Association study of Calpain-10 gene polymorphisms and essential hypertension *

19 10 Vol. 19 No. 10 2009 5 China Journal of Modern Medicine May 2009 1005-8982 2009 10-1479- 05-10 * 41 0006-10 SNPs PCR - R FLP - 10 SNP- 43 SNP- 19 SNP- 63 SNP - 43G/ G SNP- 63 C C- 111/ 121-10 SNP- 43 SNP- 19 SNP- 63-10 SNP R 544.1 A Association study of Calpain-10 gene polymorphisms and essential hypertension * ZHAO Hong, FU Xiaohua, YUAN Shishan, ZHANG Na, ZHANG Yong, LV Yuan, HE Quanfeng, ZHANG Jing (College of Medicine, Hunan Normal University, Changsha, Hunan 410006, P.R.China) Abstract: Objective The aim of this study was to analyze the association of calpain-10 gene single nucleotide polymorphisms (SNPs) with essential hypertension and the related traits in sample in Changsha region. Methods The SNP-43, SNP-19 and SNP-63 of calpain-10 gene were genotyped by using PCR-RFLP. Results The SNPs and their major haplotype combinations were not significantly associated with essential hypertension. However, SNP- 43 G/G haplotype was associated with lower values of total-cholesterol and the C allele of SNP-63 was associated with higher values of C-peptide in normal controls. In addition, haplotype combination 111/121 was associated with higher values of fasting glucose in study cases and lower values of LDL- cholesterol in normal controls. Conclusions SNP-43, SNP-19, SNP-63 and their major haplotype combinations of calpain-10 gene may not play a major role in the genetic susceptibility to essential hypertension in population of Changsha region, but may involve in fat and glucose metabolisms and influence insulin sensitivity. Key words: calpain-10 gene; essential hypertension; single-nucleotide polymorphism (SNP); insulin sensitivity - 10 [1~5] - 10-10 SNP- 43 SNP- 19 SNP- 63 2008-12- 10 * 2004CCA003AA- 1 03JJY6010 [ ] Email fuxh1@126.com 1479

19 1 27 26 36~72 54 1.1 40 BMI WHR 1999 C- A1c 16 24 41~71 56 mmol/l pmol/l 53 /22.5 1 1 t P <0.001 2 t P <0.001 1 BMI / kg/m 2 WHR mmol/l C- pmol/l ng/ml % n =40 55.8±14.9 16/24 24.5±3.4 0.86±0.07 5.5±1.3 41.3±30.8 1.9±0.9 7.4±1.7 1.47±1.14 n =53 54.3±18.1 27/26 22.9±4.1 0.85±0.08 5.2±1.3 35.8±24.0 1.7±0.7 7.0±1.5 1.23±0.88 1 mmhg 1 mmhg 2 mmol/l mmol/l mmol/l mmol/l n =40 150±15 97±16 5.0±1.0 1.7±1.2 1.4±0.4 2.8±0.8 0.76±0.54 n =53 110±15 73±10 4.6±1.0 1.3±1.1 1.5±0.3 2.6±0.9 0.58±0.48 1.2 1.2.1 DNA 5'- GCTGGCTGGTGACATCAGTGC- 3' 5'- AC 2 ml CAAGTCAAGGCTTAGCCTCACCTTCATA- 3' - DNA PCR PCR DNA 1.2.2 PCR SNP- 19 CAPN10- g. 7920inde l32 bp 5'- GTTTG- GTTCTCTTCAGCGTGGAG- 3' 5'- CATGAACC- 1 32 bp CTGGCAGGGTCTAAG- 3' 155 bp 2 32 3 PCR 25μL DNA 187 bp 1 150 ng 10 mmol/ltris- HCL ph8.3 50 mmol/l KCL SNP- 63 PCR 6 IU HhaI 2.5 mmol/l MgCl 2 200μl/L dntp 400 NEB 37 SNP- 63 PCR pmol/l 1.25 IUTaq PCR 1 C 162 bp 30 bp 94 12 min 94 30 s 60 30 s 72 30 s 35, 72 10 min SNP- 63 CAPN10- g.16378c/t, 5'- AAGGGGGGCCAGGGCCTGACGGGGGTGG CG- 3' 5'- AGCACTCCCAGCTCCTGATC- 3' SNP- 43 PCR 10 IU NdeI PCR NEB 37 3% SNP- 19 PCR 94 12, min 94 30 s 62 30 s 72 30 s 35, 1 G 2 A 238 72 10 min 1480 SNP- 43 CAPN10- g.4852g/a SNP- 63 1.2.3 SNP- 19 PCR 3% DNA 2 T 192 bp DNA 3% 2 bp 208 bp DNA 3

10-10 1 20 bp DNA Marker 2 5 2/2 3 1/1 4 6 1/2 1 SNP- 19 1.3 SPSS 13.0 ± x±s t χ 2 Hardy- Weinberg χ 2 ANOVA LSD P 0.05 7 50 bp DNA Marker 1 3 6 C/C 2 4 T/T 5 C/T 2 SNP- 63 P =0.013 6 50 bp DNA Marker 1 4 G/A 2 3 5 G/G SNP- 19 3 SNP- 43 2 % 3 2 2.1 Hardy- Weinberg 2 3 111/121 111/122 121/121 10.0% 12.5% 32.5% 22.6% 17.0% 30.2% 3 2.2 SNP- 43 3 G/G G/A SNP- 43 SNP- 43 SNP- 19 SNP- 19SNP- 63 SNP- 63 GG GA+AA G A 1/1 1/2 2/2 1 2 C/C C/T T/T C T 77.5 22.5 88.8 11.2 10.0 35.0 55.0 27.5 72.5 60.0 30.0 10.0 75.0 25.0 88.7 11.3 94.3 5.7 5.7 52.8 41.5 32.1 67.9 64.2 28.3 7.5 78.3 21.7 P BMI kg/m 2 WHR 0.147 0.166 0.202 0.501 0.852 0.597 C- SNP- 43 (mmhg) (mmhg) mmol/l (mmol/l (mmol/l) (mmol/l) (mmol/l) GG 31 24.6±3.2 0.86±0.08 5.4±0.6 40.5±30.4 1.9±0.8 7.6±1.7 1.42±1.13 148±13 96±14 4.9±0.9 1.6±1.1 1.4±0.4 2.8±0.8 0.73±0.49 GA+AA 9 24.1±4.1 0.86±0.05 5.7±2.6 44.8±34.6 1.9±1.2 6.7±1.5 1.69±1.28 156±19 101±24 5.1±1.3 1.9±1.6 1.3±0.3 2.9±1.1 0.85±0.73 P NS NS NS NS NS NS NS NS NS NS NS NS NS NS GG 47 23.0±4.3 0.85±0.08 5.3±1.4 37.4±24.7 1.8±0.7 7.1±1.5 1.30±0.91 109±15 72±10 4.4±1.0 1.2±1.1 1.4±0.3 2.5±0.9 0.57±0.50 GA+AA 6 22.5±2.4 0.86±0.08 4.4±0.5 22.7±9.8 1.3±0.3 6.7±1.2 0.64±0.23 115±17 75±10 5.6±0.4 1.5±0.6 1.5±0.5 3.2±0.5 0.66±0.29 P NS NS NS NS NS NS NS NS NS 0.013 NS NS NS NS NS 1481

19 SNP- 63 4 111/122 121/121 C/C T/T C- P =0.020 P =0.044 4 SNP- 63 0.044 ANOVA LSD CC TT P =0.044 NS 111/121 111/122 4 5 BMI kg/m 2 WHR 5 3 C- (mmhg) (mmhg) mmol/l (mmol/l(mmol/l) (mmol/l) (mmol/l) 121/121 13 23.9±2.8 0.87±0.07 5.3±0.5 38.2±26.3 1.8±0.5 8.0±1.7 1.31±0.89 148±11 95±9 5.0±0.9 1.6±1.0 1.6±0.4 2.7±0.7 0.74±0.46 P NS NS 0.020 a NS NS NS NS NS NS NS NS NS NS NS 111/121 111/122 3 P =0.007 BMI kg/m 2 WHR CC CT C- 24 24.6±3.5 0.87±0.06 5.7±1.6 42.3±27.7 2.1±0.8 7.6±1.6 1.54±0.99 148±16 95±16 5.0±1.0 1.8±1.2 12 23.9±3.3 0.86±0.09 5.3±0.5 42.0±40.8 1.5±0.8 7.3±1.8 1.49±1.57 151±16 97±18 4.9±0.9 1.8±1.3 26.6±3.5 0.88±0.08 6.3±0.7 44.3±25.3 2.9±0.9 7.8±1.2 1.74±0.89 135±6 89±6 5.2±1.0 1.7±0.3 26.2±3.8 0.87±0.07 5.4±0.4 55.8±59.6 1.8±1.2 7.5±2.1 2.00±2.30 156±21104±26 4.7±1.1 1.9±0.8 12 23.0±3.9 0.88±0.08 5.4±0.9 41.8±23.2 1.9±0.4 7.3±1.2 1.44±0.69 107±13 71±9 4.0±1.1 1.5±2.1 9 22.3±4.1 0.86±0.09 4.8±0.6 33.7±18.6 1.3±0.5 6.7±1.2 1.07±0.64 117±12 75±9 4.5±0.8 1.5±0.5 5 111/121 111/121 121/121 (mmhg) (mmhg) mmol/l (mmol/l (mmol/l) (mmol/l) (mmol/l) TT 4 25.6±3.6 0.82±0.02 4.8±0.4 33.2±20.9 1.5±1.0 6.0±0.9 1.02±0.66 157±4 108±14 4.4±0.9 0.6±0.1 1.3±0.2 2.8±1.0 0.30±0.05 P NS VS NS NS NS NS NS NS NS NS NS NS NS NS CC CT 34 22.8±3.7 0.86±0.07 5.4±1.6 40.2±26.6 1.9±0.7 7.1±1.6 1.42±0.98 108±15 73±10 4.6±1.2 1.3±1.3 15 23.2±5.5 0.84±0.09 4.8±0.5 31.4±16.6 1.5±0.5 6.9±1.2 1.00±0.57 114±13 74±9 4.5±0.9 1.2±0.6 1.5±0.4 1.4±0.3 1.4±0.3 1.5±0.5 TT 4 23.3±0.6 0.78±0.07 5.1±0.8 16.2±1.6 1.2±0.5 7.0±1.4 0.53±0.12 102±14 68±10 4.5±0.4 1.1±0.3 1.5±0.2 2.4±0.4 0.50±0.13 P NS VS NS NS 0.044 NS NS NS NS NS NS NS NS NS 1.4±0.4 1.2±0.2 1.3±0.2 1.3±0.3 2.8±0.9 2.9±0.8 2.6±1.0 2.5±0.8 3.1±0.9 2.6±1.1 2.0±0.7 2.5±0.7 121/121 16 22.4±4.4 0.84±0.06 5.7±2.1 43.0±32.0 2.0±0.9 7.0±2.0 1.59±1.23 107±17 73±11 4.9±1.1 1.1±0.5 1.5±0.3 3.0±1.0 0.52±0.20 P NS NS NS NS NS NS NS NS NS NS NS NS 0.024 b NS 0.81±0.53 0.81±0.60 0.61±0.57 0.54±0.28 0.76±0.13 0.86±0.36 0.68±0.93 0.66±0.23 0.020 a ANOVA LSD 111/121 111/122 P =0.022 111/121 121/121 P =0.007 0.024 b ANOVA LSD 111/121 121/121 P =0.007 NS 3 BAIER - 10 [7] - 10 SNP- 43 SNP- 43 SNP- 19 SNP- 63 G - 10 mrna - 10 LOPEZ- ORDUNA [8] 2 [6] SNP- 43 G - 10 SNP- 43G/G - 10 mrna SNP- 43 G 111/121 1482

10-10 [1] SOWERS JR. Insulin resistance and hypertension[j]. Am J Phys- iol Heart Circ Physiol, 2004, 286(5): H1597-1602. HORIKAWA [9] [4] SONI AM, PINGITORE A, GHIONE S, et al. Early hyperten- insulin resistance, epicardial, and visceral fat[j]. Hypertension, 2008, 51-10 SNP- 43 SNP- 19 SNP- 63 112/121 2 KANG [J]. Lancet, 2007, 370(9587): 591-603. [10] 111/121 2 KANG [11] 2 sion is associated with reduced regional cardiac function, 111/121 (2): 282-288. 2 [12 13] - 10 Chinese Journal of Medicine, 2002, 41(6): 370-373. SNP - 43 G/G 111/121 ORHO- MELANDER [14] SNP- 43 G/G CARLSSON [15] Biochem Biophys Res Commun, 2007, 358(3): 831-836. SNP- 43 G/G WU [16] 112/121 mellitus[j]. Nat Genet, 2000, 26(2): 163-175. - 10 Hum Genet, 2006, 51(7): 629-633. SNP- 63C/C T/T C- C/C 73(3): 268-275. SNP- 63C/C T/T C- C- - 10 2006, 89(4): 360-367. 51(8): 2658-2664. - 10 SNP- 43 SNP- 19 SNP- 63 expression in obese Swedish subjects [J]. Metab, 2004, 89(7): 3601-3605. 1483 [2] REAVEN GM. Insulin resistance, the insulin resistance syndrome, and cardiovascular disease[j]. Panminerva Med,2005,47(4):201-210. [3] MESSERLI FH, WILLIAMS B, RITZ E. Essential hypertension [5] ZHANG Y, RONG J. Relationship of hemorheology changes, insulin resistance and macroangiopaothy in type 2 diabetes[j]. China Journal of Modern Medicine, 2008, 18(14): 2039-2045. Chinese [6] HONG J, LI GW, LI CM, et al. Relationship between calpain- 10 gene polymorphism, hypertension and plasma glucose[j]. [7] BAIER LJ, PERMANA PA, YANG X, et al. A calpain- 10 gene polymorphism is associated with reduced muscle mrna levels and insulin resistance[j]. J Clin Invest, 2000, 106(7): R69-73. [8] LOPEZ- ORDUNA E, GARCíA- MENA J, GARCíA- MACEDO R, et al. CAPN10 mrna splicing and decay is not affected by a SNP associated with susceptibility to type 2 diabetes [J]. [9] HORIKAWA Y, ODA N, COX NJ, et al. Genetic variation in the gene encoding calpain- 10 is associated with type 2 diabetes [10] KANG ES, KIM HJ, NAM M, et al. A novel 111/121 diplotype in the Calpain- 10 gene is associated with type 2 diabetes[j]. J [11] KANG ES, NAM M, KIM HJ, et al. Haplotype combination of Calpain- 10 gene polymorphism is associated with metabolic syndrome in type 2 diabetes[j]. Diabetes Res Clin Pract, 2006, [12] HEGELE RA, HARRIS SB, ZINMAN B, et al. Absence of association of type 2 diabetes with CAPN10 and PC- 1 polymorphisms in Oji- Cree[J]. Diabetes Care, 2001, 24(8): 1498-1499. [13] JENSEN DP, URHAMMER SA, EIBERG H, et al.variation in CAPN10 in relation to type 2 diabetes, obesity and quantitative metabolic traits: studies in 6018 whites [J]. Mol Genet Metab, [14] ORHO- MELANDER M, KLANNEMARK M, SVENSSON MK, et al. Variants in the calpain- 10 gene predispose to insulin resistance and elevated free fatty acid levels[j]. Diabetes, 2002, [15] CARLSSON E, FREDRIKSSON J, GROOP L, et al. Variation in the calpain- 10 gene is associated with elevated triglyceride levels and reduced adipose tissue messenger ribonucleic acid J Clin Endocrinol [16] WU B, TAKAHASHI J, FU M, et al. Variants of calpain- 10 gene and its association with type 2 diabetes mellitus in a Chinese population[j]. Diabetes Res Clin Pract,2005,68(2): 155-161.