psl1 , 90%~95%. (Oryza sativa L) *,

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "psl1 , 90%~95%. (Oryza sativa L) *,"

Transcript

1 psl1 * * (,, *, ricegb@yzu.edu.cn).. 11 Co F 1 F 2,., psl1, SSR psl1 2., 34 STS, psl1., psl1 BAC, 48 kb,. (Oryza sativa L), 90%~95%.,.,, [1,2].,., [3]., 1 d, 2%, 1% [1,4].,.,,.,.,., RNA,. [1~6]., : ( ), ; ( ). [2,5~17],, [6].,. T-DNA cdna, [17~30].,,,., 10, 3 [31,32] 1), Li [33] pse(t), kb.. 1 ( ). 11 Co 60,,. 6 1)

2 , ; 11. ( ) , F 1, F F 2, ;, F 2,.,, F 2. F 2,, F 3. ( ). Michelmore [34]. F 2 2, 10 DNA, 2. 2 ;,. ( ) DNA SSR. F 2, 6~8 cm. F (psl1). DNA CTAB [35]., SSR µl Mg 2+ (25 mmol/l) 2.5 µl, 10 PCR ( Mg 2+ ) 2.5 µl, dntp (2.5 mmol/l) 2.5 µl, (15 ng/µl) 2.0 µl, DNA ( 15 ng/µl) 2µL, Taq (5 U/µL) 0.2 µl, 13.3 µl. Biometra PCR. : 94 5 min; 94, 1 min; 55, 1 min; 72, 1.5 min; 32 ; min. 4%, (EB) UVP. ( ) STS. BLAST, (Nipponbare) 9311 ; Primer bp 200~500 bp PCR, ;,,. ( ). 1 2, ( ) 2, MAPMAKER (EXP3.0b) [36], , ( 1),,. 25~30 d,, ,,,. 6 11, F 1, 6 11,. F 2,

3 ,. F ( 1), 1.,, psl1 (presescing leaf). 2.3 psl1, SSR, 2 SSR, 2, F 2 SSR , 6 2 (RM6, RM5303, RM5474, RM425, RM406 RM166),. RM6, RM5303, RM5472, RM425, RM406 RM166,, psl1, RM6-RM5303-RM5472-sl1- RM425-RM406-RM166. psl1 RM5472 RM425, RM5472 RM cm ( 2). RM5472 RM psl psl1,. psl1 RM5474 RM425, RM5472 RM cm. BAC 34 STS,, 9 ( 2) F 1, F 2 P 1 P 2 F 1 F 2 / χ 2 (3 1) / / RM5472 RM425 F 2 P1, ; P2,

4 psl1 STS STS2-19 STS2-26, cm., STS2-25( 4). STS2-19 STS (5 3 ) BAC STS2-5 F ATTTGGTTTGATTTTATTCC AP R TCTTGGTATGTGCTCACTTT STS2-6 F TGCTGTGGTTGTTCCTGTC AP R TTTAGGTTATGTTTACAAGAGGC STS2-9 F GGGAACTAAACCAAGCCTAA AP R CATCCGCATCGTAGTATTCA STS2-11 F ATCTGATGGGCGAACAACCT AP R TGGTCGTCGTCACTGTTGGA STS2-18 F CAGAGCAGCCTACCTAGCAG AP R TTCAGCCTTGACAAACCATC STS2-19 F CTGCGACATCTTCTGGCTAA AP R GCAGGCAGAAAGCGTACTAAC STS2-25 F TGCGACATCTTCTGGCTAA AP R CAGGCAGAAAGCGTACTAAC STS2-26 F GATGGTGGGACTGGCTAGTGT AP R TGTGGTGGTTATGTTGGGAAG STS2-28 F TCTCCCGATACATTCTCAA AP R ATACGGCATACAACCAAAC 2.5 psl1 2, RM6535 BAC AP005297, STS2-18 STS2-19 BAC AP004114, STS2-26 STS2-28 BAC AP , psl1 ( 6). AP005297, AP AP BAC, BAC, psl1 STS2-19 STS2-26, cm. STS2-19 AP004114, STS2-26 BAC 4 psl1 2 AP005733,., 48 kb, psl1, psl1. 3,,,.., ;, Rubisco [7].. 5 STS2-19 STS2-25 F 2 P1, ; P2,

5 psl1, [13].,, 25 d, 50~60 d; ; ;.. : ( ), ; ( ),., H3 [37], (pheophorbide a oxygenase).. [38]. [39],., hys1 (hypersenescence 1), cpr5 (constitutive expresser or pathogenesis related gene 5). [40]. 3 ore1, ore3 ore9. ore9, F-box [41].., Buchanan-Wallaston [13] ,,. Lin [6],,. cdna-aflp [13]., 11,, (psl1). STS-19 STS2-26, STS cm, STS cm, STS2-25., psl1 BAC, psl1 AP AP kb,. ( : ) ( : 2003CB CB120807) ( : 05KAJ2012). 1,,.., 2005, 21(3): ,..,

6 , 38(4): ,,.., 1997, 23(2): ,.., 1993, 14(4): ,.., 2003, 1(3): Lin J F, Wu S H. Molecular events in senescing Arabidopsis leaves. Plant J, 2004, 39: Stessman D, Miller A, Spalding M, et al. Regulation of photosynthesis during Arabidopsis leaf development in continuous light. Photosynthesis Res, 2002, 72: Hensel L L, Grbic V, Baumgarten D A, et al. Developmental and age-related processes that influence the longevity and senescence of photosynthetic tissues in Arabidopsis. Plant Cell, 1993, 5: Lohman K N, Gan S, John M C, et al. Molecular analysis of natural leaf senescence in Arabidopsis thaliana. Physiol Plant, 1994, 92: Oh S A, Lee S Y, Chung I K, et al. A senescence-associated gene of Arabidopsis thaliana is distinctively regulated during natural and artificially induced leaf senescence. Plant Mol Biol, 1996, 30: Park J H, Oh S A, Kim Y H, et al. Differential expression of senescence-associated mrnas during leaf senescence induced by different senescence inducing factors in Arabidopsis. Plant Mol Biol, 1998, 37: Buchanan-Wollaston V. Isolation of cdna clones for genes that are expressed during leaf senescence in Brassica napus. Plant Physiol, 1994, 105: Buchanan-Wallaston V, Simon E, Elizabeth H, et al. The molecular analysis of leaf senescence: A genomics approach. Plant Biotechnol J, 2003, 1: Hanfrey C, Fife M, Buchanan-Wollaston V. Leaf senescence in Brassica napus: Expression of genes encoding pathogenesis-related proteins. Plant Mol Biol, 1996, 30: Becker W, Apel K. Differences in gene expression between natural and artificially induced leaf senescence. Planta, 1993, 189: Kleber-Janke T, Krupinska K. Isolation of cdna clones for genes showing enhanced expression in barley leaves during dark-induced senescence as well as during senescence under field condition. Planta, 1997, 203: Smart C M, Hosken S E, Thomas H, et al. The timing of maize leaf senescence and characterization of senescence-related cdnas. Physiol Plant, 1995, 93: Feng Q, Zhang Y, Hao P, et al. Sequence and analysis of rice chromosome 4. Nature, 2002, 420: Goff S A, Ricke D, Lan T H, et al. A draft sequence of the rice genome (Oryza sativa L. ssp. japonica). Science, 2002, 296: Kikuchi S, Satoh K, Nagata T, et al. Collection, mapping and annotation of over cdna clones from Japonica rice. Science, 2003, 301: International Rice Genome Sequencing Project. The map-based sequence of the rice genome. Nature, 2005, 436: Jiang G H, He Y Q, Xu C G, et al. The genetic basis of stay-green in rice analyzed in a population of doubled haploid lines derived from an indica by japonica cross. Theor Appl Genet, 2004, 108(4): Lin L, Liu Y G, Xu X, et al. Efficient linking and transfer of multiple genes by a multigene assembly and transformation vector system. Proc Natl Acad Sci USA, 2003, 100: The Rice Chromosome 10 Sequencing Consortium. In-depth view of structure, activity, and evolution of rice chromosome 10. Science, 2003, 300: Sasaki T, Matsumoto T, Yamamoto K, et al. The genome sequence and structure and rice chromosome 1. Nature, 2002, 420: Shimamoto K, Kyozuka J. Rice as a model for comparative genomics of plants. Annu Rev Plant Biol, 2002, 53: Xue Y, Li J, Xu Z. Recent highlights of the China Rice Functional Genomics Program. Trends Genet, 2003, 19: Yu J, Hu S, Wang J, et al. A draft sequence of the rice genome (Oryza sativa L. ssp. indica). Science, 2002, 296: Zhang Y, Huang Y, Zhang L, et al. Structural features of the rice chromosome 4 centromere. Nucleic Acids Res, 2004, 32: Li X, Qian Q, Fu Z, et al. Control of tillering in rice. Nature, 2003, 422: Jung K H, Hur J, Ryu C H, et al. Characterization of a rice chlorophyll-deficient mutant using the T-DNA gene-trap system. Plant Cell Physiol, 2003, 44(5): Lee S, Kim J H, Yoo E S, et al. Differential regulation of chlorophyll a oxygenase genes in rice. Plant Mol Biol, 2005, 57(6): Li F Z, Jin S H, Hu G C. Isolation and physiological characteristics of a premature senescence mutant in rice (Oryza sativa L). J Zhejiang Univ Sci, 2005, 6B(8): Michelmore R W, Paran I, Kesseli R V. Identification of markers linked to disease-resistance genes by bulked segregant analysis: A rapid method to detect markers in specific genomic regions by using segregating populations. Proc Natl Acad Sci USA, 1991, 88(21): ,,,. sd-g., 2004, 49(8): Lander E S, Green P, Abrahamson J, et al. MAPMAKER: An interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genomics, 1987, 1: Thomas H, Schellenberg M, Vicentini F, et al. Gregor Mendel s green and yellow pea seeds. Bot Acta, 1996, 109: Thomas H. Sid a Mendelian locus controlling thylakoid disassembly in senescing leaves of Festuca pretensis. Theor Appl Genet, 1987, 73: Cha K W, Lee Y J, Koh H J, et al. Isolation, characterization, and mapping of the stay green mutant in rice. Theor Appl Genet, 2002, 104(4): Yoshida S, Ito M, Nishida I, et al. Identification of a novel gene HYS1/CRG5 that has a repressive role in the induction of leaf senescence and pathogen-defense responses in Arabidopsis thaliana. Plant J, 2002, 29: Woo H R, Chung K M, Park J H, et al. ORE9, an F-box protein that regulates leaf senescence in Arabidopsis. Plant Cell, 2001, 13(8): ( , )

SCIENTIA SILVAE SINICAE. a/ b. oldhamii). The length of cab2bo1 ( GenBank accession

SCIENTIA SILVAE SINICAE. a/ b. oldhamii). The length of cab2bo1 ( GenBank accession 43 3 2 0 0 7 3 SCIENTIA SILVAE SINICAE Vol143, No13 Mar., 2 0 0 7 a/ b 3 1 1 2 1 (1. 100102 ; 2. 100091) : RT2PCR RACE a/ b cdna, cab2 BO1 ( GenBank : EF061137) 1 102 bp, 64 861 bp 1, 265 cab2bo1 64 232

Διαβάστε περισσότερα

Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene

Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene 2001, 24 (1) : 2529 Journal of Nanjing Agricultural University rolc (, 210095) :, rolc ( Nicotiana tabacum ), GUS, PCR Southern rolc,, rolc : ; ; rolc ; : S572103513 : A : 1000Ο2030 (2001) 01Ο0025Ο05 Study

Διαβάστε περισσότερα

Archive of SID. نشانمند كردن ژنه يا برگرداننده باروري بوسيله تجزيه كلاس مغلوب در برنج چكيده مقدمه

Archive of SID.  نشانمند كردن ژنه يا برگرداننده باروري بوسيله تجزيه كلاس مغلوب در برنج چكيده مقدمه نشانمند كردن ژنه يا برگرداننده باروري بوسيله تجزيه كلاس مغلوب در برنج (-), 4 3 2 1 ياراحمدي محمد مهدي سوهاني * ابوبكر جوهرعلي بابك ربيعي (// : -// : ) سعيد و ع يل 5 اكبر عبادي چكيده WA. IR42686R IR58025A

Διαβάστε περισσότερα

Aus dem Institut für Pflanzenzüchtung und Pflanzenschutz

Aus dem Institut für Pflanzenzüchtung und Pflanzenschutz Aus dem Institut für Pflanzenzüchtung und Pflanzenschutz Advanced Backcross QTL analysis and genetic study of an introgressed powdery-mildew resistance gene derived from Avena macrostachya in oat (Avena

Διαβάστε περισσότερα

Basic & Clinical Medicine PLGA MUC1 MUC1 IC 50 MUC1 +

Basic & Clinical Medicine PLGA MUC1 MUC1 IC 50 MUC1 + 2011 7 31 7 1001-6325 2011 07-0751 -05 July 2011 Vol. 31 No. 7 MUC1 1 1 1 2 1 1* 1. 100005 2. 100190 MUC1 PLGA MUC1 MUC1 MUC1 MCF-7 HepG2 MTS IC 50 MUC1 225. 3 ± 9. 2 nm 83. 6% ± 1. 7% MUC1 + MCF-7 P

Διαβάστε περισσότερα

cm cm 92. 0% DH S 917

cm cm 92. 0% DH S 917 34 9 2010 9 JOURNAL OF FISHERIES OF CHINA Vol. 34 No. 9 Sep. 2010 1000-0615 2010 09-1354 - 09 DOI 10. 3724 /SP. J. 1231. 2010. 06963 1 2 2 2 2 1* 1. 361005 2. 361021 157 DH 24 SRAP 16 SSR 224 157 124 SRAP

Διαβάστε περισσότερα

CorV CVAC. CorV TU317. 1

CorV CVAC. CorV TU317. 1 30 8 JOURNAL OF VIBRATION AND SHOCK Vol. 30 No. 8 2011 1 2 1 2 2 1. 100044 2. 361005 TU317. 1 A Structural damage detection method based on correlation function analysis of vibration measurement data LEI

Διαβάστε περισσότερα

PACS: Pj, Gg

PACS: Pj, Gg * 1)2) 2) 3) 2) 1) 1) (, 310023 ) 2) (, 315211 ) 3) (, 510006 ) ( 2011 6 16 ; 2011 10 31 ),..,,.,.,. :,,, PACS: 07.05.Pj, 05.45.Gg 1,.,, [1,2].,,, [3,4].,, [5,6].,. [7 9]., [10 17].,.,, [10]., [18 20],

Διαβάστε περισσότερα

Progress in Plant Resistance Induced by Salicylic Acid

Progress in Plant Resistance Induced by Salicylic Acid 5 3 ( ) Vol 5 No 3(Suppl ) 2 0 0 1 11 Life Science Research Nov 2001 Ξ ( 361005) :, : ; ; :Q954 :A :1007-7847(2001) S0-0185 - 05 Progress in Plant Resistance Induced by Salicylic Acid ZHANG Chun2guang,J

Διαβάστε περισσότερα

Journal of Ningxia Medical University. Annexin P19 mrna P < AnnexinA2 P19 mrna. AnnexinA2 P19 mrna. PCR 1.

Journal of Ningxia Medical University. Annexin P19 mrna P < AnnexinA2 P19 mrna. AnnexinA2 P19 mrna. PCR 1. 33 6 2011 6 Journal of Ningxia Medical University 511 1674-6309 2011 06-0511 - 04 AnnexinA2 P19 1 2 3 3 3 1. 415700 2. 750004 3. 750004 AnnexinA2 P19 62 IHC RT - PCR Western blot AnnexinA2P19 mrna AnnexinA2

Διαβάστε περισσότερα

TABLE OF CONTENTS Page

TABLE OF CONTENTS Page TABLE OF CONTENTS Page Acknowledgements... VI Declaration... VII List of abbreviations... VIII 1. INTRODUCTION... 1 2. BASIC PRINCIPLES... 3 2.1. Hereditary Colorectal Cancer... 3 2.1.1. Differential diagnosis...

Διαβάστε περισσότερα

[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,

[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13, in vitro αα In Vitro α-glucosidase and α-amylase Inhibitory Effects of Herbal Tea Leaves from Yacon (Smallanthus sonchifolius) 1, 1, 1, 2, 1, 2, 3, 1, 2, 1, 2, 1, 2, 1, 2 1, 2, *, 1 2, 3 Yuto Ueda 1, Shintaro

Διαβάστε περισσότερα

6 T-DNA PCR TAIL-PCR T-DNA. 69% 30% T-DNA left border LB right border RB T-DNA A T-DNA

6 T-DNA PCR TAIL-PCR T-DNA. 69% 30% T-DNA left border LB right border RB T-DNA A T-DNA Research Paper Acta Microbiologica Sinica 51 2 203-207 4 February 2011 ISSN 0001-6209 CN 11-1995 / Q http / / journals. im. ac. cn / actamicrocn Botrytis cinerea T-DNA * 310014 Botrytis cinerea T-DNA Agrobactirium

Διαβάστε περισσότερα

Identification of Fish Species using DNA Method

Identification of Fish Species using DNA Method 5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,

Διαβάστε περισσότερα

30s 56 60s 72 60s dntp cm s s s 23

30s 56 60s 72 60s dntp cm s s s 23 31 3 Vol 31 No 3 2012 8 JOURNAL OF OCEANOGRAPHY IN TAIWAN STRAIT Aug 2012 AFLP 1 1 2 1 1 361005 2 361005 dntp Taq Mg 2 + 300 ng DNA 5U PstI 5U MseI 4 h 16 10 50 AFLP AFLP 64 12 AFLP DOI 10 3969 /J ISSN

Διαβάστε περισσότερα

Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού

Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού Σχολή Θετικών Επιστημών Τμήμα Βιολογίας Πρόγραμμα Μεταπτυχιακών Σπουδών Κατεύθυνση: Εφαρμοσμένη γενετική και βιοτεχνολογία ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου

Διαβάστε περισσότερα

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2 344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.

Διαβάστε περισσότερα

Inferring regulatory subnetworks through the analysis of genome-wide expression profiles

Inferring regulatory subnetworks through the analysis of genome-wide expression profiles NATIONAL AND KAPODISTRIAN UNIVERSITY OF ATHENS SCHOOL OF SCIENCE DEPARTMENT OF INFORMATICS AND TELECOMMUNICATIONS POSTGRADUATE PROGRAM "INFORMATION TECHNOLOGIES IN MEDICINE AND BIOLOGY" MASTER S THESIS

Διαβάστε περισσότερα

Progress in breeding techniques of ornamental plants

Progress in breeding techniques of ornamental plants 2003,32(2):64-68. 650091 S603.6 A 1009-7791(2003)02-0064-05 Progress in breeding techniques of ornamental plants LIU Xiao-li, LIU Fei-hu (College of Life Science, Yunnan University, Kunming 650091, Yunnan

Διαβάστε περισσότερα

Apr Vol.26 No.2. Pure and Applied Mathematics O157.5 A (2010) (d(u)d(v)) α, 1, (1969-),,.

Apr Vol.26 No.2. Pure and Applied Mathematics O157.5 A (2010) (d(u)d(v)) α, 1, (1969-),,. 2010 4 26 2 Pure and Applied Matheatics Apr. 2010 Vol.26 No.2 Randić 1, 2 (1., 352100; 2., 361005) G Randić 0 R α (G) = v V (G) d(v)α, d(v) G v,α. R α,, R α. ; Randić ; O157.5 A 1008-5513(2010)02-0339-06

Διαβάστε περισσότερα

Journal of the CUN(Natural Sciences Edition) ...

Journal of the CUN(Natural Sciences Edition) ... 2007 2 16 1 ( ) Journal of the CUN(Natural Sciences Edition) Feb. 2007 Vol. 16 No. 1 1,2, 1, 1, 2 (11, 100081 ; 21, 100875) :. 2,42D NAA 62BA.,.. : ; ; ; :Q94513 :A :100528036 (2007) 0120023206 : (1),

Διαβάστε περισσότερα

ADVANCES IN RICE BREEDING FOR THE FUNCTIONAL COMPONENTS

ADVANCES IN RICE BREEDING FOR THE FUNCTIONAL COMPONENTS 364 2004,18 (5) :364 367 Acta Agriculturae Nucleatae Sinica :100028551 (2004) 052364204 1 2 1 2 1,2 3 (1., 310029 ; 2., 310006) :, 2, : ; ; ADVANCES IN RICE BREEDING FOR THE FUNCTIONAL COMPONENTS HU Fan2rong

Διαβάστε περισσότερα

( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;

( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ; 28 1 2006 1 RESOURCES SCIENCE Vol. 28 No. 1 Jan. 2006 :1007-7588(2006) 01-0002 - 07 20 1 1 2 (11 100101 ; 21 101149) : 1978 1978 2001 ; 2010 ; ; ; : ; ; 24718kg 1) 1990 26211kg 260kg 1995 2001 238kg( 1)

Διαβάστε περισσότερα

Cellular Physiology and Biochemistry

Cellular Physiology and Biochemistry Original Paper 2016 The Author(s). 2016 Published The Author(s) by S. Karger AG, Basel Published online: November 25, 2016 www.karger.com/cpb Published by S. Karger AG, Basel 486 www.karger.com/cpb Accepted:

Διαβάστε περισσότερα

SOD SNP % Cu /Zn-SOD. DAM- BE DNAStar % Mn /Fe-SOD. 6 1SNP /17. 9 bp

SOD SNP % Cu /Zn-SOD. DAM- BE DNAStar % Mn /Fe-SOD. 6 1SNP /17. 9 bp 2011 33 6 1206-1211 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com SOD SNP 1 2 3 2 2* 1. 330004 2. 330004 3. 510006 GenBank Cu /Zn-SOD Mn /Fe-SOD

Διαβάστε περισσότερα

Motion analysis and simulation of a stratospheric airship

Motion analysis and simulation of a stratospheric airship 32 11 Vol 32 11 2011 11 Journal of Harbin Engineering University Nov 2011 doi 10 3969 /j issn 1006-7043 2011 11 019 410073 3 2 V274 A 1006-7043 2011 11-1501-08 Motion analysis and simulation of a stratospheric

Διαβάστε περισσότερα

, DYY-8B, ; : Centrifuge 11 R. min

, DYY-8B, ; : Centrifuge 11 R. min 40 Chinese Journal of Otology Vol. 8 No.1 2010 DNA A1555G - ( 030001) 2 12 68 DNA (polymerase chain reaction PCR) DNA A1555G 7 DNA 12S rrna 1555 A G A1555G ; DNA A1555G ; ; ; R764.433 R342.4 A 1672-2922(2010)01-040-06

Διαβάστε περισσότερα

J. Dairy Sci. 93: doi: /jds American Dairy Science Association, 2010.

J. Dairy Sci. 93: doi: /jds American Dairy Science Association, 2010. Supplementary Table 1. Primers and PCR conditions used for the amplification of the goat SCD1 cdna (PCR1 to PCR6) and three SCD1 polymorphic regions (PCR7 to PCR9) PCR Primers Sequence Position 1 Thermal

Διαβάστε περισσότερα

, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells

, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells 2011 9 1 77 SLC26A4 HEK 293 1 2 1 1 1 1 (100853) 2 ( 050051) SLC26A4 (pegfp enhanced green fluorescent protein) SLC26A4 pegfp-slc26a4 HEK293 pegfp-slc26a4 HEK293 - (RT-PCR) SLC26A4 mrna Western Blot (

Διαβάστε περισσότερα

Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica

Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica 35 1 2 0 1 7 1 DOI 10. 13193 /j. issn. 1673-7717. 2017. 01. 035 1 1 1 1 2 1. 150036 2. 150040 D101 DEAE Cellulose 52 Sephacryl S - 300 - - PJP - 1a PJP - 3a 1. 34 10 3 Da 1. 70 10 7 Da - PJP - 3a 4. 56

Διαβάστε περισσότερα

Downloaded from jcpp.iut.ac.ir at 8:11 IRDT on Thursday July 12th 2018

Downloaded from jcpp.iut.ac.ir at 8:11 IRDT on Thursday July 12th 2018 / () / / (b a ) * (/ : / : ).. b a..... / /. Pinb-D1e. Pinb-D1c... :.() (Matrix)..( ). (Triticum aestivum).(). fshahria@yahoo.com.au : : * / () / /.() () b a..( ) Pinb-D1d Pinb-D1c Pinb-D1e ().( )...(

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΤΕΧΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ. Πτυχιακή εργασία

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΤΕΧΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ. Πτυχιακή εργασία ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΤΕΧΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ Πτυχιακή εργασία ΥΔΡΟΠΟΝΙΚΗ ΚΑΛΛΙΕΡΓΕΙΑ ΔΥΟΣΜΟΥ ΣΕ ΔΙΑΦΟΡΕΤΙΚΑ ΘΡΕΠΤΙΚΑ ΔΙΑΛΥΜΑΤΑ ΕΡΑΤΩ ΝΙΚΟΛΑΪΔΟΥ Λεμεσός 2014

Διαβάστε περισσότερα

Approximation Expressions for the Temperature Integral

Approximation Expressions for the Temperature Integral 20 7Π8 2008 8 PROGRSS IN CHMISRY Vol. 20 No. 7Π8 Aug., 2008 3 3 3 3 3 ( 230026),,,, : O64311 ; O64213 : A : 10052281X(2008) 07Π821015206 Approimation pressions for the emperature Integral Chen Haiiang

Διαβάστε περισσότερα

α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN BIOTECHNOLOGY BULLETIN 2011 3 α 1 2-300457 PCR Helicobacter pylori HP DNA α 1 2- α 1 2-fucosyltransferase α 1 2-fuct 906 bp pet-22b + pet-fuct BL21 DE3 25 0. 1 mmol /L IPTG 4 h SDS-PAGE 33 kd α 1 2- BL21

Διαβάστε περισσότερα

Chalkou I. C. [PROJECT] Ανάθεση εργασιών.

Chalkou I. C. [PROJECT] Ανάθεση εργασιών. Πληροφορική της Υγείας 2014 Chalkou I. C. [PROJECT] Ανάθεση εργασιών. Περιεχόμενα 1. Ομάδα ΣΤ... 3 1.1 ΜΑΡΚΟΠΟΥΛΟΥ- ΣΠΥΡΟΠΟΥΛΟΥ -ΚΩΝΣΤΑΝΤΟΠΟΥΛΟΥ... 3 1.2 ΜΑΡΚΟΣ- ΚΟΥΤΣΟΠΟΥΛΟΣ ΑΥΓΕΡΗ - ΜΠΟΥΖΑΛΑ... 3 1.3

Διαβάστε περισσότερα

Quick algorithm f or computing core attribute

Quick algorithm f or computing core attribute 24 5 Vol. 24 No. 5 Cont rol an d Decision 2009 5 May 2009 : 100120920 (2009) 0520738205 1a, 2, 1b (1. a., b., 239012 ; 2., 230039) :,,.,.,. : ; ; ; : TP181 : A Quick algorithm f or computing core attribute

Διαβάστε περισσότερα

Journal of Ningxia Medical University BRCA2. M2610I 2405 delt stp ± t = P > %

Journal of Ningxia Medical University BRCA2. M2610I 2405 delt stp ± t = P > % 33 6 2011 6 Journal of Ningxia Medical University 515 1674-6309 2011 06-0515 - 04 16 BRCA2 1 2 2 1 3 1. 750004 2. 750021 3. 750004 16-2 BRCA2 16 16 30 PCR BRCA2 16 3 18. 75% 2 M2610I 2405 delt stp729 1

Διαβάστε περισσότερα

Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...

Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines... III Contents I II III Abstract... I Zusammenfassung... II Contents... III 1 Aim of the work... 1 2 Introduction... 2 2.1 Short overview of Chinese hamster ovary cell lines... 2 2.2 Unspecific mutations:

Διαβάστε περισσότερα

Trace gas emissions from soil ecosystems and their implications in the atmospheric environment

Trace gas emissions from soil ecosystems and their implications in the atmospheric environment J. Jpn. Soc. Soil Phys. No. 3., p.,+ -+,**- * Trace gas emissions from soil ecosystems and their implications in the atmospheric environment Kazuyuki YAGI* * National Institute for Agro-Environmental Science,

Διαβάστε περισσότερα

Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin

Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin 2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,

Διαβάστε περισσότερα

Evolution of Novel Studies on Thermofluid Dynamics with Combustion

Evolution of Novel Studies on Thermofluid Dynamics with Combustion MEMOIRS OF SHONAN INSTITUTE OF TECHNOLOGY Vol. 42, No. 1, 2008 * Evolution of Novel Studies on Thermofluid Dynamics with Combustion Hiroyuki SATO* This paper mentions the recent development of combustion

Διαβάστε περισσότερα

High mobility group 1 HMG1

High mobility group 1 HMG1 Vol. 29, pp.705 ~ 711, 2001 High mobility group 1 HMG1 13 12 20 anti-neutrophil cytoplasmic antibodies, ANCA ANCA 1982 Davies 1980 1 high mobility group HMG1 HMG2 30 kd high mobility group HMGHMG HMG1

Διαβάστε περισσότερα

Resistance monitoring and target gene cloning of Bemisia tabaci Q-biotype from Jiangsu Province

Resistance monitoring and target gene cloning of Bemisia tabaci Q-biotype from Jiangsu Province Chinese Journal of Applied Entomology 2011 48 1 48 53 * Q 1 2 1 1 2 1 1. 225009 2. 100081 3 Q Bemisia tabaci Gennadius 5 Q RCR 287 bp 184 bp ace1 para- Q F331W L925I T929V Resistance monitoring and target

Διαβάστε περισσότερα

Screening of Respiration-deficient Saccharomyces cerevisiae Strains with Sugar-and Thermo-tolerances

Screening of Respiration-deficient Saccharomyces cerevisiae Strains with Sugar-and Thermo-tolerances 3 3 Vol3 No3 3 9 Life Science Research June 9 *,,, 535 :, 3, 5- (TTC), 3,, T,, ; (5~5 μ 375~5 μ),, 5% (W/V), 55,, 55% 9% : ; ; ; ; :Q39 + :A :7-77(9)3-99-5 Screening of Respiration-deficient Saccharomyces

Διαβάστε περισσότερα

Studies on Cold Tolerance of Rice, Oryza sativa L.

Studies on Cold Tolerance of Rice, Oryza sativa L. 29 5 2003 9 708 714 ACTA AGRONOMICA SINICA Vol. 29, No. 5 pp. 708 714 Sept., 2003. 1,2 2 1 3 3 1 1 2 Ξ ( 1, 650205 ; 2, 430070 ; 3, 06228555, ) F 2, 159 RFLP SSR STATISTIC, ( r) 0. 8364 ; ( ) 43, 8 11

Διαβάστε περισσότερα

CPT. Tsuchiya. beta. quantitative RT PCR QIAGEN IGFBP. Fect Transfection Reagent sirna. RT PCR RNA Affymetrix GeneChip Expression Array

CPT. Tsuchiya. beta. quantitative RT PCR QIAGEN IGFBP. Fect Transfection Reagent sirna. RT PCR RNA Affymetrix GeneChip Expression Array 7 PTEN p Tsuchiya DNA Hepatocyte nuclear factor beta HNF beta HNFbeta IGFBP GLUT G Pase MODY maturity onset diabetes of the young Tsuchiya HNFbeta HNFbeta HNFbeta sirna CPT HNFbeta HNFbeta TOVG KOC ESMCAS

Διαβάστε περισσότερα

Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival

Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to facilitate intracellular survival Hongwei Gu 1,2*, Chihao Zhao 1,2*, Tianfu Zhang 1,2*, Hongwei Liang 1,2, Xiao-Ming Wang 1,

Διαβάστε περισσότερα

,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78

,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78 ISSN 100727626 CN 1123870ΠQ 2002 4 Chinese Journal of Biochemistry and Molecular Biology 18 (2) :245 249 HLA2B2704 3 2) ( 2) 100044) HLA2B2704 286 HLA2B2704 DNA ( HLA2B2704 DNA) PCR F0 F1 RT2PCR HLA2B2704

Διαβάστε περισσότερα

Η συμβολή της μοριακής εργαστηριακής διάγνωσης στην κλινική πράξη Α ΠΑΠΑΔΟΠΟΥΛΟΥ ΕΔΙΠ, ΙΑΤΡΙΚΗΣ ΣΧΟΛΗΣ ΕΚΠΑ

Η συμβολή της μοριακής εργαστηριακής διάγνωσης στην κλινική πράξη Α ΠΑΠΑΔΟΠΟΥΛΟΥ ΕΔΙΠ, ΙΑΤΡΙΚΗΣ ΣΧΟΛΗΣ ΕΚΠΑ Η συμβολή της μοριακής εργαστηριακής διάγνωσης στην κλινική πράξη Α ΠΑΠΑΔΟΠΟΥΛΟΥ ΕΔΙΠ, ΙΑΤΡΙΚΗΣ ΣΧΟΛΗΣ ΕΚΠΑ Δηλώνω ότι δεν έχω σύγκρουση συμφερόντων Χαρτογράφηση του ανθρώπινου γονιδιώματος- Ημερομηνίες

Διαβάστε περισσότερα

Gateway cdna. cdna. pdest TM ~ cfu/ ml ~ cfu bp

Gateway cdna. cdna. pdest TM ~ cfu/ ml ~ cfu bp 2010 32 4 0791-0796 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com Gateway cdna * * 350002 cdna cdna Gateway RNA mrna 3 cdna BP LR cdna pdest TM

Διαβάστε περισσότερα

Diagnosing X-linked Ichthyosis by Monoplast Single-round Duplex PCR

Diagnosing X-linked Ichthyosis by Monoplast Single-round Duplex PCR 13 4 Vol13 No4 2009 8 Life Science Research Aug 2009 2009 PCR X- *,,,,,,,, 410078 : X- (X-linked ichthyosis, XLI), XLI, XLI (preimplantation genetic diagnosis, PGD) PCR amelogenin (Amel), 958% 909%, 15%;

Διαβάστε περισσότερα

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water 31 1 2010 1 ENVIRONMENTAL SCIENCE Vol. 31,No. 1 Jan.,2010, 3, (,, 100084) :,.,, ( Microcystis aeruginosa),3 (A 2 O ) 10 6 ml - 1,> 0139 d - 1. A 2 O222,. TP ( K max ) ( R max ), Monod. :; ; ; ; :X173 :A

Διαβάστε περισσότερα

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology human telomerase reverse transcriptase htert

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology human telomerase reverse transcriptase htert ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2013 4 29 4 383 ~ 388 PCR htert mrna 1 2 2 3 1 1 2 2 1 1 530021 2 530021 3 * 3 530021 human

Διαβάστε περισσότερα

Rapid Raman spectra identification and determination of levofloxacin hydrochloride injection *

Rapid Raman spectra identification and determination of levofloxacin hydrochloride injection * DOI:0.655/j.0254-793.20.09.039 75 * 2 2 3. 200435 2. 20203 3. 20000 ph R97 A 0254-793 20 09-75 - 05 Rapid Raman spectra identification and determination of levofloxacin hydrochloride injection * CHEN Bin

Διαβάστε περισσότερα

Ίδρυμα Τεχνολογίας & Έρευνας (ΙΤΕ)

Ίδρυμα Τεχνολογίας & Έρευνας (ΙΤΕ) Ίδρυμα Τεχνολογίας & Έρευνας (ΙΤΕ) Ινστιτούτο Μοριακής Βιολογίας & Βιοτεχνολογίας (IMBB) Ηράκλειο, Κρήτη Σύντομη Ιστορία του ΙΜΒΒ Ιδρύθηκε το 1983 Ένα από τα Ινστιτούτα του Ερευνητικού Κέντρου Κρήτης (ΕΚΕΚ)

Διαβάστε περισσότερα

SVM. Research on ERPs feature extraction and classification

SVM. Research on ERPs feature extraction and classification 39 1 2011 2 Journal of Fuzhou University Natural Science Edition Vol 39 No 1 Feb 2011 DOI CNKI 35-1117 /N 20110121 1723 008 1000-2243 2011 01-0054 - 06 ERPs 350108 - ERPs SVM ERPs SVM 90% ERPs SVM TP391

Διαβάστε περισσότερα

ER-Tree (Extended R*-Tree)

ER-Tree (Extended R*-Tree) 1-9825/22/13(4)768-6 22 Journal of Software Vol13, No4 1, 1, 2, 1 1, 1 (, 2327) 2 (, 3127) E-mail xhzhou@ustceducn,,,,,,, 1, TP311 A,,,, Elias s Rivest,Cleary Arya Mount [1] O(2 d ) Arya Mount [1] Friedman,Bentley

Διαβάστε περισσότερα

A research on the influence of dummy activity on float in an AOA network and its amendments

A research on the influence of dummy activity on float in an AOA network and its amendments 2008 6 6 :100026788 (2008) 0620106209,, (, 102206) : NP2hard,,..,.,,.,.,. :,,,, : TB11411 : A A research on the influence of dummy activity on float in an AOA network and its amendments WANG Qiang, LI

Διαβάστε περισσότερα

X,60. Umiel,, Griesbach,, China Academic Journal Electronic Publishing House. All rights reserved ,Vol. 22,No.

X,60. Umiel,, Griesbach,, China Academic Journal Electronic Publishing House. All rights reserved ,Vol. 22,No. 2002,Vol. 22,No. 2 3 ( 100101 ),,,,,,, ( ), 60 Co 1 111,,,, [1 ],,,,,, Umiel,,,, 11312, [2 ] Griesbach,,, F 2 [3 ] DNA 112,,, 2,, -, [4 ] 3 :,,, 113 11311 X,60 80, :,,,, ;,,, 81 ,,,,, [1 ],,, : [5 8 ]

Διαβάστε περισσότερα

D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical and experimental study

D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical and experimental study Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical

Διαβάστε περισσότερα

svari Real-time RT-PCR RSV

svari Real-time RT-PCR RSV 19 39-43 12 Real-time RS svarireal-time RSV subgroup HMPV RSV N Real-time 100 100 Real-time RSV subgroup RSV HMPV F Real-time 55.8 95.5 genotype A2 B1 TaqMan svari InfV RS RSV HMPV HRV PIV RSV HMPV RSV

Διαβάστε περισσότερα

DNA G7444A, 2. Study on a new point mutation of nt7444 G A in the mitochondrial DNA in a type 2 diabetes mellitus family

DNA G7444A, 2. Study on a new point mutation of nt7444 G A in the mitochondrial DNA in a type 2 diabetes mellitus family HEREDITAS (Beijing) 2007 4, 29(4): 433 437 ISSN 0253-9772 www.chinagene.cn DOI: 10.1360/yc-007-0433 2 DNA G7444A,,,,,,,, 350005 : PCR-RFLP 2 DNA G7444A,, 27, 11 DNA G7444A, 11 2 5, 1,, DNA G7444A, 2 :

Διαβάστε περισσότερα

Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention

Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention 33 2 2011 4 Vol. 33 No. 2 Apr. 2011 1002-8412 2011 02-0096-08 1 1 1 2 3 1. 361005 3. 361004 361005 2. 30 TU746. 3 A Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention

Διαβάστε περισσότερα

Νόσος Parkinson-Νέοι ορίζοντες Ξηροµερήσιου Γεωργία Νευρολόγος-Μέλος ερευνητικής οµάδας Νευρογενετικής Αίτια της νόσου Parkinson Περιβαλλοντικοί παράγοντες Γενετικοί παράγοντες Γενετική βλάβη (παθογόνα

Διαβάστε περισσότερα

th International Conference on Machine Learning and Applications. E d. h. U h h b w k. b b f d h b f. h w k by v y

th International Conference on Machine Learning and Applications. E d. h. U h h b w k. b b f d h b f. h w k by v y 212 11th International Conference on Machine Learning and Applications C b G E P fi d P P I f Id fy F M d D d W, M O h, E Z,T L C f C S, U v y f M, C G b, FL 33146, USA E : d.w 1@. d, h @.. d D f C S d

Διαβάστε περισσότερα

PACS: Ox, Cw, a, TP

PACS: Ox, Cw, a, TP * (, 210046 ) ( 2011 12 30 ; 2012 4 27 ),.,., ; ;.,,. :,, PACS: 02.10.Ox, 02.50.Cw, 05.40. a, 07.05.TP 1 ().,.,,,, s d. [1]., [2,3],,,.,,.,,,.,,,., [4 6].,, 1. A. 40 110 S E N(42,2 2 ) D N(63,3 2 ) B:70

Διαβάστε περισσότερα

(Synesthesia) (B) 22-25

(Synesthesia) (B) 22-25 (Synesthesia) 18 1993 10 (B) 22-25 10 50 1. Root, N. B., Rouw, R., Asano, M., Kim, C-Y., Melero, H., Yokosawa, K., & Ramachandran, V. S.(2018). Why is the synesthete's "A" red? Using a five-language dataset

Διαβάστε περισσότερα

ΜΕΛΕΤΗ ΣΥΜΠΕΡΙΦΟΡΑΣ ΦΛΟΓΩΝ ΠΡΟΠΑΝΙΟΥ ΣΤΑΘΕΡΟΠΟΙΗΜΕΝΩΝ ΣΕ ΕΠΙΠΕΔΟ ΣΩΜΑ ΜΕ ΔΙΑΣΤΡΩΜΑΤΩΜΕΝΗ ΕΙΣΑΓΩΓΗ ΜΙΓΜΑΤΟΣ

ΜΕΛΕΤΗ ΣΥΜΠΕΡΙΦΟΡΑΣ ΦΛΟΓΩΝ ΠΡΟΠΑΝΙΟΥ ΣΤΑΘΕΡΟΠΟΙΗΜΕΝΩΝ ΣΕ ΕΠΙΠΕΔΟ ΣΩΜΑ ΜΕ ΔΙΑΣΤΡΩΜΑΤΩΜΕΝΗ ΕΙΣΑΓΩΓΗ ΜΙΓΜΑΤΟΣ ΜΕΛΕΤΗ ΣΥΜΠΕΡΙΦΟΡΑΣ ΦΛΟΓΩΝ ΠΡΟΠΑΝΙΟΥ ΣΤΑΘΕΡΟΠΟΙΗΜΕΝΩΝ ΣΕ ΕΠΙΠΕΔΟ ΣΩΜΑ ΜΕ ΔΙΑΣΤΡΩΜΑΤΩΜΕΝΗ ΕΙΣΑΓΩΓΗ ΜΙΓΜΑΤΟΣ Ειδική Ερευνητική Εργασία Υποβληθείσα στο Τμήμα Φυσικής του Πανεπιστημίου Πατρών Υπό ΤΣΙΡΩΝΗ ΓΕΩΡΓΙΟ

Διαβάστε περισσότερα

Evaluation of Resistance to Scab in Pear Germplasms

Evaluation of Resistance to Scab in Pear Germplasms 2012 13 4 571-576 Journal of Plant Genetic Resources / 125100 197 Evaluation of Resistance to Scab in Pear Germplasms DONG Xing-guangTIAN Lu-mingCAO Yu-fen Research Institute of PomologyChinese Academy

Διαβάστε περισσότερα

( HN2y Co14 Co8 Co36 Sx (2) 56 (2) ) 16S

( HN2y Co14 Co8 Co36 Sx (2) 56 (2) ) 16S 16S23S rrna 197 16S23S rrna (, 100050) : 16S23S rrna,, 2, 16S23S rrna,3 3 (ATCC10248 NCPPB 947 NCPPB3580) 1 B. phenazinium (LMG2247) 8 ( HN2y Co14 Co8 Co36 Sx8801 90-3 56 (2) 56 (2) ) 16S 23S rrna,( GenBank)

Διαβάστε περισσότερα

THE GENETIC TRANSFORMATION OF STRAWBERRY WITH WINTER FLOUNDER ANTIFREEZE PROTEIN GENE

THE GENETIC TRANSFORMATION OF STRAWBERRY WITH WINTER FLOUNDER ANTIFREEZE PROTEIN GENE 2009,23 (3) :423 428 Journal of Nuclear Agricultural Sciences 423 :100028551 (2009) 032423206 1 2 1 3 3 1 4 (11, 010031 ;21, 010021 ; 31, 010010 ;41, 010070) : 2, pre pro mature 3 (AFP), 7 Km PCR PCR2Southern,6,,

Διαβάστε περισσότερα

Digesting Plasmid DNA with Restriction Endonuclease s under the Condition of Microwave-heating

Digesting Plasmid DNA with Restriction Endonuclease s under the Condition of Microwave-heating ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2012 4 28 4 380 ~ 384-1 2 1 1 1 * 1 310021 2 210095 2 min DNA 2 min Q78 Digesting Plasmid

Διαβάστε περισσότερα

Varietal Differences in Response of Main Root Traits to Nitrogen Application Time in Rice ( Oryza sativa L. )

Varietal Differences in Response of Main Root Traits to Nitrogen Application Time in Rice ( Oryza sativa L. ) 29 6 2003 11 871 877 ACTA AGRONOMICA SINICA Vol. 29, No. 6 pp. 871 877 Nov., 2003 3 Ξ ( 225009) 8 6 63, 4 : (1) ; (2) N N, N ; (3), ; (4) ; (5) ; ; N : S511 ;S365 : A Varietal Differences in Response of

Διαβάστε περισσότερα

J. of Math. (PRC) Banach, , X = N(T ) R(T + ), Y = R(T ) N(T + ). Vol. 37 ( 2017 ) No. 5

J. of Math. (PRC) Banach, , X = N(T ) R(T + ), Y = R(T ) N(T + ). Vol. 37 ( 2017 ) No. 5 Vol. 37 ( 2017 ) No. 5 J. of Math. (PRC) 1,2, 1, 1 (1., 225002) (2., 225009) :. I +AT +, T + = T + (I +AT + ) 1, T +. Banach Hilbert Moore-Penrose.. : ; ; Moore-Penrose ; ; MR(2010) : 47L05; 46A32 : O177.2

Διαβάστε περισσότερα

Supporting Information. Enhanced energy storage density and high efficiency of lead-free

Supporting Information. Enhanced energy storage density and high efficiency of lead-free Supporting Information Enhanced energy storage density and high efficiency of lead-free CaTiO 3 -BiScO 3 dielectric ceramics Bingcheng Luo 1, Xiaohui Wang 1*, Enke Tian 2, Hongzhou Song 3, Hongxian Wang

Διαβάστε περισσότερα

Buried Markov Model Pairwise

Buried Markov Model Pairwise Buried Markov Model 1 2 2 HMM Buried Markov Model J. Bilmes Buried Markov Model Pairwise 0.6 0.6 1.3 Structuring Model for Speech Recognition using Buried Markov Model Takayuki Yamamoto, 1 Tetsuya Takiguchi

Διαβάστε περισσότερα

ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ Ν.Κ. ΜΟΣΧΟΝΑ (Νοεμβριος 2013)

ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ Ν.Κ. ΜΟΣΧΟΝΑ (Νοεμβριος 2013) ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ Ν.Κ. ΜΟΣΧΟΝΑ (Νοεμβριος 2013) 1. ΑΤΟΜΙΚΑ ΣΤΟΙΧΕΙΑ Όνομα: Νικόλαος Κ. Μοσχονάς Ημερομηνία Γεννήσεως: 21 Νοεμβρίου 1952 Οικογενειακή Κατάσταση: Έγγαμος, δύο παιδία 2. ΣΠΟΥΔΕΣ 1979-1981:

Διαβάστε περισσότερα

TGFp FSH INH INH

TGFp FSH INH INH (210095) E-mail ( genlinwang@hotmail.com) - -(Strept Avidin-Biotin-Peroxidase Complex SABC), 1 32,, 1 inhibin INH α 32 000 TGFp FSH FSH [1] INHα Sertoli Noguchi 1997 [2] Meunier et al.1988 [3] INH INH

Διαβάστε περισσότερα

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Vasilis Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus http://en.wikipedia.org/wiki/image:cyprus_topo.png

Διαβάστε περισσότερα

Development of a Seismic Data Analysis System for a Short-term Training for Researchers from Developing Countries

Development of a Seismic Data Analysis System for a Short-term Training for Researchers from Developing Countries No. 2 3+/,**, Technical Research Report, Earthquake Research Institute, University of Tokyo, No. 2, pp.3+/,,**,. * * Development of a Seismic Data Analysis System for a Short-term Training for Researchers

Διαβάστε περισσότερα

Research on Economics and Management

Research on Economics and Management 36 5 2015 5 Research on Economics and Management Vol. 36 No. 5 May 2015 490 490 F323. 9 A DOI:10.13502/j.cnki.issn1000-7636.2015.05.007 1000-7636 2015 05-0052 - 10 2008 836 70% 1. 2 2010 1 2 3 2015-03

Διαβάστε περισσότερα

17 min R A (2009) To probe into the thermal property the mechanism of the thermal decomposition and the prospective

17 min R A (2009) To probe into the thermal property the mechanism of the thermal decomposition and the prospective ( 31001) (CDZ)CDZCDZ GAMSSCDZCDZ (DSC)CDZCDZ (G) DakinCDZ 1 1 CDZ a =173.9 kj mol min -1 CDZ 17 min A=.69 10 A=1.175 10 17 R97.14A1007-7693(009)1-1019-05 a =17.3 kj mol 1 Mechanism and Kinetics of hermal

Διαβάστε περισσότερα

rp, ribosomal protein 60S rp mrna rpl30 rps14 RT-PCR mrna nonsense-mediated mrna decay smg-2 smg-2 mrna rp rpl-1 rpl-1

rp, ribosomal protein 60S rp mrna rpl30 rps14 RT-PCR mrna nonsense-mediated mrna decay smg-2 smg-2 mrna rp rpl-1 rpl-1 rp, ribosomal protein 60S 47 rpl 40S 32 rps rp mrna rpl30 rps14 rpl12 rpl3 rps13 rp mrna nonsense-mediated mrna decay (NMD) C. elegans smg-2 smg-2 mrna 50 rp 7 rp 4 rpl 4 rp NMD mrna 6 rp mrna rp mrna

Διαβάστε περισσότερα

Ινσουλίνη και καρδιά. Ηλιάδης Φώτης Λέκτορας Α.Π.Θ.

Ινσουλίνη και καρδιά. Ηλιάδης Φώτης Λέκτορας Α.Π.Θ. Ινσουλίνη και καρδιά Ηλιάδης Φώτης Λέκτορας Α.Π.Θ. Επίδραση ινσουλίνης στο ήπαρ, στους μυς και στον λιπώδη ιστό : Διατήρηση ευγλυκαιμίας Nature 2001;414:799 806 Ινσουλίνη? Λειτουργικότητα Μορφολογία Βιωσιμότητα

Διαβάστε περισσότερα

Studies on nuclear phase and genetic attribute of the basidiospores of Flammulina velutipes

Studies on nuclear phase and genetic attribute of the basidiospores of Flammulina velutipes 263369~3752007 Mycosystema 1 430070 2 273155 3 80.2%7.5% 12.3% RAPD 10 4 4 RAPD Q939.5 A1672-6472200703-0369-0375 Studies on nuclear phase and genetic attribute of the basidiospores of Flammulina velutipes

Διαβάστε περισσότερα

Prey-Taxis Holling-Tanner

Prey-Taxis Holling-Tanner Vol. 28 ( 2018 ) No. 1 J. of Math. (PRC) Prey-Taxis Holling-Tanner, (, 730070) : prey-taxis Holling-Tanner.,,.. : Holling-Tanner ; prey-taxis; ; MR(2010) : 35B32; 35B36 : O175.26 : A : 0255-7797(2018)01-0140-07

Διαβάστε περισσότερα

ACTA MATHEMATICAE APPLICATAE SINICA Nov., ( µ ) ( (

ACTA MATHEMATICAE APPLICATAE SINICA Nov., ( µ ) (  ( 35 Þ 6 Ð Å Vol. 35 No. 6 2012 11 ACTA MATHEMATICAE APPLICATAE SINICA Nov., 2012 È ÄÎ Ç ÓÑ ( µ 266590) (E-mail: jgzhu980@yahoo.com.cn) Ð ( Æ (Í ), µ 266555) (E-mail: bbhao981@yahoo.com.cn) Þ» ½ α- Ð Æ Ä

Διαβάστε περισσότερα

A Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn

A Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn 56 [ ] 167-3619(009)03-056-05 Journal of Tropical Medicine Vol.9 No.3 Mar.009 * ( 510515) (PCT) CNKI VIP PCT QUADAS Metadisc1.4 DOR (SROC) SROC (AUC) Review Manager5 Meta 8 ; 7 8 (χ =3.8P=0.858I =0.0%)

Διαβάστε περισσότερα

Fifty years of amphioxus study in China

Fifty years of amphioxus study in China 20 1 2008 2 Chinese Bulletin of Life Sciences Vol. 20, No. 1 Feb., 2008 1004-0374(2008)01-0064-05 50, 266003 50, Q959.287A Fifty years of amphioxus study in China ZHANG Shi-cui*, GUO Bin, LIANG Yu-jun

Διαβάστε περισσότερα

Medicago marina 2012

Medicago marina 2012 ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ Τµήµα Γεωπονικής Βιοτεχνολογίας ΣΚΑΓΙΑ. ΑΓΓΕΛΙΚΗ ΜΕΤΑΠΤΥΧΙΑΚΗ ΙΑΤΡΙΒΗ Χαρακτηρισµός και Φυλογενετική ανάλυση συµβιωτικών βακτηρίων που αποµονώθηκαν από τα φυµάτια της Medicago

Διαβάστε περισσότερα

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics 260.602.01 September 2, 2005 Jonathan Pevsner, Ph.D. pevsner@jhmi.edu bioinformatics medical informatics Tool-users public health informatics databases algorithms Tool-makers

Διαβάστε περισσότερα

ACTA SCIENTIAE CIRCUMSTANTIAE. 16S rrna PNAN5 ( Rhodococcus sp. strain PNAN5). 20. ( Institute of Microbiology, Chinese Academy of Sciences,

ACTA SCIENTIAE CIRCUMSTANTIAE. 16S rrna PNAN5 ( Rhodococcus sp. strain PNAN5). 20. ( Institute of Microbiology, Chinese Academy of Sciences, 24 3 2004 5 ACTA SCIENTIAE CIRCUMSTANTIAE Vol. 24,No. 3 May,2004 :025322468 (2004) 0320482205 :X523 :A PNAN5 ( Rhodococcus sp. strain PNAN5),,, 3 (, 100080) :, 16S rrna PNAN5 ( Rhodococcus sp. strain PNAN5).

Διαβάστε περισσότερα

Εκδίδεται μία φορά το χρόνο από το:

Εκδίδεται μία φορά το χρόνο από το: Εκδίδεται μία φορά το χρόνο από το: Τμήμα Πληροφορικής και Τηλεπικοινωνιών Εθνικό και Καποδιστριακό Πανεπιστήμιο Αθηνών, Πανεπιστημιούπολη, 15784 Αθήνα Τηλ: 210-727 5190, Φαξ: 210-727 5333 email: library@di.uoa.gr,

Διαβάστε περισσότερα

Identification of Salmonella,Campylobacter jejuni and Enterohemorrhagic E.coli by Denaturing High-performance Liquid Chromatography

Identification of Salmonella,Campylobacter jejuni and Enterohemorrhagic E.coli by Denaturing High-performance Liquid Chromatography BIOTECHNOLOGY BULLETIN 2009 3 116015 PCR multiplex PCR mpcr denaturing high-performance liquid chromatography DHPLC O157 H7 fimy gyra O157 H7 rfbe 3 O157 H7 PCR 284 159 499 bp PCR O157 H7 1.5 CFU/ ml 15

Διαβάστε περισσότερα

CBF1. Study on CBF1 Gene Transferred from Transgenic Strawberry to Nontransgenic

CBF1. Study on CBF1 Gene Transferred from Transgenic Strawberry to Nontransgenic 2007 5 3 309 313 Molecular Plant Breeding, 2007, Vol.5, No.3, 309 313 Research Report CBF1 1,3 2 1 3 1 1* 1,, 100093; 2,, 1000871; 3,, 010019 *, jinwanmei@sohu.com CBF1 PCR 640 bpcbf1 20 16 2CBF1, CBF1,,

Διαβάστε περισσότερα

RAPD. ( B rassica rapa) RFL P ( Restriction Fragment Length Polymorphism) RFL P ; RFL P, rapa. CHIN ESE BIODIV ERSIT Y 6 (2) :99 104, May, 1998 RAPD

RAPD. ( B rassica rapa) RFL P ( Restriction Fragment Length Polymorphism) RFL P ; RFL P, rapa. CHIN ESE BIODIV ERSIT Y 6 (2) :99 104, May, 1998 RAPD 6,2,1998 5 CHIN ESE BIODIV ERSIT Y 6 (2) :99104, May, 1998 Ξ RAPD 1 1 2 1 1 2 1 (, 100081) 2 (, 430062) RAPD, 34,Ward s : ; ;DNA 34 8,, RAPD Genetic diversity among Chinese oilseed accessions of Brassica

Διαβάστε περισσότερα

VSC STEADY2STATE MOD EL AND ITS NONL INEAR CONTROL OF VSC2HVDC SYSTEM VSC (1. , ; 2. , )

VSC STEADY2STATE MOD EL AND ITS NONL INEAR CONTROL OF VSC2HVDC SYSTEM VSC (1. , ; 2. , ) 22 1 2002 1 Vol. 22 No. 1 Jan. 2002 Proceedings of the CSEE ν 2002 Chin. Soc. for Elec. Eng. :025828013 (2002) 0120017206 VSC 1, 1 2, (1., 310027 ; 2., 250061) STEADY2STATE MOD EL AND ITS NONL INEAR CONTROL

Διαβάστε περισσότερα

Βιοπληροφορική. Ενότητα 2: Βάσεις Δεδομένων (1/3), 1 ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου

Βιοπληροφορική. Ενότητα 2: Βάσεις Δεδομένων (1/3), 1 ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου Βιοπληροφορική Ενότητα 2: Βάσεις Δεδομένων (1/3), 1 ΔΩ Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου Μαθησιακοί Στόχοι Αναφορά στη χρησιμότητα των βιολογικών ΒΔ. Κατανόηση των χαρακτηριστικών, των ιδιαιτεροτήτων

Διαβάστε περισσότερα

1987, 3 ; ; RNA, , 1988, van der Krol. (chalcone synthase,chs) ,,,, (antisense) 112 ( sense suppression cosuppression)

1987, 3 ; ; RNA, , 1988, van der Krol. (chalcone synthase,chs) ,,,, (antisense) 112 ( sense suppression cosuppression) 23 7 CHINA BIOTECHNOLOGY 2003 7 3 1 3 3 2 2 2 (1 510631 2 510650) 1987, 3 : (1) RNA ; (2) ; (3),,,, ; ;,,, ;,,,,,, 1 (antisense) (sense),,, 111 RNA ( antisense suppression),, DNA RNA, :2002207228 :2003205219

Διαβάστε περισσότερα

ΠΟΛΥΤΕΧΝΕΙΟ ΚΡΗΤΗΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΕΡΙΒΑΛΛΟΝΤΟΣ

ΠΟΛΥΤΕΧΝΕΙΟ ΚΡΗΤΗΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΠΟΛΥΤΕΧΝΕΙΟ ΚΡΗΤΗΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΕΡΙΒΑΛΛΟΝΤΟΣ Τομέας Περιβαλλοντικής Υδραυλικής και Γεωπεριβαλλοντικής Μηχανικής (III) Εργαστήριο Γεωπεριβαλλοντικής Μηχανικής TECHNICAL UNIVERSITY OF CRETE SCHOOL of

Διαβάστε περισσότερα