Sequencing and Comparison of Two2passage Genomes of Fast2growth Isolates of Attenuated Hepatitis A Virus( H2 Strain) in KMB17 Cells

Transcript

1 ISSN CN ΠQ Chinese Journal of Biochemistry and Molecular Biology 17 (5) : ( H2 ) 3 ( ) ( H2 ) (HAVH2K7) KMB17 28 d 14 d lgccid 50 ( ml) AC2PCR PCR p GEM2T cdna 2 HAVH2K % 3 VP2 (A2S) ;2C(N2H) ;3A(R2C) % 13 5 (5 UTR) (2C Q2P ;3A A2S ;3C T2A ;3D V2G) 2C UTR 2C H2 R512 Q754 Sequencing and Comparison of Two2passage Genomes of Fast2growth Isolates of Attenuated Hepatitis A Virus( H2 Strain) in KMB17 Cells HU Ning2zhu HU Yun2zhang 3 SHI Hai2jing QU Su SHAO Cong2wen LIU Guo2dong ( Institute of Medical Biology Chinese Academy of Medical Sciences Peking Union Medical College Kunming China) Abstract The complete genomes of two2passage isolates of live attenuated hepatitis A virus(hav H2 Strain) in KMB17 cells were sequenced and compared in order to study the mechanism of cellular adaptation of HAV During 222passage adaptation the replicating cycle was shortened from 28 days to 14 days antigenic and infec2 tious titer increased with increasing passages At passage 22 antigenic titer and infectious titer (lgccid 50 per ml) reached and 7 83 respectively The sequence alignment of passages 6 ( HAVH2 K7P6) and 22 ( HAVH2 K7P22) with original passage ( HAVH2 K7) showed that mutations of genomes increased with increas2 ing passages and most of the mutations were concentrated in 5 untranslated region (5 UTR) and 2C coding re2 gion HAVH2K7P6 showed only difference of 0 07 % with HAVH2K7 and only six nucleotide mutations in the whole genome all in open reading frame (ORF) resulting in the three amino acids exchanges A to S exchange in structural protein VP2 ;N to H exchange in nonstructural protein 2C ;R to C exchange in nonstructural pro2 tein 3A However there were eighteen nucleotide mutations in the genome of HAVH2 K7P22 five mutations in : ; : Tel : (0871) E2mail com Received :March ;Accepted :May Corresponding author Tel : (0871) E2mail com

2 UTR thirteen in ORF resulting in seven amino acids exchanges four mutations were new in addition to three common mutations with HAVH2K7P6 one Q to P exchange in 2C protein ;A to S in 3A ;T to A in 3C ;V to G in 3D In addition to 5 UTR the 2C coding region was more mutating region with four nucleotide mutations re2 sulting in one amino acid exchange The analysis showed that 5 UTR and 2C coding region play an important role in adaptation of HAVH2K7 in KMB17 cells Key words live attenuated hepatitis A virus H2 strain cellular adaptation fast growth genome sequence analysis (hepatitis A virus HAV) HAV ( Picornavirus) 110 mlπ (25 cm 2 ) KMB17 ( Hepatovirus) RNA h HAV 715 kb d 3 ELISA HAV (ORF) 2227 Reed2Muench 5 2P12P22P323 P1 4 ELISA (VP4 VP2 VP3 VP1) P2 P3 114 [10 ] 7 (2A 2B 2C 3A 3B 3C 3D) 5 H2 Goldkey 3 5 (5 UTR) (Table 1) Fig ;3 (3 UTR) AC2PCR RT2PCR Poly(A) [1 5 ] HAV HAVK7P6) (22 HAVK7P22) PCR ( AC2PCR) PCR 2HAV Eppendorf 1 2 HAV H 2 PBS PCR (500 mmolπl KCl 100 [6 ] mmolπl Tris2HCl ph mmolπl MgCl %Gel2 HAV 5 UTR 2B 2C 3A atin) mmolπl dntp 100 ng 2BΠ2C (polyt) min [7 9 ] HAV RNA 1 1 RNasin HAV ( H2M20K7) ( Promega) 1 1 M2MLV RT ( Gibco BRL) 37 1 h cdna 100 ng Taq DNA PCR PCR : s s s 30 PCR 112 % PCR HAV(H2 ) cdna ( TaKaRa) H2M20K7 ; T4 DNA ( TaKaRa) p GEM2T ( Pro2 KMB17 mega) DH5 X2gal IPTG LB ABI377 KMB17 27 d 7 PCR H2M20K7 KMB17 OMEGA d 22 KMB17 ( 6

3 5 : (H2 ) 543 Fig 1 Sequencing strategy of HAV genome A2I represent 9 amplified fragments of HAV Table 1 The primers used for amplification of HAV genomic RNA Cloned fragments Primers Sequences A(0 8 kb) A1 5 22CGCCGGCGTTCAAGAGGGGTGTCCGGAG223 A2 5 22GAATCTCAATGCCAAATCTTGC223 B(0 5 kb) B1 5 22TCTGAGGTACTCAGGGGC223 B2 5 22CAGTCAATGATGCTATAGAACC223 C(1 1 kb) C1 5 22CCAACAGGGGGGATTGATC223 C2 5 22CGTTAGAAGGAGAGGTCAATC223 D(1 0 kb) D1 5 22CCCTGGATTTCTGACACTC22C3 D2 5 22CAGTGGATAACATGGCATTTG223 E(1 1 kb) E1 5 22GTCTGTCACAGAACAATCAGA22G3 E2 5 22GATCCCAGAACAGATATCTCTTAA223 F(1 2 kb) F1 5 22GTTAAGAGATATCTGTTCTGGATC223 F2 5 22CCATCCTCCAACGAGCACTCC223 G(1 2 kb) G1 5 22CAGTTCTTTAGTCATGACAGTTG223 G2 5 22GCCATTGGATCAATTTCAGC223 H(1 1 kb) H1 5 22GAGTCCCATTTATCATCACA223 H2 5 22GTCCAATCAGATCAAGATTATC223 I(0 5 kb) I1 5 22GATTCTCTGTTATGGAGATG223 1) A2I represent 9 amplified fragments of HAV 2) 1 and 2 represent positively and negatively oriented primers respectively 2 I2 5 22TTTTTTTTTTTTTTTTTTTTTATTT HAV( H2) K7 HAV ( H2) K7 KMB17 28 d d ( 14 d) (lgccid 50 ml) (P6) lgccid 50 ( ml) (P22) lgccid 50 ( ml) ( Table 2) P d 14 d lgccid 50 ( ml) 7187 (Table 3) Table 2 Titers of different passages of HAVH2K7 in KMB17 for 14 days Passages Antigen titers Infectious titers(lgccid 50 per ml)

4 Table 3 One2step growth dynamics of HAVH2K7P22 in KMB17 cells Post inoculation days Antigen titers Infectious titers(lgccid 50 per ml) ND Not determined %) HAVH2K7 KMB17 HAV (14 d) 5 UTR 2C HAVH2K7 VP4 VP3 VP1 2A 3 UTR 28 d 14 d 2C 4968 A C N VP ; 2B D UTR 5 2C 3 3A 1 3C 2 3D (VP B C C D 7256 ) ; 2C A C D 6427 ( Table 4) UTR 2C (Table 5) VP4 PV3 VP1 2A 3 UTR 6 22 ( [10 HAVH2K % 6 HAVH2 ] VP2 (2 ) 2B 2C 3A 3D [11 ] 1 2 VP2 HAVH2K7 858 G T A S HAV H 3A 5193 C T R C 3 [12 ] 0 07 % HAVH2K7P6 6 H2 KMB17 5 UTP ( 28 d 14 d) HAVH2K d % 5 5 UTR VP2 (2 ) 2B (1 ) 2C(4 ( HAVH2K7P6) (HAVH2K7P22) ) 3A 3C 3D 1 6 (HAVH2K7) 5 UTR 5 ; : (1) ; d ; (2) 54 % 18 9 HAV (5 UTR 5 UTR 2C P1 P2 P3 3 UTR) 5 UTR 2C

5 5 : (H2 ) 545 Table 4 Differences in the genome sequences and amino acids of the HAVH2K7 with that of HAVH2K7P6 and HAVH2K7P22 Nucleotide position Location Nucleotide HAVH2K7 HAVH2K7P6 HAVH2K7P UTR C C T UTR T T C UTR T T C UTR A A G UTR A A T Amino acids HAVH2K7 HAVH2K7P6 HAVH2K7P VP2 G T T A S S 1178 VP2 C T T I I I B T C C I I I C A A C Q Q P C T T C A A A C A A T T T T C A C C N H H A C T T R C C A G G T A A S C G G A L L L C A A G T T A D T T G V V G D A T T A A A Table 5 Identity comparisons of nucleotide sequence of HAVH2K7 with that of HAVH2K7P6 and HAVH2K7P22 Genomic region HAVH2K7P6 ( %) HAVH2K7P22 ( %) Genome UTR VP VP VP VP A B C A B C D UTR C HAVH2K7 6 2B 1 HAVH2K7 2C 1 1 (HAVH2K7P6) C 0107 % 3 (VP2 A2S ;2C 3 1 HAVH2 K7P22 N2H ;3A R2C) ( HAVH2K7P22) 2C % 7 4 3A HAVH2K7 6 1 HAVH2K7P6 (2C Q2P ; 3A A2S ; 3C T2A ;3D V2G) HAV 5 UTR [13 ] HAV 5 UTR (internal ribosome entry segment IRES) [14 5 UTR ] HAVH2K7P6 5 UTR HAVH2K7P22 5 UTR 5 IRES Emerson [9 ] 2B 2C 2B 1 (R2C) 22

6 (A2S) 3C HAVH2K7P D (V2G) HAV :63 68 RNA 5 UTR 3 UTR P1 P2 P3 2B 2C 5 UTR [9 ] HAV HAV [8 9 ] to cell culture Virology : HAVH2K7 5 UTR RNA IRES 2B [8 9 ] HAVH2K7P UTR 2C 2B 1 5 UTR 2C HAVH2K7 KMB17 KMB17 ( References) 1 Najarian R Caput O Gee W Potter S J Renard A Merryweather J Van Nest GDina D Primary structure and gene organization of human hepa2 titis A virus Proc Natl Acad Sci USA : Cohen I J Tichehurst R J Purcell H R Burckler2White A Baroudy B M Complete nucleotide sequence of wild2type hepatitis A virus :Compar2 ison of different strains of hepatitis A virus and other picornaviruses J Virol : Paul V A Tada H von der Helm KWissel T Kiehn R Wimmer E Deinhardt E The entire nucleotide sequence of the genome of human hepatitis A virus (isolate MBB) Virus Res : Graff J Normann A Feinstone S M Flehmig B Nucleotide sequence of wild2type hepatitis A virus GBM in comparison with two cell culture2ada2 pted variants J Virol : Totsuka A Moritsugu Y Hepatitis A virus proteins Intervirology 6 Graff J Kasang C Normann A Pfisterer2Hunt M Feinstone M S Fleh2 mig B Mutational events in consecutive passages of hepatitis A virus strain GBM during cell culture adaptation Virology : Day S P Murphy P Brown E A Lemon S M Mutations within the 5 nonstructural region of hepatitis A virus RNA which enhance replication in BS2C21 cells J Virol : Emerson S U Huang Y KMcrill C Lewis M Purcell R H Mutations in both the 2B and 2C genes of hepatitis A virus are involved in adaptation to growth in cell cuture J Virol : Emerson S U Huang Y KPurcell R H 2B and 2C mutations are essen2 tial but mutations throughout the genome of HAV contribute to adaptation (B ) (Mao Jiang2sen Xie Ru2 ying Huang Hai2ying Study on live attenuated hepatitis A vaccine I The experiment of different attenuated strains in rhesus monkeys Science in China Ser B 1987 (6) : H2 K7 ( ) ( Zhou De2jiu Cao Yi2yun Huang Xiao2qin Dong De2xiang Analysis of complete genome of live attenuated hepatitis A vaccine H2 strain K7 J Yunnan Univ) : Cohen I E Rosenblum Ticehurst R J Daemer J R Feinstone M S Pur2 cell H R Complete nucleotide sequence of an attenuated hepatitis A vir2 us :Comparison with wild2type virus Proc Natl Acad Sci USA : Zhang H Chao Shi2fong Ping Li2hua Grace KClarke B Lemon M S An infectious cdna clone of a cytopathic hepatitis A virus : Genomic re2 gions associated with rapid replication and cytopathic effect Virology : Glass J M Jia X Summers F D Identification of the hepatitis A virus in2 ternal ribosome entry site : In Vitro and in vivo analysis of bicistronic RNAs containing the 5 noncoding region Virology :