Πξνηεηλόκελα Θέκαηα Βηνινγίαο Καηεύζπλζεο Απαντήσεις: ΘΔΜΑ 1 ο 1:γ, 2:α, 3:β, 4:β, 5:δ.

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Πξνηεηλόκελα Θέκαηα Βηνινγίαο Καηεύζπλζεο 21-5-2015. Απαντήσεις: ΘΔΜΑ 1 ο 1:γ, 2:α, 3:β, 4:β, 5:δ."


1 Απαντήσεις: ΘΔΜΑ 1 ο 1:γ, 2:α, 3:β, 4:β, 5:δ. ΘΔΜΑ 2 ο Α. Η κέζνδνο αιπζηδσηήο αληίδξαζεο πνιπκεξάζεο (PCR: Polymerase Chain Reaction) καο επηηξέπεη λα αληηγξάςνπκε επηιεθηηθά, εθαηνκκύξηα θνξέο, εηδηθέο αιιεινπρίεο DNA από έλα ζύλζεην κείγκα κνξίσλ DNA, ρσξίο ηε κεζνιάβεζε δσληαλνύ θπηηάξνπ. Η ηερληθή απηή πνπ άξρηζε λα εθαξκόδεηαη επξέσο από ην 1985, έρεη απμήζεη ηελ επαηζζεζία ησλ γελεηηθώλ αλαιύζεσλ θαη έρεη πνιιέο πξαθηηθέο εθαξκνγέο. Γηα παξάδεηγκα ρξεζηκνπνηείηαη ζηελ Ιαηξηθή γηα ηε δηάγλσζε αζζελεηώλ όπσο ηνπ AIDS, ζηελ εγθιεκαηνινγία γηα ηε δηαιεύθαλζε ππνζέζεσλ θαη ζηε κειέηε DNA από απνιηζώκαηα. Β. Αξρηθά ν Mendel δεκηνύξγεζε ακηγή ζηειέρε γηα ηε ζπγθεθξηκέλε ηδηόηεηα πνπ κειεηνύζε. Αθνύ απέθηεζε ηέηνηα ζηειέρε, ζηε ζπλέρεηα έθαλε ηερλεηή γνληκνπνίεζε κεηαμύ δύν ακηγώλ θπηώλ, πνπ δηέθεξαλ σο πξνο ηελ ηδηόηεηα απηή. Σα θπηά απηά απνηεινύζαλ ηελ παηξηθή γεληά (Ρ). Οη απόγνλνη ηνπο ήηαλ ε πξώηε ζπγαηξηθή γεληά, πνπ ήηαλ άηνκα πβξηδηθά (γεληά F1,), δειαδή ήηαλ απόγνλνη ακηγώλ γνλέσλ πνπ είραλ δηαθνξεηηθή έθθξαζε ηνπ ίδηνπ ραξαθηήξα, όπσο ςειό θαη θνληό θπηό. Σα άηνκα απηά ηα άθελε λα απηνγνληκνπνηεζνύλ θαη έπαηξλε ηνπο απνγόλνπο ηνπο, πνπ απνηεινύζαλ ηε δεύηεξε ζπγαηξηθή γεληά (γεληά F2). Από ηα απνηειέζκαηα ησλ πεηξακάησλ ηνπ ν Mendel δηαηύπσζε ηνπο λόκνπο ηεο θιεξνλνκηθόηεηαο: ην λόκν ηνπ δηαρσξηζκνύ ησλ αιιειόκνξθσλ γνληδίσλ θαη ην λόκν ηεο αλεμάξηεηεο κεηαβίβαζεο ησλ γνληδίσλ. Γ. Παξόιν πνπ ε γνληδηαθή ζεξαπεία παξνπζηάδεηαη σο παλάθεηα ζηελ Ιαηξηθή, ε εθαξκνγή ηεο, ηνπιάρηζηνλ ζην άκεζν κέιινλ, ζα είλαη πεξηνξηζκέλε επεηδή δελ έρνπλ αθόκε μεπεξαζηεί πξνβιήκαηα όπσο απηά πνπ αθνξνύλ ηε ρξήζε ησλ θνξέσλ. Όπσο αλαθέξζεθε πξνεγνπκέλσο, ζηηο πεξηζζόηεξεο πεξηπηώζεηο σο θνξείο ρξεζηκνπνηνύληαη ηνί νη νπνίνη αλ θαη θαζίζηαληαη αβιαβείο, έρνπλ κηθξή πηζαλόηεηα λα πξνθαιέζνπλ παξελέξγεηεο θαη ζε νξηζκέλεο πεξηπηώζεηο

2 θαξθίλν. Έηζη ινηπόλ ε αλάπηπμε πην θαηάιιεισλ θνξέσλ είλαη ν επόκελνο ζηόρνο γηα ηε βειηίσζε ησλ κεζόδσλ ηεο γνληδηαθήο ζεξαπείαο, Γ. Η θισλνπνίεζε είλαη πνιύ ρξήζηκε ζηνλ πνιιαπιαζηαζκό δηαγνληδηαθώλ δώσλ. Η δεκηνπξγία ελόο δηαγνληδηαθνύ δώνπ πνπ παξάγεη ηνλ αλζξώπηλν παξάγνληα πήμεο ηνπ αίκαηνο, γηα παξάδεηγκα, θνζηίδεη 1-2 εθαηνκκύξηα επξώ. Με θισλνπνίεζε κπνξνύλ εύθνια λα παξαρζνύλ πνιιά παλνκνηόηππα δώα θαη έηζη αθόκε κεγαιύηεξεο πνζόηεηεο ηνπ θαξκάθνπ. Η θισλνπνίεζε κπνξεί επίζεο λα ζπλεηζθέξεη ζηελ πξνζηαζία από ηελ εμαθάληζε δηάθνξσλ δώσλ ηνπ πιαλήηε καο. ηηο θαηαςύμεηο πνιιώλ δσνινγηθώλ θήπσλ ππάξρνπλ θαηεςπγκέλα σάξηα θαη ζπεξκαηνδσάξηα ή έκβξπα δώσλ πνπ θηλδπλεύνπλ λα εμαθαληζηνύλ. Ππξήλεο από απηά ηα θύηηαξα κπνξνύλ λα κεηαθεξζνύλ ζε απύξελα σνθύηηαξα ηνπ είδνπο πνπ καο ελδηαθέξεη θαη ζηε ζπλέρεηα λα θπνθνξεζνύλ ζην ίδην ή ζε ζπγγεληθό είδνο δώνπ. ΘΔΜΑ 3 ο Α. Καηά ηε δεκηνπξγία ησλ αλαζπλδπαζκέλσλ πιαζκηδίσλ, νξηζκέλα πιαζκίδηα μαλαγίλνληαη θπθιηθά από ηελ DNA δεζκάζε, ρσξίο λα πξνζιάβνπλ μέλν DNA. Μεηά ην κεηαζρεκαηηζκό ησλ βαθηεξίσλ μεληζηώλ κε ηα πιαζκίδηα, πξνθύπηνπλ νη εμήο θαηεγνξίεο βαθηεξηαθώλ απνηθηώλ, ζε ζηεξεό ζξεπηηθό πιηθό: α. Βαθηήξηα πνπ πξνζέιαβαλ αλαζπλδπαζκέλν πιαζκίδην θαη εκθαλίδνπλ αλζεθηηθόηεηα κόλν ζηελ ακπηθηιιίλε. β. Βαθηήξηα πνπ πξνζέιαβαλ κε αλαζπλδπαζκέλν πιαζκίδην θαη εκθαλίδνπλ αλζεθηηθόηεηα ηόζν ζηελ ακπηθηιιίλε όζν θαη ζηε πεληθηιιίλε. γ. Βαθηήξηα πνπ δελ πξνζέιαβαλ αλαζπλδπαζκέλν πιαζκίδην θαη είλαη επαίζζεηα ηόζν ζηελ ακπηθηιιίλε όζν θαη ζηε πεληθηιιίλε. Η ηειηθή επηινγή ησλ βαθηεξηαθώλ θιώλσλ πνπ πεξηέρνπλ ηα αλαζπλδπαζκέλα πιαζκίδηα ζα γίλεη σο εμήο. Αξρηθά πξνζζέηνπκε ακπηθηιιίλε ζηε ζηεξεή θαιιηέξγεηα ή ζην ζξεπηηθό κέζν ηεο θαιιηέξγεηαο πξηλ ηελ αλάπηπμε ησλ απνηθηώλ, ώζηε λα κελ αλαπηπρζνύλ νη απνηθίεο ησλ βαθηεξίσλ πνπ δελ πεξηέρνπλ πιαζκίδην. ηε ζπλέρεηα κέξνο από ηηο ππόινηπεο απνηθίεο

3 κεηαθέξνληαη ζε λέν ζηεξεό ζξεπηηθό πιηθό θαη δνθηκάδνληαη σο πξνο ηελ αλζεθηηθόηεηά ηνπο ζηελ πεληθηιιίλε. Οη επαίζζεηεο ζηελ πεληθηιιίλε απνηθίεο ζα είλαη απηέο πνπ ζα πεξηέρνπλ ην αλαζπλδπαζκέλν πιαζκίδην θαη ζα αλήθνπλ ζηελ γνληδησκαηηθή καο βηβιηνζήθε. Β. Α. H ΗbA είλαη ε θύξηα αηκνζθαηξίλε ζε έλαλ πγηή ελήιηθα θαη απνηειείηαη από 2 α θαη 2 β αιπζίδεο (ζύζηαζε α 2 β 2 ). Η ΗbA 2 αληρλεύεηαη ζε κηθξέο πνζόηεηεο ζε έλαλ πγηή ελήιηθα θαη απνηειείηαη από 2 α θαη 2 δ πνιππεπηηδηθέο αιπζίδεο (ζύζηαζε α 2 δ 2 ). Η ΗbF νλνκάδεηαη θαη εκβξπηθή αηκνζθαηξίλε από ηηο ιαηηληθέο ιέμεηο Fetus (έκβξπν), θαη Fetal (εκβξπηθόο), έρεη ζύζηαζε α 2 γ 2 θαη αληρλεύεηαη ζε πνζόηεηα ιηγόηεξε από 1% ζε έλαλ πγηή ελήιηθα. Β. Ο Γηώξγνο παξνπζηάδεη παληειή έιιεηςε HbA. Σν γεγνλόο όηη παξνπζηάδεη θαη απμεκέλε ζύλζεζε HbF ζεκαίλεη όηη πάζρεη από β-ζαιαζζαηκία. ηα νκόδπγα άηνκα παξαηεξείηαη ζε πνιιέο πεξηπηώζεηο αύμεζε ηεο HbF, ε νπνία ππνθαζηζηά κεξηθώο ηε ιεηηνπξγία ηεο HbA. Η β-ζαιαζζαηκία ραξαθηεξίδεηαη από κεγάιε εηεξνγέλεηα, δειαδή πξνθαιείηαη από πνιιά δηαθνξεηηθά είδε γνληδηαθώλ κεηαιιάμεσλ όπσο αληηθαηαζηάζεηο, ειιείςεηο θαη πξνζζήθεο βάζεσλ. Σα ζπκπηώκαηα ηεο αζζέλεηαο δηαθέξνπλ σο πξνο ηε βαξύηεηα κεηαμύ δηαθόξσλ αηόκσλ θαη ζρεηίδνληαη κε ην είδνο ηεο κεηάιιαμεο πνπ ηα πξνθαιεί. Σα ζπκπηώκαηα κπνξεί λα θπκαίλνληαη από ζνβαξή αλαηκία (παληειήο έιιεηςε πνιππεπηηδηθήο αιπζίδαο β, ζπλεπώο θαη HbA) όπσο ζηελ πεξίπησζε ηνπ Γηώξγνπ έσο ιηγόηεξν ζνβαξή αλαηκία (ειάηησζε ζύλζεζεο πνιππεπηηδηθήο αιπζίδαο β, ζπλεπώο ζύλζεζε HbΑ ζε πνιύ κηθξή πνζόηεηα). Σα νκόδπγα άηνκα κε β-ζαιαζζαηκία, όπσο ν Γηώξγνο, εκθαλίδνπλ ζνβαξή αλαηκία. Η αληηκεηώπηζε γίλεηαη κε ζπρλέο κεηαγγίζεηο αίκαηνο, νη νπνίεο όκσο ζηαδηαθά δεκηνπξγνύλ πξόβιεκα ιόγσ ηεο ππεξθόξησζεο ηνπ νξγαληζκνύ κε ζίδεξν. Σν πξόβιεκα απηό αληηκεησπίδεηαη κε θαξκαθεπηηθή αγσγή (απνζηδήξσζε). Γ. Σα απνηειέζκαηα ζρεηηθά κε ην Βαζίιε δείρλνπλ απμεκέλε ζύλζεζε HbA 2 ζε ζρέζε κε ηηο θπζηνινγηθέο ηηκέο. Η αύμεζε ηεο ζπγθεθξηκέλεο αηκνζθαηξίλεο παξαηεξείηαη ζηα εηεξόδπγα άηνκα, ζηα άηνκα δειαδή πνπ είλαη θνξείο β-

4 ζαιαζζαηκίαο θαη απνηειεί δηαγλσζηηθό δείθηε. Ο Βαζίιεο παξνπζηάδεη ζπλεπώο ήπηα αλαηκία θαη δελ εθδειώλεη ηα ζπκπηώκαηα. Γ. Η Μαξία πάζρεη από δξεπαλνθπηηαξηθή αλαηκία. Αζζελείο κε δξεπαλνθππαξηθή αλαηκία είλαη νκόδπγνη γηα ην κεηαιιαγκέλν γνλίδην πνπ ζπκβνιίδεηαη κε β s. Σα άηνκα απηά παξάγνπλ κόλν HbS, θαη θαζόινπ HbA. Σν 1949, ν Linus Pauling θαη νη ζπλεξγάηεο ηνπ αλαθάιπςαλ όηη ε αηκνζθαηξίλε ησλ ελειίθσλ, HbA, δηέθεξε ζηα θπζηνινγηθά άηνκα ζε ζρέζε κε εθείλα πνπ έπαζραλ από δξεπαλνθπηηαξηθή αλαηκία. Η δηαθνξά εληνπίδεηαη ζην έθην ακηλνμύ ηεο β- πνιππεπηηδηθήο αιπζίδαο, όπνπ ην γινπηακηληθό νμύ αληηθαζίζηαηαη από βαιίλε. Η κεηαιιαγκέλε αηκνζθαηξίλε ζπκβνιίδεηαη σο HbS. Η αιιαγή ζηελ αθνινπζία ησλ ακηλνμέσλ είλαη απνηέιεζκα κηαο γνληδηαθήο κεηάιιαμεο ζηελ ηξηπιέηα πνπ θσδηθνπνηεί ην γινπηακηληθό νμύ. ηελ θσδηθή αιπζίδα ηνπ DNA δειαδή, αιιάδεη κία βάζε θαη ην θπζηνινγηθό θσδηθόλην GAG, πνπ θσδηθνπνηεί ην γινπηακηληθό νμύ, αληηθαζίζηαηαη από ην GTG, πνπ θσδηθνπνηεί ηε βαιίλε. Η κεηάιιαμε πνπ πξνθαιεί ηε δξεπαλνθπηηαξηθή αλαηκία νδεγεί ζε αιιαγή ηεο ζηεξενδηάηαμεο ηεο αηκνζθαηξίλεο, ε νπνία έρεη σο απνηέιεζκα ηελ αιιαγή ηεο κνξθήο ησλ εξπζξνθπηηάξσλ, ηα νπνία, ζε ζπλζήθεο έιιεηςεο νμπγόλνπ, παίξλνπλ ραξαθηεξηζηηθό δξεπαλνεηδέο ζρήκα. Σα δξεπαλνθύηηαξα εκπνδίδνπλ ηε θπζηνινγηθή θπθινθνξία ηνπ αίκαηνο ζηα ηξηρνεηδή αγγεία δεκηνπξγώληαο πξνβιήκαηα ζε δηάθνξα όξγαλα όπσο ζην ζπιήλα θαη ηνπο πλεύκνλεο. Σα δξεπαλνθύηηαξα θαηαζηξέθνληαη ηαρύηεξα από ηα θπζηνινγηθά κε ζπλέπεηα ηελ εκθάληζε ζπκπησκάησλ αλαηκίαο. Δ. Η Ναηαιία είλαη θνξέαο δξεπαλνθπηηαξηθήο αλαηκίαο δηόηη εθηόο από ηε θπζηνινγηθή αηκνζθαηξίλε HbA παξάγεηαη ζηα εξπζξνθύηηαξά ηεο θαη παζνινγηθή αηκνζθαηξίλε HbS (22,2%). Σα εηεξόδπγα άηνκα (θνξείο) έρνπλ έλα θπζηνινγηθό β γνλίδην θαη έλα κεηαιιαγκέλν θαη δελ εκθαλίδνπλ ηα ζπκπηώκαηα ηεο αζζέλεηαο. ηνπο θνξείο πξνθαιείηαη δξεπάλσζε κόλν ζε ζπλζήθεο κεγάιεο έιιεηςεο νμπγόλνπ, όπσο ζε πςόκεηξν κεγαιύηεξν από m. Σ. Η αλάιπζε ησλ πνζνηήησλ ησλ αηκνζθαηξηλώλ ζηνλ νξγαληζκό ηεο Διέλεο δείρλνπλ κείσζε όισλ ησλ αηκνζθαηξηλώλ. Κνηλό ραξαθηεξηζηηθό ηεο ζύζηαζεο

5 όισλ ησλ αηκνζθαηξηλώλ ηνπ αλζξώπνπ είλαη ε παξνπζία ησλ α αιπζίδσλ. πλεπώο πηζαλόηαηα ε Διέλε πάζρεη από α ζαιαζζαηκία. Σα γνλίδηα πνπ θσδηθνπνηνύλ ηελ πνιππεπηηδηθή αιπζίδα α είλαη δηπιά, δειαδή ππάξρνπλ δύν γνλίδηα α ζε θάζε νκόινγν ρξσκόζσκα. Η α-ζαιαζζαηκία είλαη απνηέιεζκα, ζρεδόλ ζε όιεο ηηο πεξηπηώζεηο, ειιείςεσλ νιόθιεξνπ ηνπ γνληδίνπ πνπ θσδηθνπνηεί ηελ πνιππεπηηδηθή αιπζίδα α. Δθόζνλ ζε θάζε άηνκν ππάξρνπλ ζπλνιηθά ηέζζεξα γνλίδηα α, ειιείςεηο κπνξεί λα δεκηνπξγεζνύλ ζε έλα, δύν, ηξία, ή θαη ζηα ηέζζεξα από απηά ηα γνλίδηα. Όζν πεξηζζόηεξα γνλίδηα α ιείπνπλ ηόζν βαξύηεξα είλαη ηα ζπκπηώκαηα ηεο αζζέλεηαο. ΘΔΜΑ 4 ο Γ1.1. Σν αληηθσδηθόλην είλαη κία εηδηθή ηξηπιέηα λνπθιενηηδίσλ ηνπ trna, ε νπνία είλαη ζπκπιεξσκαηηθή κε ην θσδηθόλην πνπ θσδηθνπνηεί ην ακηλνμύ ην νπνίν κεηαθέξεηαη θαηά ηε κεηάθξαζε από ην ζπγθεθξηκέλν trna. Σν αληηθσδηθόλην 3 CUU5 ζα πξέπεη λα ππάξρεη σο ηξηπιέηα ζην trna πνπ παξάγεηαη θαηά ηε κεηαγξαθή ηνπ γνληδίνπ ηνπ. Σν trna είλαη ζπκπιεξσκαηηθό κε ηε κε θσδηθή αιπζίδα. πλεπώο κε θσδηθή αιπζίδα είλαη ε αιπζίδα ΙΙ θαη θσδηθή ε αιπζίδα Ι. Γ1.2. Η κεηαγξαθή γίλεηαη ζε πξνζαλαηνιηζκό 5 πξνο 3 θαη ε παξαγόκελε αιπζίδα trna είλαη αληηπαξάιιειε κε ηε κε θσδηθή αιπζίδα. Οη δύν αιπζίδεο ηνπ DNA είλαη κεηαμύ ηνπο αληηπαξάιιειεο δηόηη έηζη δεκηνπξγνύληαη θαηά ηε δηάξθεηα ηεο αληηγξαθήο ηνπ DNA. Με βάζε ινηπόλ ηνλ πξνζαλαηνιηζκό ηνπ αληηθσδηθνλίνπ, νη πξνζαλαηνιηζκνί ησλ αιπζίδσλ ζα είλαη: Αλυσίδα Ι: 3 GCG GGA CTG TTA CTT AGA GCG CGA CCC 5 Αλυσίδα ΙΙ: 5 CGC CCT GAC AAT GAA TCT CGC GCT GGG3 Γ1.3. To trna πνπ παξάγεηαη από ηε κεηαγξαθή ηεο κε θσδηθήο αιπζίδαο ζα είλαη: 3 GCG GGA CUG UUA CUU AGA GCG CGA CCC 5

6 Γ2.1. Καζώο ην γνλίδην πξνέξρεηαη από πξνθαξπσηηθό νξγαληζκό δελ ζα πεξηέρεη εζώληα. Σν trna κε ην αληηθσδηθόλην 3 CUU5 ζπκκεηέρεη ζηε κεηάθξαζε ηνπ mrna πνπ πξνθύπηεη από ηε κεηαγξαθή ηνπ γνληδίνπ θαη γη απηό ην ιόγν ζα ζπλδέεηαη θαηά ηε δηάξθεηα ηεο κεηάθξαζεο κε ην θσδηθόλην 5 GAA3 ηνπ mrna. Γηα λα ππάξρεη ην ζπγθεθξηκέλν αληηθσδηθόλην ζην mrna, ζα πξέπεη λα ππάξρεη θαη ζηελ θσδηθή αιπζίδα ηνπ γνληδίνπ. Σν θσδηθόλην GAA εληνπίδεηαη ζηελ αιπζίδα ΙΙ ζπλεπώο απηή είλαη ε θσδηθή θη ε άιιε είλαη ε κε θσδηθή θαη ε κεηαγξαθόκελε. Γ2.2. Ο προζαναηολιζμός ηων αλσζίδων είναι: Αλυσίδα Ι: Αλυσίδα ΙΙ: 5 CCCGCGATGCGTT AGGGTGATTCCGGCAΤATATTGGAGAGGGΤGACCCC3 3 GGGCGCTACGCAATCCCACTAAGGCC GTΑTATAACCTCTCC CΑCTGGGG5 Γ2.3. Το mrna ποσ προκύπηει από ηη μεηαγραθή είναι: 3 GGGCGCUACGCAAUCCCACUAAGGCC GUΑUAUAACCUCUCC CΑCUGGGG5 Δ2.4. Tα αληηθωδηθόληα ηωλ trna είλαη εηδηθέο ηξηπιέηεο λνπθιενηηδίωλ κε ηηο νπνίεο ζπλδένληαη κε βάζε ηνλ θαλόλα ηεο ζπκπιεξωκαηηθόηεηαο κε ηα θωδηθόληα ηνπ mrna. Τν θωδηθόλην ιήμεο δελ αληηζηνηρεί ζε trna νύηε ζε αληηθωδηθόλην. Σπλεπώο ζα είλαη: 3 UAC5, 3 GGC5, 3 CUU5, 3 AGU5, 3 GGG5. Δ2.5. Μεηά ηε δεκηνπξγία ηνπ πεπηηδηθνύ δεζκνύ κεηαμύ ηεο ιεπθίλεο θαη ηνπ πξνεγνύκελνπ ακηλνμένο ζπάλε νη δεζκνί πδξνγόλνπ κεηαμύ θωδηθνλίνπ θαη αληηθωδηθνλίνπ ηνπ πξνεγνύκελνπ ακηλνμένο θαη κεηά ε κηθξή θαη ε κεγάιε ππνκνλάδα ηνπ ξηβνζώκαηνο κεηαθηλνύληαη θαηά έλα ακηλνμύ. Σπλεπώο ζπάδνπλ νη δεζκνί πδξνγόλνπ κεηαμύ ηνπ θωδηθνλίνπ 3 GCC5 θαη αληηθωδηθνλίνπ 3 GGC5. Σπλνιηθά ζα ζπάζνπλ 9 δεζκνί πδξνγόλνπ. Δ3.1. Τν πξηκόζωκα δεκηνπξγεί ηα πξωηαξρηθά ηκήκαηα, κηθξά ηκήκαηα RNA, θαηά ηε δηάξθεηα ηεο αληηγξαθήο ηνπ DNA. Τα πξωηαξρηθά ηκήκαηα είλαη ζπκπιεξωκαηηθά κε ηηο κεηξηθέο αιπζίδεο ηνπ DNA. Τν ζπγθεθξηκέλν είλαη ζπκπιεξωκαηηθό κε ηελ αιπζίδα ΙΙ ωο εμήο:

7 5 GCGAUGCGUU3 Αλυσίδα ΙΙ: 3 GGGCGCTACGCAATCCCACTAAGGCC GTΑTATAACCTCTCC CΑCTGGGG5 Σν πξσηαξρηθό ηκήκα παξαηεξνύκε όηη δελ ζπλδέεηαη ζηελ άθξε ηεο αιπζίδαο ΙΙ. πλεπώο ζε απηή ηελ αιπζίδα δεκηνπξγήζεθαλ πεξηζζόηεξα από έλα πξσηαξρηθά ηκήκαηα θαη ζα αληηγξάθεηαη αζπλερώο. ηελ αιπζίδα Ι ε αληηγξαθή ζαγίλεηαη κε ζπλερή ηξόπν. Δπηκέιεηα ζεκάησλ: Χάιθνο Γεκήηξηνο, Βηνιόγνο, Phd.


ΒΙΟΛΟΓΙΑ ΚΑΤΔΥΘΥΝΣΗΣ Γ ΛΥΚΔΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΔΥΘΥΝΣΗΣ Γ ΛΥΚΔΙΟΥ ΔΝΓΔΙΚΤΙΚΔΣ ΑΠΑΝΤΗΣΔΙΣ ΘΔΜΑ Α: Α1. δ Α2. β Α3. γ Α4. α Α5. γ ΘΔΜΑ Β: Β1. Σει. 14 «Μηα πνιπλνπθιενηηδηθή αιπζίδα ζρεκαηίδεηαη ν πξνζαλαηνιηζκόο ηεο πνιπλνπθιενηηδηθήο αιπζίδαο

Διαβάστε περισσότερα

Απνηειέζκαηα Εξσηεκαηνινγίνπ 2o ηεηξάκελν 2011-12

Απνηειέζκαηα Εξσηεκαηνινγίνπ 2o ηεηξάκελν 2011-12 Απνηειέζκαηα Εξσηεκαηνινγίνπ 2o ηεηξάκελν 11-12 Project 6: Ταμίδη κε ηε Μεραλή ηνπ Φξόλνπ Υπεύζπλνη Καζεγεηέο: Ε. Μπηιαλάθε Φ. Αλησλάηνο Δρώηηζη 3: Πνηα από ηα παξαθάησ ΜΜΕ ηεξαξρείηε από πιεπξάο ζεκαζίαο;

Διαβάστε περισσότερα

Αζθήζεηο 5 νπ θεθαιαίνπ Crash course Step by step training. Dipl.Biol.cand.med. Stylianos Kalaitzis

Αζθήζεηο 5 νπ θεθαιαίνπ Crash course Step by step training. Dipl.Biol.cand.med. Stylianos Kalaitzis Αζθήζεηο 5 νπ θεθαιαίνπ Crash course Step by step training Dipl.Biol.cand.med. Stylianos Kalaitzis Stylianos Kalaitzis Μνλνϋβξηδηζκνο 1 Γπν γνλείο, εηεξόδπγνη γηα ηνλ αιθηζκό θάλνπλ παηδηά. Πνία ε πηζαλόηεηα

Διαβάστε περισσότερα


H ΜΑΓΕΙΑ ΤΩΝ ΑΡΙΘΜΩΝ H ΜΑΓΕΙΑ ΤΩΝ ΑΡΙΘΜΩΝ Φξεζηκόηεηα καζεκαηηθώλ Αξρή θαηακέηξεζεο Όζα έδσζαλ νη Έιιελεο... Τξίγσλνη αξηζκνί Τεηξάγσλνη αξηζκνί Δπηκήθεηο αξηζκνί Πξώηνη αξηζκνί Αξηζκνί κε μερσξηζηέο ηδηόηεηεο Γίδπκνη πξώηνη

Διαβάστε περισσότερα


ΠΑΡΑΡΣΗΜΑ Δ. ΔΤΡΔΗ ΣΟΤ ΜΔΣΑΥΗΜΑΣΙΜΟΤ FOURIER ΓΙΑΦΟΡΩΝ ΗΜΑΣΩΝ ΠΑΡΑΡΣΗΜΑ Δ. ΔΤΡΔΗ ΣΟΤ ΜΔΣΑΥΗΜΑΣΙΜΟΤ FOURIER ΓΙΑΦΟΡΩΝ ΗΜΑΣΩΝ Εδώ ζα ππνινγίζνπκε ην κεηαζρεκαηηζκό Fourier κεξηθώλ αθόκα ζεκάησλ, πξνζπαζώληαο λα μεθηλήζνπκε από ην κεηαζρεκαηηζκό Fourier γλσζηώλ ζεκάησλ

Διαβάστε περισσότερα

ΓΗΑΓΩΝΗΣΜΑ ΣΤΑ ΜΑΘΖΜΑΤΗΚΑ. Ύλη: Μιγαδικοί-Σσναρηήζεις-Παράγωγοι Θεη.-Τετν. Καη Εήηημα 1 ο :

ΓΗΑΓΩΝΗΣΜΑ ΣΤΑ ΜΑΘΖΜΑΤΗΚΑ. Ύλη: Μιγαδικοί-Σσναρηήζεις-Παράγωγοι Θεη.-Τετν. Καη Εήηημα 1 ο : ΓΗΑΓΩΝΗΣΜΑ ΣΤΑ ΜΑΘΖΜΑΤΗΚΑ Ον/μο:.. Γ Λσκείοσ Ύλη: Μιγαδικοί-Σσναρηήζεις-Παράγωγοι Θεη.-Τετν. Καη. 11-1-11 Εήηημα 1 ο : Α. Γηα ηελ ζπλάξηεζε f, λα βξείηε ην δηάζηεκα ζην νπνίν είλαη παξαγσγίζηκε θαζώο θαη

Διαβάστε περισσότερα

ει. 36 παιαηνύ ζρνιηθνύ βηβιίνπ (ζει. 40 ηνπ λένπ ζρνιηθνύ βηβιίνπ): «Καηά ηελ έλαξμε ζύκπινθν έλαξμεο ηεο πξσηετλνζύλζεζεο.»

ει. 36 παιαηνύ ζρνιηθνύ βηβιίνπ (ζει. 40 ηνπ λένπ ζρνιηθνύ βηβιίνπ): «Καηά ηελ έλαξμε ζύκπινθν έλαξμεο ηεο πξσηετλνζύλζεζεο.» ΠΑΝΔΛΛΑΓΗΚΔ ΔΞΔΣΑΔΗ Γ ΣΑΞΖ ΖΜΔΡΖΗΟΤ ΓΔΝΗΚΟΤ ΛΤΚΔΗΟΤ ΚΑΗ ΔΠΑΛ (ΟΜΑΓΑ Β ) ΠΑΡΑΚΔΤΖ 22 ΜΑΪΟΤ 2015 - ΔΞΔΣΑΕΟΜΔΝΟ ΜΑΘΖΜΑ: ΒΗΟΛΟΓΗΑ ΘΔΣΗΚΖ ΚΑΣΔΤΘΤΝΖ ΘΔΜΑ Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ ΘΔΜΑ Β Β1. 1 Α 2 Β 3

Διαβάστε περισσότερα


ΔΝΓΔΙΚΤΙΚΔΣ ΛΥΣΔΙΣ ΣΤΑ ΜΑΘΗΜΑΤΙΚΑ ΚΑΤΔΥΘΥΝΣΗΣ Γ ΛΥΚΔΙΟΥ ΓΔΥΤΔΡΑ 27 ΜΑΪΟΥ 2013 ΔΝΓΔΙΚΤΙΚΔΣ ΛΥΣΔΙΣ ΣΤΑ ΜΑΘΗΜΑΤΙΚΑ ΚΑΤΔΥΘΥΝΣΗΣ Γ ΛΥΚΔΙΟΥ ΓΔΥΤΔΡΑ 7 ΜΑΪΟΥ 13 ΘΔΜΑ Α : (Α1) Σρνιηθό βηβιίν ζειίδα 33-335 (Α) Σρνιηθό βηβιίν ζειίδα 6 (Α3) Σρνιηθό βηβιίν ζειίδα (Α) α) Λάζνο β) Σωζηό γ) Σωζηό

Διαβάστε περισσότερα


ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου ΥΟΛΕΙΟ.. ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου έλαξμεο 09.30 ιήμεο 09.45 Σην παξαθάησ ζρήκα θαίλεηαη ηκήκα ελόο πνιενδνκηθνύ ζρεδίνπ κηαο πόιεο. Οη ζθηαζκέλεο

Διαβάστε περισσότερα

Άζκηζη ζτέζης κόζηοσς-τρόνοσ (Cost Time trade off) Καηαζκεσαζηική ΑΔ

Άζκηζη ζτέζης κόζηοσς-τρόνοσ (Cost Time trade off) Καηαζκεσαζηική ΑΔ Άζκηζη ζτέζης κόζηοσς-τρόνοσ (Cost Time trade off) Καηαζκεσαζηική Δίζηε μησανικόρ διοίκηζηρ μεγάληρ καηαζκεςαζηικήρ εηαιπείαρ και καλείζηε να ςλοποιήζεηε ηο έπγο πος πεπιγπάθεηαι από ηον Πίνακα 1. Κωδ.

Διαβάστε περισσότερα

ΔΕΟ 13. Ποσοτικές Μέθοδοι. θαη λα ππνινγίζεηε ην θόζηνο γηα 10000 παξαγόκελα πξντόληα. Να ζρεδηαζηεί γηα εύξνο πξντόλησλ έσο 30000.

ΔΕΟ 13. Ποσοτικές Μέθοδοι. θαη λα ππνινγίζεηε ην θόζηνο γηα 10000 παξαγόκελα πξντόληα. Να ζρεδηαζηεί γηα εύξνο πξντόλησλ έσο 30000. ΔΕΟ 13 Ποσοτικές Μέθοδοι Σσνάρηηζη Κόζηοσς C(), μέζο κόζηος C()/. Παράδειγμα 1 Μηα εηαηξεία δαπαλά γηα θάζε πξντόλ Α πνπ παξάγεη 0.0 λ.κ. Τα πάγηα έμνδα ηεο εηαηξείαο είλαη 800 λ.κ. Ζεηείηαη 1) Να πεξηγξάςεηε

Διαβάστε περισσότερα

Απαντήσεις θέματος 2. Παξαθάησ αθνινπζεί αλαιπηηθή επίιπζε ησλ εξσηεκάησλ.

Απαντήσεις θέματος 2. Παξαθάησ αθνινπζεί αλαιπηηθή επίιπζε ησλ εξσηεκάησλ. Απαντήσεις θέματος 2 Απηά πνπ έπξεπε λα γξάςεηε (δελ ρξεηαδόηαλ δηθαηνιόγεζε εθηόο από ην Γ) Α return a*b; Β 0:acegf2, 1: acegf23, 2: acegf234, 3:acegf2345, 4:acegf23456, 5:acegf234567, 6:acegf2345678,

Διαβάστε περισσότερα


ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου ΥΟΛΕΙΟ.. ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου έλαξμεο 09.30 ιήμεο 09.45 Σην παξαθάησ ζρήκα θαίλεηαη ηκήκα ελόο πνιενδνκηθνύ ζρεδίνπ κηαο πόιεο. Οη ζθηαζκέλεο

Διαβάστε περισσότερα


ΠΟΛΤΜΕΡΙΜΟ - ΠΕΣΡΟΥΗΜΙΚΑ ΠΟΛΤΜΕΡΙΜΟ - ΠΕΣΡΟΥΗΜΙΚΑ ΠΑΡΑΔΕΙΓΜΑΣΑ Ο πολσμεριζμός Πολσμεριζμός είναι η τημική ανηίδραζη καηά ηην οποία πολλά μόρια ίδιων ή διαθορεηικών οργανικών ενώζεων, ποσ ονομάζονηαι μονομερή, ενώνονηαι και ζτημαηίζοσν

Διαβάστε περισσότερα

Πολυεπίπεδα/Διασυμδεδεμέμα Δίκτυα

Πολυεπίπεδα/Διασυμδεδεμέμα Δίκτυα Πολυεπίπεδα/Διασυμδεδεμέμα Δίκτυα Κοιμωμικά δίκτυα (multiplex network) Έρεηε ινγαξηαζκό ζην Facebook? Έρεηε ινγαξηαζκό ζην LinkedIn? Έρεηε ινγαξηαζκό ζην Twitter? Αεροπορικές γραμμές της Ευρώπης(multiplex

Διαβάστε περισσότερα


ΓΔΧΜΔΣΡΙΑ ΓΙΑ ΟΛΤΜΠΙΑΓΔ ΒΑΓΓΔΛΗ ΦΤΥΑ 2009 ελίδα 2 από 9 ΔΤΘΔΙΔ SIMSON 1 ΒΑΙΚΔ ΠΡΟΣΑΔΙ 1.1 ΔΤΘΔΙΑ SIMSON Γίλεηαη ηξίγσλν AB θαη ηπρόλ ζεκείν ηνπ πεξηγεγξακκέλνπ θύθινπ ηνπ. Αλ 1, 1 θαη 1 είλαη νη πξνβνιέο ηνπ ζηηο επζείεο πνπ

Διαβάστε περισσότερα


ΕΛΛΗΝΙΚΟ ΑΝΟΙΚΤΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΕΛΛΗΝΙΚΟ ΑΝΟΙΚΤΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΣΠΟΥΔΕΣ ΣΤΙΣ ΦΥΣΙΚΕΣ ΕΠΙΣΤΗΜΕΣ ΓΕΝΙΚΑ ΜΑΘΗΜΑΤΙΚΑ ΙΙ - ΦΥΕ 0 7 Ινπλίνπ 009 Απαντήσειρ στιρ ασκήσειρ τηρ τελικήρ εξέτασηρ στιρ Σςνήθειρ Διαυοπικέρ Εξισώσειρ Αγαπηηέ θοιηηηή/ηπια,

Διαβάστε περισσότερα

Μονοψϊνιο. Αγνξά κε ιίγνπο αγνξαζηέο. Δύναμη μονοψωνίος Η ηθαλόηεηα πνπ έρεη ν αγνξαζηήο λα επεξεάζεη ηελ ηηκή ηνπ αγαζνύ.

Μονοψϊνιο. Αγνξά κε ιίγνπο αγνξαζηέο. Δύναμη μονοψωνίος Η ηθαλόηεηα πνπ έρεη ν αγνξαζηήο λα επεξεάζεη ηελ ηηκή ηνπ αγαζνύ. Μονοψϊνιο Ολιγοψώνιο Αγνξά κε ιίγνπο αγνξαζηέο. Δύναμη μονοψωνίος Η ηθαλόηεηα πνπ έρεη ν αγνξαζηήο λα επεξεάζεη ηελ ηηκή ηνπ αγαζνύ. Οπιακή αξία Δπηπξόζζεηα νθέιε από ηελ ρξήζε/θαηαλάισζε κηαο επηπξόζζεηε

Διαβάστε περισσότερα


ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΔΣΑΙΡΔΙΑ ΠΑΓΚΤΠΡΙΟ ΓΙΑΓΩΝΙ ΜΟ ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΔΣΑΙΡΔΙΑ ΠΑΓΚΤΠΡΙΟ ΓΙΑΓΩΝΙ ΜΟ Α ΛΤΚΔΙΟΤ Ζμεπομηνία: 18/12/10 Ώπα εξέτασηρ: 09:30-12:30 ΠΡΟΣΕΙΝΟΜΕΝΕ ΛΤ ΕΙ 1. Δίλεηαη ην πνιπώλπκν Αλ θαη., λα βξείηε ην ηειεπηαίν ςεθίν ηνπ αξηζκνύ έρνπκε:

Διαβάστε περισσότερα

ΑΝΤΗΛΙΑΚΑ. Η Μηκή ζθέθηεθε έλαλ ηξόπν, γηα λα ζπγθξίλεη κεξηθά δηαθνξεηηθά αληειηαθά πξντόληα. Απηή θαη ν Νηίλνο ζπλέιεμαλ ηα αθόινπζα πιηθά:

ΑΝΤΗΛΙΑΚΑ. Η Μηκή ζθέθηεθε έλαλ ηξόπν, γηα λα ζπγθξίλεη κεξηθά δηαθνξεηηθά αληειηαθά πξντόληα. Απηή θαη ν Νηίλνο ζπλέιεμαλ ηα αθόινπζα πιηθά: ΑΝΤΗΛΙΑΚΑ Η Μηκή θαη ν Νηίλνο αλαξσηήζεθαλ πνην αληειηαθό πξντόλ παξέρεη ηελ θαιύηεξε πξνζηαζία ζην δέξκα ηνπο. Τα αληειηαθά πξντόληα έρνπλ έλα δείθηε αληειηαθήο πξνζηαζίαο (SPF), ν νπνίνο δείρλεη πόζν

Διαβάστε περισσότερα


ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΤΙΚΗ ΣΚΥΤΑΛΟΓΡΟΜΙΑ 2015 ΓΙΑ ΤΟ ΓΥΜΝΑΣΙΟ Τεηάπηη 28 Ιανουαπίου 2015 ΛΔΥΚΩΣΙΑ Τάξη: Α Γυμναζίου ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΤΙΚΗ ΣΚΥΤΑΛΟΓΡΟΜΙΑ 2015 ΓΙΑ ΤΟ ΓΥΜΝΑΣΙΟ Τεηάπηη 28 Ιανουαπίου 2015 ΛΔΥΚΩΣΙΑ Τάξη: Α Γυμναζίου ΠΡΟΒΛΗΜΑ Σε έλα ηνπξλνπά βόιετ δήισζαλ ζπκκεηνρή νκάδεο Γπκλαζίσλ ηεο Κύπξνπ.

Διαβάστε περισσότερα


ΑΛΛΑΓΗ ΟΝΟΜΑΣΟ ΚΑΙ ΟΜΑΔΑ ΕΡΓΑΙΑ, ΚΟΙΝΟΥΡΗΣΟΙ ΦΑΚΕΛΟΙ ΚΑΙ ΕΚΣΤΠΩΣΕ ΣΑ WINDOWS XP ΑΛΛΑΓΗ ΟΝΟΜΑΣΟ ΚΑΙ ΟΜΑΔΑ ΕΡΓΑΙΑ, ΚΟΙΝΟΥΡΗΣΟΙ ΦΑΚΕΛΟΙ ΚΑΙ ΕΚΣΤΠΩΣΕ ΣΑ WINDOWS XP ηότοι εργαζηηρίοσ ην πιαίζην ηνπ ζπγθεθξηκέλνπ εξγαζηεξίνπ ζα παξνπζηαζηνύλ βαζηθέο ιεηηνπξγίεο ησλ Windows XP πνπ ζρεηίδνληαη

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Κευάλαιο 8 Μονοπωλιακή Συμπεριφορά- Πολλαπλή Τιμολόγηση

Κευάλαιο 8 Μονοπωλιακή Συμπεριφορά- Πολλαπλή Τιμολόγηση Κευάλαιο 8 Μονοπωλιακή Συμπεριφορά- Πολλαπλή Τιμολόγηση Πώς πρέπει να τιμολογεί ένα μονοπώλιο; Μέρξη ζηηγκήο ην κνλνπώιην έρεη ζεσξεζεί ζαλ κηα επηρείξεζε ε νπνία πσιεί ην πξντόλ ηεο ζε θάζε πειάηε ζηελ

Διαβάστε περισσότερα

iii. iv. γηα ηελ νπνία ηζρύνπλ: f (1) 2 θαη

iii. iv. γηα ηελ νπνία ηζρύνπλ: f (1) 2 θαη ΔΠΑΝΑΛΗΠΣΙΚΑ ΘΔΜΑΣΑ ΣΟ ΓΙΑΦΟΡΙΚΟ ΛΟΓΙΜΟ Μάρτιος 0 ΘΔΜΑ Να ππνινγίζεηε ηα όξηα: i ii lim 0 0 lim iii iv lim e 0 lim e 0 ΘΔΜΑ Γίλεηαη ε άξηηα ζπλάξηεζε '( ) ( ) γηα θάζε 0 * : R R γηα ηελ νπνία ηζρύνπλ:

Διαβάστε περισσότερα

Δπηιέγνληαο ην «Πξνεπηινγή» θάζε θνξά πνπ ζα ζπλδέεζηε ζηελ εθαξκνγή ζα βξίζθεζηε ζηε λέα ρξήζε.

Δπηιέγνληαο ην «Πξνεπηινγή» θάζε θνξά πνπ ζα ζπλδέεζηε ζηελ εθαξκνγή ζα βξίζθεζηε ζηε λέα ρξήζε. ΑΝΟΙΓΜΑ ΝΔΑ ΥΡΗΗ 1. Γεκηνπξγείηε ηε λέα ρξήζε από ηελ επηινγή «Παξάκεηξνη/Παξάκεηξνη Δηαηξίαο/Γηαρείξηζε Δηαηξηώλ». Πιεθηξνινγείηε ηνλ θσδηθό ηεο εηαηξίαο ζαο θαη παηάηε Enter. Σηελ έλδεημε «Υξήζεηο» παηάηε

Διαβάστε περισσότερα

ΜΑΘΗΜΑΣΑ ΦΩΣΟΓΡΑΦΙΑ. Ειζαγωγή ζηη Φωηογραθία. Χριζηάκης Σαζεΐδης EFIAP

ΜΑΘΗΜΑΣΑ ΦΩΣΟΓΡΑΦΙΑ. Ειζαγωγή ζηη Φωηογραθία. Χριζηάκης Σαζεΐδης EFIAP ΜΑΘΗΜΑΣΑ ΦΩΣΟΓΡΑΦΙΑ Ειζαγωγή ζηη Φωηογραθία Χριζηάκης Σαζεΐδης EFIAP 1 ΜΑΘΗΜΑ 6 ο Προγράμμαηα θωηογραθικών μηχανών Επιλογέας προγραμμάηων Μαο δίλεη ηε δπλαηόηεηα λα ειέγμνπκε ην άλνηγκα δηαθξάγκαηνο θαη

Διαβάστε περισσότερα

Βάσεις Δεδομέμωμ. Εξγαζηήξην V. Τκήκα Πιεξνθνξηθήο ΑΠΘ 2015-2016

Βάσεις Δεδομέμωμ. Εξγαζηήξην V. Τκήκα Πιεξνθνξηθήο ΑΠΘ 2015-2016 Βάσεις Δεδομέμωμ Εξγαζηήξην V Τκήκα Πιεξνθνξηθήο ΑΠΘ 2015-2016 2 Σκοπός του 5 ου εργαστηρίου Σθνπόο απηνύ ηνπ εξγαζηεξίνπ είλαη: ε κειέηε ζύλζεησλ εξσηεκάησλ ζύλδεζεο ζε δύν ή πεξηζζόηεξεο ζρέζεηο ε κειέηε

Διαβάστε περισσότερα

Κεθάλαιο 7. Πξνζθνξά ηνπ θιάδνπ Μ. ΨΥΛΛΑΚΗ

Κεθάλαιο 7. Πξνζθνξά ηνπ θιάδνπ Μ. ΨΥΛΛΑΚΗ Κεθάλαιο 7 Πξνζθνξά ηνπ θιάδνπ 1 Προζθορά ανηαγωνιζηικού κλάδοσ Πώο πξέπεη λα ζπλδπαζηνύλ νη απνθάζεηο πξνζθνξάο ησλ πνιιώλ επηκέξνπο επηρεηξήζεσλ ελόο αληαγσληζηηθνύ θιάδνπ γηα λα βξνύκε ηελ θακπύιε πξνζθνξάο

Διαβάστε περισσότερα

Α. Εηζαγσγή ηεο έλλνηαο ηεο ηξηγσλνκεηξηθήο εμίζσζεο κε αξρηθό παξάδεηγκα ηελ εκx = 2

Α. Εηζαγσγή ηεο έλλνηαο ηεο ηξηγσλνκεηξηθήο εμίζσζεο κε αξρηθό παξάδεηγκα ηελ εκx = 2 ΣΡΙΓΩΝΟΜΔΣΡΙΚΔ EΞΙΩΔΙ Πνηα παξαδείγκαηα εμηζώζεσλ ή θαη πξνβιεκάησλ πηζηεύεηαη όηη είλαη θαηάιιεια γηα ηελ επίιπζε ηνπο θαηά ηελ δηάξθεηα ηεο δηδαθηηθήο δηαδηθαζίαο κέζα ζηελ ηάμε; 1 ε ΓΙΓΑΚΣΙΚΗ ΩΡΑ Α.

Διαβάστε περισσότερα

Constructors and Destructors in C++

Constructors and Destructors in C++ Constructors and Destructors in C++ Σύνθεζη Πνιύ ζπρλά ζηε C++ κία θιάζε κπνξεί λα πεξηέρεη ζαλ κέιεδεδνκέλα αληηθείκελα άιισλ θιάζεσλ. Πνηα είλαη ε ζεηξά κε ηελ νπνία δεκηνπξγνύληαη θαη θαηαζηξέθνληαη

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α ΕΚΦΩΝΗΣΕΙΣ Ένα από τα trna που µεταφέρουν το αµινοξύ Λευκίνη έχει ως αντικωδικόνιο την αλληλουχία 3 CUU5. Αλυσίδα Ι: GCG GGA CTG TTA CTT AGA GCG CGA CCC Αλυσίδα

Διαβάστε περισσότερα

Παιχνίδι γλωζζικής καηανόηζης με ζχήμαηα!

Παιχνίδι γλωζζικής καηανόηζης με ζχήμαηα! Cpyright 2013 Λόγος & Επικοινωνία // All rights Reserved Παιχνίδι γλωζζικής καηανόηζης με ζχήμαηα! Αυηό ηο παιχνίδι έχει ζηόχους: 1. ηελ εθγύκλαζε ηεο αθνπζηηθήο κλήκεο ησλ παηδηώλ 2. ηελ εμάζθεζε ζηελ

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΗΛΕΚΤΡΟΛΟΓΙΑ/Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 08/09/2014 ΔΙΑΓΩΝΙΣΜΑ ΕΚΠ. ΕΤΟΥΣ 204-205 ΜΑΘΗΜΑ / ΤΑΞΗ : ΗΛΕΚΤΡΟΛΟΓΙΑ/Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 08/09/204 A ΟΜΑΓΑ Οδηγία: Να γράυεηε ζηο ηεηράδιο ζας ηον αριθμό κάθε μιας από ηις παρακάηφ ερφηήζεις Α.-Α.8 και

Διαβάστε περισσότερα

Τν Πξόγξακκα ζα αλαθνηλσζεί, ακέζσο κεηά ηηο γηνξηέο ηνπ Πάζρα.

Τν Πξόγξακκα ζα αλαθνηλσζεί, ακέζσο κεηά ηηο γηνξηέο ηνπ Πάζρα. Οι Πανελλαδικέρ Δξεηάζειρ για ηην ειζαγωγή ζηην ηπιηοβάθμια εκπαίδεςζη θα ππαγμαηοποιηθούν ππιν ηιρ απολςηήπιερ ενδοζσολικέρ εξεηάζειρ ηων μαθηηών και ηων μαθηηπιών. Τν Πξόγξακκα ζα αλαθνηλσζεί, ακέζσο

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΔΙΣ ΓΙΚΤΥΑ ΥΠΟΛΟΓΙΣΤΩΝ II ΔΠΑΛ ΑΠΑΝΤΗΣΔΙΣ ΓΙΚΤΥΑ ΥΠΟΛΟΓΙΣΤΩΝ II ΔΠΑΛ ΘΔΜΑ Α Α1. α. Σ β. Σ γ. Λ δ. Λ ε. Λ ζη. Σ Α2. Γ Α3. 1. γ 2. ε 3. δ 4. α Β1. ΘΔΜΑ Β Οη ηειηθνί ππνινγηζηέο παίξλνπλ απνθάζεηο δξνκνιόγεζεο κόλν γηα ηα δηθά ηνπο απηνδύλακα

Διαβάστε περισσότερα

Σημεία Ασύπματηρ Ππόσβασηρ (Hot-Spots)

Σημεία Ασύπματηρ Ππόσβασηρ (Hot-Spots) Σημεία Ασύπματηρ Ππόσβασηρ (Hot-Spots) 1.1 Σςνοπτική Πεπιγπαυή Hot Spots Σα ζεκεία αζύξκαηεο πξόζβαζεο πνπ επηιέρζεθαλ αλαθέξνληαη ζηνλ επόκελν πίλαθα θαη παξνπζηάδνληαη αλαιπηηθά ζηηο επόκελεο παξαγξάθνπο.

Διαβάστε περισσότερα

Λεκηική έκθραζη, κριηική, οικειόηηηα και ηύπος δεζμού ζηις ζηενές διαπροζωπικές ζτέζεις

Λεκηική έκθραζη, κριηική, οικειόηηηα και ηύπος δεζμού ζηις ζηενές διαπροζωπικές ζτέζεις Λεκηική έκθραζη, κριηική, οικειόηηηα και ηύπος δεζμού ζηις ζηενές διαπροζωπικές ζτέζεις Μαξία-Ησάλλα Αξγπξνπνύινπ Βαζίιεο Παπιόπνπινο Τνκέαο Ψπρνινγίαο, Παλεπηζηήκην Αζελώλ Αλαθνίλσζε ζην 5 ν Παλειιήλην

Διαβάστε περισσότερα


ΘΔΜΑ Α ΘΔΜΑ Β ΑΠΑΝΣΖΔΗ ΘΔΜΑΣΩΝ ΒΗΟΛΟΓΗΑ ΚΑΣΔΤΘΤΝΖ. Α1.δ Α2.δ Α3.β Α4.γ Α5.α Β1. Α. I B. IV Γ. VI Γ. VII E. IΙ Σ. IΙΙ Ε. V ΑΠΑΝΣΖΔΗ ΘΔΜΑΣΩΝ ΒΗΟΛΟΓΗΑ ΚΑΣΔΤΘΤΝΖ 1 ΘΔΜΑ Α Α1.δ Α2.δ Α3.β Α4.γ Α5.α ΘΔΜΑ Β Β1. Α. I B. IV Γ. VI Γ. VII E. IΙ Σ. IΙΙ Ε. V Β2. Η εηθόλα 1 αληηζηνηρεί ζε πξνθαξπσηηθό θύηηαξν. τολικό Βιβλίο ζελ.33 «Σηνπο

Διαβάστε περισσότερα

Β3: Σει 98 Η δηάγλσζε ησλ γελεηηθώλ αζζελεηώλ.ηνπ DNA (κνξηαθή δηάγλσζε).

Β3: Σει 98 Η δηάγλσζε ησλ γελεηηθώλ αζζελεηώλ.ηνπ DNA (κνξηαθή δηάγλσζε). Βιολογία Κατεύθυνσης Απαντήσεις Θέμα Α Α1: δ Α2: γ Α3: β Α4: γ Α5: β Θέμα Β Β1: 4 2 1 6 3 5 Β2: α: DNA πνιπκεξάζε β: πξηκόζσκα γ: DNA δεζκάζε δ: DNA ειηθάζε ε: RNA πνιπκεξάζε Β3: Σει 98 Η δηάγλσζε ησλ

Διαβάστε περισσότερα

ΔΦΑΡΜΟΜΔΝΑ ΜΑΘΗΜΑΣΙΚΑ ΣΗ ΧΗΜΔΙΑ Ι ΘΔΜΑΣΑ Α επηέκβξηνο 2009. 1. Να ππνινγηζηνύλ νη κεξηθέο παξάγσγνη πξώηεο ηάμεο ηεο ζπλάξηεζεο f(x,y) =

ΔΦΑΡΜΟΜΔΝΑ ΜΑΘΗΜΑΣΙΚΑ ΣΗ ΧΗΜΔΙΑ Ι ΘΔΜΑΣΑ Α επηέκβξηνο 2009. 1. Να ππνινγηζηνύλ νη κεξηθέο παξάγσγνη πξώηεο ηάμεο ηεο ζπλάξηεζεο f(x,y) = ΘΔΜΑΣΑ Α επηέκβξηνο 9. Να ππνινγηζηνύλ νη κεξηθέο παξάγσγνη πξώηεο ηάμεο ηεο ζπλάξηεζεο f(,y) = y.. Να ππνινγηζηνύλ ηα νινθιεξώκαηα: a) ln b) a) 3cos b) e sin 4. Να ππνινγηζηεί ην νινθιήξσκα: S ( y) 3

Διαβάστε περισσότερα

B-Δέλδξα. Τα B-δέλδξα ρξεζηκνπνηνύληαη γηα ηε αλαπαξάζηαζε πνιύ κεγάισλ ιεμηθώλ πνπ είλαη απνζεθεπκέλα ζην δίζθν.

B-Δέλδξα. Τα B-δέλδξα ρξεζηκνπνηνύληαη γηα ηε αλαπαξάζηαζε πνιύ κεγάισλ ιεμηθώλ πνπ είλαη απνζεθεπκέλα ζην δίζθν. B-Δέλδξα Τα B-δέλδξα ρξεζηκνπνηνύληαη γηα ηε αλαπαξάζηαζε πνιύ κεγάισλ ιεμηθώλ πνπ είλαη απνζεθεπκέλα ζην δίζθν. Δέλδξα AVL n = 2 30 = 10 9 (πεξίπνπ). 30

Διαβάστε περισσότερα

Εςθςή ζςζηήμαηα επισειπήζεων και αξιολόγηζη

Εςθςή ζςζηήμαηα επισειπήζεων και αξιολόγηζη Εςθςή ζςζηήμαηα επισειπήζεων και αξιολόγηζη Μάθημα 11 Τμήμα Μάπκεηινγκ και Διοίκηζηρ Λειηοςπγιών Τα δηαγξάκκαηα θαηάζηαζεο (state diagrams) ρξεζηκνπνηνύληαη γηα λα βνεζήζνπλ ηνλ πξνγξακκαηηζηή λα θαηαιάβεη

Διαβάστε περισσότερα

Μηα ζπλάξηεζε κε πεδίν νξηζκνύ ην Α, ζα ιέκε όηη παξνπζηάδεη ηοπικό μέγιζηο ζην, αλ ππάξρεη δ>0, ηέηνην ώζηε:

Μηα ζπλάξηεζε κε πεδίν νξηζκνύ ην Α, ζα ιέκε όηη παξνπζηάδεη ηοπικό μέγιζηο ζην, αλ ππάξρεη δ>0, ηέηνην ώζηε: 1 ΟΡΙΜΟΙ MONOTONIA AKΡOTATA Μηα ζπλάξηεζε κε πεδίν νξηζκνύ ην Α, ζα ιέκε όηη παξνπζηάδεη ηοπικό μέγιζηο ζην, αλ ππάξρεη δ>0, ηέηνην ώζηε: Σν ιέγεηαη ζέζε ή ζεκείν ηνπ ηνπηθνύ κεγίζηνπ θαη ην ( ηνπηθό κέγηζην.

Διαβάστε περισσότερα


ΑΠΛΟΠΟΙΗΗ ΛΟΓΙΚΩΝ ΤΝΑΡΣΗΕΩΝ ΜΕ ΠΙΝΑΚΕ KARNAUGH ΑΠΛΟΠΟΙΗΗ ΛΟΓΙΚΩΝ ΤΝΑΡΣΗΕΩΝ ΜΕ ΠΙΝΑΚΕ KRNUGH Γηα λα θάλνπκε απινπνίεζε κηαο ινγηθήο ζπλάξηεζεο κε πίλαθα (ή ράξηε) Karnaugh αθνινπζνύκε ηα παξαθάησ βήκαηα:. Η ινγηθή ζπλάξηεζε ζα πξέπεη λα είλαη ζε πιήξε

Διαβάστε περισσότερα

ΛΙΜΝΗ ΤΣΑΝΤ. Σρήκα 1. Σρήκα 2

ΛΙΜΝΗ ΤΣΑΝΤ. Σρήκα 1. Σρήκα 2 ΛΙΜΝΗ ΤΣΑΝΤ Τν Σρήκα 1 δείρλεη ηελ αιιαγή ηεο ζηάζκεο ηεο Λίκλεο Τζαλη, ζηε Σαράξα ηεο Βόξεηαο Αθξηθήο. Η Λίκλε Τζαλη εμαθαλίζηεθε ηειείσο γύξσ ζην 20.000 π.χ., θαηά ηε δηάξθεηα ηεο ηειεπηαίαο επνρήο ησλ

Διαβάστε περισσότερα

T A E K W O N D O. Δ. ΠπθαξΨο. ΔπΫθνπξνο ΘαζεγεηΪο ΑζιεηηθΪο ΦπζηθνζεξαπεΫαο ΡΔΦΑΑ - ΑΞΘ

T A E K W O N D O. Δ. ΠπθαξΨο. ΔπΫθνπξνο ΘαζεγεηΪο ΑζιεηηθΪο ΦπζηθνζεξαπεΫαο ΡΔΦΑΑ - ΑΞΘ T A E K W O N D O Δ. ΠπθαξΨο ΔπΫθνπξνο ΘαζεγεηΪο ΑζιεηηθΪο ΦπζηθνζεξαπεΫαο ΡΔΦΑΑ - ΑΞΘ ΦΠΗΘΝΘΔΟΑΞΔΗΑ Ο Ρ Ι Μ Ο Φπζη(θ)νζεξαπεΫα εϋλαη ε επηζηϊκε, ε νπνϋα κόλν κε θπζηθψ κωζα θαη κεζόδνπο πξνζπαζεϋ λα ζεξαπεύζεη

Διαβάστε περισσότερα


TOOLBOOK (μάθημα 2) Δεκηνπξγία βηβιίνπ θαη ζειίδσλ ΠΡΟΑΡΜΟΓΗ: ΒΑΛΚΑΝΙΩΣΗ ΔΗΜ. ΕΚΠΑΙΔΕΤΣΙΚΟ ΠΕ19 1 TOOLBOOK ΜΑΘΗΜΑ 2 TOOLBOOK (μάθημα 2) Δεκηνπξγία βηβιίνπ θαη ζειίδσλ ΕΚΠΑΙΔΕΤΣΙΚΟ ΠΕ19 1 Δημιουργία σελίδων και βιβλίων Έλα θαηλνύξην βηβιίν πεξηέρεη κία άδεηα ζειίδα κε έλα άδεην background. Δελ κπνξνύκε λα μερσξίζνπκε

Διαβάστε περισσότερα


ΘΔΚΑ ΡΖΠ ΑΛΑΓΛΩΟΗΠΖΠ ΘΔΚΑ ΡΖΠ ΑΛΑΓΛΩΟΗΠΖΠ 1.Απηόο πνπ ζα αλαγλσξηζηεί απνπζηάδεη γηα πνιύ θαηξό. 2.Δπηζηξέθεη κε πιαζηή ηαπηόηεηα ή κεηακνξθσκέλνο. 3.Απνκνλώλνληαη ηα δύν πξόζσπα 4.Άξζε κεηακόξθσζεο 5.Απνθάιπςε 6.Ακθηβνιίεο-απνδεηθηηθά

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ ΘΕΜΑ 1 Ο Να γράψετε στο τετράδιό σας τον αριθµό της καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 εως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

Ζαχαρίας Μ. Κοντοπόδης Εργαστήριο Λειτουργικών Συστημάτων ΙΙ

Ζαχαρίας Μ. Κοντοπόδης Εργαστήριο Λειτουργικών Συστημάτων ΙΙ Διαφάνεια 1 η ΕΚΚΙΝΗΣΗ ΤΟΥ ΥΠΟΛΟΓΙΣΤΗ ΚΑΙ ΕΙΣΟΔΟΣ ΣΤΟ BIOS UITILITY Τν ζπλεζέζηεξν πιήθηξν γηα ηελ είζνδν ζην BIOS Utility είλαη ην πιήθηξν Del. Παξόια απηά δηαθνξεηηθνί θαηαζθεπαζηέο, ρξεζηκνπνηνύλ δηαθνξεηηθά

Διαβάστε περισσότερα

Σύνθεζη ηαλανηώζεων. Έζησ έλα ζώκα πνπ εθηειεί ηαπηόρξνλα δύν αξκνληθέο ηαιαληώζεηο ηεο ίδηαο ζπρλόηεηαο πνπ πεξηγξάθνληαη από ηηο παξαθάησ εμηζώζεηο:

Σύνθεζη ηαλανηώζεων. Έζησ έλα ζώκα πνπ εθηειεί ηαπηόρξνλα δύν αξκνληθέο ηαιαληώζεηο ηεο ίδηαο ζπρλόηεηαο πνπ πεξηγξάθνληαη από ηηο παξαθάησ εμηζώζεηο: Σύνθεζη ηαλανηώζεων Α. Σύλζεζε δύν α.α.η ηεο ίδιας ζστνόηηηας Έζησ έλα ζώκα πνπ εθηειεί ηαπηόρξνλα δύν αξκνληθέο ηαιαληώζεηο ηεο ίδηαο ζπρλόηεηαο πνπ πεξηγξάθνληαη από ηηο παξαθάησ εμηζώζεηο: Η απνκάθξπλζε

Διαβάστε περισσότερα

Τηλζφωνο: 99543321 Ε-mail: savvas_email@yahoo.com Ώρες διδασκαλίας: 16:00 19:15 μμ

Τηλζφωνο: 99543321 Ε-mail: savvas_email@yahoo.com Ώρες διδασκαλίας: 16:00 19:15 μμ ΠΑΙΓΑΓΩΓΙΚΟ ΙΝΣΙΣΟΤΣΟ ΚΤΠΡΟΤ Πξόγξακκα Δπηκόξθσζεο Τπνςεθίσλ Καζεγεηώλ Σερλνινγίαο Γελάξεο 2011 ΗΛΔΚΣΡΟΝΙΚΑ Ι (Ύιε Γπκλαζίνπ) Διδάσκων: Σαββίδης Σάββας Τηλζφωνο: 99543321 Ε-mail: savvas_email@yahoo.com

Διαβάστε περισσότερα

Δξγαιεία Καηαζθεπέο 1 Σάμε Σ Δ.Κ.Φ.Δ. ΥΑΝΙΧΝ ΠΡΧΣΟΒΑΘΜΙΑ ΔΚΠΑΙΓΔΤΗ. ΔΝΟΣΗΣΑ 11 ε : ΦΧ ΔΡΓΑΛΔΙΑ ΚΑΣΑΚΔΤΔ. Καηαζθεπή 1: Φαθόο κε ζσιήλα.

Δξγαιεία Καηαζθεπέο 1 Σάμε Σ Δ.Κ.Φ.Δ. ΥΑΝΙΧΝ ΠΡΧΣΟΒΑΘΜΙΑ ΔΚΠΑΙΓΔΤΗ. ΔΝΟΣΗΣΑ 11 ε : ΦΧ ΔΡΓΑΛΔΙΑ ΚΑΣΑΚΔΤΔ. Καηαζθεπή 1: Φαθόο κε ζσιήλα. Δξγαιεία Καηαζθεπέο 1 Δ.Κ.Φ.Δ. ΥΑΝΙΧΝ ΠΡΧΣΟΒΑΘΜΙΑ ΔΚΠΑΙΓΔΤΗ ΔΝΟΣΗΣΑ 11 ε : ΦΧ ΔΡΓΑΛΔΙΑ ΚΑΣΑΚΔΤΔ Καηαζθεπή 1: Φαθόο κε ζσιήλα Γηαθξάγκαηα Δξγαιεία Καηαζθεπέο 2 Η θαηαζθεπή πεξηγξάθεηαη ζηελ αληίζηνηρε ελόηεηα

Διαβάστε περισσότερα


ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ ΜΑΘΗΜΑ : ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ Α/Α : 0_1382/153 1. Καη όηαλ έγηλε ε ππνρώξεζε αξγά ην απόγεπκα, επεηδή θνβήζεθαλ νη νιηγαξρηθνί κήπσο νη δεκνθξαηηθνί, αθνύ θάλνπλ επίζεζε, θαηαιάβνπλ

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Άσκηση 1 - Μοπυοποίηση Κειμένου

Άσκηση 1 - Μοπυοποίηση Κειμένου Άσκηση 1 - Μοπυοποίηση Κειμένου Σηηο παξαθάησ γξακκέο εθαξκόζηε ηε κνξθνπνίεζε πνπ πεξηγξάθνπλ Γξακκή κε έληνλε γξαθή Γξακκή κε πιάγηα γξαθή Γξακκή κε ππνγξακκηζκέλε γξαθή Γξακκή κε Arial Font κεγέζνπο

Διαβάστε περισσότερα

Ζ ύιε εκθαλίδεηαη ζε ηξεηο θαηαζηάζεηο: ζηελ ζηεξεή, ζηελ πγξή θαη ζηελ αέξηα.

Ζ ύιε εκθαλίδεηαη ζε ηξεηο θαηαζηάζεηο: ζηελ ζηεξεή, ζηελ πγξή θαη ζηελ αέξηα. Καηαζηάζεηο ηεο ύιεο 1 ΔΚΦΔ ΥΑΝΗΧΝ ΠΡΧΣΟΒΑΘΜΗΑ ΔΚΠΑΗΓΔΤΖ ΟΗ ΦΤΗΚΔ ΔΠΗΣΖΜΔ ΣΖΝ ΠΡΟΥΟΛΗΚΖ ΑΓΧΓΖ ΔΝΟΣΖΣΑ 1: ΔΗΑΓΧΓΖ ΚΔΦΑΛΑΗΟ 4: ΚΑΣΑΣΑΔΗ ΣΖ ΤΛΖ ΚΑΣΑΣΑΔΗ ΣΖ ΤΛΖ Ζ ύιε εκθαλίδεηαη ζε ηξεηο θαηαζηάζεηο: ζηελ

Διαβάστε περισσότερα

Δξγαιεία Καηαζθεπέο 1 Σάμε Δ Δ.Κ.Φ.Δ. ΥΑΝΗΩΝ ΠΡΩΣΟΒΑΘΜΗΑ ΔΚΠΑΗΓΔΤΖ. ΔΝΟΣΖΣΑ 2 ε : ΤΛΗΚΑ ΩΜΑΣΑ ΔΡΓΑΛΔΗΑ ΚΑΣΑΚΔΤΔ. Καηαζθεπή 1: Ογθνκεηξηθό δνρείν

Δξγαιεία Καηαζθεπέο 1 Σάμε Δ Δ.Κ.Φ.Δ. ΥΑΝΗΩΝ ΠΡΩΣΟΒΑΘΜΗΑ ΔΚΠΑΗΓΔΤΖ. ΔΝΟΣΖΣΑ 2 ε : ΤΛΗΚΑ ΩΜΑΣΑ ΔΡΓΑΛΔΗΑ ΚΑΣΑΚΔΤΔ. Καηαζθεπή 1: Ογθνκεηξηθό δνρείν Δξγαιεία Καηαζθεπέο 1 Δ.Κ.Φ.Δ. ΥΑΝΗΩΝ ΠΡΩΣΟΒΑΘΜΗΑ ΔΚΠΑΗΓΔΤΖ ΔΝΟΣΖΣΑ 2 ε : ΤΛΗΚΑ ΩΜΑΣΑ ΔΡΓΑΛΔΗΑ ΚΑΣΑΚΔΤΔ Καηαζθεπή 1: Ογθνκεηξηθό δνρείν Καηαζθεπάδνπκε έλα νγθνκεηξηθό δνρείν από πιαζηηθό κπνπθάιη λεξνύ

Διαβάστε περισσότερα

Βιομησανικόρ ζσεδιαζμόρ πποϊόνηων από ανακςκλωμένερ ζςζκεςαζίερ

Βιομησανικόρ ζσεδιαζμόρ πποϊόνηων από ανακςκλωμένερ ζςζκεςαζίερ Βιομησανικόρ ζσεδιαζμόρ πποϊόνηων από ανακςκλωμένερ ζςζκεςαζίερ ΤΕΙ Δσηικής Μακεδονίας Τμήμα Βιομητανικού Στεδιαζμού Εργαζηήριο C 3 www.c3.teiwm.gr C 3 LAB www.c3.teiwm.gr 1 Εηζαγσγή Πεπιεσόμενα ύκβνια

Διαβάστε περισσότερα


ΠΑΝΓΛΛΗΝΙΓΣ 2014 ΑΠΑΝΤΗΣΓΙΣ ΣΤΑ ΘΓΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΓΥΘΥΝΣΗΣ ΠΑΝΓΛΛΗΝΙΓΣ 2014 ΑΠΑΝΤΗΣΓΙΣ ΣΤΑ ΘΓΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΓΥΘΥΝΣΗΣ Θέμα Α Α 1 : δ Α 2 : γ Α 3 : β Α 4 : γ Α 5 : β Θέμα Β Β1. 4 2 1 6 5 3 Β2. Β3. Β4. Β5. α) DNA πνιπκεξάζε β) Πξηκόζσκα γ) DNA δεζκάζε δ) DNA

Διαβάστε περισσότερα

Α Ο Κ Η Α Μ Α Ζ Η Η Ρ Η ( S E A R C H )

Α Ο Κ Η Α Μ Α Ζ Η Η Ρ Η ( S E A R C H ) Ξ G O O G L E S C H O L A R Α Ο Ξ Ε Κ Ε Θ Λ Θ Α Λ Η Τ Α Μ Η Α Μ Α Ζ Η Η Ρ Η Ρ Οξαγκαηνπνηώληαο αλαδήηεζε ζην GoogleScholar (http://scholar.google.com/) ν ρξήζηεο κπνξεί λα εληνπίζεη πιηθό αθαδεκαϊθνύ θαη

Διαβάστε περισσότερα

Διαηιμήζεις για Αιολικά Πάρκα. Κώδικες 28, 78 και 84

Διαηιμήζεις για Αιολικά Πάρκα. Κώδικες 28, 78 και 84 Διαηιμήζεις για Αιολικά Πάρκα Κώδικες 28, 78 και 84 Διαηιμήζεις για Αιολικά Πάρκα Οη Διαηιμήζεις για Αιολικά Πάρκα εθαξκόδνληαη γηα ηελ απνξξνθνύκελε ελέξγεηα από Αηνιηθά Πάξθα πνπ είλαη ζπλδεδεκέλα ζην

Διαβάστε περισσότερα

Γοκή επαλάιευες Δληοιές Όζο & Μέτρης_όηοσ

Γοκή επαλάιευες Δληοιές Όζο & Μέτρης_όηοσ Αιγόξηζκνη Γοκή επαλάιευες Δληοιές Όζο & Μέτρης_όηοσ Εηζαγσγή ζηηο Αξρέο ηεο Επηζηήκεο ησλ Η/Υ 1 Άζθεζε 34 ζει 53 Έλα ςεθηαθό θσηνγξαθηθό άικπνπκ έρεη απνζεθεπηηθό ρώξν N Mbytes. Να αλαπηύμεηε

Διαβάστε περισσότερα

Οργάνωση και Δομή Παρουσιάσεων

Οργάνωση και Δομή Παρουσιάσεων Οργάνωση και Δομή Παρουσιάσεων Οη παξνπζηάζεηο κε βνήζεηα ηνπ ππνινγηζηή γίλνληαη κε πξνγξάκκαηα παξνπζηάζεσλ, όπσο ην OpenOffice.org Impress [1] θαη ην Microsoft Office PowerPoint [2]. Απηά ηα πξνγξάκκαηα

Διαβάστε περισσότερα

Image J Plugin particle tracker για παρακολούθηση της κίνησης σωματιδίων

Image J Plugin particle tracker για παρακολούθηση της κίνησης σωματιδίων Image J Plugin particle tracker για παρακολούθηση της κίνησης σωματιδίων (https://weeman.inf.ethz.ch/particletracker/) Τν Plugin particle tracker κπνξεί λα αληρλεύζεη απηόκαηα ηα ζσκαηίδηα πνπ θηλνύληαη,

Διαβάστε περισσότερα

Κεθάιαην 20. Ελαχιστοποίηση του κόστους

Κεθάιαην 20. Ελαχιστοποίηση του κόστους Κεθάιαην 0 Ελαχιστοποίηση του κόστους Ειαρηζηνπνίεζε ηνπ θόζηνπο Μηα επηρείξεζε ειαρηζηνπνηεί ην θόζηνο ηεο αλ παξάγεη νπνηνδήπνηε δεδνκέλν επίπεδν πξντόληνο y 0 ζην κηθξόηεξν δπλαηό ζπλνιηθό θόζηνο. Τν

Διαβάστε περισσότερα

ΣΕΙ Δυτικήσ Μακεδονίασ, Παράρτημα Καςτοριάσ Τμήμα Πληροφορικήσ και Τεχνολογίασ Υπολογιςτών

ΣΕΙ Δυτικήσ Μακεδονίασ, Παράρτημα Καςτοριάσ Τμήμα Πληροφορικήσ και Τεχνολογίασ Υπολογιςτών τοιχεία του μαθήματοσ (ημζρα εβδομάδασ, ώρεσ, ζτοσ): ΣΕΙ Δυτικήσ Μακεδονίασ, Παράρτημα Καςτοριάσ Τμήμα Πληροφορικήσ και Τεχνολογίασ Υπολογιςτών Εργαςτηριακή ομάδα αςκήςεων 2 για το μάθημα «ΑΡΧΙΣΕΚΣΟΝΙΚΗ

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Άμεσοι Αλγόριθμοι: Προσπέλαση Λίστας (list access)

Άμεσοι Αλγόριθμοι: Προσπέλαση Λίστας (list access) Έρνπκε απνζεθεύζεη κηα ζπιινγή αξρείσλ ζε κηα ζπλδεδεκέλε ιίζηα, όπνπ θάζε αξρείν έρεη κηα εηηθέηα ηαπηνπνίεζεο. Μηα εθαξκνγή παξάγεη κηα αθνινπζία από αηηήκαηα πξόζβαζεο ζηα αξρεία ηεο ιίζηαο. Γηα λα

Διαβάστε περισσότερα


ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 4 ΣΥΝΔΥΑΣΤΙΚΑ ΚΥΚΛΩΜΑΤΑ ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 4 ΣΥΝΔΥΑΣΤΙΚΑ ΚΥΚΛΩΜΑΤΑ 1. ρεδίαζε πλδπαζηηθνύ Κπθιώκαηνο Έλα ζπλδπαζηηθό θύθισκα (Κ) έρεη ηξεηο εηζόδνπο A, B θαη C θαη κία έμνδν Y Y=A B+AC Να θαηαζθεπάζεηε ην ράξηε Karnaugh. B 0

Διαβάστε περισσότερα

Γιπθόδε + Ομπγόλν Δηνμείδην ηνπ άλζξαθα + Νεξό + Ελέξγεηα

Γιπθόδε + Ομπγόλν Δηνμείδην ηνπ άλζξαθα + Νεξό + Ελέξγεηα 4. ΑΝΑΠΝΟΗ Η δηάζπαζε ηεο γιπθόδεο γίλεηαη κέζα ζηα θύηηαξα, νλνκάδεηαη θπηηαξηθή αλαπλνή θαη εμαζθαιίδεη ηελ ελέξγεηα πνπ είλαη απαξαίηεηε ζην θύηηαξν. Η δηάζπαζε γίλεηαη κε ηελ παξνπζία νμπγόλνπ θαη

Διαβάστε περισσότερα

Κβαντικοί Υπολογισμοί. Πέκπηε Γηάιεμε

Κβαντικοί Υπολογισμοί. Πέκπηε Γηάιεμε Κβαντικοί Υπολογισμοί Πέκπηε Γηάιεμε Kπθισκαηηθό Mνληέιν Έλαο θιαζηθόο ππνινγηζηήο απνηειείηαη από αγσγνύο θαη ινγηθέο πύιεο πνπ απνηεινύλ ηνπο επεμεξγαζηέο. Σηνπο θβαληηθνύο ε πιεξνθνξία βξίζθεηαη κέζα

Διαβάστε περισσότερα

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ. Οξηδόληηα θαη θαηαθόξπθε κεηαηόπηζε παξαβνιήο

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ. Οξηδόληηα θαη θαηαθόξπθε κεηαηόπηζε παξαβνιήο ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ Οξηδόληηα θαη θαηαθόξπθε κεηαηόπηζε παξαβνιήο 1 ε Δξαζηεξηόηεηα Αλνίμηε ην αξρείν «Μεηαηόπηζε παξαβνιήο.ggb». Με ηε καύξε γξακκή παξηζηάλεηαη ε γξαθηθή παξάζηαζε ηεο f(x)=αx 2 πνπ ζα ηελ

Διαβάστε περισσότερα


Σήκαηα Β Α Γ Γ Δ Λ Η Σ Ο Ι Κ Ο Ν Ο Μ Ο Υ Γ Ι Α Λ Δ Ξ Η - ( 2 ) ΕΙΣΑΓΨΓΗ ΣΤΙΣ ΤΗΛΕΠΙΚΟΙΝΨΝΙΕΣ Σήκαηα 1 Β Α Γ Γ Δ Λ Η Σ Ο Ι Κ Ο Ν Ο Μ Ο Υ Γ Ι Α Λ Δ Ξ Η - ( 2 ) Σήκαηα Οξηζκόο ζήκαηνο Ταμηλόκεζε ζεκάησλ Σεηξέο Fourier Μεηαζρεκαηηζκόο Fourier Σπλέιημε Σπζρέηηζε θαη Φαζκαηηθή Ππθλόηεηα 2 Οξηζκόο Σήκαηνο

Διαβάστε περισσότερα

ΓΙΑΙΡΔΣΟΣΗΣΑ. Οπιζμόρ 1: Έζηω d,n. Λέκε όηη ν d δηαηξεί ηνλ n (ζπκβνιηζκόο: dn) αλ. ππάξρεη c ηέηνην ώζηε n. Θεώπημα 2: Γηα d,n,m,α,b ηζρύνπλ:

ΓΙΑΙΡΔΣΟΣΗΣΑ. Οπιζμόρ 1: Έζηω d,n. Λέκε όηη ν d δηαηξεί ηνλ n (ζπκβνιηζκόο: dn) αλ. ππάξρεη c ηέηνην ώζηε n. Θεώπημα 2: Γηα d,n,m,α,b ηζρύνπλ: ΓΙΑΙΡΔΣΟΣΗΣΑ Οπιζμόρ 1: Έζηω,. Λέκε όηη ν δηαηξεί ηνλ (ζπκβνιηζκόο: ) αλ ππάξρεη c ηέηνην ώζηε c. Θεώπημα : Γηα,,m,α,b ηζρύνπλ: i), (άξα ) ii) 1, 1 iii) 0 iv) 0 0 v) m m m vi) α bm vii) α (άξα ) viii)

Διαβάστε περισσότερα

Ηλεκηπονικά Απσεία και Διεπαθέρ

Ηλεκηπονικά Απσεία και Διεπαθέρ MENU ΑΝΑΦΟΡΕΣ Ηλεκηπονικά Απσεία και Διεπαθέρ Σε απηό ην ζεκείν ηεο εθαξκνγήο δεκηνπξγνύκε ηα δηάθνξα Ηιεθηξνληθά Αξρεία έηζη ώζηε λα ηα ππνβάινπκε ζηνπο δηάθνξνπο θνξείο. Γηα λα επηιέμνπκε έλα είδνο αξρείνπ

Διαβάστε περισσότερα

Δσζμενές διαηαρατές και Ονομαζηικό-πραγμαηικό επιηόκιο

Δσζμενές διαηαρατές και Ονομαζηικό-πραγμαηικό επιηόκιο Δσζμενές διαηαρατές και Ονομαζηικό-πραγμαηικό επιηόκιο Copyright 2009 Pearson Education, Inc. Publishing as Prentice Hall Macroeconomics, 5/e Olivier Blanchard 1 of 43 IS-LM: Μηχανισμός προσαρμογής μετά

Διαβάστε περισσότερα

A. Αιιάδνληαο ηε θνξά ηνπ ξεύκαηνο πνπ δηαξξέεη ηνλ αγωγό.

A. Αιιάδνληαο ηε θνξά ηνπ ξεύκαηνο πνπ δηαξξέεη ηνλ αγωγό. ΤΠΟΤΡΓΔΙΟ ΠΑΙΓΔΙΑ ΚΑΙ ΠΟΛΙΣΙΜΟΤ ΛΔΤΚΩΙΑ ΦΤΛΛΟ ΔΡΓΑΙΑ Μειέηε ηωλ παξαγόληωλ από ηνπο νπνίνπο εμαξηάηαη ε ειεθηξνκαγλεηηθή δύλακε. Τιηθά - πζθεπέο: Ηιεθηξνληθή δπγαξηά, ηξνθνδνηηθό ηάζεο, ξννζηάηεο, ακπεξόκεηξν,

Διαβάστε περισσότερα


ΙNCOFRUIT - (HELLAS). Πξνο ΟΛΑ ΤΑ ΜΔΛΗ Κε Σπλάδειθε Θέκα: Ιζπαλία & Γεξκαλία 5 ε ΔΒΓΟΜΑΓΑ 2011 (31 Ιαλ έσο 30 Φεβξ.2011) Παξαζέηνπκε θαησηέξσ: Αλαζθόπεζε ηεο 4 εο εβδνκάδνο 2011 κε ηηο ηηκέο ησλ εζπεξηδνεηδώλ πνπ δηακνξθώζεθαλ

Διαβάστε περισσότερα


ΠΡΩΣΟΚΟΛΛΑ ΓΙΑΥΔΙΡΗΗ ΣΩΝ ΣΔΡΗΓΟΝΙΚΩΝ ΒΛΑΒΩΝ Δ ΔΝΗΛΙΚΔ ΠΡΩΣΟΚΟΛΛΑ ΓΙΑΥΔΙΡΗΗ ΣΩΝ ΣΔΡΗΓΟΝΙΚΩΝ ΒΛΑΒΩΝ Δ ΔΝΗΛΙΚΔ Σν ζύγρξνλν πξόηππν αληηκεηώπηζεο ηεο ηεξεδόλαο ελειίθσλ δελ εζηηάδεηαη κόλν ζηελ απνθαηάζηαζε ησλ ηεξεδνληθώλ βιαβώλ πνπ έρνπλ εθδεισζεί, αιιά έρεη

Διαβάστε περισσότερα

Σπληήξεζε ηξνθίκσλ ρσξίο ρεκηθά πξόζζεηα PROJECT B ΛΥΚΕΙΟΥ 2 014-15

Σπληήξεζε ηξνθίκσλ ρσξίο ρεκηθά πξόζζεηα PROJECT B ΛΥΚΕΙΟΥ 2 014-15 Σπληήξεζε ηξνθίκσλ ρσξίο ρεκηθά πξόζζεηα PROJECT B ΛΥΚΕΙΟΥ 2 014-15 Εηζαγσγή Οη ηερληθέο ζπληήξεζεο ηξνθίκσλ έρνπλ ζθνπό : α) λα παξεκπνδίζνπλ αλεπηζύκεηεο κεηαβνιέο ζηα ραξαθηεξηζηηθά (γεύζε - ρξώκα -

Διαβάστε περισσότερα


ΑΙΟΛΙΚΑ ΠΑΡΚΑ. Δρώτηση 1 ΑΙΟΛΙΚΑ ΠΑΡΚΑ Πνιινί άλζξσπνη πηζηεύνπλ όηη ν άλεκνο ζα έπξεπε λα αληηθαηαζηήζεη ην πεηξέιαην θαη ην θάξβνπλν σο πεγή ελέξγεηαο γηα ηελ παξαγσγή ειεθηξηζκνύ. Οη θαηαζθεπέο πνπ θαίλνληαη ζηελ εηθόλα είλαη

Διαβάστε περισσότερα


ΥΡΙΣΟΤΓΔΝΝΙΑΣΙΚΔ ΚΑΣΑΚΔΤΔ ΥΡΙΣΟΤΓΔΝΝΙΑΣΙΚΔ ΚΑΣΑΚΔΤΔ 1) Υξηζηνπγελληάηηθα ειαηάθηα θάξηα ή θαδξάθη θάξηα ή θαδξάθη Τιηθά πνπ ζα ρξεηαζηνύκε: Υαξηί θάλζνλ καύξν γηα ην θόλην, πξάζηλν γηα ηα ειαηάθηα, θόθθηλν γηα ηα αζηεξάθηα Απιό

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Κόληξα πιαθέ ζαιάζζεο κε δηαζηάζεηο 40Υ40 εθ. Καξθηά 3 θηιά πεξίπνπ κε κήθνο ηξηπιάζην από ην πάρνο ηνπ μύινπ θπξί κεγάιν θαη ππνκνλή

Κόληξα πιαθέ ζαιάζζεο κε δηαζηάζεηο 40Υ40 εθ. Καξθηά 3 θηιά πεξίπνπ κε κήθνο ηξηπιάζην από ην πάρνο ηνπ μύινπ θπξί κεγάιν θαη ππνκνλή Δξγαιεία Καηαζθεπέο 1 Δ.Κ.Φ.Δ. ΥΑΝΙΩΝ ΠΡΩΣΟΒΑΘΜΙΑ ΔΚΠΑΙΓΔΤΗ ΔΝΟΣΗΣΑ 10 ε : ΜΗΥΑΝΙΚΗ ΜΔΡΟ Β ΠΙΔΗ ΔΡΓΑΛΔΙΑ ΚΑΣΑΚΔΤΔ Καηαζθεπή 1: Καξέθια θαθίξε Όξγαλα Τιηθά Κόληξα πιαθέ ζαιάζζεο κε δηαζηάζεηο 40Υ40 εθ.

Διαβάστε περισσότερα

Έλαο πίνακας σσμβόλων ππνζηεξίδεη δύν βαζηθέο ιεηηνπξγίεο:

Έλαο πίνακας σσμβόλων ππνζηεξίδεη δύν βαζηθέο ιεηηνπξγίεο: Πίνακες Σσμβόλων Έλαο πίνακας σσμβόλων ππνζηεξίδεη δύν βαζηθέο ιεηηνπξγίεο: Εηζαγσγή ελόο ζηνηρείνπ Αλαδήηεζε ζηνηρείνπ κε δεδνκέλν θιεηδί Άιιεο ρξήζηκεο ιεηηνπξγίεο είλαη: Δηαγξαθή ελόο θαζνξηζκέλνπ ζηνηρείνπ

Διαβάστε περισσότερα

Τ ξ ε ύ ο ξ π ς ξ σ ξ ο ί ξ σ _ Ι ε ο α μ ε ι κ ό π

Τ ξ ε ύ ο ξ π ς ξ σ ξ ο ί ξ σ _ Ι ε ο α μ ε ι κ ό π Τ ξ ε ύ ο ξ π ς ξ σ ξ ο ί ξ σ _ Ι ε ο α μ ε ι κ ό π Α ο υ ι ς ε κ ς ξ μ ι κ ή ρ ύ μ θ ε ρ η 6 Τ ξ μ έ α π ΘΘΘ, X ώ ο ξ π κ α ι Δ π ι κ ξ ι μ χ μ ί α Η έ μ α : Διδάρκξμςεπ: Τξ εύοξπ ςξσ ξοίξσ Ιεοαμεικόπ

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Γ Γυμνασίου ΥΟΛΕΙΟ.. ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Γ Γυμνασίου ιήμεο 11.00 Κάπνηνο άξρηζε λα δηαβάδεη έλα βηβιίν ηελ 1 ε Δεθεκβξίνπ. Κάζε κέξα δηάβαδε ηνλ ίδην αξηζκό ζειίδσλ

Διαβάστε περισσότερα

Αντισταθμιστική ανάλυση

Αντισταθμιστική ανάλυση Θεσξήζηε έλαλ αιγόξηζκν Α πνπ ρξεζηκνπνηεί κηα δνκή δεδνκέλσλ Γ : Καηά ηε δηάξθεηα εθηέιεζεο ηνπ Α ε Γ πξαγκαηνπνηεί κία αθνινπζία από πξάμεηο. Παξάδεηγκα: Θπκεζείηε ην πξόβιεκα ηεο εύξεζεο-έλσζεο Δίρακε

Διαβάστε περισσότερα


ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ Α/Α : 0_3207/391 1. Τελ άιιε κέξα νη Τξηάθνληα, πνιύ ηαπεηλσκέλνη θαη ληώζνληαο εγθαηαιειεηκκέλνη, ζπγθεληξώζεθαλ ζην ρώξν ησλ ζπλεδξηάζεσλ παξάιιεια, νη «ηξεηο ρηιηάδεο», ζε όια ηα ζεκεία όπνπ είραλ ηνπνζεηεζεί,

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Η/Υ A ΤΑΞΕΩΣ ΑΕ 2010-2011. Συστήματα Αρίθμησης. Υποπλοίαρχος Ν. Πετράκος ΠΝ

Η/Υ A ΤΑΞΕΩΣ ΑΕ 2010-2011. Συστήματα Αρίθμησης. Υποπλοίαρχος Ν. Πετράκος ΠΝ Συστήματα Αρίθμησης Υποπλοίαρχος Ν. Πετράκος ΠΝ 1 Ειζαγωγή Τν bit είλαη ε πην βαζηθή κνλάδα κέηξεζεο. Είλαη κία θαηάζηαζε on ή off ζε έλα ςεθηαθό θύθισκα. Άιιεο θνξέο είλαη κία θαηάζηαζε high ή low voltage

Διαβάστε περισσότερα


ΑΡΥΔ ΟΙΚΟΝΟΜΙΚΗ ΘΔΩΡΙΑ ΛΤΔΙ ΓΙΑΓΩΝΙΜΑΣΟ ΚΔΦΑΛΑΙΟΤ 2 ΑΥΔ ΟΙΚΟΝΟΜΙΚΗ ΘΔΩΙΑ ΛΤΔΙ ΙΑΩΝΙΜΑΣΟ ΚΔΦΑΛΑΙΟΤ 2 1: Λάζος (είλαη ηζνζθειήο ππεξβνιή) Α2: Λάζος (ην ζεηηθό πξόζεκν ζεκαίλεη όηη ε Πνζνζηηαία Μεηαβνιή Δηζνδήκαηνο θαη ε Πνζνζηηαία Μεηαβνιή Πνζόηεηαο ήηαλ

Διαβάστε περισσότερα


ΕΞΟΡΤΞΗ & ΚΑΣΑΚΕΤΕ ΣΗΝ ΕΤΡΩΠΗ ΜΑΘΗΜΑ 43 ΕΞΟΡΤΞΗ & ΚΑΣΑΚΕΤΕ ΣΗΝ ΕΤΡΩΠΗ ΜΑΘΗΜΑ 43 Κα ακαθένεηε 5 εονςπασθέξ πώνεξ θαη κα βνείηε ημ είδμξ ημο μνοθημύ ημοξ πιμύημο. Πμημη πανάγμκηεξ επηηνέπμοκ ηεκ θαηαζθεοή μεγάιςκ ηεπκηθώκ ένγςκ; Ε ελόνολε (ελαγςγή

Διαβάστε περισσότερα


ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ Α/Α : 0_1379/50 1. Όηαλ ινηπόλ ήξζαλ [νη πξέζβεηο ζηελ Αζήλα], αθνύ ζπλέιαβαλ νη Αζελαίνη θαη ηνπο πξέζβεηο σο ππνθηλεηέο ζηάζεο θαη όζνπο έπεηζαλ [νη πξέζβεηο], ηνπο ζπγθέληξσζαλ γηα αζθάιεηα ζηελ Αίγηλα.

Διαβάστε περισσότερα