DNA COMPUTING. Το πρώτο πείραμα του. Leonard Adleman. Μαριάννα Δερμεντζή. Σεμινάριο Θεωρητικής Πληροφορικής. και Διακριτών Μαθηματικών

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "DNA COMPUTING. Το πρώτο πείραμα του. Leonard Adleman. Μαριάννα Δερμεντζή. Σεμινάριο Θεωρητικής Πληροφορικής. και Διακριτών Μαθηματικών"

Transcript

1 DNA COMPUTING Το πρώτο πείραμα του Leonard Adleman Μαριάννα Δερμεντζή Σεμινάριο Θεωρητικής Πληροφορικής και Διακριτών Μαθηματικών Τμήμα Μαθηματικών Α.Π.Θ.

2 Περιεχόμενα DNA computing DNA Βασικές έννοιες Ιστορική Αναδρομή Περιορισμοί της συμβατικής τεχνολογίας Βασικές έννοιες Δομή Το πρώτο πείραμα του L. Adleman Ο αλγόριθμος Οι βιοδιεργασίες Η διαδικασία Συμπεράσματα Πλεονεκτήματα και περιορισμοί του DNA computing

3 Molecular Computing Mοριακή υπολογιστική (molecular computing): γενικός όρος που αναφέρεται σε κάθε υπολογιστικό σύστημα, το οποίο χρησιμοποιεί μόρια ή άτομα, ως μέσα για την επίλυση υπολογιστικών προβλημάτων. Προέκυψε από την συνεργασία επιστημόνων πληροφορικής, μαθηματικών, μοριακής βιολογίας και χημείας, στην προσπάθειά τους να μελετήσουν τη δυνατότητα πραγματοποίησης υπολογισμών με χρήση βιολογικών πολυμερών, τα οποία είναι φορείς πληροφορίας, όπως το DNA και το RNA. Συχνότερα συνδέεται με το DNA computing (αλλά μπορεί να αναφέρεται και σε κβαντικούς υπολογιστές), γιατί είναι το πεδίο που έχει σημειώσει την μεγαλύτερη πρόοδο.

4 DNA computing DNA computing: ένα νέο, ραγδαία αναπτυσσόμενο διαθεματικό επιστημονικό πεδίο, που χρησιμοποιεί το DNA ως υπολογιστικό μέσο, σε αντίθεση με την συμβατική τεχνολογία η οποία στηρίζεται στο πυρίτιο. Βασική ιδέα Κωδικοποίηση της πληροφορίας σε DNA αλυσίδες. Εκτέλεση βιοδιεργασιών για την επεξεργασία της. Τα αποτελέσματα της επεξεργασίας είναι DNA αλυσίδες. Η αποκωδικοποίηση αποτελεσμάτων γίνεται με προσδιορισμό της αλληλουχίας των DNA αλυσίδων.

5 DNA Computing Ιστορική αναδρομή R. Feynman (1959): πρώτος ανέφερε ως ιδέα την δημιουργία υπομικροσκοπικών υπολογιστών. L. Adleman (1994): πέτυχε τη λύση μιας εκδοχής επτά κόμβων του Χαμιλτονιανού προβλήματος (HPP) χρησιμοποιώντας μόνο DNA αλυσίδες μέσα σε δοκιμαστικούς σωλήνες και εκτελώντας βιοδιεργασίες. R. Lipton (1995): περιέγραψε μια μέθοδο επίλυσης του SAT προβλήματος (πρόβλημα ικανοποιησιμότητας) το οποίο είναι ένα NP-hard problem. To SAT πρόβλημα, δοθέντος ενός Boolean τύπου, συνίσταται στην εύρεση ενός συνδυασμού τιμών T (true) και F (false) που θα αποδοθούν στις μεταβλητές του τύπου έτσι ώστε αυτός να ικανοποιείται δηλαδή να παίρνει την τιμή T (true).

6 DNA Computing Ιστορική αναδρομή Το 1996 οι R. Lipton, D. Boneh, and Ch. Dunworth περιέγραψαν ένα «μοριακό πρόγραμμα» για το «σπάσιμο» του Data Encryption Standard (DES), ενός ευρέως χρησιμοποιημένου κρυπτογραφικού συστήματος. Ο DES είναι ο κρυπταλγόριθμος ο οποίος είχε επιλεγεί ως επίσημο Ομοσπονδιακό Πρότυπο Επεξεργασίας Πληροφοριών (Federal Information Processing Standard - FIPS) για τις Ηνωμένες Πολιτείες το Ο DES στη συνέχεια χρησιμοποιήθηκε διεθνώς. Το 1997 διατυπώθηκε μια θεωρία από τους M. Ogihara και A. Ray, ότι DNA υπολογιστικές διατάξεις μπορούν να προσομοιώσουν Boolean κυκλώματα σε πολύ μεγάλο βαθμό.

7 DNA Computing Ιστορική αναδρομή Το 2002 δημοσιεύτηκε η επίλυση με DNA τεχνικές, ενός SAT προβλήματος με 20 μεταβλητές. Ήταν το μεγαλύτερο πρόβλημα που είχε λυθεί έως τότε με μη ηλεκτρονικά μέσα. Ήταν ένα πολύπλοκο πρόβλημα, επιλεγμένο να έχει μόνο μια λύση και 2 20 πιθανούς συνδυασμούς. Παρόλα αυτά, είναι εντυπωσιακό το γεγονός πως κατά κανόνα (εκτός μικρών εξαιρέσεων) χρησιμοποιήθηκαν μόνο οι δύο βασικές τεχνικές της τήξης (melting) και του υβριδισμού (annealing), για την επίλυσή του.

8 DNA Computing Ιστορική αναδρομή Weizmann Institute of Science in Israel (2002): παρουσιάστηκε μια προγραμματιζόμενη υπολογιστική διάταξη η οποία στήριζε τη λειτουργία της σε ένζυμα και DNA μόρια. Μπορούσε να εκτελέσει 330 τρισεκατομμύρια λειτουργίες ανά δευτερόλεπτο, δηλαδή ήταν πάνω από φορές ταχύτερη από τον ταχύτερο υπολογιστή της εποχής. Weizmann Institute (2004): κατασκευάστηκε μια αυτόνομη DNA υπολογιστική διάταξη, με προοπτική να εφαρμοστεί στην ιατρική διάγνωση και θεραπεία in vivo.

9 DNA Computing Ιστορική αναδρομή To 2009 παρουσιάστηκε μια γενικευμένη υλοποίηση του αλγορίθμου του Strassen για τον πολλαπλασιασμό πινάκων, σε έναν DNA υπολογιστή. Caltech (2011): δημιουργήθηκε ένα κύκλωμα από 130 μονόκλωνες DNA αλυσίδες, το οποίο είχε τη δυνατότητα υπολογισμού της τετραγωνικής ρίζας αριθμών μέχρι το 15. Το 2012 παρουσιάστηκαν τα αποτελέσματα ενός πειράματος, όπου ψηφιακή πληροφορία κωδικοποιήθηκε σε DNA και κατόπιν μετατράπηκε χωρίς απώλειες στην αρχική της δυαδική μορφή.

10 DNA Computing Ιστορική αναδρομή European Bioinformatics Institute (2013): 5,2 εκατομμύρια bits κωδικοποιήθηκαν σε DNA και κατόπιν επανήλθαν στην αρχική τους μορφή. Συμπληρωματικά όμως αναπτύχθηκε και ένα σύστημα διόρθωσης λαθών και έτσι εξασφαλίστηκε χαμηλός ρυθμός απώλειας δεδομένων. Stanford University (2013): παρουσιάστηκε ένα βιολογικό transistor με την ονομασία transcriptor. Η συγκεκριμένη διάταξη, μπορεί να χρησιμοποιηθεί σε ζωντανά κύτταρα με σκοπό τον εντοπισμό και την καταγραφή της έκθεσης των κυττάρων σε εξωτερικά ερεθίσματα και ακόμη την ενεργοποίηση ή όχι της αναπαραγωγής τους εφόσον αυτό χρειάζεται.

11 DNA Computing Εκτέλεση αριθμητικών ή λογικών πράξεων. Λύση NP-hard, NP-complete προβλημάτων. Δημιουργία συστημάτων κωδικοποίησης και αποθήκευσης μεγάλου όγκου ψηφιακής πληροφορίαςκρυπτογραφία. Προγραμματιζόμενα υπολογιστικά συστήματα in vitro, με προοπτική την in vivo εφαρμογή τους στην ιατρική. Πχ. επιστήμονες ισχυρίζονται ότι DNA υπολογιστικές διατάξεις θα μπορούν να εμφυτευτούν στο ανθρώπινο σώμα για τον έλεγχο της παρουσίας των καρκινικών κυττάρων ή των επιπέδων της ινσουλίνης για διαβητικούς ασθενείς.

12 Το DNA ως μέσο για τη δημιουργία αυτομάτων μοριακής κλίμακας Κατασκευή λογικών πυλών με βάση τα μόρια DNA και ένζυμα ΜΑΥΑ Ι (2003) - MAYA II (2006) a m_olecular a_rray of Y_ES and A_NDNOT gates Παίζοντας «τρίλιζα».

13 Μια πλάκα με εσοχές περιέχει μικρά τμήματα DNA που κωδικοποιούν τις πιθανές «κινήσεις». MAYA II (2006) Μια οθόνη δείχνει ότι ο υπολογιστής (κόκκινα τετράγωνα) έχει κερδίσει το παιχνίδι με αντίπαλο κάποιο φίλο (μπλε).

14 DNA chip (DNA microarray) Μια μικροσυστοιχία DNA (τσιπ DNA ή βιοτσίπ) είναι μια συλλογή από μικροσκοπικές κηλίδες DNA που συνδέονται με μια στερεή επιφάνεια. Οι επιστήμονες χρησιμοποιούν μικροσυστοιχίες DNA για τη γονοτυπική ανάλυση πολλαπλών περιοχών ενός γονιδιώματος.

15 DNA integrated circuits Ένα DNA ολοκληρωμένο κύκλωμα είναι ένα ολοκληρωμένο σύστημα ημιαγωγών το οποίο ή αλληλεπιδρά ή ενσωματώνει DNA ή άλλα μόρια.

16 DNA υπολογιστική διάταξη Ανάπτυξη του πρώτου υπολογιστή DNA στον κόσμο για την ανάλυση γονιδίων (2002)

17 DNA υπολογιστική διάταξη

18 Περιορισμοί της συμβατικής τεχνολογίας Όριο στην ελαχιστοποίηση του μεγέθους Ταχύτητα επεξεργασίας που πλησιάζει το άνω όριο DNA: ένα μοναδικό υπολογιστικό εργαλείο με πολλά πλεονεκτήματα Δυνατότητα υπολογισμών σε μοριακό επίπεδο Watson-Crick συμπληρωματικότητα Μαζικά παράλληλη επεξεργασία Χαμηλή ενεργειακή κατανάλωση Εξαιρετικό αποθηκευτικό μέσο

19 DNA - Βασικές έννοιες Το DNA (δεοξυριβονουκλεϊκό οξύ) είναι ένα μακρομόριο, το οποίο στους ζώντες οργανισμούς έχει αποθηκευμένη την γενετική πληροφορία των κυττάρων. Απαρτίζεται από δύο μονές αλυσίδες, τα πολυνουκλεοτίδια, οι οποίες ενώνονται μεταξύ τους δημιουργώντας μια συνεστραμμένη έλικα. Κάθε αλυσίδα αποτελείται από σύνθετα οργανικά μόρια που ονομάζονται DNA νουκλεοτίδια και αποτελούν τη βασική δομική της μονάδα.

20 Η δομή του DNA

21 Η δομή του DNA

22 Η δομή του DNA

23 Σημαντικά χαρακτηριστικά Για τη δημιουργία ενός δίκλωνου DNA μορίου, είναι απαραίτητο οι μονόκλωνες αλυσίδες που το απαρτίζουν: Να είναι συμπληρωματικές Να έχουν αντίθετο προσανατολισμό

24 Watson-Crick συμπληρωματικότητα των βάσεων Στο δίκλωνο DNA μόριο οι βάσεις ενώνονται με πολύ συγκεκριμένο τρόπο: Η Αδενίνη (Α) ενώνεται μόνο με τη Θυμίνη (Τ) με δυο δεσμούς υδρογόνου Η Γουανίνη (G) μόνο με την Κυτοσίνη (C) με τρεις δεσμούς υδρογόνου Αυτό αποτελεί το βασικότερο χαρακτηριστικό το οποίο «εκμεταλλευόμαστε» σε μεγάλο βαθμό στις βιολειτουργίες οι οποίες λαμβάνουν χώρα κατά τη διάρκεια των DNA υπολογισμών.

25 Αντίθετος προσανατολισμός των βάσεων Κάθε πολυνουκλεοτίδιο έχει συγκεκριμένο προσανατολισμό 5 3. Κάθε αλυσίδα στο DNA μόριο έχει αντίθετο προσανατολισμό σε σχέση με την συμπληρωματική της.

26 DNA Computing Leonard Adleman Leonard Adleman: Αμερικανός επιστήμονας θεωρητικής πληροφορικής και καθηγητής της επιστήμης των υπολογιστών και μοριακής βιολογίας στο Πανεπιστήμιο της Βόρειας Καρολίνας. Αναφέρεται και ως ο πατέρας του DNA computing και συνεφευρέτης του κρυπτογραφικού συστήματος RSA το 1977, το οποίο έχει ευρεία εφαρμογή σε εφαρμογές ασφαλείας συμπεριλαμβανομένου και του https.

27 DNA computing Τα πρώτα βήματα. 1994: Δημοσιεύεται στο περιοδικό Science, η εργασία του Leonard Adleman με τίτλο: Molecular computation of solutions to combinatorial problems. Εκεί περιγράφεται ένα πείραμα όπου επιλύεται ένα μαθηματικό πρόβλημα (μια εκδοχή με 7 κόμβους του Χαμιλτονιανού προβλήματος) με χρήση μόνο αλυσίδων DNA και εκτέλεση βιοδιεργασιών in vitro.

28 DNA computing Ένα πρωτοποριακό πείραμα Υπολογιστικό μέσο: DNA αλυσίδες Υπολογιστική μέθοδος: Βιοδιεργασίες Ο πρώτος DNA «υπολογιστής» Ήταν η πρώτη φορά όπου: Το DNA χρησιμοποιούνταν για υπολογιστικούς σκοπούς Υπήρχε μια πειραματική απόδειξη ότι οι DNA υπολογισμοί είναι εφικτοί.

29 DNA computing Ένα πρωτοποριακό πείραμα Hamiltonian Path Problem (HPP) Ένα NP-complete πρόβλημα Ένα κατευθυνόμενο γράφημα G, με συγκεκριμένο αρχικό και τελικό κόμβο υ in και υ out αντίστοιχα, θεωρείται ότι έχει Χαμιλτονιανή διαδρομή, αν υπάρχει μια διαδρομή η οποία απαρτίζεται από ακμές e 1,e 2,..e n,, η οποία ξεκινά από τον κόμβο υ in και καταλήγει στον κόμβο υ out, περνώντας από κάθε κόμβο μόνο μια φορά.

30 DNA computing Ένα πρωτοποριακό πείραμα Ένα απλό πρόβλημα με μια επαναστατική λύση! Σε ένα κατευθυνόμενο γράφημα 7 κόμβων, έπρεπε να βρεθεί διαδρομή η οποία ξεκινούσε από τον αρχικό κόμβο O ο, σταματούσε στον τελικό O 6 και περνούσε από κάθε κόμβο μόνο μια φορά (Χαμιλτονιανή διαδρομή). Χαμιλτονιανή διαδρομή:

31 DNA computing Ένα πρωτοποριακό πείραμα Δυο σημαντικά σημεία: Η μαζικά παράλληλη επεξεργασία εξασφάλισε την δυνατότητα γρήγορης δημιουργίας όλων των πιθανών διαδρομών. Η Watson-Crick συμπληρωματικότητα ήταν καταλυτικός παράγοντας για την κωδικοποίηση της πληροφορίας.

32 Ένα πρωτοποριακό πείραμα Η κωδικοποίηση της πληροφορίας Κόμβοι (Ο i όπου i = 0, 1, 2, 3, 4, 5, 6) Τυχαία ολιγονουκλεοτίδια των 20 βάσεων. Ενδιάμεσες ακμές Ολιγονουκλεοτίδια των 20 βάσεων, τα οποία αποτελούνται από το τελευταίο μισό του κόμβου από τον οποίο ξεκινά η ακμή και το πρώτο μισό του κόμβου στον οποίο καταλήγει. Ακμές που ξεκινούν από τον κόμβο O ο Ακμές που καταλήγουν στον κόμβο O 6 Όλιγονουκλεοτίδια των 30 βάσεων τα οποία αποτελούνται από όλη την ακολουθία του O ο και το πρώτο μισό του κόμβου στον οποίο καταλήγουν. Όλιγονουκλεοτίδια των 30 βάσεων τα οποία αποτελούνται από το πρώτο μισό του κόμβου από τον οποίο ξεκινούν και όλη την ακολουθία του κόμβου O 6.

33 Ένα πρωτοποριακό πείραμα Η κωδικοποίηση της πληροφορίας Οο = 5 - AATTCGTCTAGGTACTAATT - 3 O 1 = 5 - TAGGATTCATGAATACCTAG - 3 O O-1 = 5 - AATTCGTCTAGGTACTAATT TAGGATTCAT - 3 O 1 = 5 - TAGGATTCATGAATACCTAG - 3 O 2 = 5 - ATGCATTGCAAGTAGTATTG 3 O 1-2 = 5 - GAATACCTAGATGCATTGCA - 3 O 5 = 5 - CGAATGAACTATCCGTATTA- 3 O 6 = 5 - CTAGCAATCGGATTATCCAT - 3 O 5-6 = 5 - ATCCGTATTA CTAGCAATCGGATTATCCAT- 3

34 Ένα πρωτοποριακό πείραμα Η κωδικοποίηση της πληροφορίας Συμπληρωματικές DNA αλυσίδες Οο = 5 - AATTCGTCTAGGTACTAATT - 3 O 1 = 5 - TAGGATTCATGAATACCTAG - 3 Οο = 3 - TTAAGCAGATCCATGATTAA- 5 O 1 = 3 - ATCCTAAGTACTTATGGATC - 5 O 2 = 5 - ATGCATTGCAAGTAGTATTG - 3 O 6 = 5 - CTAGCAATCGGATTATCCAT - 3 O 2 = 3 - TACGTAACGTTCATCATAAC- 5 O 6 = 3 - GATCGTTAGCCTAATAGGTA - 5

35 Ένα πρωτοποριακό πείραμα Η κωδικοποίηση της πληροφορίας Σύνθεση ολιγονουκλεοτιδίων Oligonucleotide synthesizer

36 Αλγόριθμος Βιοδιεργασίες 1. Δημιούργησε όλες τις τυχαίες διαδρομές μέσα στο γράφημα Ανάμιξη, υβριδισμός και σύνδεση (Mixing, Hybridization & Ligation) 2. Επέλεξε τις διαδρομές που αρχίζουν από τον κόμβο Ο ο και τερματίζουν στον κόμβο Ο 6 Αλυσιδωτή αντίδραση πολυμεράσης (PCR) & DNA amplification 3. Επέλεξε μόνο τις διαδρομές που περνούν από 7 ακριβώς κόμβους Gel ηλεκτροφόρηση (Gel electrophoresis) 4. Επέλεξε τις διαδρομές που περνούν από όλους τους κόμβους τουλάχιστον μια φορά 5. Αν έχουν απομείνει διαδρομές τότε η έξοδος είναι «ναι», διαφορετικά «όχι» Διαχωρισμός των DNA αλυσίδων που περιέχουν συγκεκριμένη αλληλουχία βάσεων (affinity purification), κατ επανάληψη DNA amplification με PCR & Ανάλυση αλληλουχίας DNA (DNA sequencing)

37 Ένα πρωτοποριακό πείραμα Βήμα 1- Ο Αλγόριθμος ΒΗΜΑ 1 Δημιούργησε όλες τις τυχαίες διαδρομές μέσα στο γράφημα ΒΙΟΔΙΕΡΓΑΣΙΕΣ Ανάμιξη (mixing) Υβριδισμός in vitro (annealing, base pairing) Σύνδεση (ligation)

38 Ένα πρωτοποριακό πείραμα Βήμα 1- Οι βιοδιεργασίες Ανάμιξη (mixing): τα περιεχόμενα δύο δοκιμαστικών σωλήνων αναμιγνύονται σε έναν τρίτο. Διάλυμα που περιέχει DNA

39 Ένα πρωτοποριακό πείραμα Βήμα 1 - Οι βιοδιεργασίες Υβριδισμός in vitro (annealing, base pairing): συμπληρωματικές DNA αλυσίδες μέσα σε διάλυμα, ενώνονται δημιουργώντας δίκλωνα DNA μόρια μετά από κατάλληλη μείωση της θερμοκρασίας.

40 Ένα πρωτοποριακό πείραμα Βήμα 1- Οι βιοδιεργασίες Σύνδεση (ligation): χημική αντίδραση όπου χρησιμοποιώντας ως καταλύτη ένα ένζυμο που ονομάζεται λιγάση, «ενώνονται» δύο δίκλωνα τμήματα DNA, τα οποία είτε έχουν άκρα χωρίς προεξοχή (blunt ends), είτε κάποιο από τα άκρα τους προεξέχει (sticky ends).

41 Ένα πρωτοποριακό πείραμα Βήμα 1- Οι βιοδιεργασίες Σύνδεση (ligation): χημική αντίδραση όπου χρησιμοποιώντας ως καταλύτη ένα ένζυμο που ονομάζεται λιγάση, «ενώνονται» δύο δίκλωνα τμήματα DNA, τα οποία είτε έχουν άκρα χωρίς προεξοχή (blunt ends), είτε κάποιο από τα άκρα τους προεξέχει (sticky ends).

42 Ένα πρωτοποριακό πείραμα ΒΗΜΑ 1 Η διαδικασία Τα ολιγονουκλεοτίδια τα οποία αντιστοιχούσαν στις ακμές και τα ολιγονουκλεοτίδια που αντιστοιχούσαν στα συμπληρώματα των κόμβων (Ο i ) αναμιχθήκαν, παρουσία του ένζυμου λιγάση. Παράδειγμα: Το συμπλήρωμα του κόμβου Ο 2, λειτουργεί σαν «συνδετήρας» ανάμεσα στις ακμές Ο 1-2 και Ο 2-3 Ο 1-2 Ο 2-3 Ο 2

43 Ένα πρωτοποριακό πείραμα Βήμα 2- Ο Αλγόριθμος ΒΗΜΑ 2 Επέλεξε τις διαδρομές που αρχίζουν από τον κόμβο Ο ο και τερματίζουν στον κόμβο Ο 6 ΒΙΟΔΙΕΡΓΑΣΙΕΣ Τήξη (melting) Αλυσιδωτή αντίδραση πολυμεράσης (PCR) Αναπαραγωγή DNA (DNA amplification)

44 Ένα πρωτοποριακό πείραμα Βήμα 2- Οι βιοδιεργασίες Τήξη (melting): η διαδικασία κατά την οποία ένα δίκλωνο μόριο, χωρίζεται στις δύο μονές συμπληρωματικές αλυσίδες του, μετά από κατάλληλη αύξηση της θερμοκρασίας ή με μηχανικά μέσα.

45 Ένα πρωτοποριακό πείραμα Βήμα 2- Οι βιοδιεργασίες Αλυσιδωτή αντίδραση πολυμεράσης (PCR): η μέθοδος PCR, χρησιμοποιείται για την αντιγραφή συγκεκριμένου τμήματος του αρχικού DNA μορίου. Το όνομά της προέρχεται από τα ένζυμα DNA πολυμεράσες τα οποία είναι απαραίτητα στην διαδικασία. Αναπαραγωγή DNA (DNA amplification): Η πολλαπλή επανάληψη της μεθόδου PCR, οδηγεί στην αναπαραγωγή μεγάλου αριθμού αντιγράφων του συγκεκριμένου τμήματος.

46 Ένα πρωτοποριακό πείραμα Βήμα 2- Οι βιοδιεργασίες Ειδικό μηχάνημα (thermal cycler) για PCR Ειδικοί σωλήνες PCR, σε κάθε ένα πραγματοποιείται μία αντίδραση όγκου 100μl.

47 Ένα πρωτοποριακό πείραμα Βήμα 2- Οι βιοδιεργασίες Αλυσιδωτή αντίδραση πολυμεράσης PCR

48 Ένα πρωτοποριακό πείραμα Βήμα 2- Οι βιοδιεργασίες Αλυσιδωτή αντίδραση πολυμεράσης PCR

49 Ένα πρωτοποριακό πείραμα ΒΗΜΑ 2 Η διαδικασία Το αποτέλεσμα της σύνδεσης (ligation), αναπαράχθηκε με PCR, χρησιμοποιώντας ως εκκινητές (primers), τα ολιγονουκλεοτίδια Ο ο και Ο 6, έτσι ώστε μόνο οι διαδρομές που ξεκινούσαν με Ο ο και κατέληγαν στον Ο 6, ξεχώριζαν και αναπαράγονταν. Ως αποτέλεσμα είχαμε διαδρομές μεταβλητού μήκους που ξεκινούσαν από τον Ο ο και κατέληγαν στον Ο 6. Οποιεσδήποτε διαφορετικές διαδρομές απέμειναν, απλά ισοδυναμούσαν με μικρό «θόρυβο» στο σύστημα.

50 Ένα πρωτοποριακό πείραμα Βήμα 3- Ο Αλγόριθμος ΒΗΜΑ 3 Επέλεξε μόνο τις διαδρομές που περνούν από 7 κόμβους ΒΙΟΔΙΕΡΓΑΣΙΕΣ Gel ηλεκτροφόρηση (Gel electrophoresis)

51 Ένα πρωτοποριακό πείραμα Βήμα 3- Οι βιοδιεργασίες Gel ηλεκτροφόρηση (Gel electrophoresis): μέθοδος διαχωρισμού των DNA μορίων, με βάση το μέγεθος τους (αριθμός βάσεων). Τα αρνητικά φορτισμένα DNA μόρια, αφού τοποθετηθούν σε ηλεκτρικό πεδίο, μετακινούνται προς τον θετικό πόλο. H παρουσία gel στην ηλεκτροφόρηση έχει σαν συνέπεια ο ρυθμός μετατόπισης κάθε μορίου να επηρεάζεται από το μέγεθός του. Έτσι τα μεγαλύτερα μόρια μετακινούνται αργότερα από τα μικρότερα μέσα στο gel. Ως αποτέλεσμα, σχηματίζονται στο gel διακριτές ζώνες από μόρια DNA ίδιου μεγέθους. Προκειμένου να είναι ορατές οι ζώνες, το DNA επισημαίνεται με μια φθορίζουσα χρωστική ή με ένα ραδιενεργό ισότοπο.

52 Ένα πρωτοποριακό πείραμα Βήμα 3- Οι βιοδιεργασίες Gel ηλεκτροφόρηση

53 Ένα πρωτοποριακό πείραμα Βήμα 3- Οι βιοδιεργασίες Gel ηλεκτροφόρηση

54 Ένα πρωτοποριακό πείραμα Βήμα 3- Οι βιοδιεργασίες

55 Ένα πρωτοποριακό πείραμα Βήμα 3- Η διαδικασία Χρησιμοποιείται η τεχνική της Gel ηλεκτροφόρησης για να ξεχωρίσουν από τις προυπάρχουσες διαδρομές, εκείνες που αποτελούνται από =140 βάσεις (ξεκινούν από τον O o, περιλαμβάνουν έξι ακμές και καταλήγουν στον Ο 6 ).

56 Ένα πρωτοποριακό πείραμα Βήμα 4- Ο Αλγόριθμος ΒΗΜΑ 4 Επέλεξε τις διαδρομές που περνούν από όλους τους κόμβους τουλάχιστον μια φορά ΒΙΟΔΙΕΡΓΑΣΙΕΣ Τήξη (melting) Διαχωρισμός των DNA αλυσίδων που περιέχουν μια συγκεκριμένη ακολουθία βάσεων, σε ένα ετερογενές διάλυμα (affinity purification)

57 Ένα πρωτοποριακό πείραμα Βήμα 4- Οι βιοδιεργασίες Διαχωρισμός των DNA αλυσίδων που περιέχουν μια συγκεκριμένη ακολουθία βάσεων (affinity purification): είναι μια τεχνική διαχωρισμού των μονών DNA αλυσίδων οι οποίες έχουν ίδια αλληλουχία βάσεων και περιέχονται σε ένα ετερογενές μίγμα.

58 Ένα πρωτοποριακό πείραμα Βήμα 4- Οι βιοδιεργασίες Για να εξάγουμε μονόκλωνες DNA αλυσίδες συγκεκριμένης ακολουθίας x, πρώτα δημιουργούμε συμπληρωματικές των x, μονόκλωνες DNA αλυσίδες τις οποίες προσαρτούμε σε ένα στερεό υπόστρωμα, πχ. μαγνητικά σφαιρίδια. Το ετερογενές διάλυμα περνά ανάμεσα από τα σφαιρίδια με αποτέλεσμα οι αλυσίδες που περιέχουν την ακολουθία x, να συγκρατούνται από αυτά, γιατί ενώνονται με τις συμπληρωματικές τους. Εκείνες που δεν περιέχουν την x, περνούν χωρίς να δεσμευθούν. Τα σφαιρίδια απομακρύνονται από το μίγμα, πλένονται και έτσι ξεχωρίζουν οι αλυσίδες που περιέχουν την ακολουθία x

59 Ένα πρωτοποριακό πείραμα Βήμα 4- Η διαδικασία Δημιουργία μονόκλωνων DNA αλυσίδων από τα δίκλωνα μόρια που προκύπτουν από το βήμα 3. H ακολουθία Ο 1, προσαρτάται στα μαγνητικά σφαιρίδια και το ετερογενές διάλυμα των διαδρομών περνά ανάμεσα τους. Μόνο οι διαδρομές που περιέχουν την ακολουθία Ο 1 συγκρατούνται, δηλ. μόνο αυτές που περνούν από τον κόμβο Ο 1. Το διάλυμα με τις προηγούμενες διαδρομές υποβάλλεται ξανά στην ίδια διαδικασία. Η διαδικασία επαναλαμβάνεται για όλες τις ακολουθίες μέχρι την O 5. Οι αλυσίδες που απομένουν αντιστοιχούν σε διαδρομές που περιλαμβάνουν όλους τους κόμβους. /affchrom1.html

60 Ένα πρωτοποριακό πείραμα Βήμα 5- Ο Αλγόριθμος ΒΗΜΑ 5 Έλεγξε την ύπαρξη Χαμιλτονιανής Διαδρομής ΒΙΟΔΙΕΡΓΑΣΙΕΣ Αλυσιδωτή αντίδραση πολυμεράσης (PCR) Προσδιορισμός αλληλουχίας των βάσεων (DNA Sequencing)

61 Ένα πρωτοποριακό πείραμα Βήμα 5- Οι βιοδιεργασίες Αλληλούχιση DNA: είναι η διαδικασία όπου προσδιορίζεται η ακριβής σειρά των βάσεων σε μια DNA αλυσίδα. Το αποτέλεσμα μιας βιοδιεργασίας είναι ένα σύνολο DNA αλυσίδων η αλληλουχία των οποίων μπορεί να διαβαστεί από αυτόματες διατάξεις (sequencers).

62 Ένα πρωτοποριακό πείραμα Βήμα 5- Η διαδικασία Το προϊόν του βήματος 4, (δηλαδή όλες οι αλυσίδες που ξεκινούν από τον κόμβο O o, καταλήγουν στον O 6 και περνούν από όλους τους ενδιάμεσους κόμβους), αναπαράγεται με τη διαδικασία PCR έτσι ώστε να παραχθεί ανιχνεύσιμη ποσότητα σε περίπτωση ύπαρξης διαδρομής. Κατόπιν με μια μέθοδο αλληλούχισης, προσδιορίζεται η ακριβής σειρά των βάσεων της αλυσίδας που αντιστοιχεί στη Χαμιλτονιανή διαδρομή, άρα και η σειρά των κόμβων από τους οποίους περνά. Αποτέλεσμα αυτόματης αλληλούχισης από sequencer

63 Βιοδιεργασίες - Αλγόριθμος Σε δοκιμαστικό σωλήνα αναμιγνύονται οι συμπληρωματικοί κόμβοι και οι ακμές, τα οποία συνδέονται μεταξύ τους δημιουργώντας όλες τις δυνατές διαδρομές. Εκτελείται κατ επανάληψη, η Αλυσιδωτή αντίδραση πολυμεράσης (PCR) με συγκεκριμένους εκκινητές Ο ο και Ο 6, με στόχο την αναπαραγωγή τεράστιου αριθμού διαδρομών με αρχή τον κόμβο Ο ο και τέλος τον κόμβο Ο 6. Γίνεται Gel ηλεκτροφόρηση στις παραπάνω DNA αλυσίδες, ώστε να απομονωθούν αυτές με το σωστό μήκος (που περνούν από 7 κόμβους). Εφαρμόζεται επαναληπτικά η διαδικασία affinity purification με Οi (i=1,..,5), για να διαπιστωθεί ποιες διαδρομές περνούν από όλους τους ενδιάμεσους κόμβους. Αν έχουν απομείνει DNA αλυσίδες τότε αυτές αντιστοιχούν στην λύση του προβλήματος, και αναπαράγονται με PCR για να είναι ανιχνεύσιμες. Κατόπιν γίνεται ανάλυση της αλληλουχίας των βάσεων τους και αποκωδικοποιείται η Χαμιλτονιανή διαδρομή.

64 Ένα πρωτοποριακό πείραμα Συμπεράσματα Ταχύτητα Συμβατική τεχνολογία ops/sec (supercomputers -1994) Μέθοδος του Adleman ops/sec με δυνατότητα επέκτασης στις ops/sec (Operation=ligation) Ενεργειακές απαιτήσεις 10 9 ops/joule ops/joule Πυκνότητα αποθήκευσης 1 bit / nm 3 1 bit / 1nm 3

65 Ένα πρωτοποριακό πείραμα Συμπεράσματα Πλεονέκτημα Η χρονική πολυπλοκότητα είναι γραμμική σε σχέση με τον αριθμό των κόμβων. Μειονέκτημα Ο αριθμός των διαφορετικών διαδρομών (δηλαδή το ποσό του DNA που χρειαζόμαστε) αυξάνεται εκθετικά με τον αριθμό των κόμβων. Αλλά Αντιμετώπιση 70 κόμβοι 1025 Kg DNA 200 κόμβοι δεν αρκεί όλο το DNA της γης Αναπτύχθηκαν διαφορετικοί βιοαλγόριθμοι όπως πχ. αλγόριθμος που δημιουργεί σταδιακά μόνο τις διαδρομές από τον αρχικό προς τον τελικό κόμβο.

66 Ένα πρωτοποριακό πείραμα Συμπεράσματα A proof of Principle Experiment Σχεδιάστηκε για να αποδείξει την εφικτότητα της εκτέλεσης των DNA υπολογισμών και δεν ενδιέφερε η πρακτικότητα του.

67 Πλεονεκτήματα του DNA computing Μαζικά παράλληλη επεξεργασία: Η δυνατότητα εκτέλεσης ενός πολύ μεγάλου αριθμού υπολογισμών ταυτόχρονα. Κατάλληλη μέθοδος για την επίλυση ομάδων προβλημάτων τα οποία έχουν εκθετική χρονική πολυπλοκότητα (πχ. NP-complete problems). To DNA είναι εξαιρετικό αποθηκευτικό μέσο. Πολύ μεγάλη ελάττωση του όγκου των αποθηκευτικών μέσων στο μέλλον. Χαμηλή ενεργειακή κατανάλωση.

68 Πλεονεκτήματα του DNA computing Προϋποθέτει τη συνεργασία διαφορετικών επιστημονικών πεδίων (χημείας, μαθηματικών, βιολογίας, επιστήμης των υπολογιστών), με συνέπεια την προώθηση και ξεχωριστή ανάπτυξη του κάθε τομέα. Το DNA μπορεί κανείς να το προμηθευτεί πολύ εύκολα από τη φύση. Οι μικροεπεξεργαστές είναι κατασκευασμένοι από τοξικά για το περιβάλλον υλικά σε αντίθεση με το DNA που είναι φιλικό προς το περιβάλλον.

69 Περιορισμοί και δυσκολίες Η DNA υπολογιστική μέθοδος δεν είναι κατάλληλη για την υλοποίηση όλων των αλγορίθμων (κατάλληλη για συγκεκριμένες κατηγορίες προβλημάτων). Το κόστος εφαρμογής των βιοδιεργασιών, αν και συνεχώς μειώνεται, είναι ακόμη υψηλό. Τα πειράματα DNA in vitro, χρειάζονται χρόνο για την εκτέλεσή τους (ώρες ή μέρες). Το πείραμα του Adleman χρειάστηκε επτά ημέρες για να ολοκληρωθεί. Αυτό συμβαίνει γιατί μερικές βιοδιεργασίες είναι χρονοβόρες.

70 Περιορισμοί και δυσκολίες Τα πειράματα εκτελούνται σε δοκιμαστικούς σωλήνες, επομένως είναι απαραίτητη η ανθρώπινη παρέμβαση. Στα περισσότερα πειράματα χρησιμοποιούνται ολιγονουκλεοτίδια και εμφανίζονται λάθη κατά την εκτέλεση των βιοδιεργασιών. Τέτοια λάθη μπορεί να εμφανιστούν κατά τον υβριδισμό ή την PCR. Αυτό είναι το κύριο εμπόδιο που πρέπει να ξεπεραστεί ώστε τα DNA υπολογιστικά συστήματα να γίνουν αξιόπιστα. Έχουν προταθεί ιδιαίτερα αξιόλογες λύσεις για κάποιους από τους παραπάνω περιορισμούς.

71

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

Η ΑΛΗΘΙΝΗ ΚΑΙ Η ΕΙΚΟΝΙΚΗ ΜΙΚΡΟΣΥΣΤΟΙΧΙΑ ΒΗΜΑ ΠΡΟΣ ΒΗΜΑ

Η ΑΛΗΘΙΝΗ ΚΑΙ Η ΕΙΚΟΝΙΚΗ ΜΙΚΡΟΣΥΣΤΟΙΧΙΑ ΒΗΜΑ ΠΡΟΣ ΒΗΜΑ Η ΑΛΗΘΙΝΗ ΚΑΙ Η ΕΙΚΟΝΙΚΗ ΜΙΚΡΟΣΥΣΤΟΙΧΙΑ ΒΗΜΑ ΠΡΟΣ ΒΗΜΑ DNA μικροσυστοιχίες: βήμα προς βήμα Παραγωγή DNA ανιχνευτών Οι επιστήμονες μπορούν να παράγουν «σπιτικές» μικροσυστοιχίες χρησιμοποιώντας την αλυσιδωτή

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΣΥΓΓΡΑΦΗ): ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (Θα περιέχει ερωτήσεις θεωρίας µε απαντήσεις, ασκήσεις ανοικτούκλειστού τύπου µε

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ)

ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ) ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ) Ι) ΠΡΟΑΠΑΙΤΟΥΜΕΝΕΣ ΓΝΩΣΕΙΣ ΚΑΙ ΔΕΞΙΟΤΗΤΕΣ Οι μαθητές θα πρέπει : Να γνωρίζουν ποιο μόριο είναι ο φορέας της γενετικής

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Γενικά Στοιχεία Ηλεκτρονικού Υπολογιστή

Γενικά Στοιχεία Ηλεκτρονικού Υπολογιστή Γενικά Στοιχεία Ηλεκτρονικού Υπολογιστή 1. Ηλεκτρονικός Υπολογιστής Ο Ηλεκτρονικός Υπολογιστής είναι μια συσκευή, μεγάλη ή μικρή, που επεξεργάζεται δεδομένα και εκτελεί την εργασία του σύμφωνα με τα παρακάτω

Διαβάστε περισσότερα

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ε Ν Δ Ε Ι Κ Τ Ι Κ Ε Σ Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ

Διαβάστε περισσότερα

ΟΙΚΟΝΟΜΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΠΛΗΡΟΦΟΡΙΚΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΑΛΓΟΡΙΘΜΩΝ ΒΟΗΘΟΣ: ΒΑΓΓΕΛΗΣ ΔΟΥΡΟΣ

ΟΙΚΟΝΟΜΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΠΛΗΡΟΦΟΡΙΚΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΑΛΓΟΡΙΘΜΩΝ ΒΟΗΘΟΣ: ΒΑΓΓΕΛΗΣ ΔΟΥΡΟΣ ΟΙΚΟΝΟΜΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΠΛΗΡΟΦΟΡΙΚΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΑΛΓΟΡΙΘΜΩΝ ΒΟΗΘΟΣ: ΒΑΓΓΕΛΗΣ ΔΟΥΡΟΣ Φροντιστήριο #: Εύρεση Ελαχίστων Μονοπατιών σε Γραφήματα που Περιλαμβάνουν και Αρνητικά Βάρη: Αλγόριθμος

Διαβάστε περισσότερα

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ Μανδηλαρά Γεωργία Βιολόγος PhD, Επιστημονικός Συνεργάτης Εθνική Σχολή Δημόσιας Υγείας Τμήμα Μικροβιολογίας Υδατογενείς λοιμώξεις: χρήση νερού

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Θέματα Γονιδιωματικής, Πρωτεομικής και Βιοτεχνολογίας Γονιδιώματα

Θέματα Γονιδιωματικής, Πρωτεομικής και Βιοτεχνολογίας Γονιδιώματα Θέματα Γονιδιωματικής, Πρωτεομικής και Βιοτεχνολογίας Γονιδιώματα Το γονιδίωμα περιλαμβάνει τόσο τα γονίδια όσο και τις μη κωδικοποιούσες ακολουθίες DNA. Ο όρος προτάθηκε το 1920 από τον καθηγητή Hans

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ. Χημεία της ζωής 1

ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ. Χημεία της ζωής 1 ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημεία της ζωής 1 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ Η Βιολογία μπορεί να μελετηθεί μέσα από πολλά και διαφορετικά επίπεδα. Οι βιοχημικοί, για παράδειγμα, ενδιαφέρονται περισσότερο

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ Θέμα: ΜΕΤΟΥΣΙΩΣΗ ΠΡΩΤΕΪΝΩΝ (άσκηση 7 του εργαστηριακού οδηγού) Μέσος χρόνος πειράματος: 45 λεπτά Α. ΑΝΑΛΩΣΙΜΑ Εργαλεία

Διαβάστε περισσότερα

Εισαγωγή: ΑυτοοργΑνωση, AνΑδυση και ΠολυΠλοκοτητΑ κεφάλαιο 1: ΜοριΑκη BιολογιΑ και EΠιστηΜΕσ τησ ΠληροφοριΑσ

Εισαγωγή: ΑυτοοργΑνωση, AνΑδυση και ΠολυΠλοκοτητΑ κεφάλαιο 1: ΜοριΑκη BιολογιΑ και EΠιστηΜΕσ τησ ΠληροφοριΑσ Περιεχόμενα Περιεχόμενα Εισαγωγή: Αυτοοργάνωση, Aνάδυση και Πολυπλοκότητα... 15 Πώς μπορούν τα πράγματα να αυτοοργανώνονται;... 15 Προσπάθεια να δοθεί ένας προκαταρκτικός ορισμός της αυτοοργάνωσης...18

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα

Δυαδικό Σύστημα Αρίθμησης

Δυαδικό Σύστημα Αρίθμησης Δυαδικό Σύστημα Αρίθμησης Το δυαδικό σύστημα αρίθμησης χρησιμοποιεί δύο ψηφία. Το 0 και το 1. Τα ψηφία ενός αριθμού στο δυαδικό σύστημα αρίθμησης αντιστοιχίζονται σε δυνάμεις του 2. Μονάδες, δυάδες, τετράδες,

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

1. Πότε χρησιμοποιούμε την δομή επανάληψης; Ποιες είναι οι διάφορες εντολές (μορφές) της;

1. Πότε χρησιμοποιούμε την δομή επανάληψης; Ποιες είναι οι διάφορες εντολές (μορφές) της; 1. Πότε χρησιμοποιούμε την δομή επανάληψης; Ποιες είναι οι διάφορες (μορφές) της; Η δομή επανάληψης χρησιμοποιείται όταν μια σειρά εντολών πρέπει να εκτελεστεί σε ένα σύνολο περιπτώσεων, που έχουν κάτι

Διαβάστε περισσότερα

ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ

ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ Η συµβολή της µοριακής ανάλυσης Eλισάβετ Οικονοµάκη Βιολόγος Αιµοπαθολογοανατοµικό Εργαστήριο ΠΓΝΑ > ΜΟΡΙΑΚΕΣ ΜΕΘΟ ΟΙ (Μη µορφολογικές) Αλυσιδωτή Αντίδραση Πολυµεράσης

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ α) Αφού τα σωµατικά κύτταρα της γάτας έχουν 19 ζεύγη οµολόγων χρωµοσωµάτων, άρα περιέχουν 38 απλοειδή χρωµοσώµατα στην αρχή της Μεσόφασης (G 1 -φάση), πριν

Διαβάστε περισσότερα

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία της Δημόσιας Υγείας Α. Βανταράκης Εργαστήριο Υγιεινής, Ιατρική Σχολή,

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5)

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5) 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΑΠΑΝΤΗΣΕΙΣ Β: 1- Λάθος, 2- Σωστή, 3- Λάθος, 4- Σωστή, 5- Λάθος ΘΕΜΑ 2 o ΜΟΝΑ ΕΣ 15 (3Χ5) ΜΟΝΑ ΕΣ 10 (2Χ5) 1. Καρυότυπος είναι

Διαβάστε περισσότερα

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΕΝΟΤΗΤΑ: ΕΝΖΥΜΑ ΚΑΘΗΓΗΤΗΣ: ΠΑΤΗΡ ΑΝΑΣΤΑΣΙΟΣ ΙΣΑΑΚ 1. Να εξηγήσετε γιατί πολλές βιταμίνες, παρά τη μικρή συγκέντρωσή τους στον οργανισμό, είναι πολύ σημαντικές για

Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ:

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

ΟΜΑΔΑ Λ. Αναστασίου Κωνσταντίνος Δεληγιάννη Ισαβέλλα Ζωγοπούλου Άννα Κουκάκης Γιώργος Σταθάκη Αρετιάννα

ΟΜΑΔΑ Λ. Αναστασίου Κωνσταντίνος Δεληγιάννη Ισαβέλλα Ζωγοπούλου Άννα Κουκάκης Γιώργος Σταθάκη Αρετιάννα ΟΜΑΔΑ Λ Αναστασίου Κωνσταντίνος Δεληγιάννη Ισαβέλλα Ζωγοπούλου Άννα Κουκάκης Γιώργος Σταθάκη Αρετιάννα ΒΙΟΠΛΗΡΟΦΟΡΙΚΗ Τι είναι η βιοπληροφορική; Αποκαλείται ο επιστημονικός κλάδος ο οποίος προέκυψε από

Διαβάστε περισσότερα

DNA, οργάνωση και δομή του γενετικού υλικού

DNA, οργάνωση και δομή του γενετικού υλικού DNA, οργάνωση και δομή του γενετικού υλικού Κιούπη Βασιλική, εκπαιδευτικός κλ.πε04.04 Μια εκπαιδευτική δραστηριότητα βασισμένη σε εκθέματα του ιδρύματος Ευγενίδου Εισαγωγικός τομέας και προκαταρτική φάση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Οι απειλές. Απόρρητο επικοινωνίας. Αρχές ασφάλειας δεδομένων. Απόρρητο (privacy) Μέσω κρυπτογράφησης

Οι απειλές. Απόρρητο επικοινωνίας. Αρχές ασφάλειας δεδομένων. Απόρρητο (privacy) Μέσω κρυπτογράφησης Ιόνιο Πανεπιστήμιο Τμήμα Πληροφορικής στην Επιστήμη των Υπολογιστών 2014-015 Ασφάλεια Δεδομένων http://www.ionio.gr/~mistral/tp/csintro/ Οι απειλές Ένας κακόβουλος χρήστης Καταγράφει μηνύματα που ανταλλάσσονται

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

2 ΟΥ και 7 ΟΥ ΚΕΦΑΛΑΙΟΥ

2 ΟΥ και 7 ΟΥ ΚΕΦΑΛΑΙΟΥ ΑΝΑΠΤΥΞΗ ΕΦΑΡΜΟΓΩΝ ΣΕ ΠΡΟΓΡΑΜΜΑΤΙΣΤΙΚΟ ΠΕΡΙΒΑΛΛΟΝ ΕΠΙΜΕΛΕΙΑ: ΜΑΡΙΑ Σ. ΖΙΩΓΑ ΚΑΘΗΓΗΤΡΙΑ ΠΛΗΡΟΦΟΡΙΚΗΣ ΘΕΩΡΙΑ 2 ΟΥ και 7 ΟΥ ΚΕΦΑΛΑΙΟΥ ΒΑΣΙΚΕΣ ΕΝΝΟΙΕΣ ΑΛΓΟΡΙΘΜΩΝ και ΔΟΜΗ ΑΚΟΛΟΥΘΙΑΣ 2.1 Να δοθεί ο ορισμός

Διαβάστε περισσότερα

Νέα Οπτικά Μικροσκόπια

Νέα Οπτικά Μικροσκόπια Νέα Οπτικά Μικροσκόπια Αντίθεση εικόνας (contrast) Αντίθεση πλάτους Αντίθεση φάσης Αντίθεση εικόνας =100 x (Ι υποβ -Ι δειγμα )/ Ι υποβ Μικροσκοπία φθορισμού (Χρησιμοποιεί φθορίζουσες χρωστικές για το

Διαβάστε περισσότερα

7ο ΕΡΓΑΣΤΗΡΙΟ AAAABBBBAAAAABBBBBBCCCCCCCCCCCCCCBBABAAAABBBBBBCCCCD

7ο ΕΡΓΑΣΤΗΡΙΟ AAAABBBBAAAAABBBBBBCCCCCCCCCCCCCCBBABAAAABBBBBBCCCCD ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΛΑΜΙΑΣ ΤΜΗΜΑ ΠΛΗΡΟΦΟΡΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΥΠΟΛΟΓΙΣΤΩΝ ΣΧΕΔΙΑΣΜΟΣ ΚΑΙ ΑΝΑΛΥΣΗ ΑΛΓΟΡΙΘΜΩΝ ΑΚΑΔΗΜΑΪΚΟ ΕΤΟΣ 2010 11 Ιστοσελίδα μαθήματος: http://eclass.teilam.gr/di288 1 Συμπίεση

Διαβάστε περισσότερα

ΝΑΝΟΤΕΧΝΟΛΟΓΙΑ ΚΑΙ ΠΛΗΡΟΦΟΡΙΚΗ Τα τελευταία χρόνια τα οργανικά ηλεκτρονικά (ΟΗ) αποτελούν έναν από τους πιο ραγδαία αναπτυσσόμενους

ΝΑΝΟΤΕΧΝΟΛΟΓΙΑ ΚΑΙ ΠΛΗΡΟΦΟΡΙΚΗ Τα τελευταία χρόνια τα οργανικά ηλεκτρονικά (ΟΗ) αποτελούν έναν από τους πιο ραγδαία αναπτυσσόμενους ΤΙ ΑΚΡΙΒΩΣ ΕΊΝΑΙ Η ΝΑΝΟΤΕΧΝΟΛΟΓΙΑ ΚΑΙ Η ΝΑΝΟΕΠΙΣΤΗΜΕΣ Ως Νανοτεχνολογία ορίζεται η επιστήμη, η μηχανική και η τεχνολογία στην νανοκλίμακα, δηλαδή στην κλίμακα διαστάσεων από 1 έως 100nm. Με άλλα λόγια

Διαβάστε περισσότερα

Τμήμα Μηχανολόγων Μηχανικών Πανεπιστήμιο Θεσσαλίας ΠΡΟΓΡΑΜΜΑΤΙΣΜΟΣ Η/Υ. Βήματα προς τη δημιουργία εκτελέσιμου κώδικα

Τμήμα Μηχανολόγων Μηχανικών Πανεπιστήμιο Θεσσαλίας ΠΡΟΓΡΑΜΜΑΤΙΣΜΟΣ Η/Υ. Βήματα προς τη δημιουργία εκτελέσιμου κώδικα Τμήμα Μηχανολόγων Μηχανικών Πανεπιστήμιο Θεσσαλίας ΠΡΟΓΡΑΜΜΑΤΙΣΜΟΣ Η/Υ Βήματα προς τη δημιουργία εκτελέσιμου κώδικα Ιωάννης Λυχναρόπουλος Μαθηματικός, MSc, PhD Βήματα προς τη δημιουργία εκτελέσιμου κώδικα

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

1.5 Αλκένια - αιθένιο ή αιθυλένιο

1.5 Αλκένια - αιθένιο ή αιθυλένιο 19 1.5 Αλκένια - αιθένιο ή αιθυλένιο Γενικά Αλκένια ονομάζονται οι άκυκλοι ακόρεστοι υδρογονάνθρακες, οι οποίοι περιέχουν ένα διπλό δεσμό στο μόριο. O γενικός τύπος των αλκενίων είναι C ν Η 2ν (ν 2). Στον

Διαβάστε περισσότερα

Με τα sequence projects φτάσαμε στην εποχή που η ελάχιστη πληροφορία για να ξεκινήσει ένα πείραμα είναι ολόκληρη ακολουθία DNA του οργανισμού Το DNA

Με τα sequence projects φτάσαμε στην εποχή που η ελάχιστη πληροφορία για να ξεκινήσει ένα πείραμα είναι ολόκληρη ακολουθία DNA του οργανισμού Το DNA Microarrays Με τα sequence projects φτάσαμε στην εποχή που η ελάχιστη πληροφορία για να ξεκινήσει ένα πείραμα είναι ολόκληρη ακολουθία DNA του οργανισμού Το DNA όμως του οργανισμού είναι μια στατική πληροφορία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

ΣΗΜΕΙΩΣΕΙΣ ΓΡΑΦΙΣΤΙΚΗ ΜΕ Η/Υ 1. Του Αποστόλου Παπαποστόλου Επίκουρου Καθηγητή του ΤΕΙ Αθήνας

ΣΗΜΕΙΩΣΕΙΣ ΓΡΑΦΙΣΤΙΚΗ ΜΕ Η/Υ 1. Του Αποστόλου Παπαποστόλου Επίκουρου Καθηγητή του ΤΕΙ Αθήνας ΣΗΜΕΙΩΣΕΙΣ ΓΡΑΦΙΣΤΙΚΗ ΜΕ Η/Υ 1 Του Αποστόλου Παπαποστόλου Επίκουρου Καθηγητή του ΤΕΙ Αθήνας ΕΙΣΑΓΩΓΗ Οι γραφικές παραστάσεις µε υπολογιστές έχουν προχωρήσει πολύ από τότε που οι ε- πιστήµονες που δούλευαν

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 3ο ΤΥΧΑΙΟΙ ΑΡΙΘΜΟΙ ΕΛΕΓΧΟΣ ΤΥΧΑΙΟΤΗΤΑΣ

ΚΕΦΑΛΑΙΟ 3ο ΤΥΧΑΙΟΙ ΑΡΙΘΜΟΙ ΕΛΕΓΧΟΣ ΤΥΧΑΙΟΤΗΤΑΣ ΚΕΦΑΛΑΙΟ 3ο ΤΥΧΑΙΟΙ ΑΡΙΘΜΟΙ ΕΛΕΓΧΟΣ ΤΥΧΑΙΟΤΗΤΑΣ 3.1 Τυχαίοι αριθμοί Στην προσομοίωση διακριτών γεγονότων γίνεται χρήση ακολουθίας τυχαίων αριθμών στις περιπτώσεις που απαιτείται η δημιουργία στοχαστικών

Διαβάστε περισσότερα

ΑΞΟΝΙΚΗ ΤΟΜΟΓΡΑΦΙΑ. Ευάγγελος Παντελής Επ. Καθ. Ιατρικής Φυσικής Εργαστήριο Ιατρικής Φυσικής Ιατρική Σχολή Αθηνών

ΑΞΟΝΙΚΗ ΤΟΜΟΓΡΑΦΙΑ. Ευάγγελος Παντελής Επ. Καθ. Ιατρικής Φυσικής Εργαστήριο Ιατρικής Φυσικής Ιατρική Σχολή Αθηνών ΑΞΟΝΙΚΗ ΤΟΜΟΓΡΑΦΙΑ Ευάγγελος Παντελής Επ. Καθ. Ιατρικής Φυσικής Εργαστήριο Ιατρικής Φυσικής Ιατρική Σχολή Αθηνών ΙΑΤΡΙΚΗ ΦΥΣΙΚΗ Διαγνωστικές και θεραπευτικές εφαρμογές ακτινοβολιών : Κεφάλαιο 11 ΕΙΣΑΓΩΓΗ

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα

Βιοπληροφορική Ι. Παντελής Μπάγκος. Παν/µιο Στερεάς Ελλάδας

Βιοπληροφορική Ι. Παντελής Μπάγκος. Παν/µιο Στερεάς Ελλάδας Βιοπληροφορική Ι Παντελής Μπάγκος Παν/µιο Στερεάς Ελλάδας Λαµία 2006 1 Βιοπληροφορική Ι Εισαγωγή: Ορισµός της Βιοπληροφορικής, Υποδιαιρέσεις της Βιοπληροφορικής, Τα είδη των δεδοµένων στη Βιοπληροφορική.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

8.1 Θεωρητική εισαγωγή

8.1 Θεωρητική εισαγωγή ΨΗΦΙΑΚΑ ΚΥΚΛΩΜΑΤΑ - ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 8 ΣΤΟΙΧΕΙΑ ΜΝΗΜΗΣ ΚΑΤΑΧΩΡΗΤΕΣ Σκοπός: Η µελέτη της λειτουργίας των καταχωρητών. Θα υλοποιηθεί ένας απλός στατικός καταχωρητής 4-bit µε Flip-Flop τύπου D και θα µελετηθεί

Διαβάστε περισσότερα

Εισαγωγή στην επιστήμη της Πληροφορικής και των. Aσφάλεια

Εισαγωγή στην επιστήμη της Πληροφορικής και των. Aσφάλεια Εισαγωγή στην επιστήμη της Πληροφορικής και των Τηλεπικοινωνιών Aσφάλεια Περιεχόμενα Πλευρές Ασφάλειας Ιδιωτικό Απόρρητο Μέθοδος Μυστικού Κλειδιού (Συμμετρική Κρυπτογράφηση) Μέθοδος Δημόσιου Κλειδιού (Ασύμμετρη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ο ρόλος των αλγορίθμων στις υπολογιστικές διαδικασίες Παύλος Εφραιμίδης Δομές Δεδομένων και Αλγόριθμοι

ο ρόλος των αλγορίθμων στις υπολογιστικές διαδικασίες Παύλος Εφραιμίδης Δομές Δεδομένων και Αλγόριθμοι Παύλος Εφραιμίδης 1 περιεχόμενα αλγόριθμοι τεχνολογία αλγορίθμων 2 αλγόριθμοι αλγόριθμος: οποιαδήποτε καλά ορισμένη υπολογιστική διαδικασία που δέχεται κάποια τιμή ή κάποιο σύνολο τιμών, και δίνεικάποιατιμήήκάποιοσύνολοτιμώνως

Διαβάστε περισσότερα

Εργαλεία & Υλικά Διαλύματα Χρωστικές

Εργαλεία & Υλικά Διαλύματα Χρωστικές Ενότητα Ροή γενετικής πληροφορίας Φύλλο εργασίας 2 Απομόνωση νουκλεϊκών οξέων από φυτικά κύτταρα Βιολογία Γ Γυμνασίου Ονοματεπώνυμο Τμήμα Ημερομηνία. Τα νουκλεϊκά οξέα, όπως και οι πρωτεΐνες, είναι μακρομοριακές

Διαβάστε περισσότερα

ΕΝΤΟΝΑ ΗΛΙΑΚΑ ΦΑΙΝΟΜΕΝΑ

ΕΝΤΟΝΑ ΗΛΙΑΚΑ ΦΑΙΝΟΜΕΝΑ ΕΝΤΟΝΑ ΗΛΙΑΚΑ ΦΑΙΝΟΜΕΝΑ Διαστημικός καιρός. Αποτελεί το σύνολο της ηλιακής δραστηριότητας (ηλιακός άνεμος, κηλίδες, καταιγίδες, εκλάμψεις, προεξοχές, στεμματικές εκτινάξεις ηλιακής μάζας) που επηρεάζει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο)

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) 1 ΦΟΡΕΙΣ πλασµίδια βακτηρίων βακτηριοφάγοι ιοί συνδυασµός πλασµιδίου βακτηριοφάγου (κοσµίδια) 2 ΦΟΡΕΙΣ Βακτηριοφάγοι Χαρακτηριστικά

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

Υπερπροσαρμογή (Overfitting) (1)

Υπερπροσαρμογή (Overfitting) (1) Αλγόριθμος C4.5 Αποφυγή υπερπροσαρμογής (overfitting) Reduced error pruning Rule post-pruning Χειρισμός χαρακτηριστικών συνεχών τιμών Επιλογή κατάλληλης μετρικής για την επιλογή των χαρακτηριστικών διάσπασης

Διαβάστε περισσότερα

ΕΠΛ 003.3: ΕΠΙΣΤΗΜΗ ΤΗΣ ΠΛΗΡΟΦΟΡΙΚΗΣ ΚΑΙ ΠΛΗΡΟΦΟΡΙΑΚΑ ΣΥΣΤΗΜΑΤΑ. Για οικονομολόγους

ΕΠΛ 003.3: ΕΠΙΣΤΗΜΗ ΤΗΣ ΠΛΗΡΟΦΟΡΙΚΗΣ ΚΑΙ ΠΛΗΡΟΦΟΡΙΑΚΑ ΣΥΣΤΗΜΑΤΑ. Για οικονομολόγους ΕΠΛ 003.3: ΕΠΙΣΤΗΜΗ ΤΗΣ ΠΛΗΡΟΦΟΡΙΚΗΣ ΚΑΙ ΠΛΗΡΟΦΟΡΙΑΚΑ ΣΥΣΤΗΜΑΤΑ Για οικονομολόγους Στόχοι 1 Να εξετάσουμε γιατί η Πληροφορική είναι χρήσιμη στην οικονομική επιστήμη. Να μάθουμε πώς χρησιμοποιείται η Πληροφορική

Διαβάστε περισσότερα

Αλγόριθμοι και Πολυπλοκότητα

Αλγόριθμοι και Πολυπλοκότητα Αλγόριθμοι και Πολυπλοκότητα Ροή Δικτύου Δημήτρης Μιχαήλ Τμήμα Πληροφορικής και Τηλεματικής Χαροκόπειο Πανεπιστήμιο Μοντελοποίηση Δικτύων Μεταφοράς Τα γραφήματα χρησιμοποιούνται συχνά για την μοντελοποίηση

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

TFT TV. Τι είναι οι TFT και πως λειτουργούν;

TFT TV. Τι είναι οι TFT και πως λειτουργούν; TFT TV Τι είναι οι TFT και πως λειτουργούν; Η ετυμολογία του όρου TFT (Thin Film Transistor ή τρανζίστορ λεπτού φιλμ) μας παραπέμπει στο δομικό στοιχείο ελέγχου της οθόνης, που είναι το τρανζίστορ. Οι

Διαβάστε περισσότερα

ΤΟ ΙΝΤΕΡΝΕΤ ΚΩΣΤΗΣ ΚΙΤΣΟΠΟΥΛΟΣ Α 2

ΤΟ ΙΝΤΕΡΝΕΤ ΚΩΣΤΗΣ ΚΙΤΣΟΠΟΥΛΟΣ Α 2 ΤΟ ΙΝΤΕΡΝΕΤ ΚΩΣΤΗΣ ΚΙΤΣΟΠΟΥΛΟΣ Α 2 ΤΙ ΕΙΝΑΙ ΤΟ INTERNET Το Internet είναι ένα πλέγμα από εκατομμύρια διασυνδεδεμένους υπολογιστές που εκτείνεται σχεδόν σε κάθε γωνιά του πλανήτη και παρέχει τις υπηρεσίες

Διαβάστε περισσότερα

ΗΜΥ 210: Σχεδιασμός Ψηφιακών Συστημάτων. Μετρητές 1

ΗΜΥ 210: Σχεδιασμός Ψηφιακών Συστημάτων. Μετρητές 1 ΗΜΥ-210: Σχεδιασμός Ψηφιακών Συστημάτων Μετρητές Διδάσκουσα: Μαρία Κ. Μιχαήλ Πανεπιστήμιο Κύπρου Τμήμα Ηλεκτρολόγων Μηχανικών και Μηχανικών Υπολογιστών Περίληψη Μετρητής Ριπής Σύγχρονος υαδικός Μετρητής

Διαβάστε περισσότερα

Το «κλειστό» σύστημα. Ανοικτές επικοινωνίες... Εισαγωγή στην Τεχνολογία της Πληροφορικής. Εισαγωγή στην τεχνολογία της πληροφορικής

Το «κλειστό» σύστημα. Ανοικτές επικοινωνίες... Εισαγωγή στην Τεχνολογία της Πληροφορικής. Εισαγωγή στην τεχνολογία της πληροφορικής ΕΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ Εισαγωγή στην Τεχνολογία της Πληροφορικής ΓΙΩΡΓΟΣ Ν. ΓΙΑΝΝΟΠΟΥΛΟΣ Λέκτορας στο Πανεπιστήμιο Αθηνών gyannop@law.uoa.gr Το «κλειστό» σύστημα ΕΙΣΟΔΟΣ ΕΠΕΞΕΡΓΑΣΙΑ

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 18. 18 Μηχανική Μάθηση

ΚΕΦΑΛΑΙΟ 18. 18 Μηχανική Μάθηση ΚΕΦΑΛΑΙΟ 18 18 Μηχανική Μάθηση Ένα φυσικό ή τεχνητό σύστηµα επεξεργασίας πληροφορίας συµπεριλαµβανοµένων εκείνων µε δυνατότητες αντίληψης, µάθησης, συλλογισµού, λήψης απόφασης, επικοινωνίας και δράσης

Διαβάστε περισσότερα

Σχετικά με το μάθημα. Ο Υπολογιστής Η γενική εικόνα. Η μνήμη. Ενότητες μαθήματος. Εισαγωγή στους Υπολογιστές. Βιβλία για το μάθημα

Σχετικά με το μάθημα. Ο Υπολογιστής Η γενική εικόνα. Η μνήμη. Ενότητες μαθήματος. Εισαγωγή στους Υπολογιστές. Βιβλία για το μάθημα Ιόνιο Πανεπιστήμιο Τμήμα Πληροφορικής Εισαγωγή στην Επιστήμη των Υπολογιστών 2014-15 Εισαγωγή στους Υπολογιστές (αρχές λειτουργίας και τεχνολογία) Σχετικά με το μάθημα Ενότητες μαθήματος Αρχές λειτουργίας

Διαβάστε περισσότερα

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr Παρουσιάσεις μαθήματος http://users.auth.gr/~palexios/

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. H β- θαλασσαιμία είναι

Διαβάστε περισσότερα

Πώς μπορούμε να δημιουργούμε γεωμετρικά σχέδια με τη Logo;

Πώς μπορούμε να δημιουργούμε γεωμετρικά σχέδια με τη Logo; Κεφάλαιο 2 Εισαγωγή Πώς μπορούμε να δημιουργούμε γεωμετρικά σχέδια με τη Logo; Η Logo είναι μία από τις πολλές γλώσσες προγραμματισμού. Κάθε γλώσσα προγραμματισμού έχει σκοπό τη δημιουργία προγραμμάτων

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαια 12 &13: Φασματοσκοπία μαζών και υπερύθρου

Οργανική Χημεία. Κεφάλαια 12 &13: Φασματοσκοπία μαζών και υπερύθρου Οργανική Χημεία Κεφάλαια 12 &13: Φασματοσκοπία μαζών και υπερύθρου 1. Γενικά Δυνατότητα προσδιορισμού δομών με σαφήνεια χρησιμοποιώντας τεχνικές φασματοσκοπίας Φασματοσκοπία μαζών Μέγεθος, μοριακός τύπος

Διαβάστε περισσότερα

ΠΕΡΙΕΧΟΜΕΝΑ. Πρόλογος...9 ΚΕΦ. 1. ΑΡΙΘΜΗΤΙΚΑ ΣΥΣΤΗΜΑΤΑ - ΚΩΔΙΚΕΣ

ΠΕΡΙΕΧΟΜΕΝΑ. Πρόλογος...9 ΚΕΦ. 1. ΑΡΙΘΜΗΤΙΚΑ ΣΥΣΤΗΜΑΤΑ - ΚΩΔΙΚΕΣ ΠΕΡΙΕΧΟΜΕΝΑ Πρόλογος...9 ΚΕΦ. 1. ΑΡΙΘΜΗΤΙΚΑ ΣΥΣΤΗΜΑΤΑ - ΚΩΔΙΚΕΣ 1.1 Εισαγωγή...11 1.2 Τα κύρια αριθμητικά Συστήματα...12 1.3 Μετατροπή αριθμών μεταξύ των αριθμητικών συστημάτων...13 1.3.1 Μετατροπή ακέραιων

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

ΕΣΩΤΕΡΙΚΗ ΕΝΕΡΓΕΙΑ Μηχανική ενέργεια Εσωτερική ενέργεια:

ΕΣΩΤΕΡΙΚΗ ΕΝΕΡΓΕΙΑ Μηχανική ενέργεια Εσωτερική ενέργεια: ΕΣΩΤΕΡΙΚΗ ΕΝΕΡΓΕΙΑ Μηχανική ενέργεια (όπως ορίζεται στη μελέτη της μηχανικής τέτοιων σωμάτων): Η ενέργεια που οφείλεται σε αλληλεπιδράσεις και κινήσεις ολόκληρου του μακροσκοπικού σώματος, όπως η μετατόπιση

Διαβάστε περισσότερα

ΤΙ ΕΙΝΑΙ Ο ΥΠΟΛΟΓΙΣΤΗΣ

ΤΙ ΕΙΝΑΙ Ο ΥΠΟΛΟΓΙΣΤΗΣ ΤΙ ΕΙΝΑΙ Ο ΥΠΟΛΟΓΙΣΤΗΣ Ο όρος είναι συντομογραφία του όρου «Αυτόματος, Ηλεκτρονικός Ψηφιακός Υπολογιστής Γενικού Σκοπού» [1]. Αυτόματος Μετά την έναρξη της λειτουργίας του εργάζεται μόνος του εκτελώντας

Διαβάστε περισσότερα

ΤΕΣΤ 30 ΕΡΩΤΗΣΕΩΝ ΓΝΩΣΤΙΚΟΥ ΧΗΜΕΙΑΣ

ΤΕΣΤ 30 ΕΡΩΤΗΣΕΩΝ ΓΝΩΣΤΙΚΟΥ ΧΗΜΕΙΑΣ ΤΕΣΤ 30 ΕΡΩΤΗΣΕΩΝ ΓΝΩΣΤΙΚΟΥ ΧΗΜΕΙΑΣ ο αριθμός Avogadro, N A, L = 6,022 10 23 mol -1 η σταθερά Faraday, F = 96 487 C mol -1 σταθερά αερίων R = 8,314 510 (70) J K -1 mol -1 = 0,082 L atm mol -1 K -1 μοριακός

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Οι ιδιότητες των αερίων και καταστατικές εξισώσεις. Θεόδωρος Λαζαρίδης Σημειώσεις για τις παραδόσεις του μαθήματος Φυσικοχημεία Ι

Οι ιδιότητες των αερίων και καταστατικές εξισώσεις. Θεόδωρος Λαζαρίδης Σημειώσεις για τις παραδόσεις του μαθήματος Φυσικοχημεία Ι Οι ιδιότητες των αερίων και καταστατικές εξισώσεις Θεόδωρος Λαζαρίδης Σημειώσεις για τις παραδόσεις του μαθήματος Φυσικοχημεία Ι Τι είναι αέριο; Λέμε ότι μία ουσία βρίσκεται στην αέρια κατάσταση όταν αυθόρμητα

Διαβάστε περισσότερα