Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει:"

Transcript

1 Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει: Με ποια πειράµατα οι επιστήµονες κατέληξαν στο συµπέρασµα ότι το DNA είναι το γενετικό υλικό του κυττάρου. Ποιες οι διαφορές RNA και DNA. Τη δοµή ενός δεοξυριβονουκλεοτιδίου και ενός ριβονουκλεοτιδίου. Τι δοµή της δίκλωνης αλυσίδας του DNA και του RNA. Τα δεδοµένα που επέτρεψαν τον προσδιορισµό της δοµής του DNA στο χώρο. Τα χαρακτηριστικά του µοντέλου της διπλής έλικας. Που συναντάµε, ποια η δοµή και ποια η φυσιολογική λειτουργία των πλασµιδίων. Γιατί και πώς το γενετικό υλικό του ανθρώπου πακετάρεται στον πυρήνα. Τις διαφορές και τις οµοιότητες µιτοχονδρίων και χλωροπλαστών.

2 10. Μαθαίνουµε τη θεωρία - Λέξεις κλειδιά Βήµα 1 ο ÂÞìá 1 Μαθαίνουµε τη θεωρία - Λέξεις κλειδιά Θεωρία 1 Γιατί παλαιότερα εθεωρούντο οι πρωτεΐνες φορείς των γενετικών πληροφοριών; Απάντηση: Οι επιστήµονες πίστευαν ότι τα µόρια που µεταφέρουν τη γενετική πληροφορία είναι οι πρωτεΐνες, που παρουσιάζουν µεγαλύτερη ποικιλοµορφία, επειδή είναι αποτέλεσµα συνδυασµού 20 διαφορετικών αµινοξέων, ενώ τα νουκλεϊκά οξέα είναι αποτέλεσµα συνδυασµού 4 µόνο νουκλεοτιδίων. Θεωρία 2 Ποια πειράµατα είχαν αποφασιστική συµβολή στο να αποδειχθεί ότι το DNA είναι το γενετικό υλικό; Απάντηση: Μια από τις πρώτες µελέτες που οδήγησε στην ταυτοποίηση του DNA ως γενετικό υλικό έγινε από τον Griffith (1928). Ο Griffith χρησιµοποίησε 2 στελέχη του βακτηρίου Diplococcus pneumoniae (πνευµονιόκκος). Το πρώτο, ονοµάζεται λείο γιατί έχει µια κάψα που περιβάλλει το κύτταρο και το προστατεύει µέσα στον ξενιστή, ενώ το δεύτερο αδρό γιατί δεν έχει την κάψα και δεν είναι λοιµογόνο. Ο Griffith στα πειράµατα του σκότωσε µε θέρµανση τα λεία βακτήρια και µε αυτά µόλυνε ποντίκι, το οποίο παρέµεινε ζωντανό. Όταν όµως µόλυνε το ποντίκι µε ζωντανά αδρά βακτήρια και νεκρά λεία τότε το ποντίκι πέθανε και στο αίµα του βρέθηκαν πολλά λεία βακτήρια. Ο Griffith συµπέρανε ότι µερικά αδρά βακτήρια µετασχηµατίστηκαν σε λεία λοιµογόνα µετά από αλληλεπίδραση µε τα νεκρά λεία βακτήρια. Υπέθεσε ότι ο παράγοντας µετασχηµατισµού είναι κάποιο µόριο των νεκρών βακτηρίων που είναι υπεύθυνο για την αλλαγή του γενετικού υλικού των αδρών βακτηρίων, αλλά δεν κατάφερε να εξηγήσει πως από τα νεκρά λεία βακτήρια δηµιουργήθηκαν ζωντανά λεία και που ακριβώς οφειλόταν αυτή η αλλαγή. Το 1944 οι T. Avery, C. Macleod και M. McCarthy έδειξαν ότι ο παράγοντας µετασχηµατισµού δεν ήταν πρωτεΐνη αλλά DNA. Οι ερευνητές χρησιµοποίησαν ένα σύστηµα in vitro και όχι in vivo, όπου ο µετασχηµατισµός των αδρών σε λεία βακτήρια έγινε σε δοκιµαστικό σωλήνα. Κλασµάτωσαν τα νεκρά λεία βακτήρια στα διάφορα συστατικά τους (µεµβράνες, πρωτεΐνες, λιπίδια, RNA και DNA) και έλεγξαν ποιο από τα συστατικά αυτά είχε την ικανότητα µετασχη-

3 Βήµα 1 ο Μαθαίνουµε τη θεωρία - Λέξεις κλειδιά 11. µατισµού. Ανακάλυψαν ότι αιτία της αλλαγής αυτής ήταν το DNA. Η πλήρης απόδειξη ήλθε το 1953 από τα πειράµατα των Hersey και Chase οι οποίοι µελέτησαν τον κύκλο ζωής του βακτηριοφάγου Τ 2. Οι ερευνητές για να διαπιστώσουν αν ο φάγος καθώς µολύνει το βακτήριο εγχέει σ' αυτό DNA, πρωτεΐνες ή και τα δυο κατασκεύασαν ραδιενεργούς φάγους, χρησιµοποιώντας 32 Ρ για την ιχνηθέτηση του DNA και 35 S για την ιχνηθέτηση των πρωτεϊνών. Βρήκαν ότι τα βακτήρια περιείχαν µόνο ραδιενεργό φώσφορο και όχι θείο, δηλαδή µόνο DNA. Έτσι αποδείχθηκε ότι µόνο το DNA των φάγων εισχωρεί στο βακτηριακό κύτταρο και κατά συνέπεια αυτό είναι το γενετικό υλικό, αφού το γεγονός αυτό εξασφαλίζει την αναπαραγωγή τους. Θεωρία 3 Ποιες είναι οι βιοχηµικές ενδείξεις ότι το DNA είναι το γενετικό υλικό; Απάντηση: α. Η ποσότητα του DNA σε κάθε οργανισµό είναι σταθερή και δεν µεταβάλλεται από αλλαγές στο περιβάλλον, καθώς επίσης είναι η ίδια στους διαφόρους κυτταρικούς τύπους του ίδιου οργανισµού. β. Τα γαµετικά κύτταρα των ανωτέρων ζώων, που είναι απλοειδή, περιέχουν τη µισή ποσότητα DNA απ' ότι τα σωµατικά κύτταρα του ίδιου οργανισµού που είναι διπλοειδή. γ. Η ποσότητα του DNA είναι συνήθως ανάλογη µε την πολυπλοκότητα του οργανισµού, όσο πιο προχωρηµένος εξελικτικά είναι ο οργανισµός, τόσο περισσότερο είναι το DNA που περιέχει. Θεωρία 4 ώσατε διαφορές και οµοιότητες RNA και DNA. Απάντηση: DNA RNA Συνήθως δίκλωνο Συνήθως µονόκλωνο Αποτελείται από δεοξυριβονουκλεοτίδια Αποτελείται από ριβονουκλεοτίδια Περιέχει τις βάσεις αδενίνη (Α), Περιέχει τις βάσεις αδενίνη (A), θυµίνη(τ), κυτοσίνη (C), γουανίνη ουρακίλη(u), κυτοσίνη (C), γουανίνη (G) (G) Χρησιµοποιεί για πεντοζη την δεοξυριβόζη Τα νουκλεοτίδια του φέρουν και µια φωσφορική οµάδα (Η 3 ΡΟ 4 ) Χρησιµοποιεί για πεντόζη την ριβόζη Τα νουκλεοτίδια του φέρουν και µια φωσφορική οµάδα (Η 3 ΡΟ 4 )

4 12. Μαθαίνουµε τη θεωρία - Λέξεις κλειδιά Βήµα 1 ο Θεωρία 5 Να περιγράψετε την δοµή ενός δεοξυριβονουκλεοτιδίου. Απάντηση: Τα δεοξυριβονουκλεοτίδια είναι συστατικά των δεοξυριβονουκλεϊκών οξέων. Κάθε νουκλεοτίδιο του DNA αποτελείται από: α. µια πεντόζη, τη δεοξυριβόζη β. µια φωσφορική οµάδα ενωµένη µε την πεντόζη µε τον 5' άνθρακα. γ. µια αζωτούχα βάση, που µπορεί να είναι αδενίνη (Α), θυµίνη(τ), κυτοσίνη (C), γουανίνη (G), η οποια συνδεεται µε την πεντοζη µε τον 1' άνθρακα. Θεωρία 6 Να περιγράψετε τη δοµή ενός ριβονουκλεοτιδίου. Απάντηση: Τα ριβονουκλεοτίδια είναι συστατικά των ριβονουκλεϊκών οξέων. Κάθε νουκλεοτίδιο του RNA αποτελείται από: α. µια πεντοζη, τη ριβόζη β. µια φωσφορική οµάδα ενωµένη µε την πεντόζη µε το 5' άνθρακα γ. µια αζωτούχο βάση, που µπορεί να είναι αδενίνη (A), ουρακίλη(u), κυτοσίνη (C), γουανίνη (G) που συνδέεται µε τον 1' άνθρακα της πεντόζης.

5 Βήµα 1 ο Μαθαίνουµε τη θεωρία - Λέξεις κλειδιά 13. Θεωρία 7 Γιατί η κατεύθυνση της αλυσίδας του DNA και του RNA είναι πάντα 5' - 3'; Απάντηση: Μια πολυνουκλεοτιδική αλυσίδα σχηµατίζεται από την ένωση πολλών νουκλεοτιδίων µε οµοιοπολικό δεσµό. Ο δεσµός αυτός δηµιουργείται µεταξύ του υδροξυλίου του 3' άνθρακα της πεντόζης του πρώτου νουκλεοτιδίου και της φωσφορικής οµάδας που είναι συνδεδεµένη στον 5' άνθρακα της πεντόζης του επόµενου νουκλεοτιδίου. Ο δεσµός αυτός ονοµάζεται φωσφοδιεστερικός δεσµός. Με τον τρόπο αυτό η πολυνουκλεοτιδική αλυσίδα που δηµιουργείται έχει ένα σκελετό, που αποτελείται από επανάληψη των µορίων φωσφορική οµάδα - πεντόζη - φωσφορική οµάδα - πεντόζη. Ανεξάρτητα από τον αριθµό των νουκλεοτιδίων από τα οποία αποτελείται η πολυνουκλεοτιδική αλυσίδα το πρώτο της νουκλεοτίδιο έχει πάντα µια ελεύθερη φωσφορική οµάδα συνδεδεµένη στον 5' άνθρακα της πεντόζης του και το τελευταίο νουκλεοτίδιο της έχει ελεύθερο το υδροξύλιο του 3' άνθρακα της πεντόζης του. Για το λόγο αυτό αναφέρεται ότι ο προσανατολισµός της πολυνουκλεοτιδικής αλυσίδας είναι πάντα 5' - 3'.

6 14. Μαθαίνουµε τη θεωρία - Λέξεις κλειδιά Βήµα 1 ο Θεωρία 8 Ποια δεδοµένα επέτρεψαν τον προσδιορισµό της δοµής του DNA στο χώρο; Απάντηση: α. Σε κάθε µόριο DNA (που συνήθως είναι δίκλωνο) το πλήθος των αδενινών ισούται µε το πλήθος των θυµινών, ενώ το πλήθος των γουανινών ισούται µε το πλήθος των κυτοσινών. ( ηλαδή Α = Τ και G = C) β. Η αναλογία των αζωτούχων βάσεων (Α +Τ / G +C) διαφοροποιείται σε κάθε είδος οργανισµού και είναι σχετική µε αυτό. γ. Η απεικόνιση του µορίου του DNA µε χρήση ακτινών - Χ

7 Βήµα 1 ο Μαθαίνουµε τη θεωρία - Λέξεις κλειδιά 15. Έτσι το 1953 οι Watson και Crick διατύπωσαν το µοντέλο της διπλής έλικας του DNA. Θεωρία 9 Ποια είναι τα χαρακτηριστικά του µοντέλου της διπλής έλικας; Απάντηση: α. Τα µόρια του DNA έχουν ελικοειδή δοµή και είναι φτιαγµένα από έναν σταθερό σκελετό, που αποτελείται από επαναλαµβανόµενα µόρια φωσφορικής οµάδας - δεοξυριβόζης β. Το µόριο αποτελείται από µια διπλή έλικα µε τον υδρόφιλο σκελετό (σακχαρικά κατάλοιπα και φωσφορικές ρίζες) εκτεθειµένο στο εξωτερικό υδατικό περιβάλλον και τις υδρόφοβες βάσεις στο εσωτερικό του µορίου. γ. Οι δυο ελικοειδείς αλυσίδες συγκρατούνται µεταξύ τους µε υδρογονικούς δεσµούς ανάµεσα στις συµπληρωµατικές βάσεις. Ως τέτοιες θεωρούνται τα ζευγάρια αδενίνη - θυµίνη ( 2 δεσµοί υδρογόνου) και γουανίνη - κυτοσίνη (3 δεσµοί υδρογόνου). δ. Η συµπληρωµατικότητα των αλυσίδων υποδηλώνει ότι η νουκλεοτιδική αλληλουχία της µιας αλυσίδας καθορίζει την νουκλεοτιδική αλληλουχία της άλλης. Το γεγονός αυτό είναι πολύ σηµαντικό για την αντιγραφή του DNA διότι κάθε αλυσίδα µπορεί να χρησιµεύσει ως καλούπι για την σύνθεση µιας συµπληρωµατικής αλυσίδας έτσι ώστε να παραχθούν δυο δίκλωνα DNA ίδια µε το µητρικό. ε. Η κατεύθυνση των αλυσίδων είναι αντιπαράλληλη, το 3' άκρο της µιας είναι ζευγαρωµένο µε το 5' άκρο της άλλης. στ. Σε κάθε στροφή της έλικας αντιστοιχούν 10 ζευγάρια βάσεων. Η κατακόρυφη απόσταση ανάµεσα στα δυο διαδοχικά ζευγάρια βάσεων είναι 0,34 nm και το βήµα της έλικας είναι 34 nm. ζ. Η διπλή έλικα είναι δεξιόστροφη και έχει δευτεροταγή δοµή στο χώρο. Θεωρία 10 Ισχύει η πρόταση το γενετικό υλικό ελέγχει όλες τις λειτουργίες του κυττάρου ; Εξηγήστε. Απάντηση: Η παραπάνω πρόταση ισχύει αφού οι λειτουργίες του γενετικού υλικού είναι: α. Αποθήκευση της γενετικής πληροφορίας. Οι γενετικές πληροφορίες που καθορίζουν όλα τα χαρακτηριστικά ενός οργανισµού οργανώνονται σε λειτουργικές µονάδες, τα γονίδια. β. Η διατήρηση και µεταβίβαση της γενετικής πληροφορίας, που εξασφαλίζεται από κύτταρο σε κύτταρο και από οργανισµό σε οργανισµό µε τον αυτοδιπλασιασµό του DNA

8 16. Μαθαίνουµε τη θεωρία - Λέξεις κλειδιά Βήµα 1 ο γ. Η έκφραση των γενετικών πληροφοριών, που επιτυγχάνεται µε τον έλεγχο της πρωτεϊνοσύνθεσης. Θεωρία 11 Πλασµίδια. Που τα συναντάµε; Ποια είναι η δοµή τους; Ποια η φυσιολογική τους λειτουργία; Απάντηση: Τα πλασµίδια τα συναντάµε αποκλειστικά στο κυτταρόπλασµα των βακτηρίων. Οι γενετικές πληροφορίες του βακτηριακού κυττάρου είναι αποθηκευµένες στο χρω- µόσωµα και στις εξωχρωµατοσωµικές γενετικές µονάδες (πλασµίδια). Πρόκειται για µικρά, κυκλικά µόρια DNA(µε διπλή δεξιόστροφη έλικα) που είναι ανεξάρτητα από το βακτηριακό χρωµόσωµα. Μερικά πλασµίδια µεταφέρουν µόνο ένα ή δυο γονίδια, ενώ άλλα είναι µεγαλύτερα και φθάνουν να έχουν µέγεθος ίσο µε το 1/5 του βακτηριακού χρωµοσώµατος και µεταφέρουν πολλά γονίδια. Αντιπροσωπεύουν το 1-2 % του γενετικού υλικού του βακτηρίου. ιπλασιάζονται ανεξάρτητα του κεντρικού γενετικού υλικού του βακτηρίου. Περιέχουν γονίδια: 1. που προσδίδουν ανθεκτικότητα σε αντιβιοτικά και 2. που βοηθούν στις ανταλλαγές γενετικού υλικού µεταξύ: α. πλασµιδίων του ίδιου του βακτηρίου ή πλασµιδίων και άλλων πλασµιδίων διαφορετικών κυττάρων. β. πλασµιδίων και κεντρικού γενετικού υλικού του ίδιου του βακτηρίου γ. πλασµιδίων και κεντρικών γενετικών υλικών διαφορετικών κυττάρων. Θεωρία 12 Γιατί το γενετικό υλικό του ανθρώπου πακετάρεται στον πυρήνα και πως; Απάντηση: Το γενετικό υλικό του ανθρώπου αναδιπλώνεται µε τη βοήθεια πρωτεϊνών για να χωρέσει στον πυρήνα του κυττάρου. Εάν βάλουµε τα γραµµικά µόρια DNA από τα οποία αποτελείται το ανθρώπινο (πυρηνικό) γενετικό υλικό το ένα πίσω από το άλλο αυτά φθάνουν γύρω στα 2 µέτρα. Άρα λοιπόν χρειάζεται αναδίπλωση στο χώρο για να µπορεί να χωρέσει στον πυρήνα που έχει διάµετρο 10µm. Κάθε µόριο DNA πακετάρεται µε πρωτεΐνες σχηµατίζοντας ένα ινίδιο χρωµατίνης. Ένα ινίδιο χρωµατίνης µοιάζει µε κοµπολόι από χάντρες. Κάθε χάντρα ονοµάζεται νουκλεόσωµα και είναι η βασική µονάδα οργάνωσης της χρωµατίνης. Ένα νουκλεόσωµα συνίσταται από ένα οκταµερές πρωτεϊνών που ονοµάζονται ιστόνες και ένα τµήµα DNA µήκους 146 ζευγών βάσεων τυλιγµένο στο οκταµερές. Τα νουκλεοσώµατα αναδιπλώνονται µε την βοήθεια άλλων πρωτεϊνών, των µη ιστονών, οπότε συσπειρώνεται και άλλο το µόριο του DNA σχηµατίζοντας τελικά το ινίδιο της χρωµατίνης. Τέλος κάθε ινίδιο µετά από αναδίπλωση σχηµατίζει ένα χρωµόσωµα.

9 Βήµα 1 ο Μαθαίνουµε τη θεωρία - Λέξεις κλειδιά 17. Θεωρία 13 Ποιας µορφής µπορεί να είναι το γενετικό υλικό των: α. ευκαρυωτικών κυττάρων β. προκαρυωτικών κυττάρων γ. των ιών; Απάντηση: α. Των ευκαρυωτικών κυττάρων το γενετικό υλικό δεν µπορεί παρά να είναι µόνο DNA δίκλωνο γραµµικό ή DNA δίκλωνο κυκλικό όταν αναφερόµαστε σε µιτοχόνδρια και χλωροπλάστες (κάποιες εξαιρέσεις βρίσκουµε γραµµικό µιτοχονδριακό DNA σε κάποια πρωτόζωα). β. Των προκαρυωτικών κυττάρων είναι κυκλικό δίκλωνο DNA, είτε αναφερό- µαστε στο κεντρικό γενετικό υλικό είτε στο πλασµιδικό. γ. Των ιών µπορεί να είναι DNA µονόκλωνο (γραµµικό ή κυκλικό), δίκλωνο (γραµµικό ή κυκλικό) καθώς και RNA µονόκλωνο (γραµµικό ή κυκλικό), δίκλωνο (γραµµικό ή κυκλικό*). *Εξαιρετικά σπάνια περίπτωση. Θεωρία 14 Συγκρίνατε µιτοχόνδρια και χλωροπλάστες. Απάντηση: ΜΙΤΟΧΟΝ ΡΙΑ Γενετικό υλικό: DNA δίκλωνο, κυκλικό (σπάνια γραµµικό) Το γενετικό υλικό τους περιέχει πληροφορίες σχετικά µε την οξειδωτική φωσφορυλίωση ΧΛΩΡΟΠΛΑΣΤΕΣ Γενετικό υλικό: DNA δίκλωνο, κυκλικό Το γενετικό υλικό τους περιέχει πληροφορίες σχετικά µε την φωτοσύνθεση Κωδικοποιούν µικρό αριθµό πρωτεϊνών Κωδικοποιούν µικρό αριθµό πρωτεϊνών Το µεγαλύτερο πλήθος των πρωτεϊνών που είναι απαραίτητες για την λειτουργία τους κωδικοποιούνται από το DNA του πυρήνα. Το ζυγωτό στους ανώτερους οργανισµούς όπως ο άνθρωπος φέρει µητρικής προέλευσης µιτοχονδριακό DNA Μικρότερο το µιτοχονδριακό DNA σε σχέση µε των χλωροπλαστών Το µιτοχόνδριο φέρει 2-10 αντίγραφα DNA Το µεγαλύτερο πλήθος των πρωτεϊνών που είναι απαραίτητες για την λειτουργία τους κωδικοποιούνται από το DNA του πυρήνα Μεγαλύτερο το DNA των χλωροπλαστών σε σχέση µε των µιτοχονδρίων

10 18. Μαθαίνουµε τη θεωρία - Λέξεις κλειδιά Βήµα 1 ο Λέξεις κλεδιά Απλοειδές κύτταρο: Είναι το κύτταρο που το γονιδίωµα του υπάρχει σε ένα µόνο αντίγραφο. Απλοειδή κύτταρα είναι τα προκαρυωτικά κύτταρα, µερικοί κατώτεροι ευκαρυωτικοί οργανισµοί και οι γαµέτες των διπλοειδών οργανισµών. ιπλοειδές κύτταρο: Είναι το κύτταρο που το γονιδίωµα του υπάρχει σε δυο αντίγραφα. ιπλοειδή κύτταρα είναι τα σωµατικά κύτταρα των ανωτέρων ευκαρυωτικών οργανισµών. Αριθµός ή αλληλουχία βάσεων: Είναι ο όρος που περιγράφει το µήκος ή την αλληλουχία ενός νουκλεϊκού οξέος αντίστοιχα. π.χ. το δίκλωνο µόριο DNA έχει µήκος ζεύγη βάσεων. Γονιδίωµα κυττάρου: Είναι το σύνολο του γενετικού υλικού ενός κυττάρου. Σε ένα ευκαρυωτικό κύτταρο ο όρος αφορά συνήθως µόνο στο γενετικό υλικό που βρίσκεται στον πυρήνα του. εοξυριβονουκλεοτίδιο: Είναι το νουκλεοτίδιο που έχει ως σάκχαρο (πεντόζη) τη δεοξυριβόζη και ως αζωτούχο βάση αδενίνη (Α), θυµίνη(τ), κυτοσίνη (C), γουανίνη (G). Είναι η βασική µονάδα του DNA. Ριβονουκλεοτίδιο: Είναι το νουκλεοτίδιο που έχει ως σάκχαρο (πεντόζη) τη ριβόζη και ως αζωτούχο βάση αδενίνη (A), ουρακίλη(u), κυτοσίνη (C), γουανίνη (G). Είναι η βασική µονάδα του RNA. Καρυότυπος: Είναι η απεικόνιση, κατά σειρά µεγέθους, των µεταφασικών χρω- µοσωµάτων ενός κυττάρου. Ο αριθµός αλλά και η µορφολογία των χρωµοσωµάτων αποτελεί χαρακτηριστικό κάθε είδους. Νουκλεόσωµα: Αποτελεί τη βασική µονάδα οργάνωσης του ινιδίου της χρωµατίνης. Ένα νουκλεόσωµα συνίσταται από ένα οκταµερές πρωτεϊνών που ονοµάζονται ιστόνες και ένα τµήµα DNA µήκους 146 ζευγών βάσεων τυλιγµένο στο οκταµερές. Τα νουκλεοσώµατα αναδιπλώνονται µε την βοήθεια άλλων πρωτεϊνών, των µη ιστονών, οπότε συσπειρώνεται και άλλο το µόριο του DNA σχηµατίζοντας τελικά το ινίδιο της χρωµατίνης. Πλασµίδια: Πρόκειται για µικρά, κυκλικά µόρια DNA, που είναι ανεξάρτητα από το βακτηριακό χρωµόσωµα. Αντιπροσωπεύουν το 1-2 % του γενετικού υλικού του βακτηρίου. ιπλασιάζονται ανεξάρτητα του κεντρικού γενετικού υλικού του βακτηρίου. Περιέχουν γονίδια που προσδίδουν ανθεκτικότητα σε αντιβιοτικά και που βοηθούν στις ανταλλαγές γενετικού υλικού του βακτηρίου είτε µε άλλα είτε µε τον εαυτό τους. Φωσφοδιεστερικός δεσµος: Είναι οµοιοπολικός δεσµός συµπύκνωσης (δηλαδή µε ταυτόχρονη αποβολή ενός µορίου νερού) που ενώνει δυο νουκλεοτίδια. Σχη- µατίζεται µεταξύ του υδροξυλίου του 3' άνθρακα της πεντόζης του πρώτου νουκλεοτιδίου και της φωσφορικής οµάδας που είναι συνδεδεµένη στον 5' άνθρακα της πεντόζης του επόµενου νουκλεοτιδίου. Ονοµάζεται και 3' - 5' φωσφοδιεστερικός δεσµός.

11 Βήµα 1 ο Μαθαίνουµε τη θεωρία - Λέξεις κλειδιά 19. Πνευµονιόκκοκος: Είδος βακτηρίου, που είναι παθογόνο και προσβάλει το αναπνευστικό σύστηµα, χρησιµοποιήθηκε από τον Griffith για την εύρεση του γενετικού υλικού. In vivo: Πρόκειται για βιολογικό πείραµα το οποίο γίνεται µέσα στον οργανισµό. In vitro: Πρόκειται για βιολογικό πείραµα το οποίο γίνεται στο εργαστήριο µέσα σε δοκιµαστικό σωλήνα. Βακτηριοφάγος: Πρόκειται για ιό ο οποίος προσβάλλει µόνο βακτήρια. Ιχνηθέτηση: Θεωρείται η αντικατάσταση ή από την αρχή τοποθέτηση ενός ραδιενεργού ισοτόπου στη θέση του κανονικού στοιχείου. Συµπληρωµατικότητα βάσεων: Ο µηχανισµός κατά τον οποίο στις αλυσίδες των νουκλεϊκών οξέων πάντα απέναντι από µια αδενίνη βρίσκεται µια θυµίνη (ή ουρακίλη αν πρόκειται για RNA) και απέναντι από µια γουανίνη υπάρχει πάντα µια κυτοσίνη. Εξασφαλίζει τη διατήρηση και τη µεταβίβαση των γενετικών πληροφοριών καθώς και τον έλεγχο του φαινοτύπου. Οκταµερές ιστονών: Σύµπλεγµα 8 πρωτεϊνών που παίρνει µέρος στην συσπείρωση του DNA. Γύρω του τυλίγεται κοµµάτι DNA µήκους 146 ζευγών βάσεων. Μη ιστόνη: Πρωτεϊνικά µόρια που βοηθούν στην παραπάνω συσπείρωση του DΝΑ. Ηµιαυτόνοµο οργανίδιο: Το οργανίδιο εκείνο το οποίο έχει την ικανότητα να συνθέτει κάποιες από τις πρωτεΐνες οι οποίες χρειάζονται για να επιτελεί τις λειτουργίες του, ενώ κάποιες άλλες κωδικοποιούνται από το πυρηνικό DNA. Συνήθως αναφερόµαστε στα µιτοχόνδρια και τους χλωροπλάστες. Γονίδια ανθεκτικότητας: Γονίδια τα οποία απαντούν στα πλασµίδια των βακτηρίων. Είναι τα γονίδια εκείνα τα οποία προσδίδουν στα βακτήρια ανθεκτικότητα σε κάποια αντιβιοτικά. Παίζουν σηµαντικό ρόλο στην επιβίωση του κυττάρου. Γονίδια µεταφοράς γενετικού υλικού: Γονίδια τα οποία απαντούν στα πλασµίδια των βακτηρίων. Είναι τα γονίδια εκείνα τα οποία είναι υπεύθυνα για την µεταφορά του γενετικού υλικού, είτε από το κύριο DNA του βακτηρίου στα πλασµίδια είτε από τα πλασµίδια του βακτηρίου στα πλασµίδια του ίδιου βακτηρίου, είτε στην µεταφορά DNA από τα πλασµίδια σε πλασµίδια άλλου βακτηρίου (βακτηριακή σύζευξη), είτε στην µεταφορά DNA από τα πλασµίδια στο κύριο γενετικό υλικό άλλων βακτηρίων. Μιτοχονδριακό DNA: DNA το οποίο εντοπίζεται στα µιτοχόνδρια. Πρόκειται για κυκλικό δίκλωνο (και σπάνια γραµµικό σε κάποια πρωτόζωα) µόριο το οποίο σε κάθε µιτοχόνδριο µπορεί να υπάρχει σε 2-10 αντίγραφα. Συνθέτει κάποιες πρωτεΐνες που είναι υπεύθυνες για την οξειδωτική φωσφορυλίωση. Αντιγράφεται ανεξάρτητα από το πυρηνικό γενετικό υλικό ανάλογα µε τις ανάγκες του κυττάρου. Στους ανώτερους οργανισµούς όπως ο άνθρωπος είναι καθαρά µητρικής προέλευσης (διότι στα σπερµατοζωάρια τα µιτοχόνδρια βρίσκονται στον αυχένα τους, κοµ- µάτι το οποίο δεν εισχωρεί στο ωάριο όταν γίνεται η γονιµοποίηση). Σε µέγεθος είναι µικρότερο από το DNA των χλωροπλαστών. Το γενετικό υλικό των µιτοχονδρίων αποτελεί λιγότερο από το 0,1% του γενετικού υλικού όλου του κυττάρου.

12 20. Μαθαίνουµε τη θεωρία - Λέξεις κλειδιά Βήµα 1 ο Οξειδωτική φωσφορυλίωση: Λειτουργία του µιτοχονδρίου που σχετίζεται µε την απελευθέρωση ενέργειας σε µορφή ΑΤΡ, την οποία χρησιµοποιεί το κύτταρο. Ινίδιο χρωµατίνης: Είναι η µορφή του χρωµοσώµατος κατά τη µεσόφαση. Α- ποτελείται από ένα µόριο DNA πακεταρισµένο µε πρωτεΐνες ιστόνες και µη ιστόνες. Στο ηλεκτρονικό µικροσκόπιο µοιάζει µε κοµπολόι από χάντρες. Κάθε χάντρα ονοµάζεται νουκλεόσωµα και αποτελεί τη βασική µονάδα οργάνωσης του ινιδίου χρωµατίνης. Αδελφές χρωµατίδες: Στο στάδιο αντιγραφής του DNA παράγονται δυο θυγατρικά µόρια DNA τα οποία οργανώνονται σε δυο ινίδια χρωµατίνης και παραµένουν ενωµένα σε ένα σηµείο, το κεντροµερίδιο, ο σχηµατισµός αυτός ονοµάζεται αδελφές χρωµατίδες. Φυλετικό χρωµόσωµα: Είναι ένα ζευγάρι χρωµοσωµάτων που καθορίζουν το φύλο. Στον άνθρωπο το 23ο ζεύγος χρωµοσωµάτων στα θηλυκά άτοµα αποτελείται από δυο οµόλογα φυλετικά χρωµοσώµατα που συµβολίζονται ΧΧ, ενώ στα αρσενικά άτοµα από το ζεύγος ΧΥ, όπου το Υ είναι µικρότερο σε µέγεθος από το Χ. Οµόλογα χρωµοσώµατα: Είναι ζευγάρι χρωµοσωµάτων στα σωµατικά κύτταρα των διπλοειδών οργανισµών που έχουν το ίδιο σχήµα, το ίδιο µέγεθος και την ίδια θέση κεντροµεριδίου. Περιέχουν την ίδια σειρά γονιδίων που ελέγχουν την ίδια ιδιότητα µε διαφορετικό ενδεχοµένως τρόπο. Αλληλόµορφα γονίδια: Είναι γονίδια που βρίσκονται σε οµόλογα χρωµοσώµατα στον ίδιο γενετικό τόπο και ελέγχουν ίδιες λειτουργίες Αυτοσωµικά χρωµοσώµατα: Πρόκειται για τα 22 ζεύγη χρωµοσωµάτων που καθορίζουν τις λειτουργίες των ανθρώπινων κυττάρων εκτός από το φύλο. Αποικία: Πρόκειται για συναθροίσεις προκαρυωτικών κυττάρων όπως π.χ. των βακτηρίων που µοιάζουν µε τους ιστούς των ευκαρυωτικών. Κάθε κύτταρο είναι αυτόνοµος οργανισµός. Βακτήριο: Προκαρυωτικό κύτταρο το οποίο έχει σαν κύριο γενετικό υλικό κυκλικό µόριο DNA και σαν δευτερεύον πλασµίδια µε κυκλικό DNA, δεν έχει οργανωµένο πυρήνα και δεν έχει ευκαριωτικά οργανίδια (π.χ. σύστηµα Golgi, µιτοχόνδρια, χλωροπλάστες κ.α) και ανήκει στους µικροοργανισµούς. Γονίδιο: Είναι το τµήµα εκείνο του DNA που µεταφράζεται. Επίσης υπάρχουν και γονίδια που κωδικοποιούν άλλους τύπους RNA (trna, rrna, snrna και όχι πρωτεΐνες). Είναι το κοµµάτι το οποίο δεν αποτελεί την σαβούρα του γενετικού υλικού του κυττάρου. Ζωνοποίηση: Χρώση του καρυότυπου µε ειδικές χρωστικές ουσίες που τον κάνουν έτοιµο για µελέτη και παρατήρηση. Βελτιώνεται η δυνατότητα διαπίστωσης δοµικών αναµαλιών. Πουρίνες, Πυριµιδίνες: Πουρίνες είναι οι αζωτούχες βάσεις αδενίνη και γουανίνη και Πυριµιδίνες είναι οι κυτοσίνη, ουρακίλη, θυµίνη.

13 Βήµα 2 ο Ερωτήσεις θεωρίας 21. ÂÞìá 2 ÂÞìá 1 Ερωτήσεις Θεωρίας ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ Ερωτήσεις ανάπτυξης 1. Πώς σχηµατίζεται ένα νουκλεοτίδιο και πώς µια πολυνουκλεοτιδική α- λυσίδα; 2. Ποια είναι τα ελευθέρα άκρα µιας πολυνουκλεοτιδικής αλυσίδας και ποιος είναι ο προσανατολισµός της; 3. Ποιοι δεσµοί υπάρχουν στο µόριο του DNA; 4. Να περιγράψετε το µοντέλο της διπλής έλικας του DNA στο χώρο κατά Watson και Crick. 5. Να εξηγήσετε γιατί το DNA ελέγχει όλες τις λειτουργίες των κυττάρων. 6. Σε ποια µέρη ενός ευκαρυωτικού κυττάρου µπορούµε να συναντήσου- µε γενετικό υλικό; 7. Τι είναι τα πλασµίδια και ποιες είναι οι ιδιότητες τους; 8. Ποια είναι η σύσταση της χρωµατίνης; 9. Να αναφέρετε τις χαρακτηριστικές µορφές του γενετικού υλικού ενός ευκαρυωτικού κυττάρου, στα διάφορα στάδια του κυτταρικού κύκλου. 10. Ποια τεχνική ακολουθούµε προκειµένου να παρατηρήσουµε τα χρω- µοσώµατα ενός ανθρώπινου κυττάρου; 11. Να αιτιολογήσετε την εικασία τα µιτοχόνδρια και οι χλωροπλάστες µπορεί κάποτε να αποτελούσαν υποχρεωτικά ενδοσυµβιωτικά κύτταρα στα ευκαρυωτικά κύτταρα.

14 22. Ερωτήσεις θεωρίας Βήµα 2 ο 12. Ποιες µορφές µπορεί να πάρει το γενετικό υλικό των ιών; 13. Εντοπίστε τις διαφορές µεταξύ του γενετικού υλικού των ιών και των βακτηρίων. 14. Ποια είναι η σηµασία της συµπληρωµατικότητας των αζωτούχων βάσεων στο µόριο του DNA; 15. Τι συµβαίνει κατά τη διάρκεια της µεσόφασης; (Να συµβουλευτείται το παράρτηµα) 16. Σε τι διαφέρουν δυο µη οµόλογα µεταφασικά χρωµοσώµατα; (Να συµβουλευτείται το παράρτηµα) 17. Το συνολικό DNA σε ζεύγη βάσεων στη Drosophila melanogaster (έντοµο), στο Sacharomyces cerevisiae (ζύµη) και στην Eserichichia coli (βακτήριο) είναι: µπέρασµα προκύπτει; 8 1,6 10, 7 1,4 10 και αντίστοιχα. Τι συ- 18. Γιατί η µελέτη των χρωµοσωµάτων γίνεται όταν αυτά βρίσκονται στο στάδιο της µετάφασης; (Να συµβουλευτείται το παράρτηµα) 19. Σε τρία φυσιολογικά κύτταρα του καλαµποκιού η ποσότητα DNA σε 9 9 ζεύγη βάσεων είναι αντίστοιχα: Α κύτταρο: 5 10, Β κύτταρο: και Γ κύτταρο: Τι είδους κύτταρα µπορεί να είναι αυτά; (Πανελλήνιες 2002) 20. Συµπληρώστε τον παρακάτω πίνακα που αναφέρεται σε ανθρώπινα κύτταρα. (Να συµβουλευτείται το παράρτηµα)

15 Βήµα 2 ο Ερωτήσεις θεωρίας 23. Χαρακτηριστικά κυττάρου (απλοειδές - διπλοειδές και αν υπάρχουν ο- µόλογα χρωµοσώ- µατα) Αντίγραφα γονιδιώµατος Ποσότητα DNA σε ζεύγη βάσεων Μόρια DNA Αριθµός χρωµοσω- µάτων Γαµέτης Σωµατικό κύτταρο στην αρχή της µεσόφασης Σωµατικό κύτταρο στην µετάφαση Προϊόν πρώτης µειωτικής διαίρεσης 21. Ο παρακάτω πίνακας περιέχει πληροφορίες για το γενετικό υλικό 4 ιων. Τι είδους γενετικό υλικό περιέχει ο καθένας; ΙΟΣ Α ΙΟΣ Β ΙΟΣ Γ ΙΟΣ Φ.φ.δ Αδενίνες Θυµίνες Κυτοσίνες Γουανίνες Ουρακίλες

16 24. Ερωτήσεις θεωρίας Βήµα 2 ο Ερωτήσεις πολλαπλής επιλογής 1. Στο πείραµα του Griffith: α. τα αδρά µη παθογόνα βακτήρια µετασχηµατίστηκαν σε αδρά παθογόνα β. τα αδρά µη παθογόνα βακτήρια µετασχηµατίστηκαν σε λεία παθογόνα γ. τα λεία παθογόνα βακτήρια µετασχηµατίστηκαν σε αδρά δ. τα αδρά βακτήρια µετασχηµατίστηκαν σε λεία παθογόνα 2. Στο πείραµα των Avery, Mc Cleod και Mc Carthy αποδείχτηκε ότι η ουσία που προκαλούσε το µετασχηµατισµό των αδρών βακτηρίων σε λεία παθογόνα ήταν: α. οι πρωτεΐνες β. το DNA γ. οι υδατάνθρακες δ. το RNA 3. Η ποσότητα του DNA είναι: α. σταθερή σε κάθε σωµατικό κύτταρο ενός οργανισµού (στάδιο G1) και δεν µεταβάλλεται από αλλαγές στο περιβάλλον β. κατά κανόνα, ανάλογη µε την πολυπλοκότητα του οργανισµού γ. η µισή στα γαµετικά κύτταρα σε σύγκριση µε τα σωµατικά δ. όλα τα παραπάνω 4. Τα πειράµατα των Hershey και Chase απέδειξαν: α. ότι ολόκληρος ο φάγος εισέρχεται τα βακτήρια β. ότι το πρωτεϊνικό περίβληµα εισέρχεται στο βακτήριο γ. ότι το DNA είναι το γενετικό υλικό δ. όλα τα παραπάνω 5. Η συµπληρωµατικότητα των βάσεων έχει µεγάλη σηµασία: α. για τον αυτοδιπλασιασµό του DNA β. για τη µεταβίβαση της γενετικής πληροφορίας από κύτταρο σε κύτταρο γ. για τη σύνθεση των πρωτεϊνών δ. για όλα τα παραπάνω 6. Το νουκλεϊκό οξύ RNA είναι το γενετικό υλικό: α. των προκαρυωτικών κυττάρων β. των µιτοχονδρίων και χλωροπλαστών γ. των διπλοειδών οργανισµών δ. κάποιων ιών 7. Το γονιδίωµα στους προκαρυωτικούς οργανισµούς είναι: α. δύο αντίγραφα κυκλικών µορίων DNA β. µόνο δίκλωνα κυκλικά µόρια DNA, τα πλασµίδια

17 Βήµα 2 ο Ερωτήσεις θεωρίας 25. γ. ένα δίκλωνο κυκλικό µόριο DNA και τα πλασµίδια δ. ένα κυκλικό µόριο DNA µε πρωτεΐνες 8. Τα πλασµίδια που υπάρχουν σε ένα προκαρυωτικό κύτταρο: α. είναι δίκλωνα µόρια DNA µε το ίδιο µέγεθος β. φέρουν γενικές πληροφορίες για το σύνολο των ιδιοτήτων του βακτηρίου γ. µεταφέρουν γενετικό υλικό σε άλλα βακτήρια δ. αντιγράφονται ταυτόχρονα µε το κύριο µόριο DNA του βακτηρίου 9. Το γενετικό υλικό βρίσκεται στην κυκλική του µορφή: α. στα προκαρυωτικά κύτταρα β. σε κάποιους ιούς γ. στους χλωροπλάστες και στα µιτοχόνδρια των περισσότερων ευκαρυωτικών κυττάρων δ. σε όλα τα παραπάνω 10. Υψηλός βαθµός συσπείρωσης του DNA παρατηρείται: α. κατά την αντιγραφή του DNA β. στο τέλος της µίτωσης γ. στο στάδιο της µετάφασης δ. στη µεσόφαση 11. Σε ένα διπλοειδές κύτταρο στο τέλος της µίτωσης το γενετικό υλικό των δύο θυγατρικών κυττάρων αποτελείται: α. από δύο µη αδελφές χρωµατίδες κάθε οµόλογου ζεύγους χρωµοσωµάτων β. από ένα µόριο DNA, κάθε χρωµοσώµατος γ. από δύο αλυσίδες DNA κάθε αρχικού χρωµοσώµατος δ. από όλα τα παραπάνω 12. Οι αδελφές χρωµατίδες: α. προκύπτουν από την αντιγραφή του DNA β. συνδέονται στο κεντροµερίδιο γ. η καθεµιά αποτελείται από ένα µόριο DNA συνδεδεµένο µε ιστόνες δ. όλα τα παραπάνω 13. Η λειτουργία του DNA ως γενετικό υλικό είναι δυνατή, επειδή το µόριό του έχει τις παρακάτω ιδιότητες: α. παράγει αντίγραφά του β. µεταβιβάζει τις γενετικές πληροφορίες από ένα κύτταρο στα γειτονικά του γ. ελέγχει όλες τις κυτταρικές δραστηριότητες, όπως σύνθεση ριβοσωµάτων, πρωτεϊνών και µιτοχονδρίων δ. όλα τα παραπάνω

18 26. Ερωτήσεις θεωρίας Βήµα 2 ο 14. Οι πληροφορίες για τις κληρονοµικές ιδιότητες ενός οργανισµού, είναι α- ποθηκευµένες: α. στο µόριο DNA β. στα χρωµοσώµατα όλων των κυττάρων γ. στα γονίδια δ. στις πολυπεπτιδικές αλυσίδες 15. Το µιτοχονδριακό DNA ενός κυττάρου: α. είναι πατρικής προέλευσης β. περιέχει γονίδια ανθεκτικότητας σε αντιβιοτικά γ. κληροδοτείται από την µητέρα δ. είναι µονόκλωνο Ερωτήσεις τύπου σωστό - λάθος 1. Στο δίκλωνο µόριο DNA ισχύει πάντα η ισότητα: A+ T = C+ G. ( ) 2. Η αναλογία των βάσεων στο DNA διαφέρει από είδος σε είδος και σχετίζεται µε το είδος του οργανισµού. ( ) 3. Το κυκλικό µόριο DNA των προκαρυωτικών κυττάρων αναδιπλώνεται και πακετάρεται µε τη βοήθεια κυρίως ιστονών. ( ) 4. Τα χρωµοσώµατα µελετώνται στο στάδιο της µεσόφασης. ( ) 5. Η ποσότητα των πρωτεϊνών σε κάθε κύτταρο ενός οργανισµού είναι σταθερή και δεν µεταβάλλεται από αλλαγές στο περιβάλλον. ( ) 6. Η ποσότητα DNA σε κάθε κύτταρο ενός οργανισµού µεταβάλλεται µε την ηλικία του οργανισµού. ( ) 7. Το καρδιακό κύτταρο περιέχει διπλάσια ποσότητα DNA από το γαµετικό κύτταρο. ( ) 8. Τα γαµετικά κύτταρα του ανθρώπου περιέχουν 23 οµόλογα χρωµοσώµατα. ( ) 9. Στο πείραµα του Griffith µεγάλο ποσοστό αδρών βακτηρίων µετασχηµατίστηκαν σε λεία παθογόνα. ( ) 10. Σε µερικές περιπτώσεις το RNA είναι φορέας γενετικών πληροφοριών. ( ) 11. Τα γονίδια διπλασιάζονται στη µεσόφαση. ( ) 12. Ο αριθµός των φυλετικών χρωµοσωµάτων σε ένα ανθρώπινο νευρικό κύτταρο είναι δύο. ( ) 13. Το περιβάλλον µπορεί να µεταβάλλει την ποσότητα του DNA ενός οργανισµού. ( ) 14. Η µία πολυνουκλεοτιδική αλυσίδα ενός µορίου DNA ονοµάζεται αδελφή χρωµατίδα. ( ) 15. Όλα τα οργανίδια ενός ευκαρυωτικού κυττάρου έχουν DNA. ( )

19 Βήµα 2 ο Ερωτήσεις θεωρίας 27. Ερωτήσεις αντιστοίχισης 1. α. Νουκλεόσωµα 1. Βρίσκεται στους ιούς β. Πλασµίδιο 2. Το γονιδίωµα υπάρχει σε ένα αντίγραφο γ. Κεντροµερίδιο 3. Συνδέει τα οµόλογα χρωµοσώµατα δ. ίκλωνο µόριο RNA 4. ίκλωνο, κυκλικό µόριο DNA ε. Απλοειδές κύτταρο 5. Συνδέει τις αδελφές χρωµατίδες 6. Βασική µονάδα οργάνωσης των ινιδίων χρωµατίνης 2. α. Γαµέτης β. ιπλοειδές κύτταρο γ. Ιός δ. Μιτοχόνδριο ε. Βακτήριο 1. To νουκλεϊκό του οξύ µπορεί να είναι µονόκλωνο µόριο DNA 2. Περιέχει τη µισή ποσότητα DNA από ένα σωµατικό κύτταρο 3. Είναι ηµιαυτόνοµο οργανίδιο 4. Το γονιδίωµα υπάρχει σε δύο αντίγραφα 5. Περιέχει πλασµίδια 6. Το γενετικό υλικό ενός κυττάρου 3. α. Λείο βακτήριο 1. DNA ιός β. Ραδιενεργό 35 S 2. Πνευµονιόκοκκος µη παθογόνος γ. Βακτηριοφάγος Τ 2 3. Πρωτεΐνες δ. Βακτήριο χωρίς κάλυµµα 4. Πνευµονιόκοκκος παθογόνος ε. Γενετικό υλικό κυττάρων 5. RNA ιός 6. DNA 4. α. Ινίδια χρωµατίνης β. Νουκλεοσώµατα γ. Ιστόνες δ. Χρωµοσώµατα 1. Κατά την µεσόφαση µπορούµε να τα διακρίνουµε µε την βοήθεια του οπτικού µικροσκοπίου 2. Πρωτεΐνες των νουκλεοσωµάτων 3. Αντιγράφονται κατά την διάρκεια της µίτωσης 4. Αποτελούνται από 2 αδελφές χρωµατίδες ενωµένες στο κεντροµερίδιο 5. Πακετάρονται και σχηµατίζουν ινίδια χρωµατίνης 6. Μόρια DNA του µεσοφασικού πυρήνα πακεταρισµένα µε πρωτεΐνες

20 28. Ερωτήσεις θεωρίας Βήµα 2 ο Ερωτήσεις συµπλήρωσης κενών 1. Στο πείραµα του Griffith µερικά... βακτήρια µετασχηµατίστηκαν σε... παθογόνα. 2. Οι αζωτούχες βάσεις της µιας αλυσίδας του DNA συνδέονται µε δεσµούς µε τις αζωτούχες βάσεις της απέναντι αλυσίδας µε βάση τον κανόνα της... των βάσεων. 3. Τα χρωµοσώµατα ταξινοµούνται κατά ελαττούµενο µέγεθος. Η απεικόνιση αυτή αποτελεί τον Τα κύτταρα που το γονιδίωµά τους υπάρχει σε ένα µόνο αντίγραφο ονοµάζονται... ενώ σε δύο αντίγραφα ονοµάζονται Κάθε νουκλεοτίδιο του DNA αποτελείται από µία πεντόζη, τη... ενωµένη µε µία... οµάδα και µία... βάση. 6. Το DNA αποτελείται από δύο... αλυσίδες που σχηµατίζουν στο χώρο µία... διπλή Ανάµεσα στην αδενίνη και τη... σχηµατίζονται... δεσµοί υδρογόνου, ενώ ανάµεσα στη... και την κυτοσίνη σχηµατίζονται... δεσµοί υδρογόνου. 8. Η συµπληρωµατικότητα έχει τεράστια σηµασία για τον... του DNA, µία ιδιότητα που το καθιστά το καταλληλότερο µόριο για τη διατήρηση και τη... της γενετικής πληροφορίας. Το DNA αποτελεί το όλων των κυττάρων και των περισσοτέρων ιών. Κάποιοι ιοί έχουν ως γενετικό υλικό Το γενετικό υλικό του κυττάρου ονοµάζεται Η βασική µονάδα οργάνωση της χρωµατίνης είναι....

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 21/09/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Για το γονιδίωμα της γάτας

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049

Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049 ΝΙΚΟΠΟΥΛΟΣ ΚΩΝ/ΝΟΣ 5 η ΕΚΔΟΣΗ Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049 1 2 3 ΔΙΑΦΟΡΕΣ ΜΕΤΑΞΥ DNA και RNA DNA Δίκλωνο

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΣΥΓΓΡΑΦΗ): ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (Θα περιέχει ερωτήσεις θεωρίας µε απαντήσεις, ασκήσεις ανοικτούκλειστού τύπου µε

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό

1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό 1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό 1.1.1.Με βάση την εικόνα που σας δίνεται (πείραμα Griffith) να απαντήσετε στις ερωτήσεις που ακολουθούν. Α. Το συστατικό των βακτηρίων

Διαβάστε περισσότερα

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ α) Αφού τα σωµατικά κύτταρα της γάτας έχουν 19 ζεύγη οµολόγων χρωµοσωµάτων, άρα περιέχουν 38 απλοειδή χρωµοσώµατα στην αρχή της Μεσόφασης (G 1 -φάση), πριν

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση:

KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1. Η ποσότητα του DNA α. είναι ίδια

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΧΕΙΡΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 15 ΣΕΠΤΕΜΒΡΙΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ ΘΕΜΑ 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2009 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

1.1. Το γενετικό υλικό είναι το DNA 1. ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΒΑΣΙΚΕΣ ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ

1.1. Το γενετικό υλικό είναι το DNA 1. ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΒΑΣΙΚΕΣ ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ 1. ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1.1. Το γενετικό υλικό είναι το DNA ΒΑΣΙΚΕΣ ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ 1.1.1 Γιατί οι επιστήμονες πίστευαν ότι τα μόρια που μεταφέρουν τη γενετική πληροφορία είναι οι πρωτεΐ νες; Οι επιστήμονες

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orionidef.gr ΘΕΜΑ A Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ο µέγιστος αριθµός διαφορετικών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α 1 : α Α 2 : γ Α 3 : δ Α 4 : β Α 5 : γ ΘΕΜΑ Β Β 1 : σελ. 120 σχολικού: >. Β 2 :

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 α Α2 γ Α3 δ Α4 β Α5 γ ΘΕΜΑ Β Β1. Σελ. 120 σχολ. βιβλίου: «Για την επιλογή οργάνων

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ε Ν Δ Ε Ι Κ Τ Ι Κ Ε Σ Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β )

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 β Α2 γ Α3 α Α4 δ Α5 γ ΘΕΜΑ Β Β1: 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β Β2:

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στην λέξη ή τη φράση, η

Διαβάστε περισσότερα

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ e-mail: info@iliaskos.gr www.iliaskos.gr ΚΕΦΑΛΑΙΟ 1 TO ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ερωτήσεις

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

ΤΕΤΡΑΚΤΥΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ

ΤΕΤΡΑΚΤΥΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΤΕΤΡΑΚΤΥΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ Αµυραδάκη 20, Νίκαια (210-4903576) ΤΑΞΗ... Γ ΛΥΚΕΙΟΥ... ΜΑΘΗΜΑ...ΒΙΟΛΟΓΙΑ ΚΑΤ/ΣΗΣ... ΝΟΕΜΒΡΙΟΣ 2011 ΑΞΙΟΛΟΓΗΣΗ ΚΕΦΑΛΑΙΑ 1 ο -2 ο ΘΕΜΑ 1ο Α. Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. α, Α2. γ, Α3. δ, Α4. β, Α5. γ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (30-05-2012) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σελ.120 Τα µονοκλωνικά αντισώµατα χρησιµοποιούνται για την επιλογή οργάνων συµβατών για µεταµόσχευση.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. 1. Στην πλειονότητά

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο ΙΑΓΩΝΙΣΜΑ Α/ Ποιες οι λειτουργίες του γενετικού υλικού ; (Μονάδες 6) Β/ Που βρίσκεται το γενετικό υλικό στα ευκαρυωτικά και στα προκαρυωτικά ; (Μονάδες 6)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Αναφερθείτε σε οµοιότητες και διαφορές του γενετικού υλικού µεταξύ προκαρυωτών και ευκαρυωτών. ΠΡΟΚΑΡΥΩΤΙΚΑ ΚΥΤΤΑΡΑ Μικρότερο µέγεθος Ένα µικρό κυκλικό δίκλωνο µόριο DNA στην πυρηνική

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 Πανελλήνιες 2015 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 ΘΕΜΑ Α Α1- β Α2- γ Α3- α Α4- δ Α5- γ ΘΕΜΑ Β Β1. Α: σωματικά κύτταρα στην αρχή της μεσόφασης -> 1,4,5,6 Β: γαμέτης:

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 ΘΕΜΑ Α Α1.β Α2.γ Α3.α Α4.δ Α5.γ ΘΕΜΑ Β Β1. 1A, 2B, 3B, 4A, 5A, 6A, 7B, 8B Β2. σελίδα 40 σχολικού

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ www.romvos.edu.gr ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α 1.Β 2.Γ 3.Α 4.Δ 5.Γ ΘΕΜΑ Β Β1) 1.Α 2.Β 3.Β 4.Α 5.Α 6.Α 7.Β 8.Β Β2) Σελ. 40 σχολικού βιβλίου : Κατά την έναρξη

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς

Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ:

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Ζήτηµα 1ο Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Σε µια συνεχή

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr Τ: 2221-300524 & 6937016375 Προς: Μαθητές Α, Β & Γ Λυκείου / Κάθε ενδιαφερόμενο Αγαπητοί Φίλοι Όπως σίγουρα γνωρίζετε, από τον Ιούνιο του 2010 ένα νέο «ΔΙΑΚΡΟΤΗΜΑ» λειτουργεί και στη Χαλκίδα. Στο Φροντιστήριό

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα