Πξνηεηλόκελα Θέκαηα Βηνινγίαο Καηεύζπλζεο Απαντήσεις: ΘΔΜΑ 1 ο 1:γ, 2:α, 3:β, 4:β, 5:δ.

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Πξνηεηλόκελα Θέκαηα Βηνινγίαο Καηεύζπλζεο 21-5-2015. Απαντήσεις: ΘΔΜΑ 1 ο 1:γ, 2:α, 3:β, 4:β, 5:δ."

Transcript

1 Απαντήσεις: ΘΔΜΑ 1 ο 1:γ, 2:α, 3:β, 4:β, 5:δ. ΘΔΜΑ 2 ο Α. Η κέζνδνο αιπζηδσηήο αληίδξαζεο πνιπκεξάζεο (PCR: Polymerase Chain Reaction) καο επηηξέπεη λα αληηγξάςνπκε επηιεθηηθά, εθαηνκκύξηα θνξέο, εηδηθέο αιιεινπρίεο DNA από έλα ζύλζεην κείγκα κνξίσλ DNA, ρσξίο ηε κεζνιάβεζε δσληαλνύ θπηηάξνπ. Η ηερληθή απηή πνπ άξρηζε λα εθαξκόδεηαη επξέσο από ην 1985, έρεη απμήζεη ηελ επαηζζεζία ησλ γελεηηθώλ αλαιύζεσλ θαη έρεη πνιιέο πξαθηηθέο εθαξκνγέο. Γηα παξάδεηγκα ρξεζηκνπνηείηαη ζηελ Ιαηξηθή γηα ηε δηάγλσζε αζζελεηώλ όπσο ηνπ AIDS, ζηελ εγθιεκαηνινγία γηα ηε δηαιεύθαλζε ππνζέζεσλ θαη ζηε κειέηε DNA από απνιηζώκαηα. Β. Αξρηθά ν Mendel δεκηνύξγεζε ακηγή ζηειέρε γηα ηε ζπγθεθξηκέλε ηδηόηεηα πνπ κειεηνύζε. Αθνύ απέθηεζε ηέηνηα ζηειέρε, ζηε ζπλέρεηα έθαλε ηερλεηή γνληκνπνίεζε κεηαμύ δύν ακηγώλ θπηώλ, πνπ δηέθεξαλ σο πξνο ηελ ηδηόηεηα απηή. Σα θπηά απηά απνηεινύζαλ ηελ παηξηθή γεληά (Ρ). Οη απόγνλνη ηνπο ήηαλ ε πξώηε ζπγαηξηθή γεληά, πνπ ήηαλ άηνκα πβξηδηθά (γεληά F1,), δειαδή ήηαλ απόγνλνη ακηγώλ γνλέσλ πνπ είραλ δηαθνξεηηθή έθθξαζε ηνπ ίδηνπ ραξαθηήξα, όπσο ςειό θαη θνληό θπηό. Σα άηνκα απηά ηα άθελε λα απηνγνληκνπνηεζνύλ θαη έπαηξλε ηνπο απνγόλνπο ηνπο, πνπ απνηεινύζαλ ηε δεύηεξε ζπγαηξηθή γεληά (γεληά F2). Από ηα απνηειέζκαηα ησλ πεηξακάησλ ηνπ ν Mendel δηαηύπσζε ηνπο λόκνπο ηεο θιεξνλνκηθόηεηαο: ην λόκν ηνπ δηαρσξηζκνύ ησλ αιιειόκνξθσλ γνληδίσλ θαη ην λόκν ηεο αλεμάξηεηεο κεηαβίβαζεο ησλ γνληδίσλ. Γ. Παξόιν πνπ ε γνληδηαθή ζεξαπεία παξνπζηάδεηαη σο παλάθεηα ζηελ Ιαηξηθή, ε εθαξκνγή ηεο, ηνπιάρηζηνλ ζην άκεζν κέιινλ, ζα είλαη πεξηνξηζκέλε επεηδή δελ έρνπλ αθόκε μεπεξαζηεί πξνβιήκαηα όπσο απηά πνπ αθνξνύλ ηε ρξήζε ησλ θνξέσλ. Όπσο αλαθέξζεθε πξνεγνπκέλσο, ζηηο πεξηζζόηεξεο πεξηπηώζεηο σο θνξείο ρξεζηκνπνηνύληαη ηνί νη νπνίνη αλ θαη θαζίζηαληαη αβιαβείο, έρνπλ κηθξή πηζαλόηεηα λα πξνθαιέζνπλ παξελέξγεηεο θαη ζε νξηζκέλεο πεξηπηώζεηο

2 θαξθίλν. Έηζη ινηπόλ ε αλάπηπμε πην θαηάιιεισλ θνξέσλ είλαη ν επόκελνο ζηόρνο γηα ηε βειηίσζε ησλ κεζόδσλ ηεο γνληδηαθήο ζεξαπείαο, Γ. Η θισλνπνίεζε είλαη πνιύ ρξήζηκε ζηνλ πνιιαπιαζηαζκό δηαγνληδηαθώλ δώσλ. Η δεκηνπξγία ελόο δηαγνληδηαθνύ δώνπ πνπ παξάγεη ηνλ αλζξώπηλν παξάγνληα πήμεο ηνπ αίκαηνο, γηα παξάδεηγκα, θνζηίδεη 1-2 εθαηνκκύξηα επξώ. Με θισλνπνίεζε κπνξνύλ εύθνια λα παξαρζνύλ πνιιά παλνκνηόηππα δώα θαη έηζη αθόκε κεγαιύηεξεο πνζόηεηεο ηνπ θαξκάθνπ. Η θισλνπνίεζε κπνξεί επίζεο λα ζπλεηζθέξεη ζηελ πξνζηαζία από ηελ εμαθάληζε δηάθνξσλ δώσλ ηνπ πιαλήηε καο. ηηο θαηαςύμεηο πνιιώλ δσνινγηθώλ θήπσλ ππάξρνπλ θαηεςπγκέλα σάξηα θαη ζπεξκαηνδσάξηα ή έκβξπα δώσλ πνπ θηλδπλεύνπλ λα εμαθαληζηνύλ. Ππξήλεο από απηά ηα θύηηαξα κπνξνύλ λα κεηαθεξζνύλ ζε απύξελα σνθύηηαξα ηνπ είδνπο πνπ καο ελδηαθέξεη θαη ζηε ζπλέρεηα λα θπνθνξεζνύλ ζην ίδην ή ζε ζπγγεληθό είδνο δώνπ. ΘΔΜΑ 3 ο Α. Καηά ηε δεκηνπξγία ησλ αλαζπλδπαζκέλσλ πιαζκηδίσλ, νξηζκέλα πιαζκίδηα μαλαγίλνληαη θπθιηθά από ηελ DNA δεζκάζε, ρσξίο λα πξνζιάβνπλ μέλν DNA. Μεηά ην κεηαζρεκαηηζκό ησλ βαθηεξίσλ μεληζηώλ κε ηα πιαζκίδηα, πξνθύπηνπλ νη εμήο θαηεγνξίεο βαθηεξηαθώλ απνηθηώλ, ζε ζηεξεό ζξεπηηθό πιηθό: α. Βαθηήξηα πνπ πξνζέιαβαλ αλαζπλδπαζκέλν πιαζκίδην θαη εκθαλίδνπλ αλζεθηηθόηεηα κόλν ζηελ ακπηθηιιίλε. β. Βαθηήξηα πνπ πξνζέιαβαλ κε αλαζπλδπαζκέλν πιαζκίδην θαη εκθαλίδνπλ αλζεθηηθόηεηα ηόζν ζηελ ακπηθηιιίλε όζν θαη ζηε πεληθηιιίλε. γ. Βαθηήξηα πνπ δελ πξνζέιαβαλ αλαζπλδπαζκέλν πιαζκίδην θαη είλαη επαίζζεηα ηόζν ζηελ ακπηθηιιίλε όζν θαη ζηε πεληθηιιίλε. Η ηειηθή επηινγή ησλ βαθηεξηαθώλ θιώλσλ πνπ πεξηέρνπλ ηα αλαζπλδπαζκέλα πιαζκίδηα ζα γίλεη σο εμήο. Αξρηθά πξνζζέηνπκε ακπηθηιιίλε ζηε ζηεξεή θαιιηέξγεηα ή ζην ζξεπηηθό κέζν ηεο θαιιηέξγεηαο πξηλ ηελ αλάπηπμε ησλ απνηθηώλ, ώζηε λα κελ αλαπηπρζνύλ νη απνηθίεο ησλ βαθηεξίσλ πνπ δελ πεξηέρνπλ πιαζκίδην. ηε ζπλέρεηα κέξνο από ηηο ππόινηπεο απνηθίεο

3 κεηαθέξνληαη ζε λέν ζηεξεό ζξεπηηθό πιηθό θαη δνθηκάδνληαη σο πξνο ηελ αλζεθηηθόηεηά ηνπο ζηελ πεληθηιιίλε. Οη επαίζζεηεο ζηελ πεληθηιιίλε απνηθίεο ζα είλαη απηέο πνπ ζα πεξηέρνπλ ην αλαζπλδπαζκέλν πιαζκίδην θαη ζα αλήθνπλ ζηελ γνληδησκαηηθή καο βηβιηνζήθε. Β. Α. H ΗbA είλαη ε θύξηα αηκνζθαηξίλε ζε έλαλ πγηή ελήιηθα θαη απνηειείηαη από 2 α θαη 2 β αιπζίδεο (ζύζηαζε α 2 β 2 ). Η ΗbA 2 αληρλεύεηαη ζε κηθξέο πνζόηεηεο ζε έλαλ πγηή ελήιηθα θαη απνηειείηαη από 2 α θαη 2 δ πνιππεπηηδηθέο αιπζίδεο (ζύζηαζε α 2 δ 2 ). Η ΗbF νλνκάδεηαη θαη εκβξπηθή αηκνζθαηξίλε από ηηο ιαηηληθέο ιέμεηο Fetus (έκβξπν), θαη Fetal (εκβξπηθόο), έρεη ζύζηαζε α 2 γ 2 θαη αληρλεύεηαη ζε πνζόηεηα ιηγόηεξε από 1% ζε έλαλ πγηή ελήιηθα. Β. Ο Γηώξγνο παξνπζηάδεη παληειή έιιεηςε HbA. Σν γεγνλόο όηη παξνπζηάδεη θαη απμεκέλε ζύλζεζε HbF ζεκαίλεη όηη πάζρεη από β-ζαιαζζαηκία. ηα νκόδπγα άηνκα παξαηεξείηαη ζε πνιιέο πεξηπηώζεηο αύμεζε ηεο HbF, ε νπνία ππνθαζηζηά κεξηθώο ηε ιεηηνπξγία ηεο HbA. Η β-ζαιαζζαηκία ραξαθηεξίδεηαη από κεγάιε εηεξνγέλεηα, δειαδή πξνθαιείηαη από πνιιά δηαθνξεηηθά είδε γνληδηαθώλ κεηαιιάμεσλ όπσο αληηθαηαζηάζεηο, ειιείςεηο θαη πξνζζήθεο βάζεσλ. Σα ζπκπηώκαηα ηεο αζζέλεηαο δηαθέξνπλ σο πξνο ηε βαξύηεηα κεηαμύ δηαθόξσλ αηόκσλ θαη ζρεηίδνληαη κε ην είδνο ηεο κεηάιιαμεο πνπ ηα πξνθαιεί. Σα ζπκπηώκαηα κπνξεί λα θπκαίλνληαη από ζνβαξή αλαηκία (παληειήο έιιεηςε πνιππεπηηδηθήο αιπζίδαο β, ζπλεπώο θαη HbA) όπσο ζηελ πεξίπησζε ηνπ Γηώξγνπ έσο ιηγόηεξν ζνβαξή αλαηκία (ειάηησζε ζύλζεζεο πνιππεπηηδηθήο αιπζίδαο β, ζπλεπώο ζύλζεζε HbΑ ζε πνιύ κηθξή πνζόηεηα). Σα νκόδπγα άηνκα κε β-ζαιαζζαηκία, όπσο ν Γηώξγνο, εκθαλίδνπλ ζνβαξή αλαηκία. Η αληηκεηώπηζε γίλεηαη κε ζπρλέο κεηαγγίζεηο αίκαηνο, νη νπνίεο όκσο ζηαδηαθά δεκηνπξγνύλ πξόβιεκα ιόγσ ηεο ππεξθόξησζεο ηνπ νξγαληζκνύ κε ζίδεξν. Σν πξόβιεκα απηό αληηκεησπίδεηαη κε θαξκαθεπηηθή αγσγή (απνζηδήξσζε). Γ. Σα απνηειέζκαηα ζρεηηθά κε ην Βαζίιε δείρλνπλ απμεκέλε ζύλζεζε HbA 2 ζε ζρέζε κε ηηο θπζηνινγηθέο ηηκέο. Η αύμεζε ηεο ζπγθεθξηκέλεο αηκνζθαηξίλεο παξαηεξείηαη ζηα εηεξόδπγα άηνκα, ζηα άηνκα δειαδή πνπ είλαη θνξείο β-

4 ζαιαζζαηκίαο θαη απνηειεί δηαγλσζηηθό δείθηε. Ο Βαζίιεο παξνπζηάδεη ζπλεπώο ήπηα αλαηκία θαη δελ εθδειώλεη ηα ζπκπηώκαηα. Γ. Η Μαξία πάζρεη από δξεπαλνθπηηαξηθή αλαηκία. Αζζελείο κε δξεπαλνθππαξηθή αλαηκία είλαη νκόδπγνη γηα ην κεηαιιαγκέλν γνλίδην πνπ ζπκβνιίδεηαη κε β s. Σα άηνκα απηά παξάγνπλ κόλν HbS, θαη θαζόινπ HbA. Σν 1949, ν Linus Pauling θαη νη ζπλεξγάηεο ηνπ αλαθάιπςαλ όηη ε αηκνζθαηξίλε ησλ ελειίθσλ, HbA, δηέθεξε ζηα θπζηνινγηθά άηνκα ζε ζρέζε κε εθείλα πνπ έπαζραλ από δξεπαλνθπηηαξηθή αλαηκία. Η δηαθνξά εληνπίδεηαη ζην έθην ακηλνμύ ηεο β- πνιππεπηηδηθήο αιπζίδαο, όπνπ ην γινπηακηληθό νμύ αληηθαζίζηαηαη από βαιίλε. Η κεηαιιαγκέλε αηκνζθαηξίλε ζπκβνιίδεηαη σο HbS. Η αιιαγή ζηελ αθνινπζία ησλ ακηλνμέσλ είλαη απνηέιεζκα κηαο γνληδηαθήο κεηάιιαμεο ζηελ ηξηπιέηα πνπ θσδηθνπνηεί ην γινπηακηληθό νμύ. ηελ θσδηθή αιπζίδα ηνπ DNA δειαδή, αιιάδεη κία βάζε θαη ην θπζηνινγηθό θσδηθόλην GAG, πνπ θσδηθνπνηεί ην γινπηακηληθό νμύ, αληηθαζίζηαηαη από ην GTG, πνπ θσδηθνπνηεί ηε βαιίλε. Η κεηάιιαμε πνπ πξνθαιεί ηε δξεπαλνθπηηαξηθή αλαηκία νδεγεί ζε αιιαγή ηεο ζηεξενδηάηαμεο ηεο αηκνζθαηξίλεο, ε νπνία έρεη σο απνηέιεζκα ηελ αιιαγή ηεο κνξθήο ησλ εξπζξνθπηηάξσλ, ηα νπνία, ζε ζπλζήθεο έιιεηςεο νμπγόλνπ, παίξλνπλ ραξαθηεξηζηηθό δξεπαλνεηδέο ζρήκα. Σα δξεπαλνθύηηαξα εκπνδίδνπλ ηε θπζηνινγηθή θπθινθνξία ηνπ αίκαηνο ζηα ηξηρνεηδή αγγεία δεκηνπξγώληαο πξνβιήκαηα ζε δηάθνξα όξγαλα όπσο ζην ζπιήλα θαη ηνπο πλεύκνλεο. Σα δξεπαλνθύηηαξα θαηαζηξέθνληαη ηαρύηεξα από ηα θπζηνινγηθά κε ζπλέπεηα ηελ εκθάληζε ζπκπησκάησλ αλαηκίαο. Δ. Η Ναηαιία είλαη θνξέαο δξεπαλνθπηηαξηθήο αλαηκίαο δηόηη εθηόο από ηε θπζηνινγηθή αηκνζθαηξίλε HbA παξάγεηαη ζηα εξπζξνθύηηαξά ηεο θαη παζνινγηθή αηκνζθαηξίλε HbS (22,2%). Σα εηεξόδπγα άηνκα (θνξείο) έρνπλ έλα θπζηνινγηθό β γνλίδην θαη έλα κεηαιιαγκέλν θαη δελ εκθαλίδνπλ ηα ζπκπηώκαηα ηεο αζζέλεηαο. ηνπο θνξείο πξνθαιείηαη δξεπάλσζε κόλν ζε ζπλζήθεο κεγάιεο έιιεηςεο νμπγόλνπ, όπσο ζε πςόκεηξν κεγαιύηεξν από m. Σ. Η αλάιπζε ησλ πνζνηήησλ ησλ αηκνζθαηξηλώλ ζηνλ νξγαληζκό ηεο Διέλεο δείρλνπλ κείσζε όισλ ησλ αηκνζθαηξηλώλ. Κνηλό ραξαθηεξηζηηθό ηεο ζύζηαζεο

5 όισλ ησλ αηκνζθαηξηλώλ ηνπ αλζξώπνπ είλαη ε παξνπζία ησλ α αιπζίδσλ. πλεπώο πηζαλόηαηα ε Διέλε πάζρεη από α ζαιαζζαηκία. Σα γνλίδηα πνπ θσδηθνπνηνύλ ηελ πνιππεπηηδηθή αιπζίδα α είλαη δηπιά, δειαδή ππάξρνπλ δύν γνλίδηα α ζε θάζε νκόινγν ρξσκόζσκα. Η α-ζαιαζζαηκία είλαη απνηέιεζκα, ζρεδόλ ζε όιεο ηηο πεξηπηώζεηο, ειιείςεσλ νιόθιεξνπ ηνπ γνληδίνπ πνπ θσδηθνπνηεί ηελ πνιππεπηηδηθή αιπζίδα α. Δθόζνλ ζε θάζε άηνκν ππάξρνπλ ζπλνιηθά ηέζζεξα γνλίδηα α, ειιείςεηο κπνξεί λα δεκηνπξγεζνύλ ζε έλα, δύν, ηξία, ή θαη ζηα ηέζζεξα από απηά ηα γνλίδηα. Όζν πεξηζζόηεξα γνλίδηα α ιείπνπλ ηόζν βαξύηεξα είλαη ηα ζπκπηώκαηα ηεο αζζέλεηαο. ΘΔΜΑ 4 ο Γ1.1. Σν αληηθσδηθόλην είλαη κία εηδηθή ηξηπιέηα λνπθιενηηδίσλ ηνπ trna, ε νπνία είλαη ζπκπιεξσκαηηθή κε ην θσδηθόλην πνπ θσδηθνπνηεί ην ακηλνμύ ην νπνίν κεηαθέξεηαη θαηά ηε κεηάθξαζε από ην ζπγθεθξηκέλν trna. Σν αληηθσδηθόλην 3 CUU5 ζα πξέπεη λα ππάξρεη σο ηξηπιέηα ζην trna πνπ παξάγεηαη θαηά ηε κεηαγξαθή ηνπ γνληδίνπ ηνπ. Σν trna είλαη ζπκπιεξσκαηηθό κε ηε κε θσδηθή αιπζίδα. πλεπώο κε θσδηθή αιπζίδα είλαη ε αιπζίδα ΙΙ θαη θσδηθή ε αιπζίδα Ι. Γ1.2. Η κεηαγξαθή γίλεηαη ζε πξνζαλαηνιηζκό 5 πξνο 3 θαη ε παξαγόκελε αιπζίδα trna είλαη αληηπαξάιιειε κε ηε κε θσδηθή αιπζίδα. Οη δύν αιπζίδεο ηνπ DNA είλαη κεηαμύ ηνπο αληηπαξάιιειεο δηόηη έηζη δεκηνπξγνύληαη θαηά ηε δηάξθεηα ηεο αληηγξαθήο ηνπ DNA. Με βάζε ινηπόλ ηνλ πξνζαλαηνιηζκό ηνπ αληηθσδηθνλίνπ, νη πξνζαλαηνιηζκνί ησλ αιπζίδσλ ζα είλαη: Αλυσίδα Ι: 3 GCG GGA CTG TTA CTT AGA GCG CGA CCC 5 Αλυσίδα ΙΙ: 5 CGC CCT GAC AAT GAA TCT CGC GCT GGG3 Γ1.3. To trna πνπ παξάγεηαη από ηε κεηαγξαθή ηεο κε θσδηθήο αιπζίδαο ζα είλαη: 3 GCG GGA CUG UUA CUU AGA GCG CGA CCC 5

6 Γ2.1. Καζώο ην γνλίδην πξνέξρεηαη από πξνθαξπσηηθό νξγαληζκό δελ ζα πεξηέρεη εζώληα. Σν trna κε ην αληηθσδηθόλην 3 CUU5 ζπκκεηέρεη ζηε κεηάθξαζε ηνπ mrna πνπ πξνθύπηεη από ηε κεηαγξαθή ηνπ γνληδίνπ θαη γη απηό ην ιόγν ζα ζπλδέεηαη θαηά ηε δηάξθεηα ηεο κεηάθξαζεο κε ην θσδηθόλην 5 GAA3 ηνπ mrna. Γηα λα ππάξρεη ην ζπγθεθξηκέλν αληηθσδηθόλην ζην mrna, ζα πξέπεη λα ππάξρεη θαη ζηελ θσδηθή αιπζίδα ηνπ γνληδίνπ. Σν θσδηθόλην GAA εληνπίδεηαη ζηελ αιπζίδα ΙΙ ζπλεπώο απηή είλαη ε θσδηθή θη ε άιιε είλαη ε κε θσδηθή θαη ε κεηαγξαθόκελε. Γ2.2. Ο προζαναηολιζμός ηων αλσζίδων είναι: Αλυσίδα Ι: Αλυσίδα ΙΙ: 5 CCCGCGATGCGTT AGGGTGATTCCGGCAΤATATTGGAGAGGGΤGACCCC3 3 GGGCGCTACGCAATCCCACTAAGGCC GTΑTATAACCTCTCC CΑCTGGGG5 Γ2.3. Το mrna ποσ προκύπηει από ηη μεηαγραθή είναι: 3 GGGCGCUACGCAAUCCCACUAAGGCC GUΑUAUAACCUCUCC CΑCUGGGG5 Δ2.4. Tα αληηθωδηθόληα ηωλ trna είλαη εηδηθέο ηξηπιέηεο λνπθιενηηδίωλ κε ηηο νπνίεο ζπλδένληαη κε βάζε ηνλ θαλόλα ηεο ζπκπιεξωκαηηθόηεηαο κε ηα θωδηθόληα ηνπ mrna. Τν θωδηθόλην ιήμεο δελ αληηζηνηρεί ζε trna νύηε ζε αληηθωδηθόλην. Σπλεπώο ζα είλαη: 3 UAC5, 3 GGC5, 3 CUU5, 3 AGU5, 3 GGG5. Δ2.5. Μεηά ηε δεκηνπξγία ηνπ πεπηηδηθνύ δεζκνύ κεηαμύ ηεο ιεπθίλεο θαη ηνπ πξνεγνύκελνπ ακηλνμένο ζπάλε νη δεζκνί πδξνγόλνπ κεηαμύ θωδηθνλίνπ θαη αληηθωδηθνλίνπ ηνπ πξνεγνύκελνπ ακηλνμένο θαη κεηά ε κηθξή θαη ε κεγάιε ππνκνλάδα ηνπ ξηβνζώκαηνο κεηαθηλνύληαη θαηά έλα ακηλνμύ. Σπλεπώο ζπάδνπλ νη δεζκνί πδξνγόλνπ κεηαμύ ηνπ θωδηθνλίνπ 3 GCC5 θαη αληηθωδηθνλίνπ 3 GGC5. Σπλνιηθά ζα ζπάζνπλ 9 δεζκνί πδξνγόλνπ. Δ3.1. Τν πξηκόζωκα δεκηνπξγεί ηα πξωηαξρηθά ηκήκαηα, κηθξά ηκήκαηα RNA, θαηά ηε δηάξθεηα ηεο αληηγξαθήο ηνπ DNA. Τα πξωηαξρηθά ηκήκαηα είλαη ζπκπιεξωκαηηθά κε ηηο κεηξηθέο αιπζίδεο ηνπ DNA. Τν ζπγθεθξηκέλν είλαη ζπκπιεξωκαηηθό κε ηελ αιπζίδα ΙΙ ωο εμήο:

7 5 GCGAUGCGUU3 Αλυσίδα ΙΙ: 3 GGGCGCTACGCAATCCCACTAAGGCC GTΑTATAACCTCTCC CΑCTGGGG5 Σν πξσηαξρηθό ηκήκα παξαηεξνύκε όηη δελ ζπλδέεηαη ζηελ άθξε ηεο αιπζίδαο ΙΙ. πλεπώο ζε απηή ηελ αιπζίδα δεκηνπξγήζεθαλ πεξηζζόηεξα από έλα πξσηαξρηθά ηκήκαηα θαη ζα αληηγξάθεηαη αζπλερώο. ηελ αιπζίδα Ι ε αληηγξαθή ζαγίλεηαη κε ζπλερή ηξόπν. Δπηκέιεηα ζεκάησλ: Χάιθνο Γεκήηξηνο, Βηνιόγνο, Phd.

Απνηειέζκαηα Εξσηεκαηνινγίνπ 2o ηεηξάκελν 2011-12

Απνηειέζκαηα Εξσηεκαηνινγίνπ 2o ηεηξάκελν 2011-12 Απνηειέζκαηα Εξσηεκαηνινγίνπ 2o ηεηξάκελν 11-12 Project 6: Ταμίδη κε ηε Μεραλή ηνπ Φξόλνπ Υπεύζπλνη Καζεγεηέο: Ε. Μπηιαλάθε Φ. Αλησλάηνο Δρώηηζη 3: Πνηα από ηα παξαθάησ ΜΜΕ ηεξαξρείηε από πιεπξάο ζεκαζίαο;

Διαβάστε περισσότερα

Αζθήζεηο 5 νπ θεθαιαίνπ Crash course Step by step training. Dipl.Biol.cand.med. Stylianos Kalaitzis

Αζθήζεηο 5 νπ θεθαιαίνπ Crash course Step by step training. Dipl.Biol.cand.med. Stylianos Kalaitzis Αζθήζεηο 5 νπ θεθαιαίνπ Crash course Step by step training Dipl.Biol.cand.med. Stylianos Kalaitzis Stylianos Kalaitzis Μνλνϋβξηδηζκνο 1 Γπν γνλείο, εηεξόδπγνη γηα ηνλ αιθηζκό θάλνπλ παηδηά. Πνία ε πηζαλόηεηα

Διαβάστε περισσότερα

H ΜΑΓΕΙΑ ΤΩΝ ΑΡΙΘΜΩΝ

H ΜΑΓΕΙΑ ΤΩΝ ΑΡΙΘΜΩΝ H ΜΑΓΕΙΑ ΤΩΝ ΑΡΙΘΜΩΝ Φξεζηκόηεηα καζεκαηηθώλ Αξρή θαηακέηξεζεο Όζα έδσζαλ νη Έιιελεο... Τξίγσλνη αξηζκνί Τεηξάγσλνη αξηζκνί Δπηκήθεηο αξηζκνί Πξώηνη αξηζκνί Αξηζκνί κε μερσξηζηέο ηδηόηεηεο Γίδπκνη πξώηνη

Διαβάστε περισσότερα

ΠΑΡΑΡΣΗΜΑ Δ. ΔΤΡΔΗ ΣΟΤ ΜΔΣΑΥΗΜΑΣΙΜΟΤ FOURIER ΓΙΑΦΟΡΩΝ ΗΜΑΣΩΝ

ΠΑΡΑΡΣΗΜΑ Δ. ΔΤΡΔΗ ΣΟΤ ΜΔΣΑΥΗΜΑΣΙΜΟΤ FOURIER ΓΙΑΦΟΡΩΝ ΗΜΑΣΩΝ ΠΑΡΑΡΣΗΜΑ Δ. ΔΤΡΔΗ ΣΟΤ ΜΔΣΑΥΗΜΑΣΙΜΟΤ FOURIER ΓΙΑΦΟΡΩΝ ΗΜΑΣΩΝ Εδώ ζα ππνινγίζνπκε ην κεηαζρεκαηηζκό Fourier κεξηθώλ αθόκα ζεκάησλ, πξνζπαζώληαο λα μεθηλήζνπκε από ην κεηαζρεκαηηζκό Fourier γλσζηώλ ζεκάησλ

Διαβάστε περισσότερα

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου ΥΟΛΕΙΟ..

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου ΥΟΛΕΙΟ.. ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου έλαξμεο 09.30 ιήμεο 09.45 Σην παξαθάησ ζρήκα θαίλεηαη ηκήκα ελόο πνιενδνκηθνύ ζρεδίνπ κηαο πόιεο. Οη ζθηαζκέλεο

Διαβάστε περισσότερα

ΔΝΓΔΙΚΤΙΚΔΣ ΛΥΣΔΙΣ ΣΤΑ ΜΑΘΗΜΑΤΙΚΑ ΚΑΤΔΥΘΥΝΣΗΣ Γ ΛΥΚΔΙΟΥ ΓΔΥΤΔΡΑ 27 ΜΑΪΟΥ 2013

ΔΝΓΔΙΚΤΙΚΔΣ ΛΥΣΔΙΣ ΣΤΑ ΜΑΘΗΜΑΤΙΚΑ ΚΑΤΔΥΘΥΝΣΗΣ Γ ΛΥΚΔΙΟΥ ΓΔΥΤΔΡΑ 27 ΜΑΪΟΥ 2013 ΔΝΓΔΙΚΤΙΚΔΣ ΛΥΣΔΙΣ ΣΤΑ ΜΑΘΗΜΑΤΙΚΑ ΚΑΤΔΥΘΥΝΣΗΣ Γ ΛΥΚΔΙΟΥ ΓΔΥΤΔΡΑ 7 ΜΑΪΟΥ 13 ΘΔΜΑ Α : (Α1) Σρνιηθό βηβιίν ζειίδα 33-335 (Α) Σρνιηθό βηβιίν ζειίδα 6 (Α3) Σρνιηθό βηβιίν ζειίδα (Α) α) Λάζνο β) Σωζηό γ) Σωζηό

Διαβάστε περισσότερα

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου ΥΟΛΕΙΟ..

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου ΥΟΛΕΙΟ.. ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου έλαξμεο 09.30 ιήμεο 09.45 Σην παξαθάησ ζρήκα θαίλεηαη ηκήκα ελόο πνιενδνκηθνύ ζρεδίνπ κηαο πόιεο. Οη ζθηαζκέλεο

Διαβάστε περισσότερα

Άζκηζη ζτέζης κόζηοσς-τρόνοσ (Cost Time trade off) Καηαζκεσαζηική ΑΔ

Άζκηζη ζτέζης κόζηοσς-τρόνοσ (Cost Time trade off) Καηαζκεσαζηική ΑΔ Άζκηζη ζτέζης κόζηοσς-τρόνοσ (Cost Time trade off) Καηαζκεσαζηική Δίζηε μησανικόρ διοίκηζηρ μεγάληρ καηαζκεςαζηικήρ εηαιπείαρ και καλείζηε να ςλοποιήζεηε ηο έπγο πος πεπιγπάθεηαι από ηον Πίνακα 1. Κωδ.

Διαβάστε περισσότερα

ΔΕΟ 13. Ποσοτικές Μέθοδοι. θαη λα ππνινγίζεηε ην θόζηνο γηα 10000 παξαγόκελα πξντόληα. Να ζρεδηαζηεί γηα εύξνο πξντόλησλ έσο 30000.

ΔΕΟ 13. Ποσοτικές Μέθοδοι. θαη λα ππνινγίζεηε ην θόζηνο γηα 10000 παξαγόκελα πξντόληα. Να ζρεδηαζηεί γηα εύξνο πξντόλησλ έσο 30000. ΔΕΟ 13 Ποσοτικές Μέθοδοι Σσνάρηηζη Κόζηοσς C(), μέζο κόζηος C()/. Παράδειγμα 1 Μηα εηαηξεία δαπαλά γηα θάζε πξντόλ Α πνπ παξάγεη 0.0 λ.κ. Τα πάγηα έμνδα ηεο εηαηξείαο είλαη 800 λ.κ. Ζεηείηαη 1) Να πεξηγξάςεηε

Διαβάστε περισσότερα

ΠΟΛΤΜΕΡΙΜΟ - ΠΕΣΡΟΥΗΜΙΚΑ

ΠΟΛΤΜΕΡΙΜΟ - ΠΕΣΡΟΥΗΜΙΚΑ ΠΟΛΤΜΕΡΙΜΟ - ΠΕΣΡΟΥΗΜΙΚΑ ΠΑΡΑΔΕΙΓΜΑΣΑ Ο πολσμεριζμός Πολσμεριζμός είναι η τημική ανηίδραζη καηά ηην οποία πολλά μόρια ίδιων ή διαθορεηικών οργανικών ενώζεων, ποσ ονομάζονηαι μονομερή, ενώνονηαι και ζτημαηίζοσν

Διαβάστε περισσότερα

ΑΝΤΗΛΙΑΚΑ. Η Μηκή ζθέθηεθε έλαλ ηξόπν, γηα λα ζπγθξίλεη κεξηθά δηαθνξεηηθά αληειηαθά πξντόληα. Απηή θαη ν Νηίλνο ζπλέιεμαλ ηα αθόινπζα πιηθά:

ΑΝΤΗΛΙΑΚΑ. Η Μηκή ζθέθηεθε έλαλ ηξόπν, γηα λα ζπγθξίλεη κεξηθά δηαθνξεηηθά αληειηαθά πξντόληα. Απηή θαη ν Νηίλνο ζπλέιεμαλ ηα αθόινπζα πιηθά: ΑΝΤΗΛΙΑΚΑ Η Μηκή θαη ν Νηίλνο αλαξσηήζεθαλ πνην αληειηαθό πξντόλ παξέρεη ηελ θαιύηεξε πξνζηαζία ζην δέξκα ηνπο. Τα αληειηαθά πξντόληα έρνπλ έλα δείθηε αληειηαθήο πξνζηαζίαο (SPF), ν νπνίνο δείρλεη πόζν

Διαβάστε περισσότερα

Μονοψϊνιο. Αγνξά κε ιίγνπο αγνξαζηέο. Δύναμη μονοψωνίος Η ηθαλόηεηα πνπ έρεη ν αγνξαζηήο λα επεξεάζεη ηελ ηηκή ηνπ αγαζνύ.

Μονοψϊνιο. Αγνξά κε ιίγνπο αγνξαζηέο. Δύναμη μονοψωνίος Η ηθαλόηεηα πνπ έρεη ν αγνξαζηήο λα επεξεάζεη ηελ ηηκή ηνπ αγαζνύ. Μονοψϊνιο Ολιγοψώνιο Αγνξά κε ιίγνπο αγνξαζηέο. Δύναμη μονοψωνίος Η ηθαλόηεηα πνπ έρεη ν αγνξαζηήο λα επεξεάζεη ηελ ηηκή ηνπ αγαζνύ. Οπιακή αξία Δπηπξόζζεηα νθέιε από ηελ ρξήζε/θαηαλάισζε κηαο επηπξόζζεηε

Διαβάστε περισσότερα

ΑΛΛΑΓΗ ΟΝΟΜΑΣΟ ΚΑΙ ΟΜΑΔΑ ΕΡΓΑΙΑ, ΚΟΙΝΟΥΡΗΣΟΙ ΦΑΚΕΛΟΙ ΚΑΙ ΕΚΣΤΠΩΣΕ ΣΑ WINDOWS XP

ΑΛΛΑΓΗ ΟΝΟΜΑΣΟ ΚΑΙ ΟΜΑΔΑ ΕΡΓΑΙΑ, ΚΟΙΝΟΥΡΗΣΟΙ ΦΑΚΕΛΟΙ ΚΑΙ ΕΚΣΤΠΩΣΕ ΣΑ WINDOWS XP ΑΛΛΑΓΗ ΟΝΟΜΑΣΟ ΚΑΙ ΟΜΑΔΑ ΕΡΓΑΙΑ, ΚΟΙΝΟΥΡΗΣΟΙ ΦΑΚΕΛΟΙ ΚΑΙ ΕΚΣΤΠΩΣΕ ΣΑ WINDOWS XP ηότοι εργαζηηρίοσ ην πιαίζην ηνπ ζπγθεθξηκέλνπ εξγαζηεξίνπ ζα παξνπζηαζηνύλ βαζηθέο ιεηηνπξγίεο ησλ Windows XP πνπ ζρεηίδνληαη

Διαβάστε περισσότερα

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΤΙΚΗ ΣΚΥΤΑΛΟΓΡΟΜΙΑ 2015 ΓΙΑ ΤΟ ΓΥΜΝΑΣΙΟ Τεηάπηη 28 Ιανουαπίου 2015 ΛΔΥΚΩΣΙΑ Τάξη: Α Γυμναζίου

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΤΙΚΗ ΣΚΥΤΑΛΟΓΡΟΜΙΑ 2015 ΓΙΑ ΤΟ ΓΥΜΝΑΣΙΟ Τεηάπηη 28 Ιανουαπίου 2015 ΛΔΥΚΩΣΙΑ Τάξη: Α Γυμναζίου ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΤΙΚΗ ΣΚΥΤΑΛΟΓΡΟΜΙΑ 2015 ΓΙΑ ΤΟ ΓΥΜΝΑΣΙΟ Τεηάπηη 28 Ιανουαπίου 2015 ΛΔΥΚΩΣΙΑ Τάξη: Α Γυμναζίου ΠΡΟΒΛΗΜΑ Σε έλα ηνπξλνπά βόιετ δήισζαλ ζπκκεηνρή νκάδεο Γπκλαζίσλ ηεο Κύπξνπ.

Διαβάστε περισσότερα

iii. iv. γηα ηελ νπνία ηζρύνπλ: f (1) 2 θαη

iii. iv. γηα ηελ νπνία ηζρύνπλ: f (1) 2 θαη ΔΠΑΝΑΛΗΠΣΙΚΑ ΘΔΜΑΣΑ ΣΟ ΓΙΑΦΟΡΙΚΟ ΛΟΓΙΜΟ Μάρτιος 0 ΘΔΜΑ Να ππνινγίζεηε ηα όξηα: i ii lim 0 0 lim iii iv lim e 0 lim e 0 ΘΔΜΑ Γίλεηαη ε άξηηα ζπλάξηεζε '( ) ( ) γηα θάζε 0 * : R R γηα ηελ νπνία ηζρύνπλ:

Διαβάστε περισσότερα

Δπηιέγνληαο ην «Πξνεπηινγή» θάζε θνξά πνπ ζα ζπλδέεζηε ζηελ εθαξκνγή ζα βξίζθεζηε ζηε λέα ρξήζε.

Δπηιέγνληαο ην «Πξνεπηινγή» θάζε θνξά πνπ ζα ζπλδέεζηε ζηελ εθαξκνγή ζα βξίζθεζηε ζηε λέα ρξήζε. ΑΝΟΙΓΜΑ ΝΔΑ ΥΡΗΗ 1. Γεκηνπξγείηε ηε λέα ρξήζε από ηελ επηινγή «Παξάκεηξνη/Παξάκεηξνη Δηαηξίαο/Γηαρείξηζε Δηαηξηώλ». Πιεθηξνινγείηε ηνλ θσδηθό ηεο εηαηξίαο ζαο θαη παηάηε Enter. Σηελ έλδεημε «Υξήζεηο» παηάηε

Διαβάστε περισσότερα

Βάσεις Δεδομέμωμ. Εξγαζηήξην V. Τκήκα Πιεξνθνξηθήο ΑΠΘ 2015-2016

Βάσεις Δεδομέμωμ. Εξγαζηήξην V. Τκήκα Πιεξνθνξηθήο ΑΠΘ 2015-2016 Βάσεις Δεδομέμωμ Εξγαζηήξην V Τκήκα Πιεξνθνξηθήο ΑΠΘ 2015-2016 2 Σκοπός του 5 ου εργαστηρίου Σθνπόο απηνύ ηνπ εξγαζηεξίνπ είλαη: ε κειέηε ζύλζεησλ εξσηεκάησλ ζύλδεζεο ζε δύν ή πεξηζζόηεξεο ζρέζεηο ε κειέηε

Διαβάστε περισσότερα

ΜΑΘΗΜΑΣΑ ΦΩΣΟΓΡΑΦΙΑ. Ειζαγωγή ζηη Φωηογραθία. Χριζηάκης Σαζεΐδης EFIAP

ΜΑΘΗΜΑΣΑ ΦΩΣΟΓΡΑΦΙΑ. Ειζαγωγή ζηη Φωηογραθία. Χριζηάκης Σαζεΐδης EFIAP ΜΑΘΗΜΑΣΑ ΦΩΣΟΓΡΑΦΙΑ Ειζαγωγή ζηη Φωηογραθία Χριζηάκης Σαζεΐδης EFIAP 1 ΜΑΘΗΜΑ 6 ο Προγράμμαηα θωηογραθικών μηχανών Επιλογέας προγραμμάηων Μαο δίλεη ηε δπλαηόηεηα λα ειέγμνπκε ην άλνηγκα δηαθξάγκαηνο θαη

Διαβάστε περισσότερα

Α. Εηζαγσγή ηεο έλλνηαο ηεο ηξηγσλνκεηξηθήο εμίζσζεο κε αξρηθό παξάδεηγκα ηελ εκx = 2

Α. Εηζαγσγή ηεο έλλνηαο ηεο ηξηγσλνκεηξηθήο εμίζσζεο κε αξρηθό παξάδεηγκα ηελ εκx = 2 ΣΡΙΓΩΝΟΜΔΣΡΙΚΔ EΞΙΩΔΙ Πνηα παξαδείγκαηα εμηζώζεσλ ή θαη πξνβιεκάησλ πηζηεύεηαη όηη είλαη θαηάιιεια γηα ηελ επίιπζε ηνπο θαηά ηελ δηάξθεηα ηεο δηδαθηηθήο δηαδηθαζίαο κέζα ζηελ ηάμε; 1 ε ΓΙΓΑΚΣΙΚΗ ΩΡΑ Α.

Διαβάστε περισσότερα

ΠΑΝΔΛΛΑΓΗΚΔ ΔΞΔΣΑΔΗ Γ ΣΑΞΖ ΖΜΔΡΖΗΟΤ ΚΑΗ Γ ΣΑΞΖ ΔΠΔΡΗΝΟΤ ΓΔΝΗΚΟΤ ΛΤΚΔΗΟΤ ΠΑΡΑΚΔΤΖ 24 ΜΑΪΟΤ 2013 - ΔΞΔΣΑΕΟΜΔΝΟ ΜΑΘΖΜΑ: ΒΗΟΛΟΓΗΑ ΘΔΣΗΚΖ ΚΑΣΔΤΘΤΝΖ

ΠΑΝΔΛΛΑΓΗΚΔ ΔΞΔΣΑΔΗ Γ ΣΑΞΖ ΖΜΔΡΖΗΟΤ ΚΑΗ Γ ΣΑΞΖ ΔΠΔΡΗΝΟΤ ΓΔΝΗΚΟΤ ΛΤΚΔΗΟΤ ΠΑΡΑΚΔΤΖ 24 ΜΑΪΟΤ 2013 - ΔΞΔΣΑΕΟΜΔΝΟ ΜΑΘΖΜΑ: ΒΗΟΛΟΓΗΑ ΘΔΣΗΚΖ ΚΑΣΔΤΘΤΝΖ ΠΑΝΔΛΛΑΓΗΚΔ ΔΞΔΣΑΔΗ Γ ΣΑΞΖ ΖΜΔΡΖΗΟΤ ΚΑΗ Γ ΣΑΞΖ ΔΠΔΡΗΝΟΤ ΓΔΝΗΚΟΤ ΛΤΚΔΗΟΤ ΠΑΡΑΚΔΤΖ 24 ΜΑΪΟΤ 2013 - ΔΞΔΣΑΕΟΜΔΝΟ ΜΑΘΖΜΑ: ΒΗΟΛΟΓΗΑ ΘΔΣΗΚΖ ΚΑΣΔΤΘΤΝΖ ΘΔΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΔΜΑ B Β1. Η γνληδηαθή

Διαβάστε περισσότερα

Παιχνίδι γλωζζικής καηανόηζης με ζχήμαηα!

Παιχνίδι γλωζζικής καηανόηζης με ζχήμαηα! Cpyright 2013 Λόγος & Επικοινωνία // All rights Reserved Παιχνίδι γλωζζικής καηανόηζης με ζχήμαηα! Αυηό ηο παιχνίδι έχει ζηόχους: 1. ηελ εθγύκλαζε ηεο αθνπζηηθήο κλήκεο ησλ παηδηώλ 2. ηελ εμάζθεζε ζηελ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΔΙΣ ΓΙΚΤΥΑ ΥΠΟΛΟΓΙΣΤΩΝ II ΔΠΑΛ

ΑΠΑΝΤΗΣΔΙΣ ΓΙΚΤΥΑ ΥΠΟΛΟΓΙΣΤΩΝ II ΔΠΑΛ ΑΠΑΝΤΗΣΔΙΣ ΓΙΚΤΥΑ ΥΠΟΛΟΓΙΣΤΩΝ II ΔΠΑΛ ΘΔΜΑ Α Α1. α. Σ β. Σ γ. Λ δ. Λ ε. Λ ζη. Σ Α2. Γ Α3. 1. γ 2. ε 3. δ 4. α Β1. ΘΔΜΑ Β Οη ηειηθνί ππνινγηζηέο παίξλνπλ απνθάζεηο δξνκνιόγεζεο κόλν γηα ηα δηθά ηνπο απηνδύλακα

Διαβάστε περισσότερα

ΠΑΡΔΜΒΑΔΙ ΔΤΑΙΘΗΣΟΠΟΙΗΗ ΚΑΙ ΠΡΟΛΗΨΗ ΓΙΑ ΣΟΝ HIV/AIDS ΣΗΝ ΑΚΣΟΓΡΑΜΜΗ ΣΩΝ ΠΔΡΙΦΔΡΔΙΑΚΩΝ ΔΝΟΣΗΣΩΝ ΣΗ ΚΔΝΣΡΙΚΗ ΜΑΚΔΓΟΝΙΑ ΑΤΓΟΤΣΟ 2014

ΠΑΡΔΜΒΑΔΙ ΔΤΑΙΘΗΣΟΠΟΙΗΗ ΚΑΙ ΠΡΟΛΗΨΗ ΓΙΑ ΣΟΝ HIV/AIDS ΣΗΝ ΑΚΣΟΓΡΑΜΜΗ ΣΩΝ ΠΔΡΙΦΔΡΔΙΑΚΩΝ ΔΝΟΣΗΣΩΝ ΣΗ ΚΔΝΣΡΙΚΗ ΜΑΚΔΓΟΝΙΑ ΑΤΓΟΤΣΟ 2014 ΠΑΡΔΜΒΑΔΙ ΔΤΑΙΘΗΣΟΠΟΙΗΗ ΚΑΙ ΠΡΟΛΗΨΗ ΓΙΑ ΣΟΝ HIV/AIDS ΣΗΝ ΑΚΣΟΓΡΑΜΜΗ ΣΩΝ ΠΔΡΙΦΔΡΔΙΑΚΩΝ ΔΝΟΣΗΣΩΝ ΣΗ ΚΔΝΣΡΙΚΗ ΜΑΚΔΓΟΝΙΑ ΑΤΓΟΤΣΟ 2014 Σν ΚΔ.ΔΛ.Π.ΝΟ., Γξαθείν Θεζζαινλίθεο θαη ε Γηεύζπλζε Γεκόζηαο Τγείαο ηεο

Διαβάστε περισσότερα

Σημεία Ασύπματηρ Ππόσβασηρ (Hot-Spots)

Σημεία Ασύπματηρ Ππόσβασηρ (Hot-Spots) Σημεία Ασύπματηρ Ππόσβασηρ (Hot-Spots) 1.1 Σςνοπτική Πεπιγπαυή Hot Spots Σα ζεκεία αζύξκαηεο πξόζβαζεο πνπ επηιέρζεθαλ αλαθέξνληαη ζηνλ επόκελν πίλαθα θαη παξνπζηάδνληαη αλαιπηηθά ζηηο επόκελεο παξαγξάθνπο.

Διαβάστε περισσότερα

Λεκηική έκθραζη, κριηική, οικειόηηηα και ηύπος δεζμού ζηις ζηενές διαπροζωπικές ζτέζεις

Λεκηική έκθραζη, κριηική, οικειόηηηα και ηύπος δεζμού ζηις ζηενές διαπροζωπικές ζτέζεις Λεκηική έκθραζη, κριηική, οικειόηηηα και ηύπος δεζμού ζηις ζηενές διαπροζωπικές ζτέζεις Μαξία-Ησάλλα Αξγπξνπνύινπ Βαζίιεο Παπιόπνπινο Τνκέαο Ψπρνινγίαο, Παλεπηζηήκην Αζελώλ Αλαθνίλσζε ζην 5 ν Παλειιήλην

Διαβάστε περισσότερα

ΔΦΑΡΜΟΜΔΝΑ ΜΑΘΗΜΑΣΙΚΑ ΣΗ ΧΗΜΔΙΑ Ι ΘΔΜΑΣΑ Α επηέκβξηνο 2009. 1. Να ππνινγηζηνύλ νη κεξηθέο παξάγσγνη πξώηεο ηάμεο ηεο ζπλάξηεζεο f(x,y) =

ΔΦΑΡΜΟΜΔΝΑ ΜΑΘΗΜΑΣΙΚΑ ΣΗ ΧΗΜΔΙΑ Ι ΘΔΜΑΣΑ Α επηέκβξηνο 2009. 1. Να ππνινγηζηνύλ νη κεξηθέο παξάγσγνη πξώηεο ηάμεο ηεο ζπλάξηεζεο f(x,y) = ΘΔΜΑΣΑ Α επηέκβξηνο 9. Να ππνινγηζηνύλ νη κεξηθέο παξάγσγνη πξώηεο ηάμεο ηεο ζπλάξηεζεο f(,y) = y.. Να ππνινγηζηνύλ ηα νινθιεξώκαηα: a) ln b) a) 3cos b) e sin 4. Να ππνινγηζηεί ην νινθιήξσκα: S ( y) 3

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ ΘΕΜΑ 1 Ο Να γράψετε στο τετράδιό σας τον αριθµό της καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 εως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

ΛΙΜΝΗ ΤΣΑΝΤ. Σρήκα 1. Σρήκα 2

ΛΙΜΝΗ ΤΣΑΝΤ. Σρήκα 1. Σρήκα 2 ΛΙΜΝΗ ΤΣΑΝΤ Τν Σρήκα 1 δείρλεη ηελ αιιαγή ηεο ζηάζκεο ηεο Λίκλεο Τζαλη, ζηε Σαράξα ηεο Βόξεηαο Αθξηθήο. Η Λίκλε Τζαλη εμαθαλίζηεθε ηειείσο γύξσ ζην 20.000 π.χ., θαηά ηε δηάξθεηα ηεο ηειεπηαίαο επνρήο ησλ

Διαβάστε περισσότερα

ΑΠΛΟΠΟΙΗΗ ΛΟΓΙΚΩΝ ΤΝΑΡΣΗΕΩΝ ΜΕ ΠΙΝΑΚΕ KARNAUGH

ΑΠΛΟΠΟΙΗΗ ΛΟΓΙΚΩΝ ΤΝΑΡΣΗΕΩΝ ΜΕ ΠΙΝΑΚΕ KARNAUGH ΑΠΛΟΠΟΙΗΗ ΛΟΓΙΚΩΝ ΤΝΑΡΣΗΕΩΝ ΜΕ ΠΙΝΑΚΕ KRNUGH Γηα λα θάλνπκε απινπνίεζε κηαο ινγηθήο ζπλάξηεζεο κε πίλαθα (ή ράξηε) Karnaugh αθνινπζνύκε ηα παξαθάησ βήκαηα:. Η ινγηθή ζπλάξηεζε ζα πξέπεη λα είλαη ζε πιήξε

Διαβάστε περισσότερα

Τηλζφωνο: 99543321 Ε-mail: savvas_email@yahoo.com Ώρες διδασκαλίας: 16:00 19:15 μμ

Τηλζφωνο: 99543321 Ε-mail: savvas_email@yahoo.com Ώρες διδασκαλίας: 16:00 19:15 μμ ΠΑΙΓΑΓΩΓΙΚΟ ΙΝΣΙΣΟΤΣΟ ΚΤΠΡΟΤ Πξόγξακκα Δπηκόξθσζεο Τπνςεθίσλ Καζεγεηώλ Σερλνινγίαο Γελάξεο 2011 ΗΛΔΚΣΡΟΝΙΚΑ Ι (Ύιε Γπκλαζίνπ) Διδάσκων: Σαββίδης Σάββας Τηλζφωνο: 99543321 Ε-mail: savvas_email@yahoo.com

Διαβάστε περισσότερα

T A E K W O N D O. Δ. ΠπθαξΨο. ΔπΫθνπξνο ΘαζεγεηΪο ΑζιεηηθΪο ΦπζηθνζεξαπεΫαο ΡΔΦΑΑ - ΑΞΘ

T A E K W O N D O. Δ. ΠπθαξΨο. ΔπΫθνπξνο ΘαζεγεηΪο ΑζιεηηθΪο ΦπζηθνζεξαπεΫαο ΡΔΦΑΑ - ΑΞΘ T A E K W O N D O Δ. ΠπθαξΨο ΔπΫθνπξνο ΘαζεγεηΪο ΑζιεηηθΪο ΦπζηθνζεξαπεΫαο ΡΔΦΑΑ - ΑΞΘ ΦΠΗΘΝΘΔΟΑΞΔΗΑ Ο Ρ Ι Μ Ο Φπζη(θ)νζεξαπεΫα εϋλαη ε επηζηϊκε, ε νπνϋα κόλν κε θπζηθψ κωζα θαη κεζόδνπο πξνζπαζεϋ λα ζεξαπεύζεη

Διαβάστε περισσότερα

TOOLBOOK (μάθημα 2) Δεκηνπξγία βηβιίνπ θαη ζειίδσλ ΠΡΟΑΡΜΟΓΗ: ΒΑΛΚΑΝΙΩΣΗ ΔΗΜ. ΕΚΠΑΙΔΕΤΣΙΚΟ ΠΕ19 1 TOOLBOOK ΜΑΘΗΜΑ 2

TOOLBOOK (μάθημα 2) Δεκηνπξγία βηβιίνπ θαη ζειίδσλ ΠΡΟΑΡΜΟΓΗ: ΒΑΛΚΑΝΙΩΣΗ ΔΗΜ. ΕΚΠΑΙΔΕΤΣΙΚΟ ΠΕ19 1 TOOLBOOK ΜΑΘΗΜΑ 2 TOOLBOOK (μάθημα 2) Δεκηνπξγία βηβιίνπ θαη ζειίδσλ ΕΚΠΑΙΔΕΤΣΙΚΟ ΠΕ19 1 Δημιουργία σελίδων και βιβλίων Έλα θαηλνύξην βηβιίν πεξηέρεη κία άδεηα ζειίδα κε έλα άδεην background. Δελ κπνξνύκε λα μερσξίζνπκε

Διαβάστε περισσότερα

ΠΕΤΡΕΛΑΙΟ ΧΑΡΑΛΑΜΠΟΤ ΜΑΡΙΑ ΣΖΑΜΟΤΡΑΝΗ ΕΛΕΝΗ ΟΤΣΖΙΟΤ ΑΤΓΕΡΙΝΗ ΧΑΙΔΕΜΕΝΑΚΗ ΝΑΣΑΛΙΑ

ΠΕΤΡΕΛΑΙΟ ΧΑΡΑΛΑΜΠΟΤ ΜΑΡΙΑ ΣΖΑΜΟΤΡΑΝΗ ΕΛΕΝΗ ΟΤΣΖΙΟΤ ΑΤΓΕΡΙΝΗ ΧΑΙΔΕΜΕΝΑΚΗ ΝΑΣΑΛΙΑ 1 ΠΕΤΡΕΛΑΙΟ ΧΑΡΑΛΑΜΠΟΤ ΜΑΡΙΑ ΣΖΑΜΟΤΡΑΝΗ ΕΛΕΝΗ ΟΤΣΖΙΟΤ ΑΤΓΕΡΙΝΗ ΧΑΙΔΕΜΕΝΑΚΗ ΝΑΣΑΛΙΑ ΝΟΗΠΚΝΠ 2 Τν πεηξέιαην, πνπ κεξηθέο θνξέο ζηελ θαζεκεξηλή γιώζζα απνθαιείηαη θαη μαύπορ σπςσόρ ή τσάι τος Ρέξαρ, είλαη

Διαβάστε περισσότερα

ΘΔΚΑ ΡΖΠ ΑΛΑΓΛΩΟΗΠΖΠ

ΘΔΚΑ ΡΖΠ ΑΛΑΓΛΩΟΗΠΖΠ ΘΔΚΑ ΡΖΠ ΑΛΑΓΛΩΟΗΠΖΠ 1.Απηόο πνπ ζα αλαγλσξηζηεί απνπζηάδεη γηα πνιύ θαηξό. 2.Δπηζηξέθεη κε πιαζηή ηαπηόηεηα ή κεηακνξθσκέλνο. 3.Απνκνλώλνληαη ηα δύν πξόζσπα 4.Άξζε κεηακόξθσζεο 5.Απνθάιπςε 6.Ακθηβνιίεο-απνδεηθηηθά

Διαβάστε περισσότερα

Σύνθεζη ηαλανηώζεων. Έζησ έλα ζώκα πνπ εθηειεί ηαπηόρξνλα δύν αξκνληθέο ηαιαληώζεηο ηεο ίδηαο ζπρλόηεηαο πνπ πεξηγξάθνληαη από ηηο παξαθάησ εμηζώζεηο:

Σύνθεζη ηαλανηώζεων. Έζησ έλα ζώκα πνπ εθηειεί ηαπηόρξνλα δύν αξκνληθέο ηαιαληώζεηο ηεο ίδηαο ζπρλόηεηαο πνπ πεξηγξάθνληαη από ηηο παξαθάησ εμηζώζεηο: Σύνθεζη ηαλανηώζεων Α. Σύλζεζε δύν α.α.η ηεο ίδιας ζστνόηηηας Έζησ έλα ζώκα πνπ εθηειεί ηαπηόρξνλα δύν αξκνληθέο ηαιαληώζεηο ηεο ίδηαο ζπρλόηεηαο πνπ πεξηγξάθνληαη από ηηο παξαθάησ εμηζώζεηο: Η απνκάθξπλζε

Διαβάστε περισσότερα

Δξγαιεία Καηαζθεπέο 1 Σάμε Σ Δ.Κ.Φ.Δ. ΥΑΝΙΧΝ ΠΡΧΣΟΒΑΘΜΙΑ ΔΚΠΑΙΓΔΤΗ. ΔΝΟΣΗΣΑ 11 ε : ΦΧ ΔΡΓΑΛΔΙΑ ΚΑΣΑΚΔΤΔ. Καηαζθεπή 1: Φαθόο κε ζσιήλα.

Δξγαιεία Καηαζθεπέο 1 Σάμε Σ Δ.Κ.Φ.Δ. ΥΑΝΙΧΝ ΠΡΧΣΟΒΑΘΜΙΑ ΔΚΠΑΙΓΔΤΗ. ΔΝΟΣΗΣΑ 11 ε : ΦΧ ΔΡΓΑΛΔΙΑ ΚΑΣΑΚΔΤΔ. Καηαζθεπή 1: Φαθόο κε ζσιήλα. Δξγαιεία Καηαζθεπέο 1 Δ.Κ.Φ.Δ. ΥΑΝΙΧΝ ΠΡΧΣΟΒΑΘΜΙΑ ΔΚΠΑΙΓΔΤΗ ΔΝΟΣΗΣΑ 11 ε : ΦΧ ΔΡΓΑΛΔΙΑ ΚΑΣΑΚΔΤΔ Καηαζθεπή 1: Φαθόο κε ζσιήλα Γηαθξάγκαηα Δξγαιεία Καηαζθεπέο 2 Η θαηαζθεπή πεξηγξάθεηαη ζηελ αληίζηνηρε ελόηεηα

Διαβάστε περισσότερα

ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ

ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ ΜΑΘΗΜΑ : ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ Α/Α : 0_1382/153 1. Καη όηαλ έγηλε ε ππνρώξεζε αξγά ην απόγεπκα, επεηδή θνβήζεθαλ νη νιηγαξρηθνί κήπσο νη δεκνθξαηηθνί, αθνύ θάλνπλ επίζεζε, θαηαιάβνπλ

Διαβάστε περισσότερα

Ζ ύιε εκθαλίδεηαη ζε ηξεηο θαηαζηάζεηο: ζηελ ζηεξεή, ζηελ πγξή θαη ζηελ αέξηα.

Ζ ύιε εκθαλίδεηαη ζε ηξεηο θαηαζηάζεηο: ζηελ ζηεξεή, ζηελ πγξή θαη ζηελ αέξηα. Καηαζηάζεηο ηεο ύιεο 1 ΔΚΦΔ ΥΑΝΗΧΝ ΠΡΧΣΟΒΑΘΜΗΑ ΔΚΠΑΗΓΔΤΖ ΟΗ ΦΤΗΚΔ ΔΠΗΣΖΜΔ ΣΖΝ ΠΡΟΥΟΛΗΚΖ ΑΓΧΓΖ ΔΝΟΣΖΣΑ 1: ΔΗΑΓΧΓΖ ΚΔΦΑΛΑΗΟ 4: ΚΑΣΑΣΑΔΗ ΣΖ ΤΛΖ ΚΑΣΑΣΑΔΗ ΣΖ ΤΛΖ Ζ ύιε εκθαλίδεηαη ζε ηξεηο θαηαζηάζεηο: ζηελ

Διαβάστε περισσότερα

ΑΓΩΜΘΡΘΙΞΘ ΤΩΠΞΘ ΡΘΡ ΛΘΙΠΕΡ ΗΚΘΙΘΕΡ ΛΘΤΑΗΚΘΔΗΡ Τ.

ΑΓΩΜΘΡΘΙΞΘ ΤΩΠΞΘ ΡΘΡ ΛΘΙΠΕΡ ΗΚΘΙΘΕΡ ΛΘΤΑΗΚΘΔΗΡ Τ. ΑΓΩΜΘΡΘΙΞΘ ΤΩΠΞΘ ΡΘΡ ΛΘΙΠΕΡ ΗΚΘΙΘΕΡ ΟΑIΤΜΘΔΘ ΡΕ ΛΕΓΑΚΞ ΓΗΟΕΔΞ 11V11 ΗΚΘΙΘΑ 6-10 ΤΠΞΜΩΜ ΛΕΘΞΜΕΙΗΛΑΑ ΞΣ ΟΑΘΤΜΘΔΘΞΣ ΡΕ ΛΕΓΑΚΞ ΓΗΟΕΔΞ ΓΘΑ ΟΑΘΙΕΡ ΗΚΘΙΘΑΡ 6-10 ΕΩΜ Η ΔΘΑΔΠΞΛΗ ΑΟΞ Η ΛΘΑ ΕΡΘΑ ΡΗΜ ΑΚΚΗ ΕΘΜΑΘ ΛΕΓΑΚΗ

Διαβάστε περισσότερα

Διαηιμήζεις για Αιολικά Πάρκα. Κώδικες 28, 78 και 84

Διαηιμήζεις για Αιολικά Πάρκα. Κώδικες 28, 78 και 84 Διαηιμήζεις για Αιολικά Πάρκα Κώδικες 28, 78 και 84 Διαηιμήζεις για Αιολικά Πάρκα Οη Διαηιμήζεις για Αιολικά Πάρκα εθαξκόδνληαη γηα ηελ απνξξνθνύκελε ελέξγεηα από Αηνιηθά Πάξθα πνπ είλαη ζπλδεδεκέλα ζην

Διαβάστε περισσότερα

Βιομησανικόρ ζσεδιαζμόρ πποϊόνηων από ανακςκλωμένερ ζςζκεςαζίερ

Βιομησανικόρ ζσεδιαζμόρ πποϊόνηων από ανακςκλωμένερ ζςζκεςαζίερ Βιομησανικόρ ζσεδιαζμόρ πποϊόνηων από ανακςκλωμένερ ζςζκεςαζίερ ΤΕΙ Δσηικής Μακεδονίας Τμήμα Βιομητανικού Στεδιαζμού Εργαζηήριο C 3 www.c3.teiwm.gr C 3 LAB www.c3.teiwm.gr 1 Εηζαγσγή Πεπιεσόμενα ύκβνια

Διαβάστε περισσότερα

Δξγαιεία Καηαζθεπέο 1 Σάμε Δ Δ.Κ.Φ.Δ. ΥΑΝΗΩΝ ΠΡΩΣΟΒΑΘΜΗΑ ΔΚΠΑΗΓΔΤΖ. ΔΝΟΣΖΣΑ 2 ε : ΤΛΗΚΑ ΩΜΑΣΑ ΔΡΓΑΛΔΗΑ ΚΑΣΑΚΔΤΔ. Καηαζθεπή 1: Ογθνκεηξηθό δνρείν

Δξγαιεία Καηαζθεπέο 1 Σάμε Δ Δ.Κ.Φ.Δ. ΥΑΝΗΩΝ ΠΡΩΣΟΒΑΘΜΗΑ ΔΚΠΑΗΓΔΤΖ. ΔΝΟΣΖΣΑ 2 ε : ΤΛΗΚΑ ΩΜΑΣΑ ΔΡΓΑΛΔΗΑ ΚΑΣΑΚΔΤΔ. Καηαζθεπή 1: Ογθνκεηξηθό δνρείν Δξγαιεία Καηαζθεπέο 1 Δ.Κ.Φ.Δ. ΥΑΝΗΩΝ ΠΡΩΣΟΒΑΘΜΗΑ ΔΚΠΑΗΓΔΤΖ ΔΝΟΣΖΣΑ 2 ε : ΤΛΗΚΑ ΩΜΑΣΑ ΔΡΓΑΛΔΗΑ ΚΑΣΑΚΔΤΔ Καηαζθεπή 1: Ογθνκεηξηθό δνρείν Καηαζθεπάδνπκε έλα νγθνκεηξηθό δνρείν από πιαζηηθό κπνπθάιη λεξνύ

Διαβάστε περισσότερα

Α Ο Κ Η Α Μ Α Ζ Η Η Ρ Η ( S E A R C H )

Α Ο Κ Η Α Μ Α Ζ Η Η Ρ Η ( S E A R C H ) Ξ G O O G L E S C H O L A R Α Ο Ξ Ε Κ Ε Θ Λ Θ Α Λ Η Τ Α Μ Η Α Μ Α Ζ Η Η Ρ Η Ρ Οξαγκαηνπνηώληαο αλαδήηεζε ζην GoogleScholar (http://scholar.google.com/) ν ρξήζηεο κπνξεί λα εληνπίζεη πιηθό αθαδεκαϊθνύ θαη

Διαβάστε περισσότερα

Γιπθόδε + Ομπγόλν Δηνμείδην ηνπ άλζξαθα + Νεξό + Ελέξγεηα

Γιπθόδε + Ομπγόλν Δηνμείδην ηνπ άλζξαθα + Νεξό + Ελέξγεηα 4. ΑΝΑΠΝΟΗ Η δηάζπαζε ηεο γιπθόδεο γίλεηαη κέζα ζηα θύηηαξα, νλνκάδεηαη θπηηαξηθή αλαπλνή θαη εμαζθαιίδεη ηελ ελέξγεηα πνπ είλαη απαξαίηεηε ζην θύηηαξν. Η δηάζπαζε γίλεηαη κε ηελ παξνπζία νμπγόλνπ θαη

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 4 ΣΥΝΔΥΑΣΤΙΚΑ ΚΥΚΛΩΜΑΤΑ

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 4 ΣΥΝΔΥΑΣΤΙΚΑ ΚΥΚΛΩΜΑΤΑ ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 4 ΣΥΝΔΥΑΣΤΙΚΑ ΚΥΚΛΩΜΑΤΑ 1. ρεδίαζε πλδπαζηηθνύ Κπθιώκαηνο Έλα ζπλδπαζηηθό θύθισκα (Κ) έρεη ηξεηο εηζόδνπο A, B θαη C θαη κία έμνδν Y Y=A B+AC Να θαηαζθεπάζεηε ην ράξηε Karnaugh. B 0

Διαβάστε περισσότερα

ΙNCOFRUIT - (HELLAS).

ΙNCOFRUIT - (HELLAS). Πξνο ΟΛΑ ΤΑ ΜΔΛΗ Κε Σπλάδειθε Θέκα: Ιζπαλία & Γεξκαλία 5 ε ΔΒΓΟΜΑΓΑ 2011 (31 Ιαλ έσο 30 Φεβξ.2011) Παξαζέηνπκε θαησηέξσ: Αλαζθόπεζε ηεο 4 εο εβδνκάδνο 2011 κε ηηο ηηκέο ησλ εζπεξηδνεηδώλ πνπ δηακνξθώζεθαλ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

ΑΙΟΛΙΚΑ ΠΑΡΚΑ. Δρώτηση 1

ΑΙΟΛΙΚΑ ΠΑΡΚΑ. Δρώτηση 1 ΑΙΟΛΙΚΑ ΠΑΡΚΑ Πνιινί άλζξσπνη πηζηεύνπλ όηη ν άλεκνο ζα έπξεπε λα αληηθαηαζηήζεη ην πεηξέιαην θαη ην θάξβνπλν σο πεγή ελέξγεηαο γηα ηελ παξαγσγή ειεθηξηζκνύ. Οη θαηαζθεπέο πνπ θαίλνληαη ζηελ εηθόλα είλαη

Διαβάστε περισσότερα

Εεύγνο Μεηάθαζε Η Μείσζε Η νκνιόγσλ. Γακέηεο. Νόκνο Αλεμάξηεηεο κεηαβίβαζεο ησλ γνληδίσλ (Κιεξνλόκεζε 2 γνληδίσλ) Μείσζε Η. Μείσζε ΗΗ.

Εεύγνο Μεηάθαζε Η Μείσζε Η νκνιόγσλ. Γακέηεο. Νόκνο Αλεμάξηεηεο κεηαβίβαζεο ησλ γνληδίσλ (Κιεξνλόκεζε 2 γνληδίσλ) Μείσζε Η. Μείσζε ΗΗ. Αληηγξαθή DNA Νόκνο Δηαρσξηζκνύ αιιειόκνξθσλ γνληδίσλ (Κληπονόμηζη 1 γονιδίος) Εεύγνο Μεηάθαζε Η Μείσζε Η νκνιόγσλ Μεηάθαζε ΗΗ Μεηάθαζε ΗΗ Μείσζε ΗΗ Γακέηεο Νόκνο Αλεμάξηεηεο κεηαβίβαζεο ησλ γνληδίσλ (Κιεξνλόκεζε

Διαβάστε περισσότερα

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Γ Γυμνασίου ΥΟΛΕΙΟ..

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Γ Γυμνασίου ΥΟΛΕΙΟ.. ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Γ Γυμνασίου ιήμεο 11.00 Κάπνηνο άξρηζε λα δηαβάδεη έλα βηβιίν ηελ 1 ε Δεθεκβξίνπ. Κάζε κέξα δηάβαδε ηνλ ίδην αξηζκό ζειίδσλ

Διαβάστε περισσότερα

Σπληήξεζε ηξνθίκσλ ρσξίο ρεκηθά πξόζζεηα PROJECT B ΛΥΚΕΙΟΥ 2 014-15

Σπληήξεζε ηξνθίκσλ ρσξίο ρεκηθά πξόζζεηα PROJECT B ΛΥΚΕΙΟΥ 2 014-15 Σπληήξεζε ηξνθίκσλ ρσξίο ρεκηθά πξόζζεηα PROJECT B ΛΥΚΕΙΟΥ 2 014-15 Εηζαγσγή Οη ηερληθέο ζπληήξεζεο ηξνθίκσλ έρνπλ ζθνπό : α) λα παξεκπνδίζνπλ αλεπηζύκεηεο κεηαβνιέο ζηα ραξαθηεξηζηηθά (γεύζε - ρξώκα -

Διαβάστε περισσότερα

ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ

ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ Α/Α : 0_3207/391 1. Τελ άιιε κέξα νη Τξηάθνληα, πνιύ ηαπεηλσκέλνη θαη ληώζνληαο εγθαηαιειεηκκέλνη, ζπγθεληξώζεθαλ ζην ρώξν ησλ ζπλεδξηάζεσλ παξάιιεια, νη «ηξεηο ρηιηάδεο», ζε όια ηα ζεκεία όπνπ είραλ ηνπνζεηεζεί,

Διαβάστε περισσότερα

ΥΡΙΣΟΤΓΔΝΝΙΑΣΙΚΔ ΚΑΣΑΚΔΤΔ

ΥΡΙΣΟΤΓΔΝΝΙΑΣΙΚΔ ΚΑΣΑΚΔΤΔ ΥΡΙΣΟΤΓΔΝΝΙΑΣΙΚΔ ΚΑΣΑΚΔΤΔ 1) Υξηζηνπγελληάηηθα ειαηάθηα θάξηα ή θαδξάθη θάξηα ή θαδξάθη Τιηθά πνπ ζα ρξεηαζηνύκε: Υαξηί θάλζνλ καύξν γηα ην θόλην, πξάζηλν γηα ηα ειαηάθηα, θόθθηλν γηα ηα αζηεξάθηα Απιό

Διαβάστε περισσότερα

Κόληξα πιαθέ ζαιάζζεο κε δηαζηάζεηο 40Υ40 εθ. Καξθηά 3 θηιά πεξίπνπ κε κήθνο ηξηπιάζην από ην πάρνο ηνπ μύινπ θπξί κεγάιν θαη ππνκνλή

Κόληξα πιαθέ ζαιάζζεο κε δηαζηάζεηο 40Υ40 εθ. Καξθηά 3 θηιά πεξίπνπ κε κήθνο ηξηπιάζην από ην πάρνο ηνπ μύινπ θπξί κεγάιν θαη ππνκνλή Δξγαιεία Καηαζθεπέο 1 Δ.Κ.Φ.Δ. ΥΑΝΙΩΝ ΠΡΩΣΟΒΑΘΜΙΑ ΔΚΠΑΙΓΔΤΗ ΔΝΟΣΗΣΑ 10 ε : ΜΗΥΑΝΙΚΗ ΜΔΡΟ Β ΠΙΔΗ ΔΡΓΑΛΔΙΑ ΚΑΣΑΚΔΤΔ Καηαζθεπή 1: Καξέθια θαθίξε Όξγαλα Τιηθά Κόληξα πιαθέ ζαιάζζεο κε δηαζηάζεηο 40Υ40 εθ.

Διαβάστε περισσότερα

Τ ξ ε ύ ο ξ π ς ξ σ ξ ο ί ξ σ _ Ι ε ο α μ ε ι κ ό π

Τ ξ ε ύ ο ξ π ς ξ σ ξ ο ί ξ σ _ Ι ε ο α μ ε ι κ ό π Τ ξ ε ύ ο ξ π ς ξ σ ξ ο ί ξ σ _ Ι ε ο α μ ε ι κ ό π Α ο υ ι ς ε κ ς ξ μ ι κ ή ρ ύ μ θ ε ρ η 6 Τ ξ μ έ α π ΘΘΘ, X ώ ο ξ π κ α ι Δ π ι κ ξ ι μ χ μ ί α Η έ μ α : Διδάρκξμςεπ: Τξ εύοξπ ςξσ ξοίξσ Ιεοαμεικόπ

Διαβάστε περισσότερα

ΠΡΩΣΟΚΟΛΛΑ ΓΙΑΥΔΙΡΗΗ ΣΩΝ ΣΔΡΗΓΟΝΙΚΩΝ ΒΛΑΒΩΝ Δ ΔΝΗΛΙΚΔ

ΠΡΩΣΟΚΟΛΛΑ ΓΙΑΥΔΙΡΗΗ ΣΩΝ ΣΔΡΗΓΟΝΙΚΩΝ ΒΛΑΒΩΝ Δ ΔΝΗΛΙΚΔ ΠΡΩΣΟΚΟΛΛΑ ΓΙΑΥΔΙΡΗΗ ΣΩΝ ΣΔΡΗΓΟΝΙΚΩΝ ΒΛΑΒΩΝ Δ ΔΝΗΛΙΚΔ Σν ζύγρξνλν πξόηππν αληηκεηώπηζεο ηεο ηεξεδόλαο ελειίθσλ δελ εζηηάδεηαη κόλν ζηελ απνθαηάζηαζε ησλ ηεξεδνληθώλ βιαβώλ πνπ έρνπλ εθδεισζεί, αιιά έρεη

Διαβάστε περισσότερα

ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ

ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ Α/Α : 0_1379/50 1. Όηαλ ινηπόλ ήξζαλ [νη πξέζβεηο ζηελ Αζήλα], αθνύ ζπλέιαβαλ νη Αζελαίνη θαη ηνπο πξέζβεηο σο ππνθηλεηέο ζηάζεο θαη όζνπο έπεηζαλ [νη πξέζβεηο], ηνπο ζπγθέληξσζαλ γηα αζθάιεηα ζηελ Αίγηλα.

Διαβάστε περισσότερα

Η/Υ A ΤΑΞΕΩΣ ΑΕ 2010-2011. Συστήματα Αρίθμησης. Υποπλοίαρχος Ν. Πετράκος ΠΝ

Η/Υ A ΤΑΞΕΩΣ ΑΕ 2010-2011. Συστήματα Αρίθμησης. Υποπλοίαρχος Ν. Πετράκος ΠΝ Συστήματα Αρίθμησης Υποπλοίαρχος Ν. Πετράκος ΠΝ 1 Ειζαγωγή Τν bit είλαη ε πην βαζηθή κνλάδα κέηξεζεο. Είλαη κία θαηάζηαζε on ή off ζε έλα ςεθηαθό θύθισκα. Άιιεο θνξέο είλαη κία θαηάζηαζε high ή low voltage

Διαβάστε περισσότερα

ΤΑΞΙΝΟΜΗΣΗ ΤΩΝ ΤΔΡΗΓΟΝΙΚΩΝ ΒΛΑΒΩΝ ΚΑΤΑ ΤΑ ICDAS II ΚΡΙΤΗΡΙΑ ΜΔ ΒΑΣΗ ΤΗ ΚΛΙΝΙΚΗ ΔΞΔΤΑΣΗ

ΤΑΞΙΝΟΜΗΣΗ ΤΩΝ ΤΔΡΗΓΟΝΙΚΩΝ ΒΛΑΒΩΝ ΚΑΤΑ ΤΑ ICDAS II ΚΡΙΤΗΡΙΑ ΜΔ ΒΑΣΗ ΤΗ ΚΛΙΝΙΚΗ ΔΞΔΤΑΣΗ ΤΑΞΙΝΟΜΗΣΗ ΤΩΝ ΤΔΡΗΓΟΝΙΚΩΝ ΒΛΑΒΩΝ ΚΑΤΑ ΤΑ ICDAS II ΚΡΙΤΗΡΙΑ ΜΔ ΒΑΣΗ ΤΗ ΚΛΙΝΙΚΗ ΔΞΔΤΑΣΗ Κιηληθή ηαμηλόκεζε ηνπ βαζκνύ ηεξεδνληθήο βιάβεο ηωλ νπώλ θαη ζρηζκώλ καζεηηθώλ επηθαλεηώλ θαηά ICDAS 1 νο Βαζκόο

Διαβάστε περισσότερα

επαξθήο ζηαηηζηηθή ζπλάξηεζε, β) Έζησ η.δ. είλαη αλεμάξηεην ηνπ. Άξα πξόθεηηαη γηα 1 n

επαξθήο ζηαηηζηηθή ζπλάξηεζε, β) Έζησ η.δ. είλαη αλεμάξηεην ηνπ. Άξα πξόθεηηαη γηα 1 n . ΜΑΚΡΑ ΣΟΑ 7 & ΕΘΝ. ΑΝΣΙΣΑΕΩ (ΠΕΙΡΑΙΑ),. ΔΕΛΗΓΙΩΡΓΗ 06 Α (ΠΕΙΡΑΙΑ), 3. ΠΤΡΓΟ ΑΘΗΝΩΝ, ΑΜΠΕΛΟΚΗΠΟΙ (ΑΘΗΝΑ). ΣΗΛ 040970,,, www.vtal.gr Επιλεγμένες Ασκήσεις. α) Έζησ η.δ. Ep. Να δεηρζεί όηη ε T,..., ~, 0

Διαβάστε περισσότερα

ΕΞΟΡΤΞΗ & ΚΑΣΑΚΕΤΕ ΣΗΝ ΕΤΡΩΠΗ ΜΑΘΗΜΑ 43

ΕΞΟΡΤΞΗ & ΚΑΣΑΚΕΤΕ ΣΗΝ ΕΤΡΩΠΗ ΜΑΘΗΜΑ 43 ΕΞΟΡΤΞΗ & ΚΑΣΑΚΕΤΕ ΣΗΝ ΕΤΡΩΠΗ ΜΑΘΗΜΑ 43 Κα ακαθένεηε 5 εονςπασθέξ πώνεξ θαη κα βνείηε ημ είδμξ ημο μνοθημύ ημοξ πιμύημο. Πμημη πανάγμκηεξ επηηνέπμοκ ηεκ θαηαζθεοή μεγάιςκ ηεπκηθώκ ένγςκ; Ε ελόνολε (ελαγςγή

Διαβάστε περισσότερα

ΞΟΝΠΔΓΓΗΕΥ ΡΝ ΞΑΗΓΗ ΓΗΑ ΡΝ ΞΔΛΘΝΠ. ΝΗ ΓΗΔΟΓΑΠΗΔΠ ΡΝ ΞΔΛΘΝΠ.

ΞΟΝΠΔΓΓΗΕΥ ΡΝ ΞΑΗΓΗ ΓΗΑ ΡΝ ΞΔΛΘΝΠ. ΝΗ ΓΗΔΟΓΑΠΗΔΠ ΡΝ ΞΔΛΘΝΠ. ΞΟΝΠΔΓΓΗΕΥ ΡΝ ΞΑΗΓΗ ΓΗΑ ΡΝ ΞΔΛΘΝΠ. ΝΗ ΓΗΔΟΓΑΠΗΔΠ ΡΝ ΞΔΛΘΝΠ. ΓΑΘΡΙΑ Π. 1,2, ΓΑΘΡΙΑΠ Θ. 1, ΚΖΡΠΗΝ- ΓΑΘΡΙΑ Γ. 1,3,4, ΘΑΡΠΗΑΟΓΑΛΖΠ Ι. 1,5, Α ΛΑΠΡΑΠΗΝ Α. 1,4,6, ΛΗΘΝΙΑΝΠ ΠΘΔΛΡΔΟΖΠ 6. 1. Δ Ρ Α Η Ο Δ Η Α Φ Ο

Διαβάστε περισσότερα

10). ΣΤΠΟΠΟΙΗΜΕΝΕ ΠΑΡΟΥΕ ΜΣ ΚΑΙ ΥΣ

10). ΣΤΠΟΠΟΙΗΜΕΝΕ ΠΑΡΟΥΕ ΜΣ ΚΑΙ ΥΣ 10). ΣΤΠΟΠΟΙΗΜΕΝΕ ΠΑΡΟΥΕ ΜΣ ΚΑΙ ΥΣ Σσποποιημένες παροτές ΥΣ Γηα ηελ ειεθηξνδόηεζε θάζε εζωηεξηθήο εγθαηάζηαζεο θαηαζθεπάδεηαη κία από ηηο «ηππνπνηεκέλεο» παξνρέο πνπ αλαθέξνληαη παξαθάηω. Γηα θάζε ηππνπνηεκέλε

Διαβάστε περισσότερα

ΙΣΤΟΡΙΑ ΤΟΥ ΑΡΧΑΙΟΥ ΚΟΣΜΟΥ

ΙΣΤΟΡΙΑ ΤΟΥ ΑΡΧΑΙΟΥ ΚΟΣΜΟΥ ΙΣΤΟΡΙΑ ΤΟΥ ΑΡΧΑΙΟΥ ΚΟΣΜΟΥ Α ΛΤΚΕΙΟΤ ΓΕΝΙΚΗ ΠΑΙΔΕΙΑ Σχολικό έτος: 2011-2012 Καθηγήτριες: Κεφαλληνού Λουκία- Καλλία Αθηνά ΙΙ. ΟΙ ΑΧΑΙΟΙ ΕΛΛΗΝΕΣ ΑΠΟ ΣΟΤ ΠΡΟΙΣΟΡΙΚΟΤ ΥΡΟΝΟΤ ΕΩ ΚΑΙ ΣΟ Μ. ΑΛΕΞΑΝΔΡΟ 1. ΕΛΛΗΝΙΚΗ

Διαβάστε περισσότερα

ΜΑΓΘΑ ΖΤΘΟΠΟΘΘΑ. Ζ καγηά παίδεη ζεκαληηθό ξόιν ζηε δηαδηθαζία ηεο πέςεο ζηα θαηνηθίδηα θαη ζηα δώα αλαπαξαγσγήο.

ΜΑΓΘΑ ΖΤΘΟΠΟΘΘΑ. Ζ καγηά παίδεη ζεκαληηθό ξόιν ζηε δηαδηθαζία ηεο πέςεο ζηα θαηνηθίδηα θαη ζηα δώα αλαπαξαγσγήο. ΜΑΓΘΑ ΖΤΘΟΠΟΘΘΑ Ζ καγηά δπζνπνηίαο παξάγεηαη από ηελ θαιιηέξγεηα ηνπ Saccharomyces Cerevisiae θαη έρεη πςειή ζξεπηηθή αμία γηα ηελ δηαηξνθή ησλ δώσλ. Φαξαθηεξίδεηαη από: Υςειή πεξηεθηηθόηεηα ζε πξσηεΐλεο

Διαβάστε περισσότερα

ΑΝΣΙΓΡΑΦΗ-ΔΚΦΡΑΗ-ΡΤΘΜΙΗ ΣΗ ΓΔΝΔΣΙΚΗ ΠΛΗΡΟΦΟΡΙΑ

ΑΝΣΙΓΡΑΦΗ-ΔΚΦΡΑΗ-ΡΤΘΜΙΗ ΣΗ ΓΔΝΔΣΙΚΗ ΠΛΗΡΟΦΟΡΙΑ ΣΗ ΓΔΝΔΣΙΚΗ ΠΛΗΡΟΦΟΡΙΑ 1. ΑΝΣΙΓΡΑΦΗ ΣΟΤ DNA A. Ηκηζπληεξεηηθόο κεραληζκόο αληηγξαθήο = ηα 2 ζπγαηξηθά κόξηα DNA είλαη παλνκνηόηππα κε ην κεηξηθό θαη θαζέλα απνηειείηαη από 1 παιηά & 1 λέα αιπζίδα B. Πξνθαξπωηηθνί

Διαβάστε περισσότερα

Τάπηα με ππάζo, bacon και θέηα by Madame Ginger

Τάπηα με ππάζo, bacon και θέηα by Madame Ginger Τάπηα με ππάζo, bacon και θέηα by Madame Ginger 1 θύιιν ζθνιηάηαο 2 πξάζα 150 γξ. bacon 150 γξ. θέηα ΓΧΓΧΝΗ 100 γξ. γξαβηέξα ΓΧΓΧΝΗ 1 θ.ζ. ειαηόιαδν Κόβνπκε ηα πξάζα ζε ιεπηέο ξνδέιεο. Κόβνπκε ην bacon

Διαβάστε περισσότερα

ACTA A.E. Αριςτο Σέλεια Πιςτοποίηςη. Ανθρώπινου Δυναμικοφ. «ΠΙΣΟΠΟΙΗΗ ΑΝΘΡΩΠΙΝΟΤ ΔΤΝΑΜΙΚΟΤ Εξελίξεισ - Προοπτικέσ»

ACTA A.E. Αριςτο Σέλεια Πιςτοποίηςη. Ανθρώπινου Δυναμικοφ. «ΠΙΣΟΠΟΙΗΗ ΑΝΘΡΩΠΙΝΟΤ ΔΤΝΑΜΙΚΟΤ Εξελίξεισ - Προοπτικέσ» ACTA A.E. Αριςτο Σέλεια Πιςτοποίηςη Ανθρώπινου Δυναμικοφ «ΠΙΣΟΠΟΙΗΗ ΑΝΘΡΩΠΙΝΟΤ ΔΤΝΑΜΙΚΟΤ Εξελίξεισ - Προοπτικέσ» Εταιρεία Ένταςησ Γνώςησ Αριςτοτελείου Πανεπιςτημίου Θεςςαλονίκησ Δια Βίου Μάθηςη Νόκνο:

Διαβάστε περισσότερα

ΑΠΑΝΣΗΔΙ ΚΡΙΣΗΡΙΟΤ ΑΞΙΟΛΟΓΗΗ ΓΙΑ ΣΟ 1 Ο ΚΔΦΑΛΑΙΟ ΘΔΣΙΚΗ ΚΑΣΔΤΘΤΝΗ ΗΜΔΡΟΜΗΝΙΑ ΔΞΔΣΑΗ: 27/09/2014 ΦΡΟΝΣΙΣΗΡΙΟ: ΚΟΡΤΦΑΙΟ

ΑΠΑΝΣΗΔΙ ΚΡΙΣΗΡΙΟΤ ΑΞΙΟΛΟΓΗΗ ΓΙΑ ΣΟ 1 Ο ΚΔΦΑΛΑΙΟ ΘΔΣΙΚΗ ΚΑΣΔΤΘΤΝΗ ΗΜΔΡΟΜΗΝΙΑ ΔΞΔΣΑΗ: 27/09/2014 ΦΡΟΝΣΙΣΗΡΙΟ: ΚΟΡΤΦΑΙΟ ΑΠΑΝΣΗΔΙ ΚΡΙΣΗΡΙΟΤ ΑΞΙΟΛΟΓΗΗ ΓΙΑ ΣΟ 1 Ο ΚΔΦΑΛΑΙΟ ΘΔΣΙΚΗ ΚΑΣΔΤΘΤΝΗ ΗΜΔΡΟΜΗΝΙΑ ΔΞΔΣΑΗ: 27/09/2014 ΦΡΟΝΣΙΣΗΡΙΟ: ΚΟΡΤΦΑΙΟ ΘΔΜΑ 1 Ο 1. γ 2. δ 3. α 4. δ 5. δ ΘΔΜΑ 2 Ο Α) Τν γελεηηθό πιηθό ησλ πξνθαξπσηηθώλ θπηηάξσλ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΣΙΚΗ ΚΑΣΕΤΘΤΝΗ Γ ΛΤΚΕΙΟΤ

ΒΙΟΛΟΓΙΑ ΘΕΣΙΚΗ ΚΑΣΕΤΘΤΝΗ Γ ΛΤΚΕΙΟΤ ΒΙΟΛΟΓΙΑ ΘΕΣΙΚΗ ΚΑΣΕΤΘΤΝΗ Γ ΛΤΚΕΙΟΤ 5Ο ΚΕΦΑΛΑΙΟ ΚΛΗΡΟΝΟΝΙΚΟΤΗΤΑ ΚΑΙ ΓΕΝΕΤΙΚΗ 5ο ΓΕΝΙΚΟ ΛΤΚΕΙΟ ΙΛΙΟΤ 5. ΚΛΗΡΟΝΟΜΙΚΟΣΗΣΑ ΚΑΙ ΓΕΝΕΣΙΚΗ 5.1. Η έννοια ηης κληρονομικόηηηας και ηης γενεηικής Βαζικές έννοιες

Διαβάστε περισσότερα

ΤΠΟΓΟΥΔΑ Σ-ΛΔΜΦΟΚΤΣΣΑΡΟΤ

ΤΠΟΓΟΥΔΑ Σ-ΛΔΜΦΟΚΤΣΣΑΡΟΤ ΤΠΟΓΟΥΔΑ Σ-ΛΔΜΦΟΚΤΣΣΑΡΟΤ 6 Τα Τ-ιεκθνθύηηαξα παίδνπλ ζεκαληηθό ξόιν ζηελ αλνζηαθή απάληεζε έλαληη ηωλ πξωηεϊληθώλ αληηγόλωλ. Από ηε ζηηγκή πνπ όινη νη παζνγόλνη κηθξννξγαληζκνί πεξηέρνπλ πξωηεΐλεο, ηα

Διαβάστε περισσότερα

Η Ύςσζε ηνπ Τηκίνπ Σηαπξνύ. 14 Σεπηεκβξίνπ

Η Ύςσζε ηνπ Τηκίνπ Σηαπξνύ. 14 Σεπηεκβξίνπ Η Ύςσζε ηνπ Τηκίνπ Σηαπξνύ 14 Σεπηεκβξίνπ Ση γηνξηάδνπκε ηελ εκέξα ηεο ύςσζεο ηνπ Σηκίνπ ηαπξνύ (1/6) Τν έηνο 326 ε Αγία Ειέλε πήγε ζηελ Ιεξνπζαιήκ γηα λα πξνζθπλήζεη ηνπο Αγίνπο Τόπνπο θαη λα επραξηζηήζεη

Διαβάστε περισσότερα

IV Ο ΕΛΛΗΝΙΜΟ ΣΗ ΔΤΗ,ΠΟΛΙΣΙΜΟΙ Δ.ΜΕΟΓΕΙΟΤ ΚΑΙ ΡΩΜΗ

IV Ο ΕΛΛΗΝΙΜΟ ΣΗ ΔΤΗ,ΠΟΛΙΣΙΜΟΙ Δ.ΜΕΟΓΕΙΟΤ ΚΑΙ ΡΩΜΗ IV Ο ΕΛΛΗΝΙΜΟ ΣΗ ΔΤΗ,ΠΟΛΙΣΙΜΟΙ Δ.ΜΕΟΓΕΙΟΤ ΚΑΙ ΡΩΜΗ Να σαπακηηπίζεηε ηιρ πποηάζειρ, πος ακολοςθούν, υρ ππορ ηην οπθόηηηά ηοςρ, με ηην ένδειξη Σωστό ή Λάθος 1. ηελ αξραία Ρώκε νη πιεβείνη δελ είραλ αξρηθά

Διαβάστε περισσότερα

Πως να δημιουργήσετε ένα Cross-Over καλώδιο

Πως να δημιουργήσετε ένα Cross-Over καλώδιο Πως να δημιουργήσετε ένα Cross-Over καλώδιο Τν crossover καλώδιο ρξεζηκνπνηείηαη γηα λα ζπλδεζνύλ δπν ππνινγηζηέο κεηαμύ ηνπο θαη αλ θηηάμνπλ έλα κηθξό ηνπηθό δίθηπν(lan). Έλα LAN κπνξεί λα είλαη ηόζν

Διαβάστε περισσότερα

Η απνξξόθεζε ηνπ νξαηνύ θσηόο γίλεηαη κέζσ ρξσζηηθώλ νπζηώλ πνπ νλνκάδνληαη τλωροθύλλες.

Η απνξξόθεζε ηνπ νξαηνύ θσηόο γίλεηαη κέζσ ρξσζηηθώλ νπζηώλ πνπ νλνκάδνληαη τλωροθύλλες. ΦΩΣΟΤΝΘΔΗ Δλαιιαθηηθή δηεξγαζία παξαγσγήο ελέξγεηαο Υξεζηκνπνηείηαη από ηνπο νλνκαδόκελνπο θσηνζπλζεηηθνύο νξγαληζκνύο Οπζηαζηηθά ε αληίζηξνθε δηεξγαζία ηεο αλαπλνήο πλίζηαηαη ζηελ δέζκεπζε ειηαθήο ελέξγεηαο

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 30 ΜΑΪΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ

Διαβάστε περισσότερα

Hellas online Προεπιλεγμένες ρσθμίσεις για FritzBox Fon WLAN 7140 (Annex B) 30.04.67 FritzBox Fon WLAN 7140 - Annex B (30.04.67)

Hellas online Προεπιλεγμένες ρσθμίσεις για FritzBox Fon WLAN 7140 (Annex B) 30.04.67 FritzBox Fon WLAN 7140 - Annex B (30.04.67) Hellas online Προεπιλεγμένες ρσθμίσεις για FritzBox Fon WLAN 7140 (Annex B) 30.04.67 FritzBox Fon WLAN 7140 - Annex B (30.04.67) Γηα λα επαλαθέξεηε ην FritzBox Fon WLAN 7140 ζηηο πξνεπηιεγκέλεο ηνπ ξπζκίζεηο

Διαβάστε περισσότερα

ΠΛΗ36. Άσκηση 1. Άσκηση 2. Οη δηεπζύλζεηο ησλ 4 σλ ππνδηθηύσλ είλαη νη αθόινπζεο. Υπνδίθηπν Α: 10.101.1.64/27 Υπνδίθηπν Β: 10.101.1.

ΠΛΗ36. Άσκηση 1. Άσκηση 2. Οη δηεπζύλζεηο ησλ 4 σλ ππνδηθηύσλ είλαη νη αθόινπζεο. Υπνδίθηπν Α: 10.101.1.64/27 Υπνδίθηπν Β: 10.101.1. Άσκηση 1 ΠΛΗ36 1. Η κόλε πεξίπησζε λα έρνπκε ζύγθξνπζε κεηαμύ παθέησλ ησλ δύν θόκβσλ είλαη λα ζηείιεη ν δεύηεξνο πξηλ πξνιάβεη λα πιεξνθνξεζεί γηα ηελ θαηάιεςε ηνπ δηάπινπ από ηνλ άιιν. Από ηε ζηηγκή πνπ

Διαβάστε περισσότερα

ΣΟ ΤΣΖΜΑ ΔΛΑΣΖΡΗΟ - ΩΜΑ

ΣΟ ΤΣΖΜΑ ΔΛΑΣΖΡΗΟ - ΩΜΑ ΣΟ ΤΣΖΜΑ ΔΛΑΣΖΡΗΟ - ΩΜΑ Σε όια ηα πξνβιήκαηα πνπ ζα αληηκεηωπίζνπκε, ην ειαηήξην ζα είλαη αβαξέο θαη ζα ηθαλνπνηεί ην λόκν ηνπ Hooke (ηδαληθό ειαηήξην), δειαδή ε δύλακε πνπ αζθεί έλα ηδαληθό ειαηήξην έρεη

Διαβάστε περισσότερα

γηα ηνλ Άξε Κσλζηαληηλίδε

γηα ηνλ Άξε Κσλζηαληηλίδε γηα ηνλ Άξε Κσλζηαληηλίδε γηα «ην θνηλό θαη ην θύξην» (Γ.νισκόο) γηα λα ρηίδω πάληα κε ηνλ ίδηνλε ηξόπν, κε ηηο ίδηεο θαηαζθεπαζηηθέο θαη πιαζηηθέο πξννπηηθέο, κε ηελ ίδηαλε πάληνηε πίζηε θαη αγάπε.. Α.Κ.

Διαβάστε περισσότερα

ΥΔΣΙΚΟΣΗΣΑ Μεηαζρεκαηηζκνί Γαιηιαίνπ. (Κιαζηθή ζεώξεζε) v t. αθνύ ζύκθσλα κε ηα πεηξάκαηα Mickelson-Morley είλαη c =c.

ΥΔΣΙΚΟΣΗΣΑ Μεηαζρεκαηηζκνί Γαιηιαίνπ. (Κιαζηθή ζεώξεζε) v t. αθνύ ζύκθσλα κε ηα πεηξάκαηα Mickelson-Morley είλαη c =c. ΥΔΣΙΚΟΣΗΣΑ Μεηαζρεκαηηζκνί Γαιηιαίνπ. (Κιαζηθή ζεώξεζε) y y z z t t Σν νπνίν νδεγεί ζην όηη = - π.(άηνπν), αθνύ ζύκθσλα κε ηα πεηξάκαηα Mikelson-Morley είλαη =. Δπίζεο y = y, z = z, t = t Σν νπνίν ( t

Διαβάστε περισσότερα

ΓΗΑΓΩΛΗΠΚΑ ΠΡΝ ΚΑΘΖΚΑ ΔΞΗΙΝΓΖΠ ΑΟΣΔΠ ΝΗΘΝΛΝΚΗΘΖΠ ΘΔΩΟΗΑΠ

ΓΗΑΓΩΛΗΠΚΑ ΠΡΝ ΚΑΘΖΚΑ ΔΞΗΙΝΓΖΠ ΑΟΣΔΠ ΝΗΘΝΛΝΚΗΘΖΠ ΘΔΩΟΗΑΠ ΓΗΑΓΩΛΗΠΚΑ ΠΡΝ ΚΑΘΖΚΑ ΔΞΗΙΝΓΖΠ ΑΟΣΔΠ ΝΗΘΝΛΝΚΗΘΖΠ ΘΔΩΟΗΑΠ ΝΚΑΓΑ Α ΔΡΩΣΖΔΗ ΩΣΟΤ- ΙΑΘΟΤ 1. Γηα έλα αγαζό όηαλ ε ζηαζεξά γ είλαη ίζε κε ην κεδέλ ηόηε ε θακπύιε πξνζθνξάο δηέξρεηαη από ηελ αξρή ηωλ αμόλωλ.

Διαβάστε περισσότερα

ΜΑΘΗΜΑΣΑ ΦΩΣΟΓΡΑΦΙΑ. Εισαγωγή στη Φωτογραυία. Χριζηάκης Σαζεΐδης - EFIAP

ΜΑΘΗΜΑΣΑ ΦΩΣΟΓΡΑΦΙΑ. Εισαγωγή στη Φωτογραυία. Χριζηάκης Σαζεΐδης - EFIAP ΜΑΘΗΜΑΣΑ ΦΩΣΟΓΡΑΦΙΑ Εισαγωγή στη Φωτογραυία Χριζηάκης Σαζεΐδης - EFIAP 1 ΜΑΘΗΜΑ 3 ο ΚΛΕΙΣΡΟ ΣΑΥΤΣΗΣΑ ΚΛΕΙΣΡΟΤ-ΕΠΙΛΟΓΗ ΚΑΣΑΛΛΗΛΗ ΣΑΥΤΣΗΣΑ Σι είναι υωτογραυική μητανή; Από πνηα κέξε απνηειείηαη: 1. Φαθό

Διαβάστε περισσότερα

Γραφεύα Επικοινωνύασ & Ενημϋρωςησ ϋρρεσ, Τψηλϊντου 4 3οσ Όροφοσ ΣΗΛ 2321023640 ΥΑΦ 2321051861

Γραφεύα Επικοινωνύασ & Ενημϋρωςησ ϋρρεσ, Τψηλϊντου 4 3οσ Όροφοσ ΣΗΛ 2321023640 ΥΑΦ 2321051861 Οπγάνωζη και διοίκηζη ηοςπιζηικών επισειπήζεων (ξενοδοσεία, ηοςπιζηικά γπαθεία ) Α) ΑΔΙ ΣΔΙ και Β) ΑΠΟΦΟΙΣΟΙ ΤΠΟΥΡΔΩΣΙΚΗ ΓΔΤΣΔΡΟΒΑΘΜΙΑ και ΜΔΣΑΓΔΤΣΔΡΟΒΑΘΜΙΑ ΔΚΠΑΙΓΔΤΗ Ρν πξόγξακκα απηό ζρεδηάζηεθε γηα

Διαβάστε περισσότερα

ΑΝΘΟ ΑΓΓΕΙΟΠΕΡΜΩΝ. Μάξζα Λαδαξίδνπ Αζαλαζηάδνπ Καζεγήηξηα. Εξγαζηήξην Μνξθνινγίαο θαη Φπζηνινγίαο Φπηώλ

ΑΝΘΟ ΑΓΓΕΙΟΠΕΡΜΩΝ. Μάξζα Λαδαξίδνπ Αζαλαζηάδνπ Καζεγήηξηα. Εξγαζηήξην Μνξθνινγίαο θαη Φπζηνινγίαο Φπηώλ ΑΝΘΟ ΑΓΓΕΙΟΠΕΡΜΩΝ Μάξζα Λαδαξίδνπ Αζαλαζηάδνπ Καζεγήηξηα Εξγαζηήξην Μνξθνινγίαο θαη Φπζηνινγίαο Φπηώλ Σκήκα Δαζνπνλίαο ΔΦΠ, παξ/κα Δξάκαο, ΣΕΙ Καβάιαο, ΑΝΘΟ ΣΩΝ ΑΓΓΔΙΟΠΔΡΜΩΝ Η εγγελήο αλαπαξαγσγή ησλ αγγεηνζπέξκσλ

Διαβάστε περισσότερα

ΑΞΙΟΘΕΑΣΑ ΣΟΤ ΥΩΡΙΟΤ ΜΑ

ΑΞΙΟΘΕΑΣΑ ΣΟΤ ΥΩΡΙΟΤ ΜΑ ΑΞΙΟΘΕΑΣΑ ΣΟΤ ΥΩΡΙΟΤ ΜΑ α. Η ΕΚΚΛΗΙΑ ΣΟΤ ΥΩΡΙΟΤ ΜΑ β. ΣΟ ΠΝΕΤΜΑΣΙΚΟ ΜΑ ΚΕΝΣΡΟ γ. Η ΠΑΝΟΡΑΜΙΚΗ ΘΕΗ ΣΟΤ ΥΩΡΙΟΤ ΜΑ α. Η ΕΚΚΛΗΙΑ ΣΟΤ ΥΩΡΙΟΤ ΜΑ. Η Εθθιεζία ηνπ ρσξηνύ καο, ε Αγία Άλλα, είλαη θηηζκέλε πξηλ πνιιά

Διαβάστε περισσότερα

Γηαηάμεηο Αλίρλεπζεο Γηαξξνώλ (λεξνύ θαπζίκωλ ρεκηθώλ )

Γηαηάμεηο Αλίρλεπζεο Γηαξξνώλ (λεξνύ θαπζίκωλ ρεκηθώλ ) Γηαηάμεηο Αλίρλεπζεο Γηαξξνώλ (λεξνύ θαπζίκωλ ρεκηθώλ ) Τν πξόβιεκα - Γηαξξνή λεξνύ Αθόκε θαη κηα κηθξή δηαξξνή λεξνύ κπνξεί λα πξνθαιέζεη θαηαζηξνθή αλ δελ αληρλεπζεί εγθαίξσο Δηαξξνή κπνξεί λα πξνέιζεη

Διαβάστε περισσότερα

ΗΛΕΚΤΡΟΝΙΚΗ ΜΝΗΜΗ ΚΑΙ ΜΙΚΡΟΕΛΕΓΚΤΕΣ

ΗΛΕΚΤΡΟΝΙΚΗ ΜΝΗΜΗ ΚΑΙ ΜΙΚΡΟΕΛΕΓΚΤΕΣ ΗΛΕΚΤΡΟΝΙΚΗ ΜΝΗΜΗ ΚΑΙ ΜΙΚΡΟΕΛΕΓΚΤΕΣ Η ζεκεξηλή ξαγδαία εμέιημε ηεο ηερλνινγίαο ηεο κηθξνειεθηξνληθήο επέηξεςε ηελ θαηαζθεπή εηδηθώλ νινθιεξσκέλσλ θπθισκάησλ απνζήθεπζεο δεδνκέλσλ θαη πιεξνθνξηώλ θαηαιακβάλνπλ

Διαβάστε περισσότερα

ΕΡΓΑΣΗΡΙΑΚΕ ΑΚΗΕΙ ΠΟΟΣΙΚΗ ΥΗΜΙΚΗ ΑΝΑΛΤΗ

ΕΡΓΑΣΗΡΙΑΚΕ ΑΚΗΕΙ ΠΟΟΣΙΚΗ ΥΗΜΙΚΗ ΑΝΑΛΤΗ ΕΡΓΑΣΗΡΙΑΚΕ ΑΚΗΕΙ ΠΟΟΣΙΚΗ ΥΗΜΙΚΗ ΑΝΑΛΤΗ 1. Τηηινκεηξηθή κέζνδνο αλάιπζεο, Βαζηθέο Αξρέο Τηηινκεηξίαο, Μεζνδνινγία, Αλαιπηηθά Σθεύε θαη Όξγαλα. 2. Αιθαιηκεηξία (Πξνζδηνξηζκόο νιηθήο νμύηεηαο μηδηνύ) 3.

Διαβάστε περισσότερα

Master Class 3. Ο Ν.Ζανταρίδης προτείνει θέματα Μαθηματικών Γ Λσκειοσ ΘΕΜΑ 1.

Master Class 3. Ο Ν.Ζανταρίδης προτείνει θέματα Μαθηματικών Γ Λσκειοσ ΘΕΜΑ 1. ΘΕΜΑ. Γηα ηελ ζπλάξηεζε f : IR IR ηζρύεη + f() f(- ) = γηα θάζε IR. Να δείμεηε όηη f() =, ΙR. Να βξείηε ηελ εθαπηόκελε (ε) ηεο C f πνπ δηέξρεηαη από ην ζεκείν (-,-) 3. Να βξείηε ην εκβαδόλ Δ(α) ηνπ ρωξίνπ

Διαβάστε περισσότερα

ΕΛΛΗΝΙΚΟ ΑΝΟΙΚΤΟ ΠΑΝΕΠΙΣΤΗΜΙΟ

ΕΛΛΗΝΙΚΟ ΑΝΟΙΚΤΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΕΛΛΗΝΙΚΟ ΑΝΟΙΚΤΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΜΑΤΙΚΗ ΕΝΟΤΗΤΑ: Βασικά Εργαλεία και Μέθοδοι για τον Έλεγχο της Ποιότητας [ΔΙΠ 50] ΕΡΓΑΣΙΑ 1 Προσοχή: Οι απαντήσεις των ασκήσεων πρέπει να φθάσουν στον

Διαβάστε περισσότερα

Μορθές Κακόβοσλοσ Κώδικα (Malicious Code)

Μορθές Κακόβοσλοσ Κώδικα (Malicious Code) Μορθές Κακόβοσλοσ Κώδικα (Malicious Code) Page 1 Υποπλοίαρτος Ν. Πεηράκος ΠΝ Αηδένηα Γνύξεηνη Ίππνη (Trojan Horses) Ινί (Viruses) Worms Root-kit Page 2 Γνύξεηνο Ίππνο (Trojan Horse) Οξηζκόο: Πξόγξακκα

Διαβάστε περισσότερα

Εισαγωγή στοςρ κβαντικούρ ςπολογιστέρ και αλγόπιθμοςρ. Γηδάζθωλ : Φνπληνπιάθεο Αληώληνο

Εισαγωγή στοςρ κβαντικούρ ςπολογιστέρ και αλγόπιθμοςρ. Γηδάζθωλ : Φνπληνπιάθεο Αληώληνο Εισαγωγή στοςρ κβαντικούρ ςπολογιστέρ και αλγόπιθμοςρ. Γηδάζθωλ : Φνπληνπιάθεο Αληώληνο Θεματικές Ενότητες 1. Απιέο έλλνηεο θβαληηθήο κεραληθήο θαη ην ζύζηεκα δύν θβαληηθώλ θαηαζηάζεωλ. 2. Qubit θαη θβαληηθόο

Διαβάστε περισσότερα

1. Οδηγίερ εγκαηάζηαζηρ και σπήζηρ έξςπνυν καπηών και τηθιακών πιζηοποιηηικών με σπήζη ηος λογιζμικού Μοzilla Thunderbird

1. Οδηγίερ εγκαηάζηαζηρ και σπήζηρ έξςπνυν καπηών και τηθιακών πιζηοποιηηικών με σπήζη ηος λογιζμικού Μοzilla Thunderbird 1. Οδηγίερ εγκαηάζηαζηρ και σπήζηρ έξςπνυν καπηών και τηθιακών πιζηοποιηηικών με σπήζη ηος λογιζμικού Μοzilla Thunderbird 1.1 Εγκαηάζηαζη ηυν οδηγών ηηρ έξςπνηρ κάπηαρ ζηο λογιζμικό Mozilla Thunderbird

Διαβάστε περισσότερα

ύζηεκα Ωξνκέηξεζεο Πξνζσπηθνύ (Έθδνζε 2) ΤΠΗΡΕΙΑ ΠΛΗΡΟΦΟΡΙΚΩΝ ΤΣΗΜΑΣΩΝ

ύζηεκα Ωξνκέηξεζεο Πξνζσπηθνύ (Έθδνζε 2) ΤΠΗΡΕΙΑ ΠΛΗΡΟΦΟΡΙΚΩΝ ΤΣΗΜΑΣΩΝ ύζηεκα Ωξνκέηξεζεο Πξνζσπηθνύ (Έθδνζε 2) ΤΠΗΡΕΙΑ ΠΛΗΡΟΦΟΡΙΚΩΝ ΤΣΗΜΑΣΩΝ Πεξηερόκελα Σερληθά Υαξαθηεξηζηηθά Καηαγξαθή Ώξαο πγρξνληζκόο πζηήκαηνο Παξνπζίαζε πζηήκαηνο Πηζαλά ελάξηα Υξήζεο 2 Σερληθά Υαξαθηεξηζηηθά

Διαβάστε περισσότερα

1 Είζοδορ ζηο Σύζηημα ΣΔΕΔ ή BPMS

1 Είζοδορ ζηο Σύζηημα ΣΔΕΔ ή BPMS ΟΤΑ Επισειπηζιακή Νοημοζύνη: Οδεγίεο πξνο ηνπο εθπαηδεπόκελνπο γηα ηε ζύλδεζε κε ην ύζηεκα Γηαρείξηζεο Δπηρεηξεζηαθώλ Γηαδηθαζηώλ γηα ηελ εθηέιεζε ηωλ Πξαθηηθώλ Αζθήζεωλ ηωλ ππν(δλνηήηωλ) Bc1.1.4, Bc1.1.5,

Διαβάστε περισσότερα

Πληροθορίες για ηο μικροζκόπιο

Πληροθορίες για ηο μικροζκόπιο Πληροθορίες για ηο μικροζκόπιο Η επηινγή ηεο θαηάιιειεο κεγέζπλζεο ζην κηθξνζθόπην εμαξηάηαη από ην πξνο παξαηήξεζε αληηθείκελν. Η δπλαηόηεηα δηάθξηζεο ηωλ δηαθόξωλ ηκεκάηωλ ηνπ θπηηάξνπ νθείιεηαη ζην

Διαβάστε περισσότερα

Γίθησα ποσ παρέτοληαη από τρήζηες: Κίλεηρα, ηετλοιογίες θαη αλοητηά δεηήκαηα Λεσηέρες Μακάηας (lmamatas@ee.ucl.ac.uk)

Γίθησα ποσ παρέτοληαη από τρήζηες: Κίλεηρα, ηετλοιογίες θαη αλοητηά δεηήκαηα Λεσηέρες Μακάηας (lmamatas@ee.ucl.ac.uk) Σεκηλάξην Τνκέα Λνγηζκηθνύ Γίθησα ποσ παρέτοληαη από τρήζηες: Κίλεηρα, ηετλοιογίες θαη αλοητηά δεηήκαηα Λεσηέρες Μακάηας (lmamatas@ee.ucl.ac.uk) Περίιευε παροσζίαζες Τη είλαη ηα «Γίθηπα πνπ παξέρνληαη

Διαβάστε περισσότερα

Ανίτνεσζη Kσκλοθορούνηων Kαρκινικών Kσηηάρων (KKK) με ηην ηετνική ηης

Ανίτνεσζη Kσκλοθορούνηων Kαρκινικών Kσηηάρων (KKK) με ηην ηετνική ηης Ανίτνεσζη Kσκλοθορούνηων Kαρκινικών Kσηηάρων (KKK) με ηην ηετνική ηης multiplex PCR ΜΘΥΑΛΗ ΚΟΤΣΘΛΘΕΡΗ, MD, Ph.D Καθηγηηής Πειραμαηικης Φσζιολογίας, Θαηρική τολή, Παν/μίοσ Αθηνών Η αλίρλεπζε ηεο ύπαξμεο

Διαβάστε περισσότερα

Α Π Α Γ Ο Ρ Δ Τ Δ Σ Α Ι Η Υ Ρ Η Η Η Λ Δ Κ Σ Ρ Ι Κ Ο Τ Κ Α Σ Α Β Ι Γ Ι Ο Τ

Α Π Α Γ Ο Ρ Δ Τ Δ Σ Α Ι Η Υ Ρ Η Η Η Λ Δ Κ Σ Ρ Ι Κ Ο Τ Κ Α Σ Α Β Ι Γ Ι Ο Τ ΟΓΗΓΙΔ ΔΓΚΑΣΑΣΑΗ ΔΝΘΔΣΟΤ Α Π Α Γ Ο Ρ Δ Τ Δ Σ Α Ι Η Υ Ρ Η Η Η Λ Δ Κ Σ Ρ Ι Κ Ο Τ Κ Α Σ Α Β Ι Γ Ι Ο Τ Τνπνζεηήζηε ηα θιηπ ηνπ λεξνρύηε ζηηο εγθνπέο πνπ βξίζθνληαη θάηω από ην λεξνρύηε (Σρ. 1). ημείωζη: αλάινγα

Διαβάστε περισσότερα