Secretion of Recombinant Proteins in Mammalian Cells Directed by Growth Hormone Signal Peptide

Transcript

1 ISSN CN ΠQ Chinese Journal of Biochemistry and Molecular Biology 21 (2) : ,, (, ) Secretion of Recombinant Proteins in Mammalian Cells Directed by Growth Hormone Signal Peptide ZHANG Zhi2Qian 3, LI Jin2Ping, HU Ying ( Department of Cell Biology, Peking University School of Oncology, Beijing Institute for Cancer Research, Beijing , China) Abstract Signal peptide capable of efficiently directing many protein secretion in mammalian cells is one of the key elements in recombinant protein production, gene therapy and the development of DNA vaccines In order to explore the possibility of rat growth hormone signal peptide as such an element,a new vector based on the mammalian expression vector pcdna3 was constructed by employing rat growth hormone ( rgh) signal peptide as leading sequence,followed by multiple cloning sites,the myc epitope2tag and 6 his purification tag in the expression cassette The vector was validated by successfully expressing and secretion of chick MMP22 C2 terminal PEX domain,a potential angiogenesis inhibitor,and tandem peptide repeats of myc epitope2tag in COS2 7 cells These results suggest that rat growth hormone signal peptide is effective in the mediation of recombinant protein expression and secretion, and this vector provides a new tool for universal cloning and secretion of exogenous proteins in mammalian cells Key words rat growth hormone, signal peptide, secretion vector, mammalian cell R392,, [4 ] IgG [5 ] [6 ], [7 ] [8 ],, CHO COS [1 ] N, CHO COS : , : , N ( No ) ( No ),,, 3 Tel : ,E2mail bta net cn, [2,3 ] Received : October 22,2004 ;Accepted : December 21,2004 Supported by National Natural Science Foundation of China (No ), Natural Science Foundation of Beijing Municipal (No ),Beijing Key High2Technology Laboratory of Cancer Molecular Biology, and Chinese Medical Board Foundation, 3 Corresponding author Tel : E2mail : bta net cn China Academic Journal Electronic Publishing House All rights reserved

2 2 : 283, MEM), Lipofectamine [9 ], ( GIBCOΠBRL), % ΠPBS 3 min,0 5 % Triton X2100ΠPBS 3, 10 min Myc10 9E10 (1 10 ) ( MMP22 C PEX, ) 37 1 h,0 5 % Triton X2100ΠPBS 3, 10 min, COS27 12 %SDS2PAGE, ATCC, Vent DNA PVDF (Milipore) 5 % ΠTTBS New England Biolabs ; T4 DNA 1 h,ttbs, Myc10 Promega 9E10 ( ) 1 h, GIBCO/ BRL TTBS, HRP (1 Sigma 112 RT2PCR 1 h, TTBS, ECL RT2PCR 11 2 (rgh) MMP22 C PEX : : GGCAAGCTT ( Hind ) ACAGATCACTGAGTGG23 : 5 2AGAGGATCCT ( BamH ) GGACAAGGGCATG2 3 ; MMP22 C PEX : :5 2CGGATCC ( BamH ) TCTGCAAGCACG23, :5 2CCTCTAGA ( Xba ) GCAAGTCCTCTTCAGAAATCAGTTTTTGCT CGAG( Xho ) GCAACCCAACCAGTC (Fig 1), PEX PCR, rgh PEX PCR rgh PEX, PEX N rgh 5 2CTGGGCCC ( Apa ) TAATGATGATGATGATGATGTCTAGA ( Xba ) CAAGT CCTCTTCAG23 C PCR Myc 6 His, Hind Apa,T4 DNA pcdna310 ( Invitrogen ) DH5, 212, Tip2500 (Qiagen ) 113 (Jackson ImmunoResearch Laboratories) 37 1 h, 0 5 % Triton X2100ΠPBS,,Olympus BH22,Kodak Tmax Western ) (Jackson ImmunoResearch Laboratories) (Amersham ),, PEX pmyc2n MycPEX/ pcdna3, COS27, 24 h 48 h Myc 9E10, MGC2803 ( ), DNA PEX,, 48 h COS27,SDS2PAGE, Myc Western COS27 ( 10 %, Fig 2 rghpexmychisπpcdna China Academic Journal Electronic Publishing House All rights reserved

3 Fig 1 Immunofluorescent staining of Myc/ PEX to demonstrate the localization of expressed PEX in transfected COS27 cells (A) MycPEXΠpcDNA3 ; (B) rghpex/ pcdna3 Bar :20 m Fig 2 Western blot analysis of COS2culture supernatants 48 hours after transient transfection probed with Myc antibody 1 rghpexmychisπpcdna ;2 E coliexpressed PEX as positive control ; 3 MycPEXΠpcDNA without signal peptide PEX 15 l Myc 26 kd, prghsecmychis(fig 3) Myc PEX ( Myc, MycPEXΠpcDNA ) prghsecmychis, COS27,, Western 48 h 213 Myc 6 Myc His (Fig 4), Fig 3 Multiple cloning sequence of the eukaryotic secretion expression vector prghsecmychis To construct prghsecmychis,this sequence replaced the multiple cloning sites between Hind and Apa of pcdna3 Arrow :signal peptide cleavage site China Academic Journal Electronic Publishing House All rights reserved

4 2 : 285 Fig 4 Western blot result of (Myc) nπprghsecmychis transfected COS27 culture medium probed with 9E10 Myc antibody Fifteen microliters of culture supernatants were loaded in each lane 1 untransfected cell supernatants ; 2 (Myc) nπprghsecmychis transfected cell supernatants, 3 PcDNA3, prghsecmychis,, CMV SV40 ( SV40 T COS27 ) Neomycin prghsecmychis, [5,8 ],, ( References),,Li [9 ],, MMP22 C PEX Myc,,,, lgg PEX [10,11 ] MMP22,PEX [10 ], COS27,,, PEX PEX,,,, 6 His, Ni2NTA PEX ( ) prghsecmychis Myc 6 His, 1 Yan S C B, Grinnell W, Wold F Post2translational modifications of proteins :some problems left to solve Trends Biol Sci,1989,14 :264 2 Von Heijne G Patterns of amino acids near signal2sequence cleavage sites Eur J Biochem,1983,133 : Perlman D,Halvororson H O A putative signal peptidase recognition site and sequence in eukaryotic and prokaryotic signal peptides J Mol Biol, 1983,167 : Schmidt F R Recombinant expression systems in the pharmaceutical industry Applied Microbiol Biotechnol,2004,65(4) : Coloma M J,Hastings A,Wims L A,Morrison S L Novel vectors for the expression of antibody molecules using variable regions generated by polymerase chain reaction J Immunol Methods,1992,152 : Chubet R G,Brizzard B L Vectors for expression and secretion of FLAG epitope2tagged proteins in mammalian cells BioTechniques,1996,20 : Herrera A M, Musacchio A, Fernandez J R, Duarte C Efficiency of erythropoietin s signal peptide for HIV mm 21 gp120 expression Biochem Biophys Res Commun,2000,273 : Liu Y C, Kawagishi M,Mikayama T,Inagaki Y,Takeuchi T,Ohashi H Processing of a fusion protein by endoprotease in COS21 cells for secretion of mature peptide by using a chimeric expression vector Proc Natl Acad Sci USA,1993,90 : China Academic Journal Electronic Publishing House All rights reserved

5 Li Y,Luo L,Rasool N,Wagner R R,Kang C Y Viral liposomes released from insect cells infected with recombinant baculovirus expressing the matrix protein of vesicular stomatitis virus J Virol,1993,7 : Brooks P C,Silletti S,von Schalscha T L,Friedlander M,Cheresh D A Disruption of angiogenesis by PEX, a noncatalytic metalloproteinase fragment with integrin binding activity Cell,1998,92(3) : ,,,,, 22C PEX (Li Jin2Ping, Zhang Guang2Mou,Ke Yang,Lin Ben2Yao,Zhao Wei,Hu Ying,Ning Tao,Lin Zhong2Xiang, Zhang Zhi2Qian Prokaryotic expression of PEX: a C2 terminal fragment of matrix metalloproteinase 2 and its effect on the inhibition of angiogenesis Prog Biochem Biophys),2002,29 (1) : The Fifth Editorial Board of Chinese Journal of Biochemistry and Molecular Biology (Advisors) ZHENGJi ZHANG Chang2Ying ZOU Cheng2Lu(Chen2lu TSOU) ( Editor2in2Chief) J IA Hong2Ti ( Associate Editors2in2Chief) CHANG Zeng2Yi SUN Zhi2Xian YANG Fu2Yu (Members of the Board,alphabetically) CHANG Zeng2Yi GU Jun HUANGLi J IAO Bing2Hua LI Bo2Liang LI Gui2Yuan LI Zai2Ping LIN Qi2Shui LIU Guo2Qin PENGJing2Pian QU Liang2Hu RUAN Kang2Cheng SUN Zhi2Xian WANG Zhi2Zhen XU Gen2Jun YANG Xiao2Ming YE Qi2Nong ZHANGJin ZHANG Yi ZHOU Jun2Mei ZHU Yu2Xian (Specially Invited Members of the Board) Ray WU(USA) LI Lin WANGLin2Fang ZHA Xi2Liang CHEN Qing2Xi HANG Hai2Ying J IA Hong2Ti KE Yang LI Gang LI Lin LIANG Ai2Hua LIU De2Fu LIU Jin2yuan QIAN Guan2Xiang RAO Zi2He SHANG Yong2Feng WANGJia2Xi WEI Qun YANG Fu2Yu YAO Li2Bo YUAN Qin2Sheng ZHANG Nai2Heng ZHOU Chun2Yan ZHU Da2Hai Robert K YU(USA) SHANG Yong2Feng WANG Zhi2Zhen GENG Yun2Qi HE Rong2Qiao J IANG Cheng2Yu J IN You2Xin LI Gen2Xi LI Ning LIANG Song2Ping LIU De2Pei MIAO Shi2Ying QIANG Bo2Qin SHI Yun2Yu SHOU Cheng2Chao WANGLin2Fang WEN Jin2Kun YANG Ke2Gong YAO Ren2Jie ZHA Xi2Liang ZHANG Xu2Jia ZHOU Hai2Meng ZHU Wei2Guo China Academic Journal Electronic Publishing House All rights reserved