CBF1. Study on CBF1 Gene Transferred from Transgenic Strawberry to Nontransgenic

Transcript

1 Molecular Plant Breeding, 2007, Vol.5, No.3, Research Report CBF1 1, * 1,, ; 2,, ; 3,, *, jinwanmei@sohu.com CBF1 PCR 640 bpcbf CBF1, CBF1,, Study on CBF1 Gene Transferred from Transgenic Strawberry to Nontransgenic Strawberry Liu Yan 1,3 Hu Yuanlei 2 Dong Jing 1 Tian Zihua 3 Chen Meixiang 1 Jin Wanmei 1* 1 Institute of Forestry and Pomology, Beijing Academy of Agriculture and Forestry Sciences, Beijing, ; 2 The College of Life Science, Peking University, Beijing, ; 3 Department of Agriculture of Inner Mongolia Agricultural University, Hohhot, * Corresponding author, jinwanmei@sohu.com Abstract In order to improve strawberry Toyonoka freezing resistance, transgenic strawberry Honeoye which was studied as father and cultivar Toyonoka which was studied as mother was crossed. Results of molecular analysis by PCR confirmed that foreign gene CBF1 in transgenic strawberry Honeoye could be transferred into cultivar Toyonoka by crossing. Electrolyte leakage tests showed that electrolyte leakage ratio of transferred CBF1 gene plants was lower than control s at every low temperature. Comparaed with cultivar Toyonoka whose electrolyte leakage ratio rised obviously at 16, electrolyte leakage ratio of transferred CBF1 gene plants rised obviously at 20, and the intercellular icing temperature of transferred CBF1 gene plants is 2 lower than control s. The study showed that the expression of CBF1 gene of crossed plant increased the freezing tolerance of transgenic strawberry. Keywords Strawberry (Fragaria ananassa Duch.), CBF1gene, Gene transfer, Freezing tolerance (Fragaria ananassa Duch.) 1990 (, 2005a) (2001) (2005b) ( )

2 310 Molecular Plant Breeding (, 2002;, 2002) (, 2000,, 10(12): ) (2000,, 45(1): 11-16) CBF1 COR CBF1 (C-repeat binding factor) (, 2007) CBF CBF1 83 pbpcbf1 LBA4404 CaMV35S NPT CBF CBF1 83 ( ) 83 70% 83 1 pbpcbf1 CaMV35S CBF1 Figure 1 Diagram of binery vector pbpcbf1 with CBF1 gene 1.3 MS ph ~ min mg/l 20 mg/l 30 mg/l 40 mg/l 50 mg/l min 3 d 70% 30 s 5 min 0.1% 10 min 3 5 min 1.5 PCR CTAB DNA DNA (2002) P1 5' GAAACGACATCGAATATTAG 3' P2 5' GTACTCTAGTCAATGAACTC 3' DNA 3 μl buffer 2 μl Mg 2+ 2 μl dntp 1 μl P1 1 μl P2 1 μl Taq 0.5 μl ddh 2 O 9.5 μl 20 μl 20 μl 94 4 min 35 (92 30 s, s, s) min (Jaglo-Ottosen et al.,1998) 0.4 cm 2

3 CBF1 Study on CBF1 Gene Transferred from Transgenic Strawberry to Non- transgenic Strawberry ml min 0~4 30 min 20 ml 30 min (DDSJ 308A, 1.000) 10 min 20 ml 30 min =( / ) 100% 2.2 MS+Km 30 mg/l ( 3A) MS+IBA 0.2 mg/l+ba 0.5 mg/l ( 3B) Joglo-Ottosen (1998) d (22~25 ) Data Logger DT ( 2) 10 mg/l 20 mg/l 26% 44% 30 mg/l 40 mg/l 50 mg/l 79% 80% 96% MS+Km 30 mg/l 3 : A: 30 mg/l ; B: Figure 3 Screening of crossed strawberry generation Note: A: Screening crossed seeds in medium with 30 mg/l Km; B: Transferred plant growth 2.3 PCR CBF1 PCR 4 PCR 640 bp 0 10 mg/l 20 mg/l 30 mg/l 40 mg/l 50 mg/l 2 Figure 2 Effect of Km of different concentration on growth of strawberry 4 PCR : M: DNA marker; 1: ; 2: ; 3, 4: ; 5, 6: Figure 4 PCR analysis of crossed generation plants Note: M: DNA marker; 1: Positive control; 2: Negative control; 3,4: Transferred CBF1 gene plants; 5,6: Non-transferred CBF1 gene plants

4 312 Molecular Plant Breeding ( 5) CBF1 6 : A: 6 3 d (22~25 ) ; B: 6 3 d (22~25 ) Figure 6 Detection of cold resistance of transferred strawberry using method of freezing survival of plants Note: A: Non-transferred CBF1 gene plants which were frozen at 6 for 3 days and then returned to a growth chamber at 22~25 for a week; B: Transferred CBF1 gene plants which were frozen at 6 for 3 days and then returned to a growth chamber at 22~25 for a week 5 Figure 5 Detection of cold resistance of transferred strawberry using method of electrical conductibity d 57.7% 35.6% 22~ % 73.2% ( 6) CBF Figure 7 Detection of cold resistance of transferred strawberry by testing intercellular icing temperature (2004) pecp

5 CBF1 Study on CBF1 Gene Transferred from Transgenic Strawberry to Non- transgenic Strawberry 313 pecp (2000) Bt (2002) bar (2006) (, 2002) CBF1 Cui H.R., Wang Z.H., Shu Q.Y., Wu D.X., Xia Y.W., and Gao M.W., 2001, Agronomic traits of hybrid progenies between Bt transgenic rice and conventional rice varieties, Zhongguo Shuidao Kexue (Chinese Journal of Rice Science), 15(2): (,,,,,, 2001, Bt,, 15(2): ) Jaglo-Ottosen K.R., Gilmour S.J., Zarka Daniel G., Schabenberger O., and Thomashow M.F., 1998, Arabidopsis CBF1 overexpression induces COR genes and enhances freezing tolerance, Science, 280(5360): Jiang F.Y., Li Y., and Weng B.Q., 2002, Review on physiology of chilling stress and chilling resistance of plants, Fujian Nongye Xuebao (Fujian Journal of Agricultural Sciences), 17(3): (,,, 2002,,, 17(3): ) Jin W.M., Yin S.P., Lu R.Q., Yuan W.F., Dong J., and Wang G.X., 2005a, GO gene transformation of strawberry and its resistance to gray mold, Fenzi Zhiwu Yuzhong (Molecular Plant Breeding), 3(6): (,,,,,, 2005a, GO,, 3(6): ) Jin W.M., Pan Q.H., Yin S.P., Dong J., Jiang L.J., Yang L., Chen Q.H., and Zhao J.B., 2005b, Progress of the genetic stability and breeding behavior of foreign gene in genetically modified plants, Fenzi Zhiwu Yuzhong (Molecular Plant Breeding), 3(6): (,,,,,,,, 2005b,,, 3(6): ) Jin W.M., Dong J., Yin S.P., Yan A.L., and Chen M.X., 2007, CBF1 gene transgenic strawberry and increase freezing tolerance, Xibei Zhiwu Xuebao (Acta Botanica Borealloccidentalla Sinica), 27(2): (,,,,, 2007, CBF1,, 27(2): ) Meng Q.R., Yang J.M., and Fan Y.L., 2002, Research progress in cold hardiness of orchard trees, Hebei Nongye Daxue Xuebao (Journal of Agricultural University of HeBei), 25(8): (,,, 2002,,, 25(8): 87-91) Wang C.L., Zhao L., Zong S.Q., Lv C.G., Zou J.S., He X.L., and Zhu W.M., 2002, Transfer of herbicide resistant gene bar into new rice variety by backcrossing, Zuowu Xuebao (Acta Agronomic Sinica), 28(3): (,,,,,,, 2002, bar,, 28(3): ) Wang D.Z., Wang S.H., Wu S., Li C.Q., Jiao D.M., Luo Y.C., Wang X.F., and Du S.Y., 2004, Inheritance and expression of the maize pepc gene in progenies of transgenic rice bred by crossing, Yichuan Xuebao (Acta Genetica Sinica), 31(2): (,,,,,,,, 2004, pepc,, 31(2): ) Wang G.L., and Fang H.J., 2002, Plant gene engineering, Science Press, Beijing, China, pp (,, 2002,,,,, pp ) Wang Z.H., Cui H.R., Shu Q.Y., Ye G.Y., Wu D.X., Gao M.W., and Xia Y.W., 2000, The inheritance and expression of transgenes in the progenies of Bt rice crossed to conventional rice varieties and its breeding utilization, Nongye Shengwu Jishu Xuebao (Journal of Agricultural Biotechnology), 8(1): (,,,,,,, 2000, Bt,, 8(1): 89-94) Yi Z.L., Wang Z.X., Tan J.P., Jiang J.X., Tan Y.N., and Zhou Q.M., 2006, Transfer of lysozyme gene into Indica parents of hybrid rice by backcrossing, Zhongguo Shuidao Kexue (Chinese Journal of Rice Science), 20(2): (,,,,,, 2006,,, 20(2): )