DNA COMPUTING. Το πρώτο πείραμα του. Leonard Adleman. Μαριάννα Δερμεντζή. Σεμινάριο Θεωρητικής Πληροφορικής. και Διακριτών Μαθηματικών

Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "DNA COMPUTING. Το πρώτο πείραμα του. Leonard Adleman. Μαριάννα Δερμεντζή. Σεμινάριο Θεωρητικής Πληροφορικής. και Διακριτών Μαθηματικών"


1 DNA COMPUTING Το πρώτο πείραμα του Leonard Adleman Μαριάννα Δερμεντζή Σεμινάριο Θεωρητικής Πληροφορικής και Διακριτών Μαθηματικών Τμήμα Μαθηματικών Α.Π.Θ.

2 Περιεχόμενα DNA computing DNA Βασικές έννοιες Ιστορική Αναδρομή Περιορισμοί της συμβατικής τεχνολογίας Βασικές έννοιες Δομή Το πρώτο πείραμα του L. Adleman Ο αλγόριθμος Οι βιοδιεργασίες Η διαδικασία Συμπεράσματα Πλεονεκτήματα και περιορισμοί του DNA computing

3 Molecular Computing Mοριακή υπολογιστική (molecular computing): γενικός όρος που αναφέρεται σε κάθε υπολογιστικό σύστημα, το οποίο χρησιμοποιεί μόρια ή άτομα, ως μέσα για την επίλυση υπολογιστικών προβλημάτων. Προέκυψε από την συνεργασία επιστημόνων πληροφορικής, μαθηματικών, μοριακής βιολογίας και χημείας, στην προσπάθειά τους να μελετήσουν τη δυνατότητα πραγματοποίησης υπολογισμών με χρήση βιολογικών πολυμερών, τα οποία είναι φορείς πληροφορίας, όπως το DNA και το RNA. Συχνότερα συνδέεται με το DNA computing (αλλά μπορεί να αναφέρεται και σε κβαντικούς υπολογιστές), γιατί είναι το πεδίο που έχει σημειώσει την μεγαλύτερη πρόοδο.

4 DNA computing DNA computing: ένα νέο, ραγδαία αναπτυσσόμενο διαθεματικό επιστημονικό πεδίο, που χρησιμοποιεί το DNA ως υπολογιστικό μέσο, σε αντίθεση με την συμβατική τεχνολογία η οποία στηρίζεται στο πυρίτιο. Βασική ιδέα Κωδικοποίηση της πληροφορίας σε DNA αλυσίδες. Εκτέλεση βιοδιεργασιών για την επεξεργασία της. Τα αποτελέσματα της επεξεργασίας είναι DNA αλυσίδες. Η αποκωδικοποίηση αποτελεσμάτων γίνεται με προσδιορισμό της αλληλουχίας των DNA αλυσίδων.

5 DNA Computing Ιστορική αναδρομή R. Feynman (1959): πρώτος ανέφερε ως ιδέα την δημιουργία υπομικροσκοπικών υπολογιστών. L. Adleman (1994): πέτυχε τη λύση μιας εκδοχής επτά κόμβων του Χαμιλτονιανού προβλήματος (HPP) χρησιμοποιώντας μόνο DNA αλυσίδες μέσα σε δοκιμαστικούς σωλήνες και εκτελώντας βιοδιεργασίες. R. Lipton (1995): περιέγραψε μια μέθοδο επίλυσης του SAT προβλήματος (πρόβλημα ικανοποιησιμότητας) το οποίο είναι ένα NP-hard problem. To SAT πρόβλημα, δοθέντος ενός Boolean τύπου, συνίσταται στην εύρεση ενός συνδυασμού τιμών T (true) και F (false) που θα αποδοθούν στις μεταβλητές του τύπου έτσι ώστε αυτός να ικανοποιείται δηλαδή να παίρνει την τιμή T (true).

6 DNA Computing Ιστορική αναδρομή Το 1996 οι R. Lipton, D. Boneh, and Ch. Dunworth περιέγραψαν ένα «μοριακό πρόγραμμα» για το «σπάσιμο» του Data Encryption Standard (DES), ενός ευρέως χρησιμοποιημένου κρυπτογραφικού συστήματος. Ο DES είναι ο κρυπταλγόριθμος ο οποίος είχε επιλεγεί ως επίσημο Ομοσπονδιακό Πρότυπο Επεξεργασίας Πληροφοριών (Federal Information Processing Standard - FIPS) για τις Ηνωμένες Πολιτείες το Ο DES στη συνέχεια χρησιμοποιήθηκε διεθνώς. Το 1997 διατυπώθηκε μια θεωρία από τους M. Ogihara και A. Ray, ότι DNA υπολογιστικές διατάξεις μπορούν να προσομοιώσουν Boolean κυκλώματα σε πολύ μεγάλο βαθμό.

7 DNA Computing Ιστορική αναδρομή Το 2002 δημοσιεύτηκε η επίλυση με DNA τεχνικές, ενός SAT προβλήματος με 20 μεταβλητές. Ήταν το μεγαλύτερο πρόβλημα που είχε λυθεί έως τότε με μη ηλεκτρονικά μέσα. Ήταν ένα πολύπλοκο πρόβλημα, επιλεγμένο να έχει μόνο μια λύση και 2 20 πιθανούς συνδυασμούς. Παρόλα αυτά, είναι εντυπωσιακό το γεγονός πως κατά κανόνα (εκτός μικρών εξαιρέσεων) χρησιμοποιήθηκαν μόνο οι δύο βασικές τεχνικές της τήξης (melting) και του υβριδισμού (annealing), για την επίλυσή του.

8 DNA Computing Ιστορική αναδρομή Weizmann Institute of Science in Israel (2002): παρουσιάστηκε μια προγραμματιζόμενη υπολογιστική διάταξη η οποία στήριζε τη λειτουργία της σε ένζυμα και DNA μόρια. Μπορούσε να εκτελέσει 330 τρισεκατομμύρια λειτουργίες ανά δευτερόλεπτο, δηλαδή ήταν πάνω από φορές ταχύτερη από τον ταχύτερο υπολογιστή της εποχής. Weizmann Institute (2004): κατασκευάστηκε μια αυτόνομη DNA υπολογιστική διάταξη, με προοπτική να εφαρμοστεί στην ιατρική διάγνωση και θεραπεία in vivo.

9 DNA Computing Ιστορική αναδρομή To 2009 παρουσιάστηκε μια γενικευμένη υλοποίηση του αλγορίθμου του Strassen για τον πολλαπλασιασμό πινάκων, σε έναν DNA υπολογιστή. Caltech (2011): δημιουργήθηκε ένα κύκλωμα από 130 μονόκλωνες DNA αλυσίδες, το οποίο είχε τη δυνατότητα υπολογισμού της τετραγωνικής ρίζας αριθμών μέχρι το 15. Το 2012 παρουσιάστηκαν τα αποτελέσματα ενός πειράματος, όπου ψηφιακή πληροφορία κωδικοποιήθηκε σε DNA και κατόπιν μετατράπηκε χωρίς απώλειες στην αρχική της δυαδική μορφή.

10 DNA Computing Ιστορική αναδρομή European Bioinformatics Institute (2013): 5,2 εκατομμύρια bits κωδικοποιήθηκαν σε DNA και κατόπιν επανήλθαν στην αρχική τους μορφή. Συμπληρωματικά όμως αναπτύχθηκε και ένα σύστημα διόρθωσης λαθών και έτσι εξασφαλίστηκε χαμηλός ρυθμός απώλειας δεδομένων. Stanford University (2013): παρουσιάστηκε ένα βιολογικό transistor με την ονομασία transcriptor. Η συγκεκριμένη διάταξη, μπορεί να χρησιμοποιηθεί σε ζωντανά κύτταρα με σκοπό τον εντοπισμό και την καταγραφή της έκθεσης των κυττάρων σε εξωτερικά ερεθίσματα και ακόμη την ενεργοποίηση ή όχι της αναπαραγωγής τους εφόσον αυτό χρειάζεται.

11 DNA Computing Εκτέλεση αριθμητικών ή λογικών πράξεων. Λύση NP-hard, NP-complete προβλημάτων. Δημιουργία συστημάτων κωδικοποίησης και αποθήκευσης μεγάλου όγκου ψηφιακής πληροφορίαςκρυπτογραφία. Προγραμματιζόμενα υπολογιστικά συστήματα in vitro, με προοπτική την in vivo εφαρμογή τους στην ιατρική. Πχ. επιστήμονες ισχυρίζονται ότι DNA υπολογιστικές διατάξεις θα μπορούν να εμφυτευτούν στο ανθρώπινο σώμα για τον έλεγχο της παρουσίας των καρκινικών κυττάρων ή των επιπέδων της ινσουλίνης για διαβητικούς ασθενείς.

12 Το DNA ως μέσο για τη δημιουργία αυτομάτων μοριακής κλίμακας Κατασκευή λογικών πυλών με βάση τα μόρια DNA και ένζυμα ΜΑΥΑ Ι (2003) - MAYA II (2006) a m_olecular a_rray of Y_ES and A_NDNOT gates Παίζοντας «τρίλιζα».

13 Μια πλάκα με εσοχές περιέχει μικρά τμήματα DNA που κωδικοποιούν τις πιθανές «κινήσεις». MAYA II (2006) Μια οθόνη δείχνει ότι ο υπολογιστής (κόκκινα τετράγωνα) έχει κερδίσει το παιχνίδι με αντίπαλο κάποιο φίλο (μπλε).

14 DNA chip (DNA microarray) Μια μικροσυστοιχία DNA (τσιπ DNA ή βιοτσίπ) είναι μια συλλογή από μικροσκοπικές κηλίδες DNA που συνδέονται με μια στερεή επιφάνεια. Οι επιστήμονες χρησιμοποιούν μικροσυστοιχίες DNA για τη γονοτυπική ανάλυση πολλαπλών περιοχών ενός γονιδιώματος.

15 DNA integrated circuits Ένα DNA ολοκληρωμένο κύκλωμα είναι ένα ολοκληρωμένο σύστημα ημιαγωγών το οποίο ή αλληλεπιδρά ή ενσωματώνει DNA ή άλλα μόρια.

16 DNA υπολογιστική διάταξη Ανάπτυξη του πρώτου υπολογιστή DNA στον κόσμο για την ανάλυση γονιδίων (2002)

17 DNA υπολογιστική διάταξη

18 Περιορισμοί της συμβατικής τεχνολογίας Όριο στην ελαχιστοποίηση του μεγέθους Ταχύτητα επεξεργασίας που πλησιάζει το άνω όριο DNA: ένα μοναδικό υπολογιστικό εργαλείο με πολλά πλεονεκτήματα Δυνατότητα υπολογισμών σε μοριακό επίπεδο Watson-Crick συμπληρωματικότητα Μαζικά παράλληλη επεξεργασία Χαμηλή ενεργειακή κατανάλωση Εξαιρετικό αποθηκευτικό μέσο

19 DNA - Βασικές έννοιες Το DNA (δεοξυριβονουκλεϊκό οξύ) είναι ένα μακρομόριο, το οποίο στους ζώντες οργανισμούς έχει αποθηκευμένη την γενετική πληροφορία των κυττάρων. Απαρτίζεται από δύο μονές αλυσίδες, τα πολυνουκλεοτίδια, οι οποίες ενώνονται μεταξύ τους δημιουργώντας μια συνεστραμμένη έλικα. Κάθε αλυσίδα αποτελείται από σύνθετα οργανικά μόρια που ονομάζονται DNA νουκλεοτίδια και αποτελούν τη βασική δομική της μονάδα.

20 Η δομή του DNA

21 Η δομή του DNA

22 Η δομή του DNA

23 Σημαντικά χαρακτηριστικά Για τη δημιουργία ενός δίκλωνου DNA μορίου, είναι απαραίτητο οι μονόκλωνες αλυσίδες που το απαρτίζουν: Να είναι συμπληρωματικές Να έχουν αντίθετο προσανατολισμό

24 Watson-Crick συμπληρωματικότητα των βάσεων Στο δίκλωνο DNA μόριο οι βάσεις ενώνονται με πολύ συγκεκριμένο τρόπο: Η Αδενίνη (Α) ενώνεται μόνο με τη Θυμίνη (Τ) με δυο δεσμούς υδρογόνου Η Γουανίνη (G) μόνο με την Κυτοσίνη (C) με τρεις δεσμούς υδρογόνου Αυτό αποτελεί το βασικότερο χαρακτηριστικό το οποίο «εκμεταλλευόμαστε» σε μεγάλο βαθμό στις βιολειτουργίες οι οποίες λαμβάνουν χώρα κατά τη διάρκεια των DNA υπολογισμών.

25 Αντίθετος προσανατολισμός των βάσεων Κάθε πολυνουκλεοτίδιο έχει συγκεκριμένο προσανατολισμό 5 3. Κάθε αλυσίδα στο DNA μόριο έχει αντίθετο προσανατολισμό σε σχέση με την συμπληρωματική της.

26 DNA Computing Leonard Adleman Leonard Adleman: Αμερικανός επιστήμονας θεωρητικής πληροφορικής και καθηγητής της επιστήμης των υπολογιστών και μοριακής βιολογίας στο Πανεπιστήμιο της Βόρειας Καρολίνας. Αναφέρεται και ως ο πατέρας του DNA computing και συνεφευρέτης του κρυπτογραφικού συστήματος RSA το 1977, το οποίο έχει ευρεία εφαρμογή σε εφαρμογές ασφαλείας συμπεριλαμβανομένου και του https.

27 DNA computing Τα πρώτα βήματα. 1994: Δημοσιεύεται στο περιοδικό Science, η εργασία του Leonard Adleman με τίτλο: Molecular computation of solutions to combinatorial problems. Εκεί περιγράφεται ένα πείραμα όπου επιλύεται ένα μαθηματικό πρόβλημα (μια εκδοχή με 7 κόμβους του Χαμιλτονιανού προβλήματος) με χρήση μόνο αλυσίδων DNA και εκτέλεση βιοδιεργασιών in vitro.

28 DNA computing Ένα πρωτοποριακό πείραμα Υπολογιστικό μέσο: DNA αλυσίδες Υπολογιστική μέθοδος: Βιοδιεργασίες Ο πρώτος DNA «υπολογιστής» Ήταν η πρώτη φορά όπου: Το DNA χρησιμοποιούνταν για υπολογιστικούς σκοπούς Υπήρχε μια πειραματική απόδειξη ότι οι DNA υπολογισμοί είναι εφικτοί.

29 DNA computing Ένα πρωτοποριακό πείραμα Hamiltonian Path Problem (HPP) Ένα NP-complete πρόβλημα Ένα κατευθυνόμενο γράφημα G, με συγκεκριμένο αρχικό και τελικό κόμβο υ in και υ out αντίστοιχα, θεωρείται ότι έχει Χαμιλτονιανή διαδρομή, αν υπάρχει μια διαδρομή η οποία απαρτίζεται από ακμές e 1,e 2,..e n,, η οποία ξεκινά από τον κόμβο υ in και καταλήγει στον κόμβο υ out, περνώντας από κάθε κόμβο μόνο μια φορά.

30 DNA computing Ένα πρωτοποριακό πείραμα Ένα απλό πρόβλημα με μια επαναστατική λύση! Σε ένα κατευθυνόμενο γράφημα 7 κόμβων, έπρεπε να βρεθεί διαδρομή η οποία ξεκινούσε από τον αρχικό κόμβο O ο, σταματούσε στον τελικό O 6 και περνούσε από κάθε κόμβο μόνο μια φορά (Χαμιλτονιανή διαδρομή). Χαμιλτονιανή διαδρομή:

31 DNA computing Ένα πρωτοποριακό πείραμα Δυο σημαντικά σημεία: Η μαζικά παράλληλη επεξεργασία εξασφάλισε την δυνατότητα γρήγορης δημιουργίας όλων των πιθανών διαδρομών. Η Watson-Crick συμπληρωματικότητα ήταν καταλυτικός παράγοντας για την κωδικοποίηση της πληροφορίας.

32 Ένα πρωτοποριακό πείραμα Η κωδικοποίηση της πληροφορίας Κόμβοι (Ο i όπου i = 0, 1, 2, 3, 4, 5, 6) Τυχαία ολιγονουκλεοτίδια των 20 βάσεων. Ενδιάμεσες ακμές Ολιγονουκλεοτίδια των 20 βάσεων, τα οποία αποτελούνται από το τελευταίο μισό του κόμβου από τον οποίο ξεκινά η ακμή και το πρώτο μισό του κόμβου στον οποίο καταλήγει. Ακμές που ξεκινούν από τον κόμβο O ο Ακμές που καταλήγουν στον κόμβο O 6 Όλιγονουκλεοτίδια των 30 βάσεων τα οποία αποτελούνται από όλη την ακολουθία του O ο και το πρώτο μισό του κόμβου στον οποίο καταλήγουν. Όλιγονουκλεοτίδια των 30 βάσεων τα οποία αποτελούνται από το πρώτο μισό του κόμβου από τον οποίο ξεκινούν και όλη την ακολουθία του κόμβου O 6.


34 Ένα πρωτοποριακό πείραμα Η κωδικοποίηση της πληροφορίας Συμπληρωματικές DNA αλυσίδες Οο = 5 - AATTCGTCTAGGTACTAATT - 3 O 1 = 5 - TAGGATTCATGAATACCTAG - 3 Οο = 3 - TTAAGCAGATCCATGATTAA- 5 O 1 = 3 - ATCCTAAGTACTTATGGATC - 5 O 2 = 5 - ATGCATTGCAAGTAGTATTG - 3 O 6 = 5 - CTAGCAATCGGATTATCCAT - 3 O 2 = 3 - TACGTAACGTTCATCATAAC- 5 O 6 = 3 - GATCGTTAGCCTAATAGGTA - 5

35 Ένα πρωτοποριακό πείραμα Η κωδικοποίηση της πληροφορίας Σύνθεση ολιγονουκλεοτιδίων Oligonucleotide synthesizer

36 Αλγόριθμος Βιοδιεργασίες 1. Δημιούργησε όλες τις τυχαίες διαδρομές μέσα στο γράφημα Ανάμιξη, υβριδισμός και σύνδεση (Mixing, Hybridization & Ligation) 2. Επέλεξε τις διαδρομές που αρχίζουν από τον κόμβο Ο ο και τερματίζουν στον κόμβο Ο 6 Αλυσιδωτή αντίδραση πολυμεράσης (PCR) & DNA amplification 3. Επέλεξε μόνο τις διαδρομές που περνούν από 7 ακριβώς κόμβους Gel ηλεκτροφόρηση (Gel electrophoresis) 4. Επέλεξε τις διαδρομές που περνούν από όλους τους κόμβους τουλάχιστον μια φορά 5. Αν έχουν απομείνει διαδρομές τότε η έξοδος είναι «ναι», διαφορετικά «όχι» Διαχωρισμός των DNA αλυσίδων που περιέχουν συγκεκριμένη αλληλουχία βάσεων (affinity purification), κατ επανάληψη DNA amplification με PCR & Ανάλυση αλληλουχίας DNA (DNA sequencing)

37 Ένα πρωτοποριακό πείραμα Βήμα 1- Ο Αλγόριθμος ΒΗΜΑ 1 Δημιούργησε όλες τις τυχαίες διαδρομές μέσα στο γράφημα ΒΙΟΔΙΕΡΓΑΣΙΕΣ Ανάμιξη (mixing) Υβριδισμός in vitro (annealing, base pairing) Σύνδεση (ligation)

38 Ένα πρωτοποριακό πείραμα Βήμα 1- Οι βιοδιεργασίες Ανάμιξη (mixing): τα περιεχόμενα δύο δοκιμαστικών σωλήνων αναμιγνύονται σε έναν τρίτο. Διάλυμα που περιέχει DNA

39 Ένα πρωτοποριακό πείραμα Βήμα 1 - Οι βιοδιεργασίες Υβριδισμός in vitro (annealing, base pairing): συμπληρωματικές DNA αλυσίδες μέσα σε διάλυμα, ενώνονται δημιουργώντας δίκλωνα DNA μόρια μετά από κατάλληλη μείωση της θερμοκρασίας.

40 Ένα πρωτοποριακό πείραμα Βήμα 1- Οι βιοδιεργασίες Σύνδεση (ligation): χημική αντίδραση όπου χρησιμοποιώντας ως καταλύτη ένα ένζυμο που ονομάζεται λιγάση, «ενώνονται» δύο δίκλωνα τμήματα DNA, τα οποία είτε έχουν άκρα χωρίς προεξοχή (blunt ends), είτε κάποιο από τα άκρα τους προεξέχει (sticky ends).

41 Ένα πρωτοποριακό πείραμα Βήμα 1- Οι βιοδιεργασίες Σύνδεση (ligation): χημική αντίδραση όπου χρησιμοποιώντας ως καταλύτη ένα ένζυμο που ονομάζεται λιγάση, «ενώνονται» δύο δίκλωνα τμήματα DNA, τα οποία είτε έχουν άκρα χωρίς προεξοχή (blunt ends), είτε κάποιο από τα άκρα τους προεξέχει (sticky ends).

42 Ένα πρωτοποριακό πείραμα ΒΗΜΑ 1 Η διαδικασία Τα ολιγονουκλεοτίδια τα οποία αντιστοιχούσαν στις ακμές και τα ολιγονουκλεοτίδια που αντιστοιχούσαν στα συμπληρώματα των κόμβων (Ο i ) αναμιχθήκαν, παρουσία του ένζυμου λιγάση. Παράδειγμα: Το συμπλήρωμα του κόμβου Ο 2, λειτουργεί σαν «συνδετήρας» ανάμεσα στις ακμές Ο 1-2 και Ο 2-3 Ο 1-2 Ο 2-3 Ο 2

43 Ένα πρωτοποριακό πείραμα Βήμα 2- Ο Αλγόριθμος ΒΗΜΑ 2 Επέλεξε τις διαδρομές που αρχίζουν από τον κόμβο Ο ο και τερματίζουν στον κόμβο Ο 6 ΒΙΟΔΙΕΡΓΑΣΙΕΣ Τήξη (melting) Αλυσιδωτή αντίδραση πολυμεράσης (PCR) Αναπαραγωγή DNA (DNA amplification)

44 Ένα πρωτοποριακό πείραμα Βήμα 2- Οι βιοδιεργασίες Τήξη (melting): η διαδικασία κατά την οποία ένα δίκλωνο μόριο, χωρίζεται στις δύο μονές συμπληρωματικές αλυσίδες του, μετά από κατάλληλη αύξηση της θερμοκρασίας ή με μηχανικά μέσα.

45 Ένα πρωτοποριακό πείραμα Βήμα 2- Οι βιοδιεργασίες Αλυσιδωτή αντίδραση πολυμεράσης (PCR): η μέθοδος PCR, χρησιμοποιείται για την αντιγραφή συγκεκριμένου τμήματος του αρχικού DNA μορίου. Το όνομά της προέρχεται από τα ένζυμα DNA πολυμεράσες τα οποία είναι απαραίτητα στην διαδικασία. Αναπαραγωγή DNA (DNA amplification): Η πολλαπλή επανάληψη της μεθόδου PCR, οδηγεί στην αναπαραγωγή μεγάλου αριθμού αντιγράφων του συγκεκριμένου τμήματος.

46 Ένα πρωτοποριακό πείραμα Βήμα 2- Οι βιοδιεργασίες Ειδικό μηχάνημα (thermal cycler) για PCR Ειδικοί σωλήνες PCR, σε κάθε ένα πραγματοποιείται μία αντίδραση όγκου 100μl.

47 Ένα πρωτοποριακό πείραμα Βήμα 2- Οι βιοδιεργασίες Αλυσιδωτή αντίδραση πολυμεράσης PCR

48 Ένα πρωτοποριακό πείραμα Βήμα 2- Οι βιοδιεργασίες Αλυσιδωτή αντίδραση πολυμεράσης PCR

49 Ένα πρωτοποριακό πείραμα ΒΗΜΑ 2 Η διαδικασία Το αποτέλεσμα της σύνδεσης (ligation), αναπαράχθηκε με PCR, χρησιμοποιώντας ως εκκινητές (primers), τα ολιγονουκλεοτίδια Ο ο και Ο 6, έτσι ώστε μόνο οι διαδρομές που ξεκινούσαν με Ο ο και κατέληγαν στον Ο 6, ξεχώριζαν και αναπαράγονταν. Ως αποτέλεσμα είχαμε διαδρομές μεταβλητού μήκους που ξεκινούσαν από τον Ο ο και κατέληγαν στον Ο 6. Οποιεσδήποτε διαφορετικές διαδρομές απέμειναν, απλά ισοδυναμούσαν με μικρό «θόρυβο» στο σύστημα.

50 Ένα πρωτοποριακό πείραμα Βήμα 3- Ο Αλγόριθμος ΒΗΜΑ 3 Επέλεξε μόνο τις διαδρομές που περνούν από 7 κόμβους ΒΙΟΔΙΕΡΓΑΣΙΕΣ Gel ηλεκτροφόρηση (Gel electrophoresis)

51 Ένα πρωτοποριακό πείραμα Βήμα 3- Οι βιοδιεργασίες Gel ηλεκτροφόρηση (Gel electrophoresis): μέθοδος διαχωρισμού των DNA μορίων, με βάση το μέγεθος τους (αριθμός βάσεων). Τα αρνητικά φορτισμένα DNA μόρια, αφού τοποθετηθούν σε ηλεκτρικό πεδίο, μετακινούνται προς τον θετικό πόλο. H παρουσία gel στην ηλεκτροφόρηση έχει σαν συνέπεια ο ρυθμός μετατόπισης κάθε μορίου να επηρεάζεται από το μέγεθός του. Έτσι τα μεγαλύτερα μόρια μετακινούνται αργότερα από τα μικρότερα μέσα στο gel. Ως αποτέλεσμα, σχηματίζονται στο gel διακριτές ζώνες από μόρια DNA ίδιου μεγέθους. Προκειμένου να είναι ορατές οι ζώνες, το DNA επισημαίνεται με μια φθορίζουσα χρωστική ή με ένα ραδιενεργό ισότοπο.

52 Ένα πρωτοποριακό πείραμα Βήμα 3- Οι βιοδιεργασίες Gel ηλεκτροφόρηση

53 Ένα πρωτοποριακό πείραμα Βήμα 3- Οι βιοδιεργασίες Gel ηλεκτροφόρηση

54 Ένα πρωτοποριακό πείραμα Βήμα 3- Οι βιοδιεργασίες

55 Ένα πρωτοποριακό πείραμα Βήμα 3- Η διαδικασία Χρησιμοποιείται η τεχνική της Gel ηλεκτροφόρησης για να ξεχωρίσουν από τις προυπάρχουσες διαδρομές, εκείνες που αποτελούνται από =140 βάσεις (ξεκινούν από τον O o, περιλαμβάνουν έξι ακμές και καταλήγουν στον Ο 6 ).

56 Ένα πρωτοποριακό πείραμα Βήμα 4- Ο Αλγόριθμος ΒΗΜΑ 4 Επέλεξε τις διαδρομές που περνούν από όλους τους κόμβους τουλάχιστον μια φορά ΒΙΟΔΙΕΡΓΑΣΙΕΣ Τήξη (melting) Διαχωρισμός των DNA αλυσίδων που περιέχουν μια συγκεκριμένη ακολουθία βάσεων, σε ένα ετερογενές διάλυμα (affinity purification)

57 Ένα πρωτοποριακό πείραμα Βήμα 4- Οι βιοδιεργασίες Διαχωρισμός των DNA αλυσίδων που περιέχουν μια συγκεκριμένη ακολουθία βάσεων (affinity purification): είναι μια τεχνική διαχωρισμού των μονών DNA αλυσίδων οι οποίες έχουν ίδια αλληλουχία βάσεων και περιέχονται σε ένα ετερογενές μίγμα.

58 Ένα πρωτοποριακό πείραμα Βήμα 4- Οι βιοδιεργασίες Για να εξάγουμε μονόκλωνες DNA αλυσίδες συγκεκριμένης ακολουθίας x, πρώτα δημιουργούμε συμπληρωματικές των x, μονόκλωνες DNA αλυσίδες τις οποίες προσαρτούμε σε ένα στερεό υπόστρωμα, πχ. μαγνητικά σφαιρίδια. Το ετερογενές διάλυμα περνά ανάμεσα από τα σφαιρίδια με αποτέλεσμα οι αλυσίδες που περιέχουν την ακολουθία x, να συγκρατούνται από αυτά, γιατί ενώνονται με τις συμπληρωματικές τους. Εκείνες που δεν περιέχουν την x, περνούν χωρίς να δεσμευθούν. Τα σφαιρίδια απομακρύνονται από το μίγμα, πλένονται και έτσι ξεχωρίζουν οι αλυσίδες που περιέχουν την ακολουθία x

59 Ένα πρωτοποριακό πείραμα Βήμα 4- Η διαδικασία Δημιουργία μονόκλωνων DNA αλυσίδων από τα δίκλωνα μόρια που προκύπτουν από το βήμα 3. H ακολουθία Ο 1, προσαρτάται στα μαγνητικά σφαιρίδια και το ετερογενές διάλυμα των διαδρομών περνά ανάμεσα τους. Μόνο οι διαδρομές που περιέχουν την ακολουθία Ο 1 συγκρατούνται, δηλ. μόνο αυτές που περνούν από τον κόμβο Ο 1. Το διάλυμα με τις προηγούμενες διαδρομές υποβάλλεται ξανά στην ίδια διαδικασία. Η διαδικασία επαναλαμβάνεται για όλες τις ακολουθίες μέχρι την O 5. Οι αλυσίδες που απομένουν αντιστοιχούν σε διαδρομές που περιλαμβάνουν όλους τους κόμβους. /affchrom1.html

60 Ένα πρωτοποριακό πείραμα Βήμα 5- Ο Αλγόριθμος ΒΗΜΑ 5 Έλεγξε την ύπαρξη Χαμιλτονιανής Διαδρομής ΒΙΟΔΙΕΡΓΑΣΙΕΣ Αλυσιδωτή αντίδραση πολυμεράσης (PCR) Προσδιορισμός αλληλουχίας των βάσεων (DNA Sequencing)

61 Ένα πρωτοποριακό πείραμα Βήμα 5- Οι βιοδιεργασίες Αλληλούχιση DNA: είναι η διαδικασία όπου προσδιορίζεται η ακριβής σειρά των βάσεων σε μια DNA αλυσίδα. Το αποτέλεσμα μιας βιοδιεργασίας είναι ένα σύνολο DNA αλυσίδων η αλληλουχία των οποίων μπορεί να διαβαστεί από αυτόματες διατάξεις (sequencers).

62 Ένα πρωτοποριακό πείραμα Βήμα 5- Η διαδικασία Το προϊόν του βήματος 4, (δηλαδή όλες οι αλυσίδες που ξεκινούν από τον κόμβο O o, καταλήγουν στον O 6 και περνούν από όλους τους ενδιάμεσους κόμβους), αναπαράγεται με τη διαδικασία PCR έτσι ώστε να παραχθεί ανιχνεύσιμη ποσότητα σε περίπτωση ύπαρξης διαδρομής. Κατόπιν με μια μέθοδο αλληλούχισης, προσδιορίζεται η ακριβής σειρά των βάσεων της αλυσίδας που αντιστοιχεί στη Χαμιλτονιανή διαδρομή, άρα και η σειρά των κόμβων από τους οποίους περνά. Αποτέλεσμα αυτόματης αλληλούχισης από sequencer

63 Βιοδιεργασίες - Αλγόριθμος Σε δοκιμαστικό σωλήνα αναμιγνύονται οι συμπληρωματικοί κόμβοι και οι ακμές, τα οποία συνδέονται μεταξύ τους δημιουργώντας όλες τις δυνατές διαδρομές. Εκτελείται κατ επανάληψη, η Αλυσιδωτή αντίδραση πολυμεράσης (PCR) με συγκεκριμένους εκκινητές Ο ο και Ο 6, με στόχο την αναπαραγωγή τεράστιου αριθμού διαδρομών με αρχή τον κόμβο Ο ο και τέλος τον κόμβο Ο 6. Γίνεται Gel ηλεκτροφόρηση στις παραπάνω DNA αλυσίδες, ώστε να απομονωθούν αυτές με το σωστό μήκος (που περνούν από 7 κόμβους). Εφαρμόζεται επαναληπτικά η διαδικασία affinity purification με Οi (i=1,..,5), για να διαπιστωθεί ποιες διαδρομές περνούν από όλους τους ενδιάμεσους κόμβους. Αν έχουν απομείνει DNA αλυσίδες τότε αυτές αντιστοιχούν στην λύση του προβλήματος, και αναπαράγονται με PCR για να είναι ανιχνεύσιμες. Κατόπιν γίνεται ανάλυση της αλληλουχίας των βάσεων τους και αποκωδικοποιείται η Χαμιλτονιανή διαδρομή.

64 Ένα πρωτοποριακό πείραμα Συμπεράσματα Ταχύτητα Συμβατική τεχνολογία ops/sec (supercomputers -1994) Μέθοδος του Adleman ops/sec με δυνατότητα επέκτασης στις ops/sec (Operation=ligation) Ενεργειακές απαιτήσεις 10 9 ops/joule ops/joule Πυκνότητα αποθήκευσης 1 bit / nm 3 1 bit / 1nm 3

65 Ένα πρωτοποριακό πείραμα Συμπεράσματα Πλεονέκτημα Η χρονική πολυπλοκότητα είναι γραμμική σε σχέση με τον αριθμό των κόμβων. Μειονέκτημα Ο αριθμός των διαφορετικών διαδρομών (δηλαδή το ποσό του DNA που χρειαζόμαστε) αυξάνεται εκθετικά με τον αριθμό των κόμβων. Αλλά Αντιμετώπιση 70 κόμβοι 1025 Kg DNA 200 κόμβοι δεν αρκεί όλο το DNA της γης Αναπτύχθηκαν διαφορετικοί βιοαλγόριθμοι όπως πχ. αλγόριθμος που δημιουργεί σταδιακά μόνο τις διαδρομές από τον αρχικό προς τον τελικό κόμβο.

66 Ένα πρωτοποριακό πείραμα Συμπεράσματα A proof of Principle Experiment Σχεδιάστηκε για να αποδείξει την εφικτότητα της εκτέλεσης των DNA υπολογισμών και δεν ενδιέφερε η πρακτικότητα του.

67 Πλεονεκτήματα του DNA computing Μαζικά παράλληλη επεξεργασία: Η δυνατότητα εκτέλεσης ενός πολύ μεγάλου αριθμού υπολογισμών ταυτόχρονα. Κατάλληλη μέθοδος για την επίλυση ομάδων προβλημάτων τα οποία έχουν εκθετική χρονική πολυπλοκότητα (πχ. NP-complete problems). To DNA είναι εξαιρετικό αποθηκευτικό μέσο. Πολύ μεγάλη ελάττωση του όγκου των αποθηκευτικών μέσων στο μέλλον. Χαμηλή ενεργειακή κατανάλωση.

68 Πλεονεκτήματα του DNA computing Προϋποθέτει τη συνεργασία διαφορετικών επιστημονικών πεδίων (χημείας, μαθηματικών, βιολογίας, επιστήμης των υπολογιστών), με συνέπεια την προώθηση και ξεχωριστή ανάπτυξη του κάθε τομέα. Το DNA μπορεί κανείς να το προμηθευτεί πολύ εύκολα από τη φύση. Οι μικροεπεξεργαστές είναι κατασκευασμένοι από τοξικά για το περιβάλλον υλικά σε αντίθεση με το DNA που είναι φιλικό προς το περιβάλλον.

69 Περιορισμοί και δυσκολίες Η DNA υπολογιστική μέθοδος δεν είναι κατάλληλη για την υλοποίηση όλων των αλγορίθμων (κατάλληλη για συγκεκριμένες κατηγορίες προβλημάτων). Το κόστος εφαρμογής των βιοδιεργασιών, αν και συνεχώς μειώνεται, είναι ακόμη υψηλό. Τα πειράματα DNA in vitro, χρειάζονται χρόνο για την εκτέλεσή τους (ώρες ή μέρες). Το πείραμα του Adleman χρειάστηκε επτά ημέρες για να ολοκληρωθεί. Αυτό συμβαίνει γιατί μερικές βιοδιεργασίες είναι χρονοβόρες.

70 Περιορισμοί και δυσκολίες Τα πειράματα εκτελούνται σε δοκιμαστικούς σωλήνες, επομένως είναι απαραίτητη η ανθρώπινη παρέμβαση. Στα περισσότερα πειράματα χρησιμοποιούνται ολιγονουκλεοτίδια και εμφανίζονται λάθη κατά την εκτέλεση των βιοδιεργασιών. Τέτοια λάθη μπορεί να εμφανιστούν κατά τον υβριδισμό ή την PCR. Αυτό είναι το κύριο εμπόδιο που πρέπει να ξεπεραστεί ώστε τα DNA υπολογιστικά συστήματα να γίνουν αξιόπιστα. Έχουν προταθεί ιδιαίτερα αξιόλογες λύσεις για κάποιους από τους παραπάνω περιορισμούς.


Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Chain Reaction (pcr)- Αλυσιδωτή αντίδραση πολυμεράσης.η

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα


ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ Τα προβλήματα αυτού του κεφαλαίου αναφέρονται στον υπολογισμό : 1. νουκλεοτιδίων ή αζωτούχων βάσεων ή πεντοζών ή φωσφορικών ομάδων 2. φωσφοδιεστερικών δεσμών ή μορίων

Διαβάστε περισσότερα

Το κεντρικό δόγμα (The central dogma)

Το κεντρικό δόγμα (The central dogma) Οι βασικές μοριακές γενετικές διαδικασίες Αντιγραφή Μεταγραφή Μετάφραση ΠΡΩΤΕΪΝΗ Το κεντρικό δόγμα (The central dogma) Σύσταση νουκλεοτιδίων του DNA και του RNA Α 5 -άκρο Θυμίνη (Θ) Β 5 άκρο Αδενίνη (Α)

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής ΚΕΑΛΑΙΟ 5 ιατήρηση και συνέχεια της ζωής 5.2 H ροή της γενετικής πληροφορίας 3 Πώς βρέθηκε η δομή του DNA στο χώρο; Η ανακάλυψη της δομής του DNA πραγματοποιήθηκε το 1953 από τους Watson και Crick. Από

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα


Η ΑΛΗΘΙΝΗ ΚΑΙ Η ΕΙΚΟΝΙΚΗ ΜΙΚΡΟΣΥΣΤΟΙΧΙΑ ΒΗΜΑ ΠΡΟΣ ΒΗΜΑ Η ΑΛΗΘΙΝΗ ΚΑΙ Η ΕΙΚΟΝΙΚΗ ΜΙΚΡΟΣΥΣΤΟΙΧΙΑ ΒΗΜΑ ΠΡΟΣ ΒΗΜΑ DNA μικροσυστοιχίες: βήμα προς βήμα Παραγωγή DNA ανιχνευτών Οι επιστήμονες μπορούν να παράγουν «σπιτικές» μικροσυστοιχίες χρησιμοποιώντας την αλυσιδωτή

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ


Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι:

Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι: 1 ΑΣΚΗΣΕΙΣ ΝΟΥΚΛΕΙΚΩΝ ΟΞΕΩΝ ΑΣΚΗΣΗ 1 Ποια είναι η δομή των νουκλεοτιδίων; Τα νουκλεοτίδια προέρχονται από τη σύνδεση με ομοιοπολικό δεσμό, τριών διαφορετικών μορίων. Μιας πεντόζης (σάκχαρο με πέντε άτομα

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Τεχνολογία του ανασυνδυασμένου DNA

Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία του ανασυνδυασμένου DNA Θέση περιορισμού συμμετρική ως προς τον άξονα που περνά από το μέσο της. Στην εικόνα φαίνεται η θέση αναγνώρισης της EcoRI RI. Η αλληλουχία είναι παλίνδρο- μη: είναι

Διαβάστε περισσότερα

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία)

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Βιοτεχνολογία Φυτών ΔΠΘ / Τμήμα Αγροτικής Ανάπτυξης ΠΜΣ Αειφορικά Συστήματα Παραγωγής και Περιβάλλον στη Γεωργία Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Αριστοτέλης Χ. Παπαγεωργίου Εργαστήριο

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Βιολογία Θετικής Κατεύθυνσης 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία ανασυνδυασμένου DNA Αναπτύχθηκε λόγω της ανακάλυψης: i. Περιοριστικών ενδονουκλεασών ii. Ειδικών φορέων DNA Έδωσε

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα


ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA 1. Γιατί οι περιοριστικές ενδονουκλεάσες και οι φορείς κλωνοποίησης είναι απαραίτητα εργαλεία για τη Γενετική Μηχανική; Οι περιοριστικές ενδονουκλεάσες είναι

Διαβάστε περισσότερα


ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 2/12/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα

Οργανική Χημεία. Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα Οργανική Χημεία Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα 1. Γενικά-ιδιότητες Κυκλικές οργανικές ενώσεις: καρβοκυκλικές (δακτύλιος περιέχει μόνο άτομα C) και ετεροκυκλικές (δακτύλιος

Διαβάστε περισσότερα

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i..

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i.. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ «XHMIKH ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ» ΕΙΣΑΓΩΓΗ ΚΑΙ Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Όταν αναφερόμαστε στον όρο «Χημική Σύσταση του Κυττάρου», τί νομίζετε ότι

Διαβάστε περισσότερα



Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση:

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου Ενότητα 1.1: Χημεία της ζωής Ενότητα 2.1: Μακρομόρια Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: 1. Για ποιο λόγο θεωρείται αναγκαία η σταθερότητα

Διαβάστε περισσότερα


ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Βιολογία. Θετικής Κατεύθυνσης

Βιολογία. Θετικής Κατεύθυνσης Βιολογία Θετικής Κατεύθυνσης Κεφάλαιο 4ο ΤΕΧΝΟΛΟΓΊΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΈΝΟΥ DNA Γενετική Μηχανική 3 Είναι ο κλάδος της Βιολογίας που περιλαμβάνει τις τεχνικές με τις οποίες ο άνθρωπος επεμβαίνει στο γενετικό

Διαβάστε περισσότερα


ΝΕΕΣ MΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΓΙΑ ΤΗΝ ΤΥΠΟΠΟΙΗΣΗ ΤΩΝ ΒΑΚΤΗΡΙΩΝ ΝΕΕΣ MΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΓΙΑ ΤΗΝ ΤΥΠΟΠΟΙΗΣΗ ΤΩΝ ΒΑΚΤΗΡΙΩΝ ΑΠΟΣΤΟΛΟΣ ΒΑΝΤΑΡΑΚΗΣ ΒΙΟΛΟΓΟΣ (M.Sc, Ph.D) Επιδημίες μολυσματικών ασθενειών συχνά οφείλονται σε έκθεση σε μία κοινή πηγή ενός αιτιολογικού παράγοντα.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 27 5 2016 Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Σχολ. βιβλίο σελ. 20 με την παλιά έκδοση ή σελ. 24 με τη νέα έκδοση : «Τα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Γενικά Στοιχεία Ηλεκτρονικού Υπολογιστή

Γενικά Στοιχεία Ηλεκτρονικού Υπολογιστή Γενικά Στοιχεία Ηλεκτρονικού Υπολογιστή 1. Ηλεκτρονικός Υπολογιστής Ο Ηλεκτρονικός Υπολογιστής είναι μια συσκευή, μεγάλη ή μικρή, που επεξεργάζεται δεδομένα και εκτελεί την εργασία του σύμφωνα με τα παρακάτω

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα



Διαβάστε περισσότερα


Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ. Χημεία της ζωής 1

ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ. Χημεία της ζωής 1 ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημεία της ζωής 1 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ Η Βιολογία μπορεί να μελετηθεί μέσα από πολλά και διαφορετικά επίπεδα. Οι βιοχημικοί, για παράδειγμα, ενδιαφέρονται περισσότερο

Διαβάστε περισσότερα

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Φραγκίσκος Κολίσης Καθηγητής Βιοτεχνολογίας, Σχολή Χημικών Μηχανικών ΕΜΠ, Διευθυντής Ινστιτούτου Βιολογικών Ερευνών και Βιοτεχνολογίας, EIE

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Γ Γ.1 Ο χαρακτήρας της ομάδας αίματος στον άνθρωπο

Διαβάστε περισσότερα

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β. Α1. Η α Α2. Η γ Α3. Η α Α4. Η δ Α5. Η γ Β1. 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β


Διαβάστε περισσότερα



Διαβάστε περισσότερα

Οργανική Χηµεία. Κεφάλαιο 29: Βιοµόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα

Οργανική Χηµεία. Κεφάλαιο 29: Βιοµόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα Οργανική Χηµεία Κεφάλαιο 29: Βιοµόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα 1. Γενικά-ιδιότητες Κυκλικές οργανικές ενώσεις: καρβοκυκλικές (δακτύλιος περιέχει µόνο άτοµα C) και ετεροκυκλικές (δακτύλιος

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

Πανελλήνιος Μαθητικός Διαγωνισμός για την επιλογή στην 11η Ευρωπαϊκή Ολυμπιάδα Επιστημών - EUSO 2013 Σάββατο 19 Ιανουαρίου 2013 ΧΗΜΕΙΑ

Πανελλήνιος Μαθητικός Διαγωνισμός για την επιλογή στην 11η Ευρωπαϊκή Ολυμπιάδα Επιστημών - EUSO 2013 Σάββατο 19 Ιανουαρίου 2013 ΧΗΜΕΙΑ Πανελλήνιος Μαθητικός Διαγωνισμός για την επιλογή στην 11η Ευρωπαϊκή Ολυμπιάδα Επιστημών - EUSO 2013 Σάββατο 19 Ιανουαρίου 2013 ΧΗΜΕΙΑ Σχολείο: 1) Ονομ/επώνυμα μαθητών: 2)... 3) ΚΙΝΗΤΙΚΗ ΜΕΛΕΤΗ ΧΗΜΙΚΗΣ

Διαβάστε περισσότερα


ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία της Δημόσιας Υγείας Α. Βανταράκης Εργαστήριο Υγιεινής, Ιατρική Σχολή,

Διαβάστε περισσότερα


ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 Α1. 1. δ 2. α 3. δ 4. γ 5. γ Βιολογία ΘΕΜΑ A κατεύθυνσης Α2. Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 ΘΕΜΑ Β 1.

Διαβάστε περισσότερα

Μία μέθοδος προσομοίωσης ψηφιακών κυκλωμάτων Εξελικτικής Υπολογιστικής

Μία μέθοδος προσομοίωσης ψηφιακών κυκλωμάτων Εξελικτικής Υπολογιστικής Μία μέθοδος προσομοίωσης ψηφιακών κυκλωμάτων Εξελικτικής Υπολογιστικής Βασισμένο σε μια εργασία των Καζαρλή, Καλόμοιρου, Μαστοροκώστα, Μπαλουκτσή, Καλαϊτζή, Βαλαή, Πετρίδη Εισαγωγή Η Εξελικτική Υπολογιστική

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. 1. Στην πλειονότητά

Διαβάστε περισσότερα

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών»

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών» Βιολογία Κατεύθυνσης Γ Λυκείου Απαντήσεις 2012 Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β ΘΕΜΑ Α Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο

Διαβάστε περισσότερα

θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν κλπ

θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν κλπ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 4 ο ΚΕΦΑΛΑΙΟ 1. Προβλήματα που αναφέρονται στα κομμάτια που θα κοπεί το DNA, στις θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν

Διαβάστε περισσότερα

Εκπαιδευτήριο TO ΠΑΓΚΡΗΤΙΟΝ Σχολικό Έτος 2007-2008 Συνθετικές εργασίες στο μάθημα Πληροφορική Τεχνολογία της Β Γυμνασίου: Όψεις της Τεχνολογίας

Εκπαιδευτήριο TO ΠΑΓΚΡΗΤΙΟΝ Σχολικό Έτος 2007-2008 Συνθετικές εργασίες στο μάθημα Πληροφορική Τεχνολογία της Β Γυμνασίου: Όψεις της Τεχνολογίας Εκπαιδευτήριο TO ΠΑΓΚΡΗΤΙΟΝ Σχολικό Έτος 2007-2008 Συνθετικές εργασίες στο μάθημα Πληροφορική Τεχνολογία της Β Γυμνασίου: Όψεις της Τεχνολογίας Θέμα: DNA Τμήμα: ΗΥ: Ομάδα: Β2 pc29 Μηλαθιανάκης Μιχάλης

Διαβάστε περισσότερα


Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

Τμήμα Χρηματοοικονομικής & Ελεγκτικής ΤΕΙ Ηπείρου Παράρτημα Πρέβεζας. Πληροφορική Ι. Μάθημα 4 ο Πράξεις με bits. Δρ.

Τμήμα Χρηματοοικονομικής & Ελεγκτικής ΤΕΙ Ηπείρου Παράρτημα Πρέβεζας. Πληροφορική Ι. Μάθημα 4 ο Πράξεις με bits. Δρ. Τμήμα Χρηματοοικονομικής & Ελεγκτικής ΤΕΙ Ηπείρου Παράρτημα Πρέβεζας Πληροφορική Ι Μάθημα 4 ο Πράξεις με bits Δρ. Γκόγκος Χρήστος Κατηγορίες πράξεων με bits Πράξεις με δυαδικά ψηφία Αριθμητικές πράξεις

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 ΘΕΜΑ Α Α1.β Α2.γ Α3.α Α4.δ Α5.γ ΘΕΜΑ Β Β1. 1A, 2B, 3B, 4A, 5A, 6A, 7B, 8B Β2. σελίδα 40 σχολικού

Διαβάστε περισσότερα

Βασικές Έννοιες Πληροφορικής

Βασικές Έννοιες Πληροφορικής Βασικές Έννοιες Πληροφορικής 1. Τι είναι ο Ηλεκτρονικός Υπολογιστής Ο Ηλεκτρονικός Υπολογιστής είναι οποιαδήποτε συσκευή μεγάλη ή μικρή που επεξεργάζεται δεδομένα και εκτελεί την εργασία του σύμφωνα με

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΘΕΜΑ Α Α1 Β Α2 Β Α3 Δ Α4 Γ Α5 Γ ΘΕΜΑ Β Β1 1. Α 2. Γ 3. Α 4. Β 5. Α 6. Α 7. Γ Β2 ΣΕΛ.24 σχολ.βιβ. «Κάθε φυσιολογικό µεταφασικό.. Η απεικόνιση αυτή αποτελεί

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4. Βασικές αρχές της μοριακής βιολογίας. Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1

ΚΕΦΑΛΑΙΟ 4. Βασικές αρχές της μοριακής βιολογίας. Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1 ΚΕΦΑΛΑΙΟ 4 Βασικές αρχές της μοριακής βιολογίας Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1 ΕΙΚΟΝΑ 4.4 Η μεταφορά της γενετικής πληροφορίας μέσω του DNA. Ακαδημαϊκές Εκδόσεις 2011 Το

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια ΚΕΦΑΛΑΙΟ 4ο: Η τεχνολογία του ανασυνδυασµένου DNA έδωσε στον άνθρωπο την ικανότητα όχι µόνο να ερευνά αλλά και να τροποποιεί το γενετικό υλικό των οργανισµών ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA Η τεχνολογία

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Υπάρχουν δύο τύποι μνήμης, η μνήμη τυχαίας προσπέλασης (Random Access Memory RAM) και η μνήμη ανάγνωσης-μόνο (Read-Only Memory ROM).

Υπάρχουν δύο τύποι μνήμης, η μνήμη τυχαίας προσπέλασης (Random Access Memory RAM) και η μνήμη ανάγνωσης-μόνο (Read-Only Memory ROM). Μνήμες Ένα από τα βασικά πλεονεκτήματα των ψηφιακών συστημάτων σε σχέση με τα αναλογικά, είναι η ευκολία αποθήκευσης μεγάλων ποσοτήτων πληροφοριών, είτε προσωρινά είτε μόνιμα Οι πληροφορίες αποθηκεύονται

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους Για να εξασφαλιστεί η σωστή και αρμονική έκφραση των ενζύμων μέσα στο κύτταρο χρειάζεται ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. και Η εναρμόνιση αυτή επιτυγχάνεται με διάφορους τρόπους

Διαβάστε περισσότερα


ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέμα 1 ο : Να επιλέξετε τη σωστή απάντηση: 1. Το σύμπλοκο έναρξης της πρωτεϊνοσύνθεσης δεν περιλαμβάνει α. το mrna β. τη μεγάλη ριβοσωμική υπομονάδα γ.

Διαβάστε περισσότερα