psl1 , 90%~95%. (Oryza sativa L) *,
|
|
- Σουσάννα Μητσοτάκης
- 7 χρόνια πριν
- Προβολές:
Transcript
1 psl1 * * (,, *, ricegb@yzu.edu.cn).. 11 Co F 1 F 2,., psl1, SSR psl1 2., 34 STS, psl1., psl1 BAC, 48 kb,. (Oryza sativa L), 90%~95%.,.,, [1,2].,., [3]., 1 d, 2%, 1% [1,4].,.,,.,.,., RNA,. [1~6]., : ( ), ; ( ). [2,5~17],, [6].,. T-DNA cdna, [17~30].,,,., 10, 3 [31,32] 1), Li [33] pse(t), kb.. 1 ( ). 11 Co 60,,. 6 1)
2 , ; 11. ( ) , F 1, F F 2, ;, F 2,.,, F 2. F 2,, F 3. ( ). Michelmore [34]. F 2 2, 10 DNA, 2. 2 ;,. ( ) DNA SSR. F 2, 6~8 cm. F (psl1). DNA CTAB [35]., SSR µl Mg 2+ (25 mmol/l) 2.5 µl, 10 PCR ( Mg 2+ ) 2.5 µl, dntp (2.5 mmol/l) 2.5 µl, (15 ng/µl) 2.0 µl, DNA ( 15 ng/µl) 2µL, Taq (5 U/µL) 0.2 µl, 13.3 µl. Biometra PCR. : 94 5 min; 94, 1 min; 55, 1 min; 72, 1.5 min; 32 ; min. 4%, (EB) UVP. ( ) STS. BLAST, (Nipponbare) 9311 ; Primer bp 200~500 bp PCR, ;,,. ( ). 1 2, ( ) 2, MAPMAKER (EXP3.0b) [36], , ( 1),,. 25~30 d,, ,,,. 6 11, F 1, 6 11,. F 2,
3 ,. F ( 1), 1.,, psl1 (presescing leaf). 2.3 psl1, SSR, 2 SSR, 2, F 2 SSR , 6 2 (RM6, RM5303, RM5474, RM425, RM406 RM166),. RM6, RM5303, RM5472, RM425, RM406 RM166,, psl1, RM6-RM5303-RM5472-sl1- RM425-RM406-RM166. psl1 RM5472 RM425, RM5472 RM cm ( 2). RM5472 RM psl psl1,. psl1 RM5474 RM425, RM5472 RM cm. BAC 34 STS,, 9 ( 2) F 1, F 2 P 1 P 2 F 1 F 2 / χ 2 (3 1) / / RM5472 RM425 F 2 P1, ; P2,
4 psl1 STS STS2-19 STS2-26, cm., STS2-25( 4). STS2-19 STS (5 3 ) BAC STS2-5 F ATTTGGTTTGATTTTATTCC AP R TCTTGGTATGTGCTCACTTT STS2-6 F TGCTGTGGTTGTTCCTGTC AP R TTTAGGTTATGTTTACAAGAGGC STS2-9 F GGGAACTAAACCAAGCCTAA AP R CATCCGCATCGTAGTATTCA STS2-11 F ATCTGATGGGCGAACAACCT AP R TGGTCGTCGTCACTGTTGGA STS2-18 F CAGAGCAGCCTACCTAGCAG AP R TTCAGCCTTGACAAACCATC STS2-19 F CTGCGACATCTTCTGGCTAA AP R GCAGGCAGAAAGCGTACTAAC STS2-25 F TGCGACATCTTCTGGCTAA AP R CAGGCAGAAAGCGTACTAAC STS2-26 F GATGGTGGGACTGGCTAGTGT AP R TGTGGTGGTTATGTTGGGAAG STS2-28 F TCTCCCGATACATTCTCAA AP R ATACGGCATACAACCAAAC 2.5 psl1 2, RM6535 BAC AP005297, STS2-18 STS2-19 BAC AP004114, STS2-26 STS2-28 BAC AP , psl1 ( 6). AP005297, AP AP BAC, BAC, psl1 STS2-19 STS2-26, cm. STS2-19 AP004114, STS2-26 BAC 4 psl1 2 AP005733,., 48 kb, psl1, psl1. 3,,,.., ;, Rubisco [7].. 5 STS2-19 STS2-25 F 2 P1, ; P2,
5 psl1, [13].,, 25 d, 50~60 d; ; ;.. : ( ), ; ( ),., H3 [37], (pheophorbide a oxygenase).. [38]. [39],., hys1 (hypersenescence 1), cpr5 (constitutive expresser or pathogenesis related gene 5). [40]. 3 ore1, ore3 ore9. ore9, F-box [41].., Buchanan-Wallaston [13] ,,. Lin [6],,. cdna-aflp [13]., 11,, (psl1). STS-19 STS2-26, STS cm, STS cm, STS2-25., psl1 BAC, psl1 AP AP kb,. ( : ) ( : 2003CB CB120807) ( : 05KAJ2012). 1,,.., 2005, 21(3): ,..,
6 , 38(4): ,,.., 1997, 23(2): ,.., 1993, 14(4): ,.., 2003, 1(3): Lin J F, Wu S H. Molecular events in senescing Arabidopsis leaves. Plant J, 2004, 39: Stessman D, Miller A, Spalding M, et al. Regulation of photosynthesis during Arabidopsis leaf development in continuous light. Photosynthesis Res, 2002, 72: Hensel L L, Grbic V, Baumgarten D A, et al. Developmental and age-related processes that influence the longevity and senescence of photosynthetic tissues in Arabidopsis. Plant Cell, 1993, 5: Lohman K N, Gan S, John M C, et al. Molecular analysis of natural leaf senescence in Arabidopsis thaliana. Physiol Plant, 1994, 92: Oh S A, Lee S Y, Chung I K, et al. A senescence-associated gene of Arabidopsis thaliana is distinctively regulated during natural and artificially induced leaf senescence. Plant Mol Biol, 1996, 30: Park J H, Oh S A, Kim Y H, et al. Differential expression of senescence-associated mrnas during leaf senescence induced by different senescence inducing factors in Arabidopsis. Plant Mol Biol, 1998, 37: Buchanan-Wollaston V. Isolation of cdna clones for genes that are expressed during leaf senescence in Brassica napus. Plant Physiol, 1994, 105: Buchanan-Wallaston V, Simon E, Elizabeth H, et al. The molecular analysis of leaf senescence: A genomics approach. Plant Biotechnol J, 2003, 1: Hanfrey C, Fife M, Buchanan-Wollaston V. Leaf senescence in Brassica napus: Expression of genes encoding pathogenesis-related proteins. Plant Mol Biol, 1996, 30: Becker W, Apel K. Differences in gene expression between natural and artificially induced leaf senescence. Planta, 1993, 189: Kleber-Janke T, Krupinska K. Isolation of cdna clones for genes showing enhanced expression in barley leaves during dark-induced senescence as well as during senescence under field condition. Planta, 1997, 203: Smart C M, Hosken S E, Thomas H, et al. The timing of maize leaf senescence and characterization of senescence-related cdnas. Physiol Plant, 1995, 93: Feng Q, Zhang Y, Hao P, et al. Sequence and analysis of rice chromosome 4. Nature, 2002, 420: Goff S A, Ricke D, Lan T H, et al. A draft sequence of the rice genome (Oryza sativa L. ssp. japonica). Science, 2002, 296: Kikuchi S, Satoh K, Nagata T, et al. Collection, mapping and annotation of over cdna clones from Japonica rice. Science, 2003, 301: International Rice Genome Sequencing Project. The map-based sequence of the rice genome. Nature, 2005, 436: Jiang G H, He Y Q, Xu C G, et al. The genetic basis of stay-green in rice analyzed in a population of doubled haploid lines derived from an indica by japonica cross. Theor Appl Genet, 2004, 108(4): Lin L, Liu Y G, Xu X, et al. Efficient linking and transfer of multiple genes by a multigene assembly and transformation vector system. Proc Natl Acad Sci USA, 2003, 100: The Rice Chromosome 10 Sequencing Consortium. In-depth view of structure, activity, and evolution of rice chromosome 10. Science, 2003, 300: Sasaki T, Matsumoto T, Yamamoto K, et al. The genome sequence and structure and rice chromosome 1. Nature, 2002, 420: Shimamoto K, Kyozuka J. Rice as a model for comparative genomics of plants. Annu Rev Plant Biol, 2002, 53: Xue Y, Li J, Xu Z. Recent highlights of the China Rice Functional Genomics Program. Trends Genet, 2003, 19: Yu J, Hu S, Wang J, et al. A draft sequence of the rice genome (Oryza sativa L. ssp. indica). Science, 2002, 296: Zhang Y, Huang Y, Zhang L, et al. Structural features of the rice chromosome 4 centromere. Nucleic Acids Res, 2004, 32: Li X, Qian Q, Fu Z, et al. Control of tillering in rice. Nature, 2003, 422: Jung K H, Hur J, Ryu C H, et al. Characterization of a rice chlorophyll-deficient mutant using the T-DNA gene-trap system. Plant Cell Physiol, 2003, 44(5): Lee S, Kim J H, Yoo E S, et al. Differential regulation of chlorophyll a oxygenase genes in rice. Plant Mol Biol, 2005, 57(6): Li F Z, Jin S H, Hu G C. Isolation and physiological characteristics of a premature senescence mutant in rice (Oryza sativa L). J Zhejiang Univ Sci, 2005, 6B(8): Michelmore R W, Paran I, Kesseli R V. Identification of markers linked to disease-resistance genes by bulked segregant analysis: A rapid method to detect markers in specific genomic regions by using segregating populations. Proc Natl Acad Sci USA, 1991, 88(21): ,,,. sd-g., 2004, 49(8): Lander E S, Green P, Abrahamson J, et al. MAPMAKER: An interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genomics, 1987, 1: Thomas H, Schellenberg M, Vicentini F, et al. Gregor Mendel s green and yellow pea seeds. Bot Acta, 1996, 109: Thomas H. Sid a Mendelian locus controlling thylakoid disassembly in senescing leaves of Festuca pretensis. Theor Appl Genet, 1987, 73: Cha K W, Lee Y J, Koh H J, et al. Isolation, characterization, and mapping of the stay green mutant in rice. Theor Appl Genet, 2002, 104(4): Yoshida S, Ito M, Nishida I, et al. Identification of a novel gene HYS1/CRG5 that has a repressive role in the induction of leaf senescence and pathogen-defense responses in Arabidopsis thaliana. Plant J, 2002, 29: Woo H R, Chung K M, Park J H, et al. ORE9, an F-box protein that regulates leaf senescence in Arabidopsis. Plant Cell, 2001, 13(8): ( , )
SCIENTIA SILVAE SINICAE. a/ b. oldhamii). The length of cab2bo1 ( GenBank accession
43 3 2 0 0 7 3 SCIENTIA SILVAE SINICAE Vol143, No13 Mar., 2 0 0 7 a/ b 3 1 1 2 1 (1. 100102 ; 2. 100091) : RT2PCR RACE a/ b cdna, cab2 BO1 ( GenBank : EF061137) 1 102 bp, 64 861 bp 1, 265 cab2bo1 64 232
Διαβάστε περισσότεραStudy on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene
2001, 24 (1) : 2529 Journal of Nanjing Agricultural University rolc (, 210095) :, rolc ( Nicotiana tabacum ), GUS, PCR Southern rolc,, rolc : ; ; rolc ; : S572103513 : A : 1000Ο2030 (2001) 01Ο0025Ο05 Study
Διαβάστε περισσότεραArchive of SID. نشانمند كردن ژنه يا برگرداننده باروري بوسيله تجزيه كلاس مغلوب در برنج چكيده مقدمه
نشانمند كردن ژنه يا برگرداننده باروري بوسيله تجزيه كلاس مغلوب در برنج (-), 4 3 2 1 ياراحمدي محمد مهدي سوهاني * ابوبكر جوهرعلي بابك ربيعي (// : -// : ) سعيد و ع يل 5 اكبر عبادي چكيده WA. IR42686R IR58025A
Διαβάστε περισσότεραAus dem Institut für Pflanzenzüchtung und Pflanzenschutz
Aus dem Institut für Pflanzenzüchtung und Pflanzenschutz Advanced Backcross QTL analysis and genetic study of an introgressed powdery-mildew resistance gene derived from Avena macrostachya in oat (Avena
Διαβάστε περισσότεραBasic & Clinical Medicine PLGA MUC1 MUC1 IC 50 MUC1 +
2011 7 31 7 1001-6325 2011 07-0751 -05 July 2011 Vol. 31 No. 7 MUC1 1 1 1 2 1 1* 1. 100005 2. 100190 MUC1 PLGA MUC1 MUC1 MUC1 MCF-7 HepG2 MTS IC 50 MUC1 225. 3 ± 9. 2 nm 83. 6% ± 1. 7% MUC1 + MCF-7 P
Διαβάστε περισσότεραcm cm 92. 0% DH S 917
34 9 2010 9 JOURNAL OF FISHERIES OF CHINA Vol. 34 No. 9 Sep. 2010 1000-0615 2010 09-1354 - 09 DOI 10. 3724 /SP. J. 1231. 2010. 06963 1 2 2 2 2 1* 1. 361005 2. 361021 157 DH 24 SRAP 16 SSR 224 157 124 SRAP
Διαβάστε περισσότεραCorV CVAC. CorV TU317. 1
30 8 JOURNAL OF VIBRATION AND SHOCK Vol. 30 No. 8 2011 1 2 1 2 2 1. 100044 2. 361005 TU317. 1 A Structural damage detection method based on correlation function analysis of vibration measurement data LEI
Διαβάστε περισσότεραPACS: Pj, Gg
* 1)2) 2) 3) 2) 1) 1) (, 310023 ) 2) (, 315211 ) 3) (, 510006 ) ( 2011 6 16 ; 2011 10 31 ),..,,.,.,. :,,, PACS: 07.05.Pj, 05.45.Gg 1,.,, [1,2].,,, [3,4].,, [5,6].,. [7 9]., [10 17].,.,, [10]., [18 20],
Διαβάστε περισσότεραProgress in Plant Resistance Induced by Salicylic Acid
5 3 ( ) Vol 5 No 3(Suppl ) 2 0 0 1 11 Life Science Research Nov 2001 Ξ ( 361005) :, : ; ; :Q954 :A :1007-7847(2001) S0-0185 - 05 Progress in Plant Resistance Induced by Salicylic Acid ZHANG Chun2guang,J
Διαβάστε περισσότεραJournal of Ningxia Medical University. Annexin P19 mrna P < AnnexinA2 P19 mrna. AnnexinA2 P19 mrna. PCR 1.
33 6 2011 6 Journal of Ningxia Medical University 511 1674-6309 2011 06-0511 - 04 AnnexinA2 P19 1 2 3 3 3 1. 415700 2. 750004 3. 750004 AnnexinA2 P19 62 IHC RT - PCR Western blot AnnexinA2P19 mrna AnnexinA2
Διαβάστε περισσότεραTABLE OF CONTENTS Page
TABLE OF CONTENTS Page Acknowledgements... VI Declaration... VII List of abbreviations... VIII 1. INTRODUCTION... 1 2. BASIC PRINCIPLES... 3 2.1. Hereditary Colorectal Cancer... 3 2.1.1. Differential diagnosis...
Διαβάστε περισσότερα[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,
in vitro αα In Vitro α-glucosidase and α-amylase Inhibitory Effects of Herbal Tea Leaves from Yacon (Smallanthus sonchifolius) 1, 1, 1, 2, 1, 2, 3, 1, 2, 1, 2, 1, 2, 1, 2 1, 2, *, 1 2, 3 Yuto Ueda 1, Shintaro
Διαβάστε περισσότερα6 T-DNA PCR TAIL-PCR T-DNA. 69% 30% T-DNA left border LB right border RB T-DNA A T-DNA
Research Paper Acta Microbiologica Sinica 51 2 203-207 4 February 2011 ISSN 0001-6209 CN 11-1995 / Q http / / journals. im. ac. cn / actamicrocn Botrytis cinerea T-DNA * 310014 Botrytis cinerea T-DNA Agrobactirium
Διαβάστε περισσότεραIdentification of Fish Species using DNA Method
5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,
Διαβάστε περισσότερα30s 56 60s 72 60s dntp cm s s s 23
31 3 Vol 31 No 3 2012 8 JOURNAL OF OCEANOGRAPHY IN TAIWAN STRAIT Aug 2012 AFLP 1 1 2 1 1 361005 2 361005 dntp Taq Mg 2 + 300 ng DNA 5U PstI 5U MseI 4 h 16 10 50 AFLP AFLP 64 12 AFLP DOI 10 3969 /J ISSN
Διαβάστε περισσότεραΜελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού
Σχολή Θετικών Επιστημών Τμήμα Βιολογίας Πρόγραμμα Μεταπτυχιακών Σπουδών Κατεύθυνση: Εφαρμοσμένη γενετική και βιοτεχνολογία ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου
Διαβάστε περισσότεραIL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2
344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.
Διαβάστε περισσότεραInferring regulatory subnetworks through the analysis of genome-wide expression profiles
NATIONAL AND KAPODISTRIAN UNIVERSITY OF ATHENS SCHOOL OF SCIENCE DEPARTMENT OF INFORMATICS AND TELECOMMUNICATIONS POSTGRADUATE PROGRAM "INFORMATION TECHNOLOGIES IN MEDICINE AND BIOLOGY" MASTER S THESIS
Διαβάστε περισσότεραProgress in breeding techniques of ornamental plants
2003,32(2):64-68. 650091 S603.6 A 1009-7791(2003)02-0064-05 Progress in breeding techniques of ornamental plants LIU Xiao-li, LIU Fei-hu (College of Life Science, Yunnan University, Kunming 650091, Yunnan
Διαβάστε περισσότεραApr Vol.26 No.2. Pure and Applied Mathematics O157.5 A (2010) (d(u)d(v)) α, 1, (1969-),,.
2010 4 26 2 Pure and Applied Matheatics Apr. 2010 Vol.26 No.2 Randić 1, 2 (1., 352100; 2., 361005) G Randić 0 R α (G) = v V (G) d(v)α, d(v) G v,α. R α,, R α. ; Randić ; O157.5 A 1008-5513(2010)02-0339-06
Διαβάστε περισσότεραJournal of the CUN(Natural Sciences Edition) ...
2007 2 16 1 ( ) Journal of the CUN(Natural Sciences Edition) Feb. 2007 Vol. 16 No. 1 1,2, 1, 1, 2 (11, 100081 ; 21, 100875) :. 2,42D NAA 62BA.,.. : ; ; ; :Q94513 :A :100528036 (2007) 0120023206 : (1),
Διαβάστε περισσότεραADVANCES IN RICE BREEDING FOR THE FUNCTIONAL COMPONENTS
364 2004,18 (5) :364 367 Acta Agriculturae Nucleatae Sinica :100028551 (2004) 052364204 1 2 1 2 1,2 3 (1., 310029 ; 2., 310006) :, 2, : ; ; ADVANCES IN RICE BREEDING FOR THE FUNCTIONAL COMPONENTS HU Fan2rong
Διαβάστε περισσότερα( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;
28 1 2006 1 RESOURCES SCIENCE Vol. 28 No. 1 Jan. 2006 :1007-7588(2006) 01-0002 - 07 20 1 1 2 (11 100101 ; 21 101149) : 1978 1978 2001 ; 2010 ; ; ; : ; ; 24718kg 1) 1990 26211kg 260kg 1995 2001 238kg( 1)
Διαβάστε περισσότεραCellular Physiology and Biochemistry
Original Paper 2016 The Author(s). 2016 Published The Author(s) by S. Karger AG, Basel Published online: November 25, 2016 www.karger.com/cpb Published by S. Karger AG, Basel 486 www.karger.com/cpb Accepted:
Διαβάστε περισσότεραSOD SNP % Cu /Zn-SOD. DAM- BE DNAStar % Mn /Fe-SOD. 6 1SNP /17. 9 bp
2011 33 6 1206-1211 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com SOD SNP 1 2 3 2 2* 1. 330004 2. 330004 3. 510006 GenBank Cu /Zn-SOD Mn /Fe-SOD
Διαβάστε περισσότεραMotion analysis and simulation of a stratospheric airship
32 11 Vol 32 11 2011 11 Journal of Harbin Engineering University Nov 2011 doi 10 3969 /j issn 1006-7043 2011 11 019 410073 3 2 V274 A 1006-7043 2011 11-1501-08 Motion analysis and simulation of a stratospheric
Διαβάστε περισσότερα, DYY-8B, ; : Centrifuge 11 R. min
40 Chinese Journal of Otology Vol. 8 No.1 2010 DNA A1555G - ( 030001) 2 12 68 DNA (polymerase chain reaction PCR) DNA A1555G 7 DNA 12S rrna 1555 A G A1555G ; DNA A1555G ; ; ; R764.433 R342.4 A 1672-2922(2010)01-040-06
Διαβάστε περισσότεραJ. Dairy Sci. 93: doi: /jds American Dairy Science Association, 2010.
Supplementary Table 1. Primers and PCR conditions used for the amplification of the goat SCD1 cdna (PCR1 to PCR6) and three SCD1 polymorphic regions (PCR7 to PCR9) PCR Primers Sequence Position 1 Thermal
Διαβάστε περισσότερα, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells
2011 9 1 77 SLC26A4 HEK 293 1 2 1 1 1 1 (100853) 2 ( 050051) SLC26A4 (pegfp enhanced green fluorescent protein) SLC26A4 pegfp-slc26a4 HEK293 pegfp-slc26a4 HEK293 - (RT-PCR) SLC26A4 mrna Western Blot (
Διαβάστε περισσότεραExtract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica
35 1 2 0 1 7 1 DOI 10. 13193 /j. issn. 1673-7717. 2017. 01. 035 1 1 1 1 2 1. 150036 2. 150040 D101 DEAE Cellulose 52 Sephacryl S - 300 - - PJP - 1a PJP - 3a 1. 34 10 3 Da 1. 70 10 7 Da - PJP - 3a 4. 56
Διαβάστε περισσότεραDownloaded from jcpp.iut.ac.ir at 8:11 IRDT on Thursday July 12th 2018
/ () / / (b a ) * (/ : / : ).. b a..... / /. Pinb-D1e. Pinb-D1c... :.() (Matrix)..( ). (Triticum aestivum).(). fshahria@yahoo.com.au : : * / () / /.() () b a..( ) Pinb-D1d Pinb-D1c Pinb-D1e ().( )...(
Διαβάστε περισσότεραΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΤΕΧΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ. Πτυχιακή εργασία
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΤΕΧΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ Πτυχιακή εργασία ΥΔΡΟΠΟΝΙΚΗ ΚΑΛΛΙΕΡΓΕΙΑ ΔΥΟΣΜΟΥ ΣΕ ΔΙΑΦΟΡΕΤΙΚΑ ΘΡΕΠΤΙΚΑ ΔΙΑΛΥΜΑΤΑ ΕΡΑΤΩ ΝΙΚΟΛΑΪΔΟΥ Λεμεσός 2014
Διαβάστε περισσότεραApproximation Expressions for the Temperature Integral
20 7Π8 2008 8 PROGRSS IN CHMISRY Vol. 20 No. 7Π8 Aug., 2008 3 3 3 3 3 ( 230026),,,, : O64311 ; O64213 : A : 10052281X(2008) 07Π821015206 Approimation pressions for the emperature Integral Chen Haiiang
Διαβάστε περισσότεραα 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN
BIOTECHNOLOGY BULLETIN 2011 3 α 1 2-300457 PCR Helicobacter pylori HP DNA α 1 2- α 1 2-fucosyltransferase α 1 2-fuct 906 bp pet-22b + pet-fuct BL21 DE3 25 0. 1 mmol /L IPTG 4 h SDS-PAGE 33 kd α 1 2- BL21
Διαβάστε περισσότεραChalkou I. C. [PROJECT] Ανάθεση εργασιών.
Πληροφορική της Υγείας 2014 Chalkou I. C. [PROJECT] Ανάθεση εργασιών. Περιεχόμενα 1. Ομάδα ΣΤ... 3 1.1 ΜΑΡΚΟΠΟΥΛΟΥ- ΣΠΥΡΟΠΟΥΛΟΥ -ΚΩΝΣΤΑΝΤΟΠΟΥΛΟΥ... 3 1.2 ΜΑΡΚΟΣ- ΚΟΥΤΣΟΠΟΥΛΟΣ ΑΥΓΕΡΗ - ΜΠΟΥΖΑΛΑ... 3 1.3
Διαβάστε περισσότεραQuick algorithm f or computing core attribute
24 5 Vol. 24 No. 5 Cont rol an d Decision 2009 5 May 2009 : 100120920 (2009) 0520738205 1a, 2, 1b (1. a., b., 239012 ; 2., 230039) :,,.,.,. : ; ; ; : TP181 : A Quick algorithm f or computing core attribute
Διαβάστε περισσότεραJournal of Ningxia Medical University BRCA2. M2610I 2405 delt stp ± t = P > %
33 6 2011 6 Journal of Ningxia Medical University 515 1674-6309 2011 06-0515 - 04 16 BRCA2 1 2 2 1 3 1. 750004 2. 750021 3. 750004 16-2 BRCA2 16 16 30 PCR BRCA2 16 3 18. 75% 2 M2610I 2405 delt stp729 1
Διαβάστε περισσότεραAbstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...
III Contents I II III Abstract... I Zusammenfassung... II Contents... III 1 Aim of the work... 1 2 Introduction... 2 2.1 Short overview of Chinese hamster ovary cell lines... 2 2.2 Unspecific mutations:
Διαβάστε περισσότεραTrace gas emissions from soil ecosystems and their implications in the atmospheric environment
J. Jpn. Soc. Soil Phys. No. 3., p.,+ -+,**- * Trace gas emissions from soil ecosystems and their implications in the atmospheric environment Kazuyuki YAGI* * National Institute for Agro-Environmental Science,
Διαβάστε περισσότεραStudies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin
2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,
Διαβάστε περισσότεραEvolution of Novel Studies on Thermofluid Dynamics with Combustion
MEMOIRS OF SHONAN INSTITUTE OF TECHNOLOGY Vol. 42, No. 1, 2008 * Evolution of Novel Studies on Thermofluid Dynamics with Combustion Hiroyuki SATO* This paper mentions the recent development of combustion
Διαβάστε περισσότεραHigh mobility group 1 HMG1
Vol. 29, pp.705 ~ 711, 2001 High mobility group 1 HMG1 13 12 20 anti-neutrophil cytoplasmic antibodies, ANCA ANCA 1982 Davies 1980 1 high mobility group HMG1 HMG2 30 kd high mobility group HMGHMG HMG1
Διαβάστε περισσότεραResistance monitoring and target gene cloning of Bemisia tabaci Q-biotype from Jiangsu Province
Chinese Journal of Applied Entomology 2011 48 1 48 53 * Q 1 2 1 1 2 1 1. 225009 2. 100081 3 Q Bemisia tabaci Gennadius 5 Q RCR 287 bp 184 bp ace1 para- Q F331W L925I T929V Resistance monitoring and target
Διαβάστε περισσότεραScreening of Respiration-deficient Saccharomyces cerevisiae Strains with Sugar-and Thermo-tolerances
3 3 Vol3 No3 3 9 Life Science Research June 9 *,,, 535 :, 3, 5- (TTC), 3,, T,, ; (5~5 μ 375~5 μ),, 5% (W/V), 55,, 55% 9% : ; ; ; ; :Q39 + :A :7-77(9)3-99-5 Screening of Respiration-deficient Saccharomyces
Διαβάστε περισσότεραStudies on Cold Tolerance of Rice, Oryza sativa L.
29 5 2003 9 708 714 ACTA AGRONOMICA SINICA Vol. 29, No. 5 pp. 708 714 Sept., 2003. 1,2 2 1 3 3 1 1 2 Ξ ( 1, 650205 ; 2, 430070 ; 3, 06228555, ) F 2, 159 RFLP SSR STATISTIC, ( r) 0. 8364 ; ( ) 43, 8 11
Διαβάστε περισσότεραCPT. Tsuchiya. beta. quantitative RT PCR QIAGEN IGFBP. Fect Transfection Reagent sirna. RT PCR RNA Affymetrix GeneChip Expression Array
7 PTEN p Tsuchiya DNA Hepatocyte nuclear factor beta HNF beta HNFbeta IGFBP GLUT G Pase MODY maturity onset diabetes of the young Tsuchiya HNFbeta HNFbeta HNFbeta sirna CPT HNFbeta HNFbeta TOVG KOC ESMCAS
Διαβάστε περισσότεραSalmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to facilitate intracellular survival Hongwei Gu 1,2*, Chihao Zhao 1,2*, Tianfu Zhang 1,2*, Hongwei Liang 1,2, Xiao-Ming Wang 1,
Διαβάστε περισσότερα,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78
ISSN 100727626 CN 1123870ΠQ 2002 4 Chinese Journal of Biochemistry and Molecular Biology 18 (2) :245 249 HLA2B2704 3 2) ( 2) 100044) HLA2B2704 286 HLA2B2704 DNA ( HLA2B2704 DNA) PCR F0 F1 RT2PCR HLA2B2704
Διαβάστε περισσότεραΗ συμβολή της μοριακής εργαστηριακής διάγνωσης στην κλινική πράξη Α ΠΑΠΑΔΟΠΟΥΛΟΥ ΕΔΙΠ, ΙΑΤΡΙΚΗΣ ΣΧΟΛΗΣ ΕΚΠΑ
Η συμβολή της μοριακής εργαστηριακής διάγνωσης στην κλινική πράξη Α ΠΑΠΑΔΟΠΟΥΛΟΥ ΕΔΙΠ, ΙΑΤΡΙΚΗΣ ΣΧΟΛΗΣ ΕΚΠΑ Δηλώνω ότι δεν έχω σύγκρουση συμφερόντων Χαρτογράφηση του ανθρώπινου γονιδιώματος- Ημερομηνίες
Διαβάστε περισσότεραGateway cdna. cdna. pdest TM ~ cfu/ ml ~ cfu bp
2010 32 4 0791-0796 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com Gateway cdna * * 350002 cdna cdna Gateway RNA mrna 3 cdna BP LR cdna pdest TM
Διαβάστε περισσότεραDiagnosing X-linked Ichthyosis by Monoplast Single-round Duplex PCR
13 4 Vol13 No4 2009 8 Life Science Research Aug 2009 2009 PCR X- *,,,,,,,, 410078 : X- (X-linked ichthyosis, XLI), XLI, XLI (preimplantation genetic diagnosis, PGD) PCR amelogenin (Amel), 958% 909%, 15%;
Διαβάστε περισσότεραGro wth Properties of Typical Water Bloom Algae in Reclaimed Water
31 1 2010 1 ENVIRONMENTAL SCIENCE Vol. 31,No. 1 Jan.,2010, 3, (,, 100084) :,.,, ( Microcystis aeruginosa),3 (A 2 O ) 10 6 ml - 1,> 0139 d - 1. A 2 O222,. TP ( K max ) ( R max ), Monod. :; ; ; ; :X173 :A
Διαβάστε περισσότεραhttp / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology human telomerase reverse transcriptase htert
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2013 4 29 4 383 ~ 388 PCR htert mrna 1 2 2 3 1 1 2 2 1 1 530021 2 530021 3 * 3 530021 human
Διαβάστε περισσότεραRapid Raman spectra identification and determination of levofloxacin hydrochloride injection *
DOI:0.655/j.0254-793.20.09.039 75 * 2 2 3. 200435 2. 20203 3. 20000 ph R97 A 0254-793 20 09-75 - 05 Rapid Raman spectra identification and determination of levofloxacin hydrochloride injection * CHEN Bin
Διαβάστε περισσότεραΊδρυμα Τεχνολογίας & Έρευνας (ΙΤΕ)
Ίδρυμα Τεχνολογίας & Έρευνας (ΙΤΕ) Ινστιτούτο Μοριακής Βιολογίας & Βιοτεχνολογίας (IMBB) Ηράκλειο, Κρήτη Σύντομη Ιστορία του ΙΜΒΒ Ιδρύθηκε το 1983 Ένα από τα Ινστιτούτα του Ερευνητικού Κέντρου Κρήτης (ΕΚΕΚ)
Διαβάστε περισσότεραSVM. Research on ERPs feature extraction and classification
39 1 2011 2 Journal of Fuzhou University Natural Science Edition Vol 39 No 1 Feb 2011 DOI CNKI 35-1117 /N 20110121 1723 008 1000-2243 2011 01-0054 - 06 ERPs 350108 - ERPs SVM ERPs SVM 90% ERPs SVM TP391
Διαβάστε περισσότεραER-Tree (Extended R*-Tree)
1-9825/22/13(4)768-6 22 Journal of Software Vol13, No4 1, 1, 2, 1 1, 1 (, 2327) 2 (, 3127) E-mail xhzhou@ustceducn,,,,,,, 1, TP311 A,,,, Elias s Rivest,Cleary Arya Mount [1] O(2 d ) Arya Mount [1] Friedman,Bentley
Διαβάστε περισσότεραA research on the influence of dummy activity on float in an AOA network and its amendments
2008 6 6 :100026788 (2008) 0620106209,, (, 102206) : NP2hard,,..,.,,.,.,. :,,,, : TB11411 : A A research on the influence of dummy activity on float in an AOA network and its amendments WANG Qiang, LI
Διαβάστε περισσότεραX,60. Umiel,, Griesbach,, China Academic Journal Electronic Publishing House. All rights reserved ,Vol. 22,No.
2002,Vol. 22,No. 2 3 ( 100101 ),,,,,,, ( ), 60 Co 1 111,,,, [1 ],,,,,, Umiel,,,, 11312, [2 ] Griesbach,,, F 2 [3 ] DNA 112,,, 2,, -, [4 ] 3 :,,, 113 11311 X,60 80, :,,,, ;,,, 81 ,,,,, [1 ],,, : [5 8 ]
Διαβάστε περισσότεραD-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical and experimental study
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical
Διαβάστε περισσότεραsvari Real-time RT-PCR RSV
19 39-43 12 Real-time RS svarireal-time RSV subgroup HMPV RSV N Real-time 100 100 Real-time RSV subgroup RSV HMPV F Real-time 55.8 95.5 genotype A2 B1 TaqMan svari InfV RS RSV HMPV HRV PIV RSV HMPV RSV
Διαβάστε περισσότεραDNA G7444A, 2. Study on a new point mutation of nt7444 G A in the mitochondrial DNA in a type 2 diabetes mellitus family
HEREDITAS (Beijing) 2007 4, 29(4): 433 437 ISSN 0253-9772 www.chinagene.cn DOI: 10.1360/yc-007-0433 2 DNA G7444A,,,,,,,, 350005 : PCR-RFLP 2 DNA G7444A,, 27, 11 DNA G7444A, 11 2 5, 1,, DNA G7444A, 2 :
Διαβάστε περισσότεραStudy on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
33 2 2011 4 Vol. 33 No. 2 Apr. 2011 1002-8412 2011 02-0096-08 1 1 1 2 3 1. 361005 3. 361004 361005 2. 30 TU746. 3 A Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
Διαβάστε περισσότεραΝόσος Parkinson-Νέοι ορίζοντες Ξηροµερήσιου Γεωργία Νευρολόγος-Μέλος ερευνητικής οµάδας Νευρογενετικής Αίτια της νόσου Parkinson Περιβαλλοντικοί παράγοντες Γενετικοί παράγοντες Γενετική βλάβη (παθογόνα
Διαβάστε περισσότεραth International Conference on Machine Learning and Applications. E d. h. U h h b w k. b b f d h b f. h w k by v y
212 11th International Conference on Machine Learning and Applications C b G E P fi d P P I f Id fy F M d D d W, M O h, E Z,T L C f C S, U v y f M, C G b, FL 33146, USA E : d.w 1@. d, h @.. d D f C S d
Διαβάστε περισσότεραPACS: Ox, Cw, a, TP
* (, 210046 ) ( 2011 12 30 ; 2012 4 27 ),.,., ; ;.,,. :,, PACS: 02.10.Ox, 02.50.Cw, 05.40. a, 07.05.TP 1 ().,.,,,, s d. [1]., [2,3],,,.,,.,,,.,,,., [4 6].,, 1. A. 40 110 S E N(42,2 2 ) D N(63,3 2 ) B:70
Διαβάστε περισσότερα(Synesthesia) (B) 22-25
(Synesthesia) 18 1993 10 (B) 22-25 10 50 1. Root, N. B., Rouw, R., Asano, M., Kim, C-Y., Melero, H., Yokosawa, K., & Ramachandran, V. S.(2018). Why is the synesthete's "A" red? Using a five-language dataset
Διαβάστε περισσότεραΜΕΛΕΤΗ ΣΥΜΠΕΡΙΦΟΡΑΣ ΦΛΟΓΩΝ ΠΡΟΠΑΝΙΟΥ ΣΤΑΘΕΡΟΠΟΙΗΜΕΝΩΝ ΣΕ ΕΠΙΠΕΔΟ ΣΩΜΑ ΜΕ ΔΙΑΣΤΡΩΜΑΤΩΜΕΝΗ ΕΙΣΑΓΩΓΗ ΜΙΓΜΑΤΟΣ
ΜΕΛΕΤΗ ΣΥΜΠΕΡΙΦΟΡΑΣ ΦΛΟΓΩΝ ΠΡΟΠΑΝΙΟΥ ΣΤΑΘΕΡΟΠΟΙΗΜΕΝΩΝ ΣΕ ΕΠΙΠΕΔΟ ΣΩΜΑ ΜΕ ΔΙΑΣΤΡΩΜΑΤΩΜΕΝΗ ΕΙΣΑΓΩΓΗ ΜΙΓΜΑΤΟΣ Ειδική Ερευνητική Εργασία Υποβληθείσα στο Τμήμα Φυσικής του Πανεπιστημίου Πατρών Υπό ΤΣΙΡΩΝΗ ΓΕΩΡΓΙΟ
Διαβάστε περισσότεραEvaluation of Resistance to Scab in Pear Germplasms
2012 13 4 571-576 Journal of Plant Genetic Resources / 125100 197 Evaluation of Resistance to Scab in Pear Germplasms DONG Xing-guangTIAN Lu-mingCAO Yu-fen Research Institute of PomologyChinese Academy
Διαβάστε περισσότερα( HN2y Co14 Co8 Co36 Sx (2) 56 (2) ) 16S
16S23S rrna 197 16S23S rrna (, 100050) : 16S23S rrna,, 2, 16S23S rrna,3 3 (ATCC10248 NCPPB 947 NCPPB3580) 1 B. phenazinium (LMG2247) 8 ( HN2y Co14 Co8 Co36 Sx8801 90-3 56 (2) 56 (2) ) 16S 23S rrna,( GenBank)
Διαβάστε περισσότεραTHE GENETIC TRANSFORMATION OF STRAWBERRY WITH WINTER FLOUNDER ANTIFREEZE PROTEIN GENE
2009,23 (3) :423 428 Journal of Nuclear Agricultural Sciences 423 :100028551 (2009) 032423206 1 2 1 3 3 1 4 (11, 010031 ;21, 010021 ; 31, 010010 ;41, 010070) : 2, pre pro mature 3 (AFP), 7 Km PCR PCR2Southern,6,,
Διαβάστε περισσότεραDigesting Plasmid DNA with Restriction Endonuclease s under the Condition of Microwave-heating
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2012 4 28 4 380 ~ 384-1 2 1 1 1 * 1 310021 2 210095 2 min DNA 2 min Q78 Digesting Plasmid
Διαβάστε περισσότεραVarietal Differences in Response of Main Root Traits to Nitrogen Application Time in Rice ( Oryza sativa L. )
29 6 2003 11 871 877 ACTA AGRONOMICA SINICA Vol. 29, No. 6 pp. 871 877 Nov., 2003 3 Ξ ( 225009) 8 6 63, 4 : (1) ; (2) N N, N ; (3), ; (4) ; (5) ; ; N : S511 ;S365 : A Varietal Differences in Response of
Διαβάστε περισσότεραJ. of Math. (PRC) Banach, , X = N(T ) R(T + ), Y = R(T ) N(T + ). Vol. 37 ( 2017 ) No. 5
Vol. 37 ( 2017 ) No. 5 J. of Math. (PRC) 1,2, 1, 1 (1., 225002) (2., 225009) :. I +AT +, T + = T + (I +AT + ) 1, T +. Banach Hilbert Moore-Penrose.. : ; ; Moore-Penrose ; ; MR(2010) : 47L05; 46A32 : O177.2
Διαβάστε περισσότεραSupporting Information. Enhanced energy storage density and high efficiency of lead-free
Supporting Information Enhanced energy storage density and high efficiency of lead-free CaTiO 3 -BiScO 3 dielectric ceramics Bingcheng Luo 1, Xiaohui Wang 1*, Enke Tian 2, Hongzhou Song 3, Hongxian Wang
Διαβάστε περισσότεραBuried Markov Model Pairwise
Buried Markov Model 1 2 2 HMM Buried Markov Model J. Bilmes Buried Markov Model Pairwise 0.6 0.6 1.3 Structuring Model for Speech Recognition using Buried Markov Model Takayuki Yamamoto, 1 Tetsuya Takiguchi
Διαβάστε περισσότεραΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ Ν.Κ. ΜΟΣΧΟΝΑ (Νοεμβριος 2013)
ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ Ν.Κ. ΜΟΣΧΟΝΑ (Νοεμβριος 2013) 1. ΑΤΟΜΙΚΑ ΣΤΟΙΧΕΙΑ Όνομα: Νικόλαος Κ. Μοσχονάς Ημερομηνία Γεννήσεως: 21 Νοεμβρίου 1952 Οικογενειακή Κατάσταση: Έγγαμος, δύο παιδία 2. ΣΠΟΥΔΕΣ 1979-1981:
Διαβάστε περισσότεραTGFp FSH INH INH
(210095) E-mail ( genlinwang@hotmail.com) - -(Strept Avidin-Biotin-Peroxidase Complex SABC), 1 32,, 1 inhibin INH α 32 000 TGFp FSH FSH [1] INHα Sertoli Noguchi 1997 [2] Meunier et al.1988 [3] INH INH
Διαβάστε περισσότεραΒάσεις δεδομένων χαρτογράφησης γονιδιωμάτων
Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Vasilis Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus http://en.wikipedia.org/wiki/image:cyprus_topo.png
Διαβάστε περισσότεραDevelopment of a Seismic Data Analysis System for a Short-term Training for Researchers from Developing Countries
No. 2 3+/,**, Technical Research Report, Earthquake Research Institute, University of Tokyo, No. 2, pp.3+/,,**,. * * Development of a Seismic Data Analysis System for a Short-term Training for Researchers
Διαβάστε περισσότεραResearch on Economics and Management
36 5 2015 5 Research on Economics and Management Vol. 36 No. 5 May 2015 490 490 F323. 9 A DOI:10.13502/j.cnki.issn1000-7636.2015.05.007 1000-7636 2015 05-0052 - 10 2008 836 70% 1. 2 2010 1 2 3 2015-03
Διαβάστε περισσότερα17 min R A (2009) To probe into the thermal property the mechanism of the thermal decomposition and the prospective
( 31001) (CDZ)CDZCDZ GAMSSCDZCDZ (DSC)CDZCDZ (G) DakinCDZ 1 1 CDZ a =173.9 kj mol min -1 CDZ 17 min A=.69 10 A=1.175 10 17 R97.14A1007-7693(009)1-1019-05 a =17.3 kj mol 1 Mechanism and Kinetics of hermal
Διαβάστε περισσότεραrp, ribosomal protein 60S rp mrna rpl30 rps14 RT-PCR mrna nonsense-mediated mrna decay smg-2 smg-2 mrna rp rpl-1 rpl-1
rp, ribosomal protein 60S 47 rpl 40S 32 rps rp mrna rpl30 rps14 rpl12 rpl3 rps13 rp mrna nonsense-mediated mrna decay (NMD) C. elegans smg-2 smg-2 mrna 50 rp 7 rp 4 rpl 4 rp NMD mrna 6 rp mrna rp mrna
Διαβάστε περισσότεραΙνσουλίνη και καρδιά. Ηλιάδης Φώτης Λέκτορας Α.Π.Θ.
Ινσουλίνη και καρδιά Ηλιάδης Φώτης Λέκτορας Α.Π.Θ. Επίδραση ινσουλίνης στο ήπαρ, στους μυς και στον λιπώδη ιστό : Διατήρηση ευγλυκαιμίας Nature 2001;414:799 806 Ινσουλίνη? Λειτουργικότητα Μορφολογία Βιωσιμότητα
Διαβάστε περισσότεραStudies on nuclear phase and genetic attribute of the basidiospores of Flammulina velutipes
263369~3752007 Mycosystema 1 430070 2 273155 3 80.2%7.5% 12.3% RAPD 10 4 4 RAPD Q939.5 A1672-6472200703-0369-0375 Studies on nuclear phase and genetic attribute of the basidiospores of Flammulina velutipes
Διαβάστε περισσότεραPrey-Taxis Holling-Tanner
Vol. 28 ( 2018 ) No. 1 J. of Math. (PRC) Prey-Taxis Holling-Tanner, (, 730070) : prey-taxis Holling-Tanner.,,.. : Holling-Tanner ; prey-taxis; ; MR(2010) : 35B32; 35B36 : O175.26 : A : 0255-7797(2018)01-0140-07
Διαβάστε περισσότεραACTA MATHEMATICAE APPLICATAE SINICA Nov., ( µ ) ( (
35 Þ 6 Ð Å Vol. 35 No. 6 2012 11 ACTA MATHEMATICAE APPLICATAE SINICA Nov., 2012 È ÄÎ Ç ÓÑ ( µ 266590) (E-mail: jgzhu980@yahoo.com.cn) Ð ( Æ (Í ), µ 266555) (E-mail: bbhao981@yahoo.com.cn) Þ» ½ α- Ð Æ Ä
Διαβάστε περισσότεραA Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn
56 [ ] 167-3619(009)03-056-05 Journal of Tropical Medicine Vol.9 No.3 Mar.009 * ( 510515) (PCT) CNKI VIP PCT QUADAS Metadisc1.4 DOR (SROC) SROC (AUC) Review Manager5 Meta 8 ; 7 8 (χ =3.8P=0.858I =0.0%)
Διαβάστε περισσότεραFifty years of amphioxus study in China
20 1 2008 2 Chinese Bulletin of Life Sciences Vol. 20, No. 1 Feb., 2008 1004-0374(2008)01-0064-05 50, 266003 50, Q959.287A Fifty years of amphioxus study in China ZHANG Shi-cui*, GUO Bin, LIANG Yu-jun
Διαβάστε περισσότεραMedicago marina 2012
ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ Τµήµα Γεωπονικής Βιοτεχνολογίας ΣΚΑΓΙΑ. ΑΓΓΕΛΙΚΗ ΜΕΤΑΠΤΥΧΙΑΚΗ ΙΑΤΡΙΒΗ Χαρακτηρισµός και Φυλογενετική ανάλυση συµβιωτικών βακτηρίων που αποµονώθηκαν από τα φυµάτια της Medicago
Διαβάστε περισσότεραIntroduction to Bioinformatics
Introduction to Bioinformatics 260.602.01 September 2, 2005 Jonathan Pevsner, Ph.D. pevsner@jhmi.edu bioinformatics medical informatics Tool-users public health informatics databases algorithms Tool-makers
Διαβάστε περισσότεραACTA SCIENTIAE CIRCUMSTANTIAE. 16S rrna PNAN5 ( Rhodococcus sp. strain PNAN5). 20. ( Institute of Microbiology, Chinese Academy of Sciences,
24 3 2004 5 ACTA SCIENTIAE CIRCUMSTANTIAE Vol. 24,No. 3 May,2004 :025322468 (2004) 0320482205 :X523 :A PNAN5 ( Rhodococcus sp. strain PNAN5),,, 3 (, 100080) :, 16S rrna PNAN5 ( Rhodococcus sp. strain PNAN5).
Διαβάστε περισσότεραΕκδίδεται μία φορά το χρόνο από το:
Εκδίδεται μία φορά το χρόνο από το: Τμήμα Πληροφορικής και Τηλεπικοινωνιών Εθνικό και Καποδιστριακό Πανεπιστήμιο Αθηνών, Πανεπιστημιούπολη, 15784 Αθήνα Τηλ: 210-727 5190, Φαξ: 210-727 5333 email: library@di.uoa.gr,
Διαβάστε περισσότεραIdentification of Salmonella,Campylobacter jejuni and Enterohemorrhagic E.coli by Denaturing High-performance Liquid Chromatography
BIOTECHNOLOGY BULLETIN 2009 3 116015 PCR multiplex PCR mpcr denaturing high-performance liquid chromatography DHPLC O157 H7 fimy gyra O157 H7 rfbe 3 O157 H7 PCR 284 159 499 bp PCR O157 H7 1.5 CFU/ ml 15
Διαβάστε περισσότεραCBF1. Study on CBF1 Gene Transferred from Transgenic Strawberry to Nontransgenic
2007 5 3 309 313 Molecular Plant Breeding, 2007, Vol.5, No.3, 309 313 Research Report CBF1 1,3 2 1 3 1 1* 1,, 100093; 2,, 1000871; 3,, 010019 *, jinwanmei@sohu.com CBF1 PCR 640 bpcbf1 20 16 2CBF1, CBF1,,
Διαβάστε περισσότεραRAPD. ( B rassica rapa) RFL P ( Restriction Fragment Length Polymorphism) RFL P ; RFL P, rapa. CHIN ESE BIODIV ERSIT Y 6 (2) :99 104, May, 1998 RAPD
6,2,1998 5 CHIN ESE BIODIV ERSIT Y 6 (2) :99104, May, 1998 Ξ RAPD 1 1 2 1 1 2 1 (, 100081) 2 (, 430062) RAPD, 34,Ward s : ; ;DNA 34 8,, RAPD Genetic diversity among Chinese oilseed accessions of Brassica
Διαβάστε περισσότεραVSC STEADY2STATE MOD EL AND ITS NONL INEAR CONTROL OF VSC2HVDC SYSTEM VSC (1. , ; 2. , )
22 1 2002 1 Vol. 22 No. 1 Jan. 2002 Proceedings of the CSEE ν 2002 Chin. Soc. for Elec. Eng. :025828013 (2002) 0120017206 VSC 1, 1 2, (1., 310027 ; 2., 250061) STEADY2STATE MOD EL AND ITS NONL INEAR CONTROL
Διαβάστε περισσότεραΒιοπληροφορική. Ενότητα 2: Βάσεις Δεδομένων (1/3), 1 ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου
Βιοπληροφορική Ενότητα 2: Βάσεις Δεδομένων (1/3), 1 ΔΩ Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου Μαθησιακοί Στόχοι Αναφορά στη χρησιμότητα των βιολογικών ΒΔ. Κατανόηση των χαρακτηριστικών, των ιδιαιτεροτήτων
Διαβάστε περισσότερα1987, 3 ; ; RNA, , 1988, van der Krol. (chalcone synthase,chs) ,,,, (antisense) 112 ( sense suppression cosuppression)
23 7 CHINA BIOTECHNOLOGY 2003 7 3 1 3 3 2 2 2 (1 510631 2 510650) 1987, 3 : (1) RNA ; (2) ; (3),,,, ; ;,,, ;,,,,,, 1 (antisense) (sense),,, 111 RNA ( antisense suppression),, DNA RNA, :2002207228 :2003205219
Διαβάστε περισσότεραΠΟΛΥΤΕΧΝΕΙΟ ΚΡΗΤΗΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΕΡΙΒΑΛΛΟΝΤΟΣ
ΠΟΛΥΤΕΧΝΕΙΟ ΚΡΗΤΗΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΕΡΙΒΑΛΛΟΝΤΟΣ Τομέας Περιβαλλοντικής Υδραυλικής και Γεωπεριβαλλοντικής Μηχανικής (III) Εργαστήριο Γεωπεριβαλλοντικής Μηχανικής TECHNICAL UNIVERSITY OF CRETE SCHOOL of
Διαβάστε περισσότερα