γύρω από δύο απλούς δεσµούς. (Α) γωνία περιστροφής γύρω από τον δεσµό µεταξύ των ατόµων αζώτου και α-άνθρακα ονοµάζεται φ, ενώ η γωνία περιστροφής γύρω από τον δεσµό µεταξύ του ατό- µου α-άνθρακα και των ανθράκων της καρβονυλικής οµάδας ονοµάζεται ψ. (Β) Μια κάτοψη του δεσµού µεταξύ αζώτου και ατόµου α-άνθρακα δείχνει πώς µετράµε τη φ. (Γ) Μια κάτοψη του δεσµού µεταξύ του ατόµου α-άνθρακα και του άνθρακα της καρβονυλικής οµάδας, δείχνει πώς µετράµε την ψ.

16 60 ΚΕΦΑΛΑΙΟ 3 οµή και λειτουργία των πρωτεϊνών EIKA 3.28 Ένα διάγραµµα Ramachandran που δείχνει τις τιµές των φ και ψ. Οι τιµές φ και ψ είναι περιορισµένες λόγω των συγκρούσεων µεταξύ ατόµων. Οι επιτρεπτές τιµές φ και ψ φαίνονται µε σκούρο πράσινο, ενώ οι οριακές τιµές φαίνονται µε ανοιχτό πράσινο. Η δοµή που φαίνεται δεξιά είναι εκείνη που δηµιουργεί τις λιγότερες συγκρούσεις µεταξύ των ατόµων. ψ φ (φ = 90Æ, ψ = 90Æ) ÂÓ Â ÓÔÂ Ù È Ποιοι συνδυασµοί είναι δυνατοί για τις γωνίες φ και ψ; Ο G.. Ramachandran διαπίστωσε ότι πολλοί συνδυασµοί δεν είναι δυνατοί λόγω των στερικών συγκρούσεων µεταξύ των ατόµων. Οι τιµές που επιτρέπονται µπορούν να τοποθετηθούν σε ένα διδιάστατο σχήµα που ονοµάζεται διάγραµµα Ramachandran (Eικόνα 3.28). Τα τρία τέταρτα των πιθανών συνδυασµών των γωνιών φ και ψ είναι αδύνατον να πραγµατοποιηθούν διότι δηµιουργούν τοπικές στερικές συγκρούσεις. Ο στερικός αποκλεισµός, δηλαδή το γεγονός ότι δύο άτοµα δεν µπορούν να είναι στο ίδιο σηµείο συγχρόνως, µπορεί να είναι σηµαντικότατος κανόνας οργάνωσης της δοµής των πρωτεϊνών. Η ικανότητα των βιολογικών πολυµερών, όπως οι πρωτεΐνες, να αναδιπλώνονται σε καλά καθορισµένες δοµές είναι ιδιαίτερα αξιοσηµείωτη θερµοδυναµικά. Φθάνει να σκεφθούµε τις ισορροπίες µεταξύ ενός ξεδιπλωµένου πολυµερούς που έχει στερεοδιάταξη τυχαίου σπειράµατος (δηλαδή µείγµατος πολλών πιθανών στερεοδιατάξεων) και µιας αναδιπλωµένης µορφής που αποκτά µια µοναδική στερεοδιάταξη. Η απελευθέρωση της εντροπίας σε συνδυασµό µε τον µεγάλο αριθµό στερεοδιατάξεων της ξεδιπλωµένης µορφής εµποδίζει την αναδίπλωση η οποία είναι δυνατόν να πραγµατοποιηθεί µόνο µε αλληλεπιδράσεις που προωθούν την αναδιπλωµένη µορφή. Εποµένως, τα πολύ ευέλικτα πολυµερή που έχουν µεγάλο αριθµό πιθανών αναδιπλώσεων δεν οδηγούν σε απόλυτα καθορισµένες µοναδικές δοµές. Η έλλειψη ευελιξίας στην πεπτιδική µονάδα και ο περιορισµένος αριθµός των επιτρεπόµενων γωνιών φ και ψ περιορίζουν τον αριθµό των δοµών που µπορεί να επιτύχει η ξεδιπλωµένη µορφή της πρωτεΐνης κατά τη διεργασία αναδίπλωσής της. 3.3 ΕΥΤΕΡΟΤΑΓΗΣ ΟΜΗ: ΟΙ ΠΟΛΥΠΕΠΤΙ ΙΚΕΣ ΑΛΥΣΙ ΕΣ ΜΠΟΡΟΥΝ ΝΑ ΑΝΑ ΙΠΛΩΝΟΝΤΑΙ ΣΕ ΚΑΝΟΝΙΚΕΣ ΟΜΕΣ ΟΠΩΣ α-ελικα, Η β-πτυχωτη ΕΠΙΦΑΝΕΙΑ, ΟΙ ΣΤΡΟΦΕΣ ΚΑΙ ΟΙ ΘΗΛΙΕΣ TRUTURAL IIGT: Eµφανίζονται σε όλο το βιβλίο και είναι ιδιαίτερες διδακτικές ασκήσεις για τη µοριακή διαµόρφωση που σας επιτρέπουν να δείτε τη δοµή και να µάθετε όλα τα τελευταία νέα της επιστήµης σχετικά µε τον τρόπο λειτουργίας κάθε µορίου. Η διεύθυνση της ιστοσελίδας: και η επιλογή: hapter, tructural Insights και µετά ο τίτλος. Είναι δυνατόν µια πολυπεπτιδική αλυσίδα να αναδιπλώνεται σε κανονικά επαναλαµβανόµενες δοµές; Το 1951 οι Linus Pauling και Robert orey πρότειναν δύο περιοδικές δοµές που τις ονόµασαν α-έλικα και β-πτυχωτή επιφάνεια. Στη συνέχεια καθορίστηκαν και άλλες δοµές όπως η β-στροφή και η Ω-θηλιά. Παρ όλο που οι δοµές αυτές δεν παρουσιάζουν περιοδικότητα, αποτελούν καλά προσδιορισµένες στροφές ή θηλιές και συνοδεύουν τις α-έλικες και τις β-πτυχωτές επιφάνειες στην τελική τριδιάστατη δοµή της πρωτεΐνης. TRUTURAL IIGT, Elements of Protein tructures: αποτελούν αντιπροσωπευτικά στοιχεία πρωτεϊνικής αρχιτεκτονικής µε τα οποία µπορείτε να ασκηθείτε. Θα βρείτε επίσης σε αυτήν τη θέση του δικτύου µια περίληψη των δευτεροταγών δοµικών µοτίβων που περιγράφονται στο παρόν κεφάλαιο.

17 (A) (B) ( ) 61 ευτεροταγής δοµή ( ) EIKA 3.29 Η δοµή µιας α-έλικας. (Α) Η απεικόνιση κορδέλας στην οποία ξεχωρίζουν τα άτοµα α-άνθρακα και οι πλευρικές αλυσίδες (πράσινο). (Β) Μια πλάγια όψη του µοντέλου µε σφαίρες και ράβδους όπου διακρίνονται οι δεσµοί υδρογόνου (διακεκοµµένες γραµµές) µεταξύ των οµάδων και. (Γ) Παρατηρώντας από το άκρο της έλικας και παράλληλα προς τον άξονα βλέπουµε τον περιελιγµένο κορµό να σχηµατίζει το εσωτερικό της έλικας και τις πλευρικές αλυσίδες (πράσινο) να προεξέχουν προς τα έξω. ( ) Ένα χωροπληρωτικό µοντέλο του (Γ) δείχνει πόσο λίγος κενός χώρος µένει στο κέντρο της έλικας Η α-έλικα είναι µια δοµή σπειράµατος που σταθεροποιείται µε ενδοµοριακούς δεσµούς υδρογόνου Στην προσπάθειά τους να καθορίσουν τις πιθανές δοµές των πεπτιδίων, οι Pauling και orey έλαβαν υπ όψιν τους στερικούς περιορισµούς καθώς και την ικανότητα του κορµού του πεπτιδίου να διαµορφώνει συνθήκες δεσµών υδρογόνου µεταξύ των οµάδων και. Η πρώτη δοµή που πρότειναν ήταν εκείνη της α-έλικας, που είναι µια ραβδόµορφη δοµή (Eικόνα 3.29). Ο κορµός, που έχει σχήµα σπειράµατος, σχηµατίζει το εσωτερικό της ράβδου και οι πλευρικές αλυσίδες εκτείνονται προς τα έξω, σε µια ελικοειδή διάταξη. Η α-έλικα σταθεροποιείται από δεσµούς υδρογόνου µεταξύ των οµάδων ΝΗ και Ο της κύριας αλυσίδας. Συγκεκριµένα, η οµάδα Ο κάθε αµινοξέος σχηµατίζει έναν δεσµό υδρογόνου µε την οµάδα ΝΗ του αµινοξέος που βρίσκεται τέσσερα κατάλοιπα µπροστά στην αλληλουχία (Eικόνα 3.30). Έτσι, στη δοµή αυτή όλες οι οµάδες και του πολυπεπτιδικού κορµού συνδέονται µε δεσµούς υδρογόνου, εκτός από εκείνες που βρίσκονται στα άκρα της έλικας. Κάθε κατάλοιπο απέχει από το επόµενο 1,5 Å κατά µήκος του άξονα της έλικας και είναι περιεστραµµένο κατά 100, δίνοντας 3,6 κατάλοιπα αµινοξέων ανά στροφή της έλικας. Συνεπώς, κατάλοιπα που απέχουν µεταξύ τους 3-4 αµινοξέα στην αλ- Η αίσθηση της στροφής περιγράφει την κατεύθυνση προς την οποία στρέφεται µια ελικοειδής δοµή σε σχέση µε τον άξονά της. Όταν κοιτάµε κατά µήκος του άξονά της και η αλυσίδα στρέφεται όπως οι δείκτες του ρολογιού τότε δίνει την αίσθηση δεξιόστροφης έλικας. Αντίστοιχα, αν στρέφεται αντίθετα προς τους δείκτες του ρολογιού τότε δίνει την αίσθηση αριστερόστροφης έλικας. R i R i+2 R i+4 R i+1 R i+3 R i+5 EIKA 3.30 ηµιουργία δεσµών υδρογόνου σε µια α-έλικα. Στην α-έλικα η οµάδα του καταλοίπου n δηµιουργεί έναν δεσµό υδρογόνου µε την οµάδα του καταλοίπου n + 4.

18 62 ΚΕΦΑΛΑΙΟ 3 οµή και λειτουργία των πρωτεϊνών (A) (B) ( ) ÂÍÈfiÛÙÚÔÊË ÏÈÎ (ÎÔÈÓ ) AÚÈÛÙÂÚfiÛÙÚÔÊË ÏÈÎ (appleôï Ûapple ÓÈ ) EIKA 3.31 ιάγραµµα Ramachandran των ελίκων. Οι δύο µορφές στροφής της έλικας, δεξιόστροφη και αριστερόστροφη, βρίσκονται σε περιοχές επιτρεπόµενων στερεοδιατάξεων όταν αναλυθούν κατά Ramachandran. Παρ όλα αυτά, σχεδόν όλες οι α-έλικες στις πρωτεΐνες είναι δεξιόστροφες. EIKA 3.33 Μια πρωτεΐνη µε βασική διαµόρφωση α-έλικας. Η φερριτίνη, µια πρωτεΐνη αποθήκευσης σιδήρου, σχηµατίζεται από δέσµη α-ελίκων. EIKA 3.32 Σχηµατική απεικόνιση µιας α-έλικας. (Α) Μοντέλο µε σφαίρες και ράβδους. (Β) Απεικόνιση κορδέλας. (Γ) Απεικόνιση κυλίνδρου. ληλουχία βρίσκονται αρκετά κοντά το ένα στο άλλο λόγω της δοµής της έλικας. Αντίθετα, αµινοξέα που είναι δίπλα στην αλληλουχία διότι βρίσκονται το ένα απέναντι στο άλλο στην έλικα δεν µπορούν να έρθουν σε επαφή. Το βήµα της α-έλικας, που ισούται µε το προϊόν της µετατόπισης (1,5 Å) επί τον αριθµό των καταλοίπων ανά στροφή (3,6), είναι 5,4 Å. Η στροφή της έλικας µπορεί να είναι δεξιόστροφη (σύµφωνα µε τους δείκτες του ρολογιού) ή αριστερόστροφη (αντίθετα από τους δείκτες του ρολογιού). Το διάγραµµα Ramachandran αποκαλύπτει ότι η δεξιόστροφη και η αριστερόστροφη έλικα αποτελούν επιτρεπόµενες στερεοδιατάξεις (Eικόνα 3.31). Παρ όλα αυτά, οι δεξιόστροφες έλικες είναι πιο ευνοούµενες ενεργειακά διότι παρουσιάζουν λιγότερες στερικές συγκρούσεις µεταξύ των πλευρικών αλυσίδων και του κορ- µού. Ουσιαστικά, όλες οι α-έλικες που απαντούν στις πρωτεΐνες είναι δεξιόστροφες. Στο σχηµατικό διάγραµµα των πρωτεϊνών, οι α-έλικες εµφανίζονται σαν στριµµένες κορδέλες ή κύλινδροι (Eικόνα 3.32). Οι Pauling και orey προέβλεψαν τη δοµή της α-έλικας έξι χρόνια πριν αποκαλυφθεί για πρώτη φορά στη δοµή της µυοσφαιρίνης µε τη χρήση των ακτίνων Χ. Η αποκάλυψη της δοµής της α-έλικας αποτελεί ορόσηµο για τη βιοχη- µεία διότι απέδειξε ότι η στερεοδιάταξη µιας πολυπεπτιδικής αλυσίδας µπορεί να προβλεφθεί αν οι ιδιότητες των στοιχείων που την αποτελούν είναι αναλυτικά και απόλυτα καθορισµένες. Το ποσοστό της α-έλικας των πρωτεϊνών ποικίλλει από 0% έως και 100% ανά περίπτωση. Παραδείγµατος χάριν, 75% των καταλοίπων της φερριτίνης, της πρωτεΐνης που βοηθά στην αποθήκευση του σιδήρου, βρίσκονται σε α-έλικα (Eικόνα 3.33). Οι απλές α-έλικες συνήθως έχουν µήκος µικρότερο από 45 Å. Παρ όλα αυτά, δύο ή περισσότερες α-έλικες µπορούν να περιελιχθούν και να δηµιουργήσουν µια πολύ σταθερή δοµή η οποία µπορεί να έχει µήκος 1000 Å (100 nm ή 0,1 µm) ή περισσότερο (Eικόνα 3.34). Τέτοια στερεοδιάταξη συσπειρωµένου σπειράµατος α-ελίκων υπάρχει στη µυοσίνη και την τροποµυο- 20 Å EIKA 3.34 Μια στερεοδιάταξη συσπειρωµένου σπειράµατος α-ελίκων. Οι δυο έλικες ελίσσονται η µία γύρω από την άλλη και σχηµατίζουν µια υπερέλικα. Οι δοµές αυτές βρίσκονται σε πολλές πρωτεΐνες, συµπεριλαµβανοµένης της κερατίνης των µαλλιών, των φτερών, των νυχιών και των κεράτων.

19 σίνη των µυών, στο ινώδες των θρόµβων του αίµατος και στην κερατίνη των µαλλιών. Οι ελικοειδείς ράβδοι των πρωτεϊνών αυτών έχουν µηχανικό ρόλο και δηµιουργούν άκαµπτα δεµάτια ινιδίων, όπως τα αγκάθια του σκαντζόχοιρου. Ο κυτταρικός σκελετός είναι πλούσιος στα λεγόµενα ενδιάµεσα νηµάτια τα οποία είναι επίσης συσπειρωµένα σπειράµατα διπλών α-ελίκων. Πολλές πρωτεΐνες που διαπερνούν βιολογικές µεµβράνες περιέχουν επίσης α-έλικες ευτεροταγής δοµή β-appleù ÒÛÂÈ Οι β-επιφάνειες σταθεροποιούνται µε δεσµούς υδρογόνου µεταξύ των πολυπεπτιδικών αλυσίδων ψ 0 60 Οι Pauling και orey ανακάλυψαν άλλο ένα περιοδικό δοµικό µοτίβο το οποίο ονόµασαν β-πτυχωτή επιφάνεια (β, διότι ήταν η δεύτερη δοµή που προσδιόρισαν, δεδοµένου ότι η πρώτη ήταν η α-έλικα). Η β-πτυχωτή επιφάνεια (ή απλώς β-επιφάνεια) διαφέρει σηµαντικά από τη ραβδόµορφη α-έλικα. Μια πολυπεπτιδική αλυσίδα, που ονοµάζεται β-πτύχωση, σε µια β-επιφάνεια είναι σχεδόν απόλυτα απλωµένη, αντίθετα από το σφιχτό σπείραµα της α-έλικας. Στην Εικόνα 3.35 βλέπουµε πώς η στερεοδιάταξη αυτή επιτρέπει µια ποικιλία από απλωµένες δοµές χωρίς στερικά προβλήµατα φ EIKA 3.35 ιάγραµµα Ramachandran για τις β-πτυχώσεις. Στην κόκκινη περιοχή του διαγράµµατος φαίνονται οι στερεοχηµικά επιτρεπό- µενες δοµές απλωµένων β-πτυχώσεων EIKA 3.36 Η δοµή της β-πτύχωσης. Οι πλευρικές αλυσίδες (πράσινο) είναι κατ εναλλαγήν επάνω και κάτω από το επίπεδο της β-πτύχωσης. Η απόσταση µεταξύ γειτονικών αµινοξέων σε µια β-πτύχωση είναι περίπου 3,5 Å, ενώ στην α-έλικα υπενθυµίζεται ότι είναι 1,5 Å. Οι πλευρικές αλυσίδες των γειτονικών αµινοξέων έχουν αντίθετη κατεύθυνση όπως φαίνεται και στην Εικόνα Μια β-επιφάνεια δηµιουργείται όταν δύο ή περισσότερες β-πτυχώσεις συνδεθούν µε δεσµούς υδρογόνου. Οι διαδοχικές β-πτυχώσεις στη β-επιφάνεια µπορεί να έχουν την ίδια κατεύθυνση (παράλληλη β-επιφάνεια) ή να έχουν αντίθετη κατεύθυνση (αντιπαράλληλη β-επιφάνεια). Στην αντιπαράλληλη β-επιφάνεια οι οµάδες ΝΗ και ενός αµινοξέος συνδέονται αντίστοιχα µε δεσµούς υδρογόνου µε τις οµάδες και ΝΗ του αµινοξέος της γειτονικής β-πτύχωσης όπως φαίνεται στην Εικόνα Στην παράλληλη β-επιφάνεια η διάταξη των δεσµών υδρογόνου είναι λίγο πιο περίπλοκη. Για κάθε αµινοξύ η οµάδα συνδέεται στο του αµινοξέος της γειτονικής β- πτύχωσης, ενώ η οµάδα συνδέεται στο του αµινοξέος που βρίσκεται EIKA 3.37 Μια αντιπαράλληλη β-επιφάνεια. Οι γειτονικές β-πτυχώσεις έχουν αντίθετες κατευθύνσεις. Οι δεσµοί υδρογόνου µεταξύ των οµάδων και συνδέουν το κάθε αµινοξύ µε ένα και µόνο αµινοξύ στη γειτονική β-πτύχωση, σταθεροποιώντας τη δοµή.

20 64 ΚΕΦΑΛΑΙΟ 3 οµή και λειτουργία των πρωτεϊνών EIKA 3.38 Μια παράλληλη β-επιφάνεια. Οι γειτονικές β-πτυχώσεις έχουν την ίδια κατεύθυνση. Οι δεσµοί υδρογόνου συνδέουν κάθε αµινοξύ της µιας πτύχωσης µε δύο διαφορετικά αµινοξέα στη γειτονική πτύχωση. (A) EIKA 3.39 οµή µιας µεικτής β-επιφάνειας. (B) ( ) δύο κατάλοιπα πιο κάτω στην αλυσίδα, όπως φαίνεται στην Εικόνα Πολλές πτυχώσεις, συνήθως 4-5 αλλά µπορεί και 10 ή και περισσότερες, συνδέονται προκειµένου να δηµιουργήσουν β-επιφάνειες και µπορεί να είναι είτε καθαρά παράλληλες είτε αντιπαράλληλες είτε µεικτές (Eικόνα 3.39). Στα σχηµατικά διαγράµµατα, οι β-πτυχώσεις συνήθως εµφανίζονται ως φαρδιά βέλη µε κατεύθυνση προς το καρβοξυ-τελικό άκρο, προσδιορίζοντας τον τύπο της β-επιφάνειας που σχηµατίζεται, παράλληλη ή αντιπαράλληλη. Οι β- επιφάνειες παρουσιάζουν µεγαλύτερη ποικιλία από τις α-έλικες, µπορεί να είναι σχετικά ευθείες αλλά οι περισσότερες εµφανίζονται µε την κάθε πτύχωση ελαφρά στριµµένη (Eικόνα 3.40). Η β-επιφάνεια είναι σηµαντικό συστατικό πολλών πρωτεϊνών. Παραδείγµατος χάριν, οι πρωτεΐνες που δεσµεύουν τα λιπαρά οξέα και είναι τόσο σηµαντικές για τον µεταβολισµό των λιπών αποτελούνται σχεδόν αποκλειστικά από β-επιφάνειες (Eικόνα 3.41). EIKA 3.40 Μια β-επιφάνεια όπου η κάθε πτύχωση είναι ελαφρώς στριµµένη σε σχέση µε την προηγούµενη. (Α) Μοντέλο µε σφαίρες και ράβδους. (Β) Σχηµατικό µοντέλο. (Γ) Σχηµατική διαµόρφωση που έχει στραφεί κατά 90 για να εµφανίσει καλύτερα το στρίψιµο.

21 65 Τριτοταγής δοµή EIKA 3.41 Μια πρωτεΐνη πλούσια σε β- επιφάνειες. Η δοµή µιας πρωτεΐνης που δεσµεύει λιπαρά οξέα. i + 1 i + 2 EIKA 3.42 Η δοµή µιας στροφής αναστροφής της αλυσίδας. Η οµάδα του καταλοίπου i της πολυπεπτιδικής αλυσίδας δεσµεύεται µε δεσµό υδρογόνου στην οµάδα ΝΗ του καταλοίπου i + 3 και σταθεροποιεί τη στροφή. i i Οι πολυπεπτιδικές αλυσίδες µπορούν να αλλάξουν κατεύθυνση δηµιουργώντας αντίθετες στροφές και θηλιές Οι πιο πολλές πρωτεΐνες έχουν συµπαγές σφαιρικό σχήµα και εποµένως για τη δηµιουργία τους απαιτούνται αναστροφές της πολυπεπτιδικής αλυσίδας τους. Πολλές από τις αναστροφές επιτυγχάνονται µε ένα κοινό δοµικό στοιχείο που ονοµάζεται στροφή αναστροφής (γνωστό επίσης και ως β-στροφή ή κάµψη φουρκέτας) και απεικονίζεται στην Εικόνα Σε πολλές β-στροφές η οµάδα του καταλοίπου i της αλυσίδας του πολυπεπτιδίου δηµιουργεί δεσµό υδρογόνου µε την οµάδα του καταλοίπου i + 3. Η αλληλεπίδραση αυτή σταθεροποιεί την απότοµη αλλαγή στην κατεύθυνση της πολυπεπτιδικής αλυσίδας. Υπάρχουν βέβαια και περιπτώσεις όπου η αναστροφή της αλυσίδας γίνεται µέσω πιο πολύπλοκων δοµών που ονοµάζονται θηλιές ή και Ω-θηλιές λόγω του σχήµατός τους. Οι θηλιές, σε αντίθεση µε τις α-έλικες και τις β-επιφάνειες, δεν έχουν κανονικές περιοδικές δοµές. Παρ όλα αυτά, και οι δοµές θηλιάς έχουν συχνά σταθερή και απόλυτα καθορισµένη δοµή (Eικόνα 3.43). Οι στροφές και οι θηλιές βρίσκονται κυρίως στην επιφάνεια των πρωτεϊνών και εποµένως συµµετέχουν στην αλληλεπίδραση των πρωτεϊνών µε άλλα µόρια. Η κατανοµή της πρωτεϊνικής αλυσίδας σε α-έλικες, β-πτυχώσεις και στροφές περιγράφεται συνήθως ως δευτεροταγής δοµή. 3.4 ΤΡΙΤΟΤΑΓΗΣ ΟΜΗ: ΟΙ Υ ΑΤΟ ΙΑΛΥΤΕΣ ΠΡΩΤΕΪΝΕΣ ΑΝΑ ΙΠΛΩΝΟΝΤΑΙ ΣΕ ΣΥΜΠΑΓΕΙΣ ΟΜΕΣ ΜΕ ΜΗ ΠΟΛΙΚΑ ΚΕΝΤΡΑ EIKA 3.43 Οι θηλιές στην επιφάνεια µιας πρωτεΐνης. Ένα τµήµα του µορίου του αντισώµατος έχει θηλιές στην επιφάνειά του (κόκκινο χρώµα) που αλληλεπιδρούν µε άλλα µόρια. Ας δούµε τώρα πώς οµαδοποιούνται τα αµινοξέα σε µια πρωτεΐνη. Η τριδιάστατη δοµή χιλιάδων πρωτεϊνών είναι σήµερα γνωστή µε µεγάλη λεπτοµέρεια και αυτό οφείλεται στη χρήση της κρυσταλλογραφίας µε ακτίνες Χ και του πυρηνικού µαγνητικού συντονισµού (Yποκεφάλαιο 4.5). Ας αρχίσουµε µε τη δοµή της µυοσφαιρίνης, της πρώτης πρωτεΐνης που µελετήθηκε σε ατοµική λεπτοµέρεια. Η µυοσφαιρίνη, ο φορέας οξυγόνου στους µυς, είναι µια πολυπεπτιδική αλυσίδα 153 αµινοξέων (βλ. επίσης Κεφάλαια 7 και 10). Η ικανότητα της µυοσφαιρίνης να δεσµεύει οξυγόνο εξαρτάται από την παρουσία της αίµης, µιας µη πολυπεπτιδικής προσθετικής (βοηθητικής) οµάδας που αποτελείται από πρωτοπορφυρίνη IX και από ένα κεντρικό άτοµο σιδήρου. Η µυοσφαιρίνη είναι µια εξαιρετικά συµπαγής πρωτεΐνη. Οι διαστάσεις της είναι Å, δηλαδή µικρότερες κατά µία τάξη µεγέθους από τις διαστάσεις της αν ήταν σε στερεοδιάταξη απλωµένης πολυπεπτιδικής αλυσίδας (Eικόνα 3.44). Το 70% περίπου

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΜΟΡΙΑΚΑ ΜΟΝΤΕΛΑ 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING) 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING)

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΜΟΡΙΑΚΑ ΜΟΝΤΕΛΑ 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING) 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING)

Διαβάστε περισσότερα

οµή και Αναδίπλωση πρωτεϊνών

οµή και Αναδίπλωση πρωτεϊνών οµή και Αναδίπλωση πρωτεϊνών Νηφόρου Κατερίνα Μεταδιδακτορική Ερευνήτρια, Οµάδα Μοριακής Καρκινογένεσης, Εργ/ριο Ιστολογίας-Εµβρυολογίας, Ιατρική Σχολή Αθηνών Σηµασία των πρωτεϊνών Ενζυµική κατάλυση Μεταφορά

Διαβάστε περισσότερα

MAΘΗΜΑ 4 ο AMINOΞΕΑ-ΠΕΠΤΙ ΙΑ-ΠΡΩΤΕΪΝΕΣ

MAΘΗΜΑ 4 ο AMINOΞΕΑ-ΠΕΠΤΙ ΙΑ-ΠΡΩΤΕΪΝΕΣ MAΘΗΜΑ 4 ο AMIΞΕΑ-ΠΕΠΤΙ ΙΑ-ΠΡΩΤΕΪΝΕΣ Αλανίνη (Αla) Αλανυλοσερίνη (Αla-Ser) Αλβουµίνη ρα. Κουκουλίτσα Αικατερίνη Χηµικός Εργαστηριακός Συνεργάτης Τ.Ε.Ι Αθήνας ckoukoul@teiath.gr AMIΞΕΑ 2 λειτουργικές οµάδες

Διαβάστε περισσότερα

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ φ φ Ccarbonyl n Ccarbonyl n N Cα n Ccarbonyl n-1 Cα n N φ Ccarbonyl n-1 ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ ψ φ ψ Ccarbonyl n N (Ca

Διαβάστε περισσότερα

οµικά στοιχεία βιοµορίων

οµικά στοιχεία βιοµορίων 2-1 Κεφάλαιο 2 οµικά στοιχεία βιοµορίων 2.1. ιαστάσεις των Βιοµορίων Οι διαστάσεις των βιοµορίων κυµαίνονται από µερικά Ångströms (10-10 m) έως µερικές εκατοντάδες Ångströms (10-8 m). (εικόνα 2.1, 2.2)

Διαβάστε περισσότερα

Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών

Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών Βασίλης Προμπονάς, PhD Ερευνητικό Εργαστήριο Βιοπληροφορικής Τμήμα Βιολογικών Επιστημών Νέα Παν/πολη, Γραφείο B161 Πανεπιστήμιο Κύπρου Ταχ.Κιβ. 20537 1678,

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ.

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ. Kυτταρική Bιολογία ΔIAΛEΞΗ 3 (7/3/2012) ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ AΣ ΘYMHΘOYME Στην προηγούμενη διάλεξη μιλήσαμε για τη χημική σύσταση των κυττάρων και για τα βιολογικά πολυμερή που αποτελούν

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 27: Βιομόρια, αμινοξέα, πεπτίδια και πρωτεΐνες

Οργανική Χημεία. Κεφάλαιο 27: Βιομόρια, αμινοξέα, πεπτίδια και πρωτεΐνες Οργανική Χημεία Κεφάλαιο 27: Βιομόρια, αμινοξέα, πεπτίδια και πρωτεΐνες 1. Γενικά Πρωτεΐνες: μεγάλα βιομόρια που απαντούν σε όλους τους ζωντανούς οργανισμούς Διαφορετικά είδη πρωτεϊνών με ποικίλη βιολογική

Διαβάστε περισσότερα

οµή και λειτουργία των µεγάλων βιολογικών µορίων

οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων κατηγορίες υδατάνθρακες πρωτεΐνες νουκλεϊνικά οξέα λιπίδια Οι πρωτεΐνες, υδατάνθρακες, νουκλεϊνικά οξέα

Διαβάστε περισσότερα

Δομικές κατηγορίες πρωτεϊνών

Δομικές κατηγορίες πρωτεϊνών 3-1 Κεφάλαι ο Δομικές κατηγορίες πρωτεϊνών 3.1. α-δομές πρωτεϊνών Οι α-έλικες είναι δομικά στοιχεία που μπορούν να σχηματίσουν πολλές κατηγορίες στερεοδομών και με πολλές διαφορετικές λειτουργίες. Εκτός

Διαβάστε περισσότερα

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ Θέµατα ιάλεξης οµή, αριθµός και διαχωρισµός των αµινοξέων Ένωση αµινοξέων µε τον πεπτιδικό δεσµό

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΜΑΤΑ 1.Πώς οι κινητικές παράμετροι Κ m και K cat χρησιμεύουν για να συγκριθεί η ανακύκλωση διαφορετικών

Διαβάστε περισσότερα

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο 1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α.

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ Θέμα: ΜΕΤΟΥΣΙΩΣΗ ΠΡΩΤΕΪΝΩΝ (άσκηση 7 του εργαστηριακού οδηγού) Μέσος χρόνος πειράματος: 45 λεπτά Α. ΑΝΑΛΩΣΙΜΑ Εργαλεία

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα

Διαβάστε περισσότερα

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: ΘΕΜΑ 1o 1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α. µόνο στο καθαρό νερό β. σε οποιοδήποτε υδατικό διάλυµα γ. µόνο σε

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση.

ΑΠΑΝΤΗΣΕΙΣ. Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. Α1. Το συζυγές οξύ της ΝΗ 3 είναι: α. ΝΗ 2 - β.νa

Διαβάστε περισσότερα

Μοριακή Αναγνώριση. 5.1. Εισαγωγή. 5.2. Σταθερές σύνδεσης και αποχωρισµού. [A][B] k d = ----------- [AB] [ΑΒ] k i = ---------- [Α][Β] Κεφάλαιο

Μοριακή Αναγνώριση. 5.1. Εισαγωγή. 5.2. Σταθερές σύνδεσης και αποχωρισµού. [A][B] k d = ----------- [AB] [ΑΒ] k i = ---------- [Α][Β] Κεφάλαιο Κεφάλαιο 5-1 5 Μοριακή Αναγνώριση 5.1. Εισαγωγή Ένα από τα σηµαντικότερα χαρακτηριστικά των ζωντανών οργανισµών είναι ότι τα µακροµόρια που περιέχουν κάνουν πολύ εξειδικευµένες αλληλεπιδράσεις µε άλλα

Διαβάστε περισσότερα

1.1 Η συζυγής βάση του Η 2 SO 4 είναι α. SO 4 2. β. HSO 4. γ. H 2 SO 3. δ. H 2 S. Μονάδες 5

1.1 Η συζυγής βάση του Η 2 SO 4 είναι α. SO 4 2. β. HSO 4. γ. H 2 SO 3. δ. H 2 S. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 7 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ

Διαβάστε περισσότερα

ΚΕΡΑΤΙΝΕΣ (ΕΝΔΙΑΜΕΣΑ ΙΝΙΔΙΑ) - ΜΑΛΛΙΩΝ, ΝΥΧΙΩΝ, ΟΠΛΩΝ (ΘΗΛΑΣΤΙΚΑ)

ΚΕΡΑΤΙΝΕΣ (ΕΝΔΙΑΜΕΣΑ ΙΝΙΔΙΑ) - ΜΑΛΛΙΩΝ, ΝΥΧΙΩΝ, ΟΠΛΩΝ (ΘΗΛΑΣΤΙΚΑ) ΚΕΡΑΤΙΝΕΣ (ΕΝΔΙΑΜΕΣΑ ΙΝΙΔΙΑ) ΣΥΣΤΑΤΙΚΑ ΥΛΙΚΑ: -ΚΥΤΤΑΡΟΣΚΕΛΕΤΟΥ - ΜΑΛΛΙΩΝ, ΝΥΧΙΩΝ, ΟΠΛΩΝ (ΘΗΛΑΣΤΙΚΑ) - ΦΤΕΡΩΝ (ΠΤΗΝΑ) - ΔΕΡΜΑΤΟΣ ΕΡΠΕΤΩΝ Οι ιστοί που περιέχουν κερατίνες Είναι συνήθως ισχυροί και αδιάλυτοι

Διαβάστε περισσότερα

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες ΕΞΕΤΑΣΤΕΑ ΥΛΗ ΕΝΟΤΗΤΑ 2: Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ, 5 9 (απλή αναφορά) 2.2 ΤΟ ΝΕΡΟ ΚΑΙ Η ΒΙΟΛΟΓΙΚΗ ΤΟΥ ΣΗΜΑΣΙΑ, 9 14 (απλή αναφορά), 2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ, σελ. 20 36 Οργανικές Ουσίες

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση:

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 1 Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΥ ΓΕΝΙΚΥ ΛΥΚΕΙΥ ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΥ 2013 ΕΞΕΤΑΖΜΕΝ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ-ΒΙΧΗΜΕΙΑ ΤΕΧΝΛΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΣ ΤΕΧΝΛΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΛ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών Χηµική Μεταβίβαση Σήµατος Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών 1 Η Επικοινωνία στα Ζωϊκά Κύτταρα 1. Δίκτυα εξωκυτταρικών και ενδοκυτταρικών

Διαβάστε περισσότερα

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Οι οργανισμοί εξασφαλίζουν ενέργεια, για τις διάφορες λειτουργίες τους, διασπώντας θρεπτικές ουσίες που περιέχονται στην τροφή τους. Όμως οι φωτοσυνθετικοί

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 17 & 18: Αλκοόλες, θειόλες, αιθέρες και εποξείδια

Οργανική Χημεία. Κεφάλαιο 17 & 18: Αλκοόλες, θειόλες, αιθέρες και εποξείδια Οργανική Χημεία Κεφάλαιο 17 & 18: Αλκοόλες, θειόλες, αιθέρες και εποξείδια 1. Αλκοόλες Ενώσεις που περιέχουν ομάδες υδροξυλίου συνδεδεμένες με κορεσμένα άτομα άνθρακα υβριδισμού sp 3 Βάσει παραπάνω ορισμού,

Διαβάστε περισσότερα

Φυσική Στερεών στις Πρωτεΐνες

Φυσική Στερεών στις Πρωτεΐνες Φυσική Στερεών στις Πρωτεΐνες Νίκος Απ. Παπανδρέου Τ.Ε.Ι. Πειραιά Φεβρουάριος 2010 Ένα ελικοϊδές μονοπάτι Χημική δομή μίας πρωτεΐνης Μήκος αλυσίδας ~30 έως ~1000 αµινοξέα Συνολικός αριθµός ατόµων έως ~

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 26: Βιομόρια: υδατάνθρακες

Οργανική Χημεία. Κεφάλαιο 26: Βιομόρια: υδατάνθρακες Οργανική Χημεία Κεφάλαιο 26: Βιομόρια: υδατάνθρακες 1. Γενικά Ενώσεις που απαντούν σε κάθε ζωντανό οργανισμό Άμυλο και ζάχαρη στις τροφές και κυτταρίνη στο ξύλο, χαρτί και βαμβάκι είναι καθαροί υδατάνθρακες

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαια 12 &13: Φασματοσκοπία μαζών και υπερύθρου

Οργανική Χημεία. Κεφάλαια 12 &13: Φασματοσκοπία μαζών και υπερύθρου Οργανική Χημεία Κεφάλαια 12 &13: Φασματοσκοπία μαζών και υπερύθρου 1. Γενικά Δυνατότητα προσδιορισμού δομών με σαφήνεια χρησιμοποιώντας τεχνικές φασματοσκοπίας Φασματοσκοπία μαζών Μέγεθος, μοριακός τύπος

Διαβάστε περισσότερα

Γκύζη 14-Αθήνα Τηλ : 210.64.52.777

Γκύζη 14-Αθήνα Τηλ : 210.64.52.777 ΘΕΜΑ Α Α1. α Α2. γ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

2.1 Εισαγωγή. 2.1 Εισαγωγή. 2.2 Το εσωτερικό των ϖρωτεϊνών είναι υδρόφοβο. 2.3 Η α-έλικα αϖοτελεί ένα σηµαντικό στοιχείο. τη δευτεροταγή δοµή

2.1 Εισαγωγή. 2.1 Εισαγωγή. 2.2 Το εσωτερικό των ϖρωτεϊνών είναι υδρόφοβο. 2.3 Η α-έλικα αϖοτελεί ένα σηµαντικό στοιχείο. τη δευτεροταγή δοµή Κεφάλαιο 2 2.1 Εισαγωγή 2.2 Το εσωτερικό των ϖρωτεϊνών είναι υδρόφοβο 2.3 Η α-έλικα αϖοτελεί ένα σηµαντικό στοιχείο της δευτεροταγούς δοµής 2.4 Η α-έλικα έχει διϖολική ροϖή 2.5 Κάϖοια αµινοξέα ϖροτιµώνται

Διαβάστε περισσότερα

5. Συμμετρία, Πολικότητα και Οπτική Ενεργότητα των μορίων

5. Συμμετρία, Πολικότητα και Οπτική Ενεργότητα των μορίων 5. Συμμετρία, Πολικότητα και Οπτική Ενεργότητα των μορίων ιδακτικοί στόχοι Μετά την ολοκλήρωση της μελέτης του κεφαλαίου αυτού θα μπορείτε να... o προβλέπετε με βάση τη συμμετρία αν ένα μόριο έχει μόνιμη

Διαβάστε περισσότερα

3 ο Κ Ε Φ Α Λ Α Ι Ο ΠΡΩΤΕΪΝΕΣ Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ

3 ο Κ Ε Φ Α Λ Α Ι Ο ΠΡΩΤΕΪΝΕΣ Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ 3 ο Κ Ε Φ Α Λ Α Ι Ο ΠΡΩΤΕΪΝΕΣ Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ Ερωτήσεις πολλαπλής επιλογής Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Βιολογικά Μακρομόρια

Βιολογικά Μακρομόρια Βιολογικά Μακρομόρια Στυλιανός Χαμηλάκης 2011 Υδατάνθρακες Με το γενικό όρο «υδατάνθρακες» χαρακτηρίζονται πολύ-υδροξυλιωμένα παράγωγα αλδεϋδών και κετονών, προϊόντα συμπύκνωσης αυτών καθώς και περισσότερο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Δρ. Ιωάννης Τσαγκατάκης Σύμβουλος Διατροφικής Αγωγής. Οι Πρωτεΐνες. Ένωση Ελλήνων Χημικών Περιφερειακό Τμήμα Κρήτης

Δρ. Ιωάννης Τσαγκατάκης Σύμβουλος Διατροφικής Αγωγής. Οι Πρωτεΐνες. Ένωση Ελλήνων Χημικών Περιφερειακό Τμήμα Κρήτης Δρ. Ιωάννης Τσαγκατάκης Σύμβουλος Διατροφικής Αγωγής Οι Πρωτεΐνες Ένωση Ελλήνων Χημικών Περιφερειακό Τμήμα Κρήτης Αμινοξέα, Πεπτίδια, Πρωτεΐνες, Ένζυμα Πεπτιδικός δεσμός Αμινοξέα Πεπτίδια (

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Πέμπτη, 12 ΙΟΥΝΙΟΥ 2008 07:30 10:30

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

Γραμμικώς πολωμένα κύματα σε κάθετο επίπεδο

Γραμμικώς πολωμένα κύματα σε κάθετο επίπεδο ΚΥΚΛΙΚΟΣ ΔΙΧΡΩΙΣΜΟΣ Γραμμικώς πολωμένα κύματα σε κάθετο επίπεδο όταν το διάνυσμα του ηλεκτρικού πεδίου ταλαντεύεται κατά μήκος μιας ίσιας γραμμής τότε τα κύματα λέγονται επίπεδα ή γραμμικώς πολωμένα Γραμμικώς

Διαβάστε περισσότερα

Συνδυάζοντας το πρώτο και το δεύτερο θερμοδυναμικό αξίωμα προκύπτει ότι:

Συνδυάζοντας το πρώτο και το δεύτερο θερμοδυναμικό αξίωμα προκύπτει ότι: Συνδυάζοντας το πρώτο και το δεύτερο θερμοδυναμικό αξίωμα προκύπτει ότι: Για να είναι μια αντίδραση αυθόρμητη, πρέπει η μεταβολή της ελεύθερης ενέργειας της αντίδρασης να είναι αρνητική. Η μεταβολή της

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

Σύζευξη σπιν-σπιν J = 0 J 0

Σύζευξη σπιν-σπιν J = 0 J 0 Σύζευξη σπιν-σπιν Ας υποθέσουµε ότι έχουµε δύο πυρήνες Α και Χ, οι οποίοι είτε συνδέονται απ ευθείας µε έναν δεσµό είτε η σύνδεσή γίνεται µε περισσότερους δεσµούς. A X J = 0 J 0 Α Χ Α Χ Το σπάσιµο των

Διαβάστε περισσότερα

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Χηµείας Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: 1.1. Ένα υδατικό διάλυµα χαρακτηρίζεται ουδέτερο

Διαβάστε περισσότερα

Η κυτταρική µετατόπιση των πρωτεϊνών

Η κυτταρική µετατόπιση των πρωτεϊνών 9-1 Κεφάλαιο 9 Η κυτταρική µετατόπιση των πρωτεϊνών Εισαγωγή Στο κύτταρο η έκφραση των πρωτεϊνών γίνεται από µόνο ένα τύπο ριβοσώµατος (εκτός των µιτοχονδριακών και των χλωροπλαστικών που µοιάζουν µε αυτά

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. β 2. γ 3. α 4. γ 5. δ ΘΕΜΑ 2ο 1. Σχολικό

Διαβάστε περισσότερα

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Ζήτηµα 1ο Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 000 Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: 1.1. Ένα υδατικό διάλυµα χαρακτηρίζεται ουδέτερο στους

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β )

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 β Α2 γ Α3 α Α4 δ Α5 γ ΘΕΜΑ Β Β1: 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β Β2:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΘΕΜΑ Α Ο Ερωτήσεις πολλαπλής επιλογής: Α1 Στην αντιγραφή του DN το σπάσιμο των υδρογονικών δεσμών μεταξύ των δύο συμπληρωματικών αλυσίδων γίνεται με τη βοήθεια

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΗ ΧΗΜΕΙΑ. 2 η θεματική ενότητα: Χημικοί δεσμοί και μοριακές ιδιότητες

ΟΡΓΑΝΙΚΗ ΧΗΜΕΙΑ. 2 η θεματική ενότητα: Χημικοί δεσμοί και μοριακές ιδιότητες ΟΡΓΑΝΙΚΗ ΧΗΜΕΙΑ 2 η θεματική ενότητα: Χημικοί δεσμοί και μοριακές ιδιότητες Σχολή: Περιβάλλοντος Τμήμα: Επιστήμης Τροφίμων και Διατροφής Εκπαιδευτής: Χαράλαμπος Καραντώνης Άδειες Χρήσης Το παρόν εκπαιδευτικό

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Γ ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2004

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Γ ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2004 ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Γ ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Για τις ερωτήσεις 1.1 και 1. να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2013 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2013 ΕΚΦΩΝΗΣΕΙΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 013 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ A Στις ερωτήσεις Α1 και Α να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 28: Βιομόρια-λιπίδια

Οργανική Χημεία. Κεφάλαιο 28: Βιομόρια-λιπίδια Οργανική Χημεία Κεφάλαιο 28: Βιομόρια-λιπίδια 1. Γενικά Λιπίδια: οργανικά μόρια που απαντούν στη φύση και απομονώνονται κατά την εκχύληση κυττάρων ή ιστών με άπολους οργανικούς διαλύτες Δύο γενικές κατηγορίες

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ. Χημεία της ζωής 1

ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ. Χημεία της ζωής 1 ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημεία της ζωής 1 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ Η Βιολογία μπορεί να μελετηθεί μέσα από πολλά και διαφορετικά επίπεδα. Οι βιοχημικοί, για παράδειγμα, ενδιαφέρονται περισσότερο

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαια 20 & 21: Καρβοξυλικά οξέα, παράγωγα τους και αντιδράσεις ακυλο υποκατάστασης

Οργανική Χημεία. Κεφάλαια 20 & 21: Καρβοξυλικά οξέα, παράγωγα τους και αντιδράσεις ακυλο υποκατάστασης Οργανική Χημεία Κεφάλαια 20 & 21: Καρβοξυλικά οξέα, παράγωγα τους και αντιδράσεις ακυλο υποκατάστασης 1. Καρβοξυλικά οξέα Σημαντικά ακυλο (-COR) παράγωγα Πλήθος καρβοξυλικών ενώσεων στη φύση, π.χ. οξικό

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ Η τροφή αποτελείται και από ουσίες μεγάλου μοριακού βάρους (πρωτεΐνες, υδατάνθρακες, λιπίδια, νουκλεϊνικά οξέα). Οι ουσίες αυτές διασπώνται (πέψη) σε απλούστερες (αμινοξέα, απλά σάκχαρα,

Διαβάστε περισσότερα

Διπλωματική Εργασία ΕΝΤΟΠΙΣΜΟΣ ΠΕΠΤΙΔΙΟΥ ΣΗΜΑΤΟΣ ΣΕ ΔΙΑΜΕΜΒΡΑΝΙΚΕΣ ΠΡΩΤΕΪΝΕΣ ΜΕ ΕΦΑΡΜΟΓΗ ΤΟΥ ΣΥΝΕΧΟΥΣ ΜΕΤΑΣΧΗΜΑΤΙΣΜΟΥ ΚΥΜΑΤΙΔΙΩΝ

Διπλωματική Εργασία ΕΝΤΟΠΙΣΜΟΣ ΠΕΠΤΙΔΙΟΥ ΣΗΜΑΤΟΣ ΣΕ ΔΙΑΜΕΜΒΡΑΝΙΚΕΣ ΠΡΩΤΕΪΝΕΣ ΜΕ ΕΦΑΡΜΟΓΗ ΤΟΥ ΣΥΝΕΧΟΥΣ ΜΕΤΑΣΧΗΜΑΤΙΣΜΟΥ ΚΥΜΑΤΙΔΙΩΝ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΠΟΛΥΤΕΧΝΙΚΗ ΣΧΟΛΗ ΤΜΗΜΑ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ & ΜΗΧΑΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ ΤΗΛΕΠΙΚΟΙΝΩΝΙΩΝ Διπλωματική Εργασία ΕΝΤΟΠΙΣΜΟΣ ΠΕΠΤΙΔΙΟΥ ΣΗΜΑΤΟΣ ΣΕ ΔΙΑΜΕΜΒΡΑΝΙΚΕΣ ΠΡΩΤΕΪΝΕΣ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ 2 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1 ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 23 ΜΑΪΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ

Διαβάστε περισσότερα

Μετά το τέλος της µελέτης του 1ου κεφαλαίου, ο µαθητής θα πρέπει να είναι σε θέση:

Μετά το τέλος της µελέτης του 1ου κεφαλαίου, ο µαθητής θα πρέπει να είναι σε θέση: Μετά το τέλος της µελέτης του 1ου κεφαλαίου, ο µαθητής θα πρέπει να είναι σε θέση: Να γνωρίζει το ατοµικό πρότυπο του Bohr καθώς και τα µειονεκτήµατά του. Να υπολογίζει την ενέργεια που εκπέµπεται ή απορροφάται

Διαβάστε περισσότερα

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή.

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή. 5ο ΓΕΛ ΧΑΛΑΝΔΡΙΟΥ Μ. ΚΡΥΣΤΑΛΛΙΑ 2/4/2014 Β 2 ΚΕΦΑΛΑΙΟ 3 ΒΙΟΛΟΓΙΑΣ 3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΙΣ ΑΣΚΗΣΕΙΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΙΣ ΑΣΚΗΣΕΙΣ Κεφάλαιο 1 1. Οι δότες δεσμών υδρογόνου είναι οι ομάδες ΝΗ και ΝΗ 2. Οι δέκτες δεσμών υδρογόνου είναι τα καρβονυλικά οξυγόνα και εκείνα τα άτομα αζώτου στην ετεροκυκλική αλυσίδα που δεν είναι δεσμευμένα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Οργανική Χημεία. Χημεία καρβονυλικών ενώσεων & Κεφάλαιο 19: Αλδεϋδες και κετόνες

Οργανική Χημεία. Χημεία καρβονυλικών ενώσεων & Κεφάλαιο 19: Αλδεϋδες και κετόνες Οργανική Χημεία Χημεία καρβονυλικών ενώσεων & Κεφάλαιο 19: Αλδεϋδες και κετόνες 1. Καρβονυλικές ενώσεις Καρβονυλική ομάδα C=O σημαντικότερη λειτουργική ομάδα οργανικής χημείας Καρβονυλικές ομάδες βρίσκονται

Διαβάστε περισσότερα

Κεφάλαιο 27 Μαγνητισµός. Copyright 2009 Pearson Education, Inc.

Κεφάλαιο 27 Μαγνητισµός. Copyright 2009 Pearson Education, Inc. Κεφάλαιο 27 Μαγνητισµός Περιεχόµενα Κεφαλαίου 27 Μαγνήτες και Μαγνητικά πεδία Τα ηλεκτρικά ρεύµατα παράγουν µαγνητικά πεδία Μαγνητικές Δυνάµεις πάνω σε φορτισµένα σωµατίδια. Η ροπή ενός βρόχου ρεύµατος.

Διαβάστε περισσότερα

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Μαντώ Κυριακού 2015

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Μαντώ Κυριακού 2015 ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Μαντώ Κυριακού 2015 Ενεργειακό Στα βιολογικά συστήματα η διατήρηση της ενέργειας συμπεριλαμβάνει οξειδοαναγωγικές αντιδράσεις παραγωγή ATP Οξείδωση: απομάκρυνση e από ένα υπόστρωμα

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ & ΠΑΡΑΓΩΓΗΣ) 2009 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ & ΠΑΡΑΓΩΓΗΣ) 2009 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ & ΠΑΡΑΓΩΓΗΣ) 2009 ΕΚΦΩΝΗΣΕΙΣ Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Σταθερά προστασίας. , αυτά προστατεύουν (αντίθετη κατεύθυνση ως προς το Β 0

Σταθερά προστασίας. , αυτά προστατεύουν (αντίθετη κατεύθυνση ως προς το Β 0 Σταθερά προστασίας Όπως αναφέραµε προηγουµένως, η χηµική µετατόπιση διαφόρων πυρήνων σ ένα µόριο οφείλεται στο χηµικό περιβάλλον των πυρήνων, το οποίο δηµιουργεί τοπικά µαγνητικά πεδία. Ανάλογα µε τον

Διαβάστε περισσότερα

Βιοϋλικά. Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά. Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών

Βιοϋλικά. Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά. Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών Βιοϋλικά Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών Περιεχόμενα ενότητας Πρωτεΐνες Δομή και είδη Λειτουργίες πρωτεϊνών

Διαβάστε περισσότερα

Ηλεκτρονικά Φαινόμενα

Ηλεκτρονικά Φαινόμενα Ηλεκτρονικά Φαινόμενα Το επαγωγικό όμως φαινόμενο οδηγεί στη διάχυση της πόλωσης και στο υπόλοιπο μόριο. Έτσι πολώνονται, με φθίνουσα όμως ένταση, και οι επόμενοι άνθρακες που είναι συνδεδεμένοι μέσω σ

Διαβάστε περισσότερα

ΜΕΤΑΒΟΛΙΣΜΟΣ ΑΝΘΡΑΚΙΚΟΥ ΣΚΕΛΕΤΟΥ ΑΜΙΝΟΞΕΩΝ

ΜΕΤΑΒΟΛΙΣΜΟΣ ΑΝΘΡΑΚΙΚΟΥ ΣΚΕΛΕΤΟΥ ΑΜΙΝΟΞΕΩΝ ΜΕΤΑΒΟΛΙΣΜΟΣ ΑΝΘΡΑΚΙΚΟΥ ΣΚΕΛΕΤΟΥ ΑΜΙΝΟΞΕΩΝ Ανασκόπηση μεταβολισμού πρωτεϊνών & αμινοξέων Ιστοί ΤΡΟΦΗ Αλανίνη & Γλουταμίνη Αμινοξέα Κυκλοφορία Πρωτεΐνες Αμινοξέα Αποκαρβοξυλίωση Βιογενείς αμίνες (νευροδιαβιβαστές,

Διαβάστε περισσότερα

β. [Η 3 Ο + ] > 10-7 Μ γ. [ΟΗ _ ] < [Η 3 Ο + ]

β. [Η 3 Ο + ] > 10-7 Μ γ. [ΟΗ _ ] < [Η 3 Ο + ] ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ

Διαβάστε περισσότερα

Θέµατα ιάλεξης ΜΕΤΑΒΟΛΙΣΜΟΣ ΛΙΠΩΝ- Λίπη και αθηροσκλήρυνση. Μεσογειακή ίαιτα. Λίπη και αθηροσκλήρυνση: Ο ρόλος της άσκησης

Θέµατα ιάλεξης ΜΕΤΑΒΟΛΙΣΜΟΣ ΛΙΠΩΝ- Λίπη και αθηροσκλήρυνση. Μεσογειακή ίαιτα. Λίπη και αθηροσκλήρυνση: Ο ρόλος της άσκησης MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΜΕΤΑΒΟΛΙΣΜΟΣ ΛΙΠΩΝ- ΠΡΩΤΕΪΝΩΝ Θέµατα ιάλεξης Ο ρόλος της διατροφής στην εµφάνιση ασθενειών της καρδιάς Επίδραση

Διαβάστε περισσότερα

Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη

Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη (αδρεναλίνη) ευνοούν τη β-οξείδωση και την κινητοποίηση

Διαβάστε περισσότερα

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΕΝΝΟΙΑ ΤΗΣ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Η κυτταρική μεμβράνη ή πλασματική μεμβράνη είναι η εξωτερική μεμβράνη που περιβάλλει το κύτταρο

Διαβάστε περισσότερα

ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΣΣΑΛΟΝΙΚΗ ΣΧΟΛΙΚΟ ΕΤΟΣ 2012-2013 Σελίδα 2 από 35 Ενότητα πρώτη Η χημεία της ζωής Ενότητα πρώτη Η χημεία της ζωής Α. Σύντομη παρουσίαση της θεωρίας Χαρακτηριστικά

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002 ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002 Α. Στις ερωτήσεις 1-2, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. ίκλωνο

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

7.9 Αντιδράσεις που δηµιουργούν ένα στερεογονικό κέντρο

7.9 Αντιδράσεις που δηµιουργούν ένα στερεογονικό κέντρο 7.9 Αντιδράσεις που δηµιουργούν ένα στερεογονικό κέντρο Πολλές αντιδράσεις µετατρέπουν µη χειρόµορφα αντιδρώντα σε χειρόµορφα προϊόντα. Εν τούτοις, είναι σηµαντικό να αναγνωρίσουµε, οτι εάν όλα τα συστατικά

Διαβάστε περισσότερα

Κεφάλαιο 32 Φως: Ανάκλασηκαι ιάθλαση. Copyright 2009 Pearson Education, Inc.

Κεφάλαιο 32 Φως: Ανάκλασηκαι ιάθλαση. Copyright 2009 Pearson Education, Inc. Κεφάλαιο 32 Φως: Ανάκλασηκαι ιάθλαση Γεωµετρική θεώρηση του Φωτός Ανάκλαση ηµιουργίαειδώλουαπόκάτοπτρα. είκτης ιάθλασης Νόµος του Snell Ορατό Φάσµα και ιασπορά Εσωτερική ανάκλαση Οπτικές ίνες ιάθλαση σε

Διαβάστε περισσότερα