PCR 2BS A X Comparison of Southern blotting and Real-time PCR in measuring telomere shortening

Transcript

1 297 DNA PCR DNA PCR population doublings PDs 2BS DNA DNA PCR 1 μg DNA 4 ~ 5 μg DNA 150 bp PCR 300 ~ 400 bp 2 PDs 2BS 5 PDs PCR 10% DNA 2. 5% P < DNA PCR DNA R doi /j. issn X A X Comparison of Southern blotting and Real-time PCR in measuring telomere shortening GAO Ling-yun LI Guo-dong TONG Tan-jun Research Center on Aging Department of Biochemistry and Molecular Biology School of Basic Medical Sciences Peking University Beijing China ABSTRACT Objective To analyze and compare the performances of two telomere measurement methods digoxigenin-labeled Southern blot and Real-time PCR in cellular senescence research. Methods Genomic DNA extracted from normal human fibroblasts 2BS of different population doublings PDs was used as test samples. The Southern blot and Real-time PCR methods for telomere measurements were optimized. The specificity and sensitivity of digoxigenin detection system were analyzed by dot blot. The two methods were respectively used to measure parallel samples to analyze and compare their resolution and accuracy. Results Digoxigenin-labeled Southern blot system could detect less than 1 μg of human genomic DNA but the optimal sample size was around 4-5 μg when measuring telomeres. The resolution of the Southern blot method was around 150 bp while the Real-time PCR method bp. The former could distinguish the difference of 2 PDs for 2BS cells while the latter could not distinguish the difference of less than 5 PDs. The measurement error of the repeated measurements for the Real-time PCR method was more than 10% which was bigger than that of the Southern blot method 2. 5% P < Conclusion Digoxigenin-labeled Southern blot system is fully applicable to telomere measurement. The performance of the Southern blot method is better than that of the Real-time PCR method while the latter is convenient and high-throughput. In the study of cellular senescence the appropriate method should be selected according to specific experiment. KEY WORDS Telomere Blotting Southern Real-time polymerase chain reaction Digoxigenin Aging ~ 40 Muller 1 McClintock 2 Drosophila melanogaster Zea mays DNA 2012CB Supported by the National Basic Research Programs of China 2012CB and the National Natural Science Foundation of China Corresponding author s ttj@ bjmu. edu. cn http / /www. cnki. net /kcms /detail / R html

2 298 mmol /L Tris ph 8. 0 DNA D 260 /D DNA 1. 3 Southern blot 4 μg DNA MspⅠ RsaⅠ NEB 20 U 50 μl 37 4 ~ 7 12 h 7 ~ 8 g /L Cawthon PCR 1 V /cm 10 ~ 12 h Real-time PCR DNA marker for Genomi DNA Fermentasin mol /L 1. 5 mol /L NaCl 0. 5 mol /L NaOH 45 min 1 mol /L Tris HCl ph mol /L NaCl 45 min 1 DNA PCR DNA marker EB DNA 36 h 80 2 ~ 4 h SSC 2 min population doublings PDs 7 ~ 8 ml 5 SSC 50% 2BS 1 g /L 0. 2 g /L SDS 10 g / L min DIG-5'-end labeled- TTAGGG 4 Invitrogen 7 ~ 8 ml 35 μg /L DNA 42 2 ~ 6 h 1 2 SSC 1 g /L 1 SDS 15 min SSC g /L SDS 15 min 2 2BS 15 ~ mol /L mol /L NaCl ph BS 55 ~ % Tween 20 1 ~ 5 min PDs 65 ~ 70 PDs PD ml 100 g /L PD31 ~ 54 PD55 30 min 20 ml Anti- 10% DMEM DIG-AP Roche 30 min 100 ml Gibco 37 5% 15 min 2 20 ml CO mol /L NaCl 0. 1 mol /L Tris ph DNA 80% PBS ml DNAzol Invitrogen 0. 5 ml 3 min DNA 1 ml CDP-Star Roche USA 5 min ImageQuant TM RT ECL TM GE Healthcare Telometric % PCR 2 TE 1 mmol /L EDTA 10 DNA mg /L min

3 DNA PCR min 730 g 4 PD29 2BS Invitrogen TE ph bp HBG1 GCTTCTGACACAACTGTGTTCACTAGC 4 μmol /L HBG2 CACCAACTTCATCCACGTTCACC 4 μmol /L 20 μl 35 ng DNA3 T S min s 54 2 min s 58 1 min 30 ABI 7300 Sequence Detection System Applied Biosystems Foster City T /S 10 μl 80 2 ~ 3 h DNA 20 min μg μg 1C smear 3 ~ 4 μg 1C 3 4 μg ± 40 bp 2 μg ± 234 bp 1 μg ± 107 bp 0. 5 μg ± 121 bp 4 μg 0. 49% 2. 2 DNA CA USA Ct CtT 2BS CtS 3 ΔCt T / DNA S T /S = 2 ΔCt T / S ± 21 bp T /S 150 bp 1. 5% 2A 2B 1 2B 5 PD31 ~ 35 T /S cumulative population doublings CPD tel 1 GGTTTTTGAGGGT- GAGGGTGAGGGTGAGGGTGAGGGT 2. 7 μmol /L tel 2 TCCCGACTATCCCTATCCCTATCCCTATCCCTATC CCTA 9 μmol /L β-globin bp bp bp SPSS bp bp 2 ± P < PD36 ~ 45 2BS 2 1C % 5% 1A 2. 3 PCR 3 PD31 PD36 PD μmol /L DIG-labeled TTAGGG 4 3 PCR 3 10 μl 76 bp 42 6 h 8 blank negative smear min 3A 3B 3C ΔCt min % T /S DIG TTAGGG 4 1B %

4 300 PCR % % 6. 12% T /S ΔCt 9. 57% T /S PD31 PD36 F = P = DNA PD36 PD41 F = P = PD31 PD41 F = 9 T /S T /S P = PD31 ~ 45 2BS % 15 3 T /S ± ± ± T /S

5 DNA PCR % ± 9. 17% PCR 3 CPD T /S 3 1 1A % ± 6. 48% 2 A analysis of telomere amplification products in a representative measurement with electrophoresis while setting a control without templates and controls without primers B results of ΔCt values C results of corresponding T /S ratios. Figure 3 3 PCR Performance of Real-time PCR in telomere measurement 24 bp 1A bp 1 μg TTAGGG mol / / mol 1 /700 DIG- TTAGGG μg DNA 1B 1C 4 ~ 5 μg DNA EcoRⅠ MspⅠ RsaⅠ 3 EcoRⅠ 3. 5 kb MspⅠ RsaⅠ DNA PCR 150 bp 2 2BS PCR P < % PCR Cawthon DNA PCR

6 302 DNA 300 ~ 400 bp Cawthon 8 T /S 500 bp DNA 10% 2. 5% P < assessment J. J Cell Mol Med Aubert G Hills M Lansdorp PM. Telomere length measurementcaveats and a critical assessment of the available technologies and tools J. Mutat Res Cawthon RM. Telomere measurement by quantitative PCR J. Nucleic Acids Res e47. 9 Horn T Robertson BC Gemmell NJ. The use of telomere length in ecology and evolutionary biology J. Heredity Li N Li Q Cao X et al. The tumor suppressor p33ing1b upregulates p16ink4a expression and induces cellular senescence. FEBS Lett Chen H Rangasamy M Tan SY et al. Evaluation of five methods for total DNA extraction from western corn rootworm beetles. PLoS One e Grant JD Broccoli D Muquit M et al. Telometric a tool provi- reproducible measurements of telomeric DNA from constant field agarose gels J. Biotechniques DNA J PCR J ding simplified PCR 13 Cawthon RM. DNA 1 Muller HJ. The remaking of chromosomes J. The Collecting Net McClintock B. The stability of broken ends of chromosomes in zea mays J. Genetics Collado M Blasco MA Serrano M. Cellular senescence in cancer and aging J. Cell Codd V Mangino M van der Harst P et al. Common variants near TERC are associated with mean telomere length J. Nat Genet Heaphy CM Meeker AK. The potential utility of telomere-related markers for cancer diagnosis J. J Cell Mol Med Lin KW Yan J. The telomere length dynamic and methods of its Telomere length measurement by a novel monochrome multiplex quantitative PCR method J. Nucleic Acids Res e Zee RY Michaud SE Germer S et al. Association of shorter mean telomere length with risk of incident myocardial infarction a prospective nested case-control approach J. Clin Chim Acta Gardner JP Li S Srinivasan SR et al. Rise in insulin resistance is associated with escalated telomere attrition J. Circulation de Lange T Shiue L Myers RM et al. Structure and variability of human chromosome ends J. Mol Cell Biol de Lange T. Telomere dynamics and genome instability in human cancer M / /Blackburn EM Greider CW. Telomeres. New York Cold Spring Harhor Lahoratory Press