Secretion of Recombinant Proteins in Mammalian Cells Directed by Growth Hormone Signal Peptide
|
|
- Άφροδίτη Αγγελίδου
- 6 χρόνια πριν
- Προβολές:
Transcript
1 ISSN CN ΠQ Chinese Journal of Biochemistry and Molecular Biology 21 (2) : ,, (, ) Secretion of Recombinant Proteins in Mammalian Cells Directed by Growth Hormone Signal Peptide ZHANG Zhi2Qian 3, LI Jin2Ping, HU Ying ( Department of Cell Biology, Peking University School of Oncology, Beijing Institute for Cancer Research, Beijing , China) Abstract Signal peptide capable of efficiently directing many protein secretion in mammalian cells is one of the key elements in recombinant protein production, gene therapy and the development of DNA vaccines In order to explore the possibility of rat growth hormone signal peptide as such an element,a new vector based on the mammalian expression vector pcdna3 was constructed by employing rat growth hormone ( rgh) signal peptide as leading sequence,followed by multiple cloning sites,the myc epitope2tag and 6 his purification tag in the expression cassette The vector was validated by successfully expressing and secretion of chick MMP22 C2 terminal PEX domain,a potential angiogenesis inhibitor,and tandem peptide repeats of myc epitope2tag in COS2 7 cells These results suggest that rat growth hormone signal peptide is effective in the mediation of recombinant protein expression and secretion, and this vector provides a new tool for universal cloning and secretion of exogenous proteins in mammalian cells Key words rat growth hormone, signal peptide, secretion vector, mammalian cell R392,, [4 ] IgG [5 ] [6 ], [7 ] [8 ],, CHO COS [1 ] N, CHO COS : , : , N ( No ) ( No ),,, 3 Tel : ,E2mail bta net cn, [2,3 ] Received : October 22,2004 ;Accepted : December 21,2004 Supported by National Natural Science Foundation of China (No ), Natural Science Foundation of Beijing Municipal (No ),Beijing Key High2Technology Laboratory of Cancer Molecular Biology, and Chinese Medical Board Foundation, 3 Corresponding author Tel : E2mail : bta net cn China Academic Journal Electronic Publishing House All rights reserved
2 2 : 283, MEM), Lipofectamine [9 ], ( GIBCOΠBRL), % ΠPBS 3 min,0 5 % Triton X2100ΠPBS 3, 10 min Myc10 9E10 (1 10 ) ( MMP22 C PEX, ) 37 1 h,0 5 % Triton X2100ΠPBS 3, 10 min, COS27 12 %SDS2PAGE, ATCC, Vent DNA PVDF (Milipore) 5 % ΠTTBS New England Biolabs ; T4 DNA 1 h,ttbs, Myc10 Promega 9E10 ( ) 1 h, GIBCO/ BRL TTBS, HRP (1 Sigma 112 RT2PCR 1 h, TTBS, ECL RT2PCR 11 2 (rgh) MMP22 C PEX : : GGCAAGCTT ( Hind ) ACAGATCACTGAGTGG23 : 5 2AGAGGATCCT ( BamH ) GGACAAGGGCATG2 3 ; MMP22 C PEX : :5 2CGGATCC ( BamH ) TCTGCAAGCACG23, :5 2CCTCTAGA ( Xba ) GCAAGTCCTCTTCAGAAATCAGTTTTTGCT CGAG( Xho ) GCAACCCAACCAGTC (Fig 1), PEX PCR, rgh PEX PCR rgh PEX, PEX N rgh 5 2CTGGGCCC ( Apa ) TAATGATGATGATGATGATGTCTAGA ( Xba ) CAAGT CCTCTTCAG23 C PCR Myc 6 His, Hind Apa,T4 DNA pcdna310 ( Invitrogen ) DH5, 212, Tip2500 (Qiagen ) 113 (Jackson ImmunoResearch Laboratories) 37 1 h, 0 5 % Triton X2100ΠPBS,,Olympus BH22,Kodak Tmax Western ) (Jackson ImmunoResearch Laboratories) (Amersham ),, PEX pmyc2n MycPEX/ pcdna3, COS27, 24 h 48 h Myc 9E10, MGC2803 ( ), DNA PEX,, 48 h COS27,SDS2PAGE, Myc Western COS27 ( 10 %, Fig 2 rghpexmychisπpcdna China Academic Journal Electronic Publishing House All rights reserved
3 Fig 1 Immunofluorescent staining of Myc/ PEX to demonstrate the localization of expressed PEX in transfected COS27 cells (A) MycPEXΠpcDNA3 ; (B) rghpex/ pcdna3 Bar :20 m Fig 2 Western blot analysis of COS2culture supernatants 48 hours after transient transfection probed with Myc antibody 1 rghpexmychisπpcdna ;2 E coliexpressed PEX as positive control ; 3 MycPEXΠpcDNA without signal peptide PEX 15 l Myc 26 kd, prghsecmychis(fig 3) Myc PEX ( Myc, MycPEXΠpcDNA ) prghsecmychis, COS27,, Western 48 h 213 Myc 6 Myc His (Fig 4), Fig 3 Multiple cloning sequence of the eukaryotic secretion expression vector prghsecmychis To construct prghsecmychis,this sequence replaced the multiple cloning sites between Hind and Apa of pcdna3 Arrow :signal peptide cleavage site China Academic Journal Electronic Publishing House All rights reserved
4 2 : 285 Fig 4 Western blot result of (Myc) nπprghsecmychis transfected COS27 culture medium probed with 9E10 Myc antibody Fifteen microliters of culture supernatants were loaded in each lane 1 untransfected cell supernatants ; 2 (Myc) nπprghsecmychis transfected cell supernatants, 3 PcDNA3, prghsecmychis,, CMV SV40 ( SV40 T COS27 ) Neomycin prghsecmychis, [5,8 ],, ( References),,Li [9 ],, MMP22 C PEX Myc,,,, lgg PEX [10,11 ] MMP22,PEX [10 ], COS27,,, PEX PEX,,,, 6 His, Ni2NTA PEX ( ) prghsecmychis Myc 6 His, 1 Yan S C B, Grinnell W, Wold F Post2translational modifications of proteins :some problems left to solve Trends Biol Sci,1989,14 :264 2 Von Heijne G Patterns of amino acids near signal2sequence cleavage sites Eur J Biochem,1983,133 : Perlman D,Halvororson H O A putative signal peptidase recognition site and sequence in eukaryotic and prokaryotic signal peptides J Mol Biol, 1983,167 : Schmidt F R Recombinant expression systems in the pharmaceutical industry Applied Microbiol Biotechnol,2004,65(4) : Coloma M J,Hastings A,Wims L A,Morrison S L Novel vectors for the expression of antibody molecules using variable regions generated by polymerase chain reaction J Immunol Methods,1992,152 : Chubet R G,Brizzard B L Vectors for expression and secretion of FLAG epitope2tagged proteins in mammalian cells BioTechniques,1996,20 : Herrera A M, Musacchio A, Fernandez J R, Duarte C Efficiency of erythropoietin s signal peptide for HIV mm 21 gp120 expression Biochem Biophys Res Commun,2000,273 : Liu Y C, Kawagishi M,Mikayama T,Inagaki Y,Takeuchi T,Ohashi H Processing of a fusion protein by endoprotease in COS21 cells for secretion of mature peptide by using a chimeric expression vector Proc Natl Acad Sci USA,1993,90 : China Academic Journal Electronic Publishing House All rights reserved
5 Li Y,Luo L,Rasool N,Wagner R R,Kang C Y Viral liposomes released from insect cells infected with recombinant baculovirus expressing the matrix protein of vesicular stomatitis virus J Virol,1993,7 : Brooks P C,Silletti S,von Schalscha T L,Friedlander M,Cheresh D A Disruption of angiogenesis by PEX, a noncatalytic metalloproteinase fragment with integrin binding activity Cell,1998,92(3) : ,,,,, 22C PEX (Li Jin2Ping, Zhang Guang2Mou,Ke Yang,Lin Ben2Yao,Zhao Wei,Hu Ying,Ning Tao,Lin Zhong2Xiang, Zhang Zhi2Qian Prokaryotic expression of PEX: a C2 terminal fragment of matrix metalloproteinase 2 and its effect on the inhibition of angiogenesis Prog Biochem Biophys),2002,29 (1) : The Fifth Editorial Board of Chinese Journal of Biochemistry and Molecular Biology (Advisors) ZHENGJi ZHANG Chang2Ying ZOU Cheng2Lu(Chen2lu TSOU) ( Editor2in2Chief) J IA Hong2Ti ( Associate Editors2in2Chief) CHANG Zeng2Yi SUN Zhi2Xian YANG Fu2Yu (Members of the Board,alphabetically) CHANG Zeng2Yi GU Jun HUANGLi J IAO Bing2Hua LI Bo2Liang LI Gui2Yuan LI Zai2Ping LIN Qi2Shui LIU Guo2Qin PENGJing2Pian QU Liang2Hu RUAN Kang2Cheng SUN Zhi2Xian WANG Zhi2Zhen XU Gen2Jun YANG Xiao2Ming YE Qi2Nong ZHANGJin ZHANG Yi ZHOU Jun2Mei ZHU Yu2Xian (Specially Invited Members of the Board) Ray WU(USA) LI Lin WANGLin2Fang ZHA Xi2Liang CHEN Qing2Xi HANG Hai2Ying J IA Hong2Ti KE Yang LI Gang LI Lin LIANG Ai2Hua LIU De2Fu LIU Jin2yuan QIAN Guan2Xiang RAO Zi2He SHANG Yong2Feng WANGJia2Xi WEI Qun YANG Fu2Yu YAO Li2Bo YUAN Qin2Sheng ZHANG Nai2Heng ZHOU Chun2Yan ZHU Da2Hai Robert K YU(USA) SHANG Yong2Feng WANG Zhi2Zhen GENG Yun2Qi HE Rong2Qiao J IANG Cheng2Yu J IN You2Xin LI Gen2Xi LI Ning LIANG Song2Ping LIU De2Pei MIAO Shi2Ying QIANG Bo2Qin SHI Yun2Yu SHOU Cheng2Chao WANGLin2Fang WEN Jin2Kun YANG Ke2Gong YAO Ren2Jie ZHA Xi2Liang ZHANG Xu2Jia ZHOU Hai2Meng ZHU Wei2Guo China Academic Journal Electronic Publishing House All rights reserved
Chinese Journal of Biochemistry and Molecular Biology. Effect of IL KAP on Tumorigenesis and Tumor Development
ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology IL KAP 2009 6 25 (6) :489 494 1), 2), 1), 1) 3 ( 1), 130021 ; 2), 130118) ( ILKAP) 2C( PP2C),,. ILKAP,. ILKAP,. ILKAP,
Screening, Expression and characterization of a Novel Protein Binding to Hepatitis B Surface Antigen
ISSN 100727626 CN 1123870ΠQ 2005 2 Chinese Journal of Biochemistry and Molecular Biology 21 (1) :53 60, (, 200433) 3, cdna ( hepatitis B surface antigen binding protein, HBsAg2BP) cdna, cdna, 1 344, ptriplex,
A Ne w Method of Separation and Bioactivity Assay of Flammulin
ISSN 100727626 CN 1123870ΠQ 2003 4 Chinese Journal of Biochemistry and Molecular Biology 19 (2) :234 239,,,,, (, 250100) 3, :, DEAE2Sephadex A250, CM2Sephadex C250,, 23 700, pi 819, max 276 278 nm, min
Chinese Journal of Biochemistry and Molecular Biology PGC-1 . PGC-1. PGC-1β PRC PGC-1 3
ISSN 1007-7626 CN 11-3870 / Q 2010 7 Chinese Journal of Biochemistry and Molecular Biology 26 7 596 ~ 603 PGC-1 * 712100 γ 1 PGC-1 PGC-1α PGC-1β PRC PGC-1 3 PGC-1α PGC-1β PRC PGC-1 PGC-1β PGC-1 γ -1 Q756
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN
BIOTECHNOLOGY BULLETIN 2011 3 α 1 2-300457 PCR Helicobacter pylori HP DNA α 1 2- α 1 2-fucosyltransferase α 1 2-fuct 906 bp pet-22b + pet-fuct BL21 DE3 25 0. 1 mmol /L IPTG 4 h SDS-PAGE 33 kd α 1 2- BL21
, Litrrow. Maxwell. Helmholtz Fredholm, . 40 Maystre [4 ], Goray [5 ], Kleemann [6 ] PACC: 4210, 4110H
57 6 2008 6 100023290Π2008Π57 (06) Π3486208 ACTA PHYSICA SINICA Vol. 57,No. 6,June,2008 ν 2008 Chin. Phys. Soc. 3 1) 2) 1) g 1) (, 130033) 2) (, 100049) (2007 9 11 ;2007 11 14 ),Littrow,,.,., Litrrow.
ER-Tree (Extended R*-Tree)
1-9825/22/13(4)768-6 22 Journal of Software Vol13, No4 1, 1, 2, 1 1, 1 (, 2327) 2 (, 3127) E-mail xhzhou@ustceducn,,,,,,, 1, TP311 A,,,, Elias s Rivest,Cleary Arya Mount [1] O(2 d ) Arya Mount [1] Friedman,Bentley
Cellular Physiology and Biochemistry
Original Paper 2016 The Author(s). 2016 Published The Author(s) by S. Karger AG, Basel Published online: November 25, 2016 www.karger.com/cpb Published by S. Karger AG, Basel 486 www.karger.com/cpb Accepted:
TGFp FSH INH INH
(210095) E-mail ( genlinwang@hotmail.com) - -(Strept Avidin-Biotin-Peroxidase Complex SABC), 1 32,, 1 inhibin INH α 32 000 TGFp FSH FSH [1] INHα Sertoli Noguchi 1997 [2] Meunier et al.1988 [3] INH INH
1., Specificity and Epitope Mapping of Four Monoclonal Antibodies. against SARS-CoV Nucleocapsid Protein
21 3 21 3 207-212 2006 5 VIROLOGICA SINICA May 2006 SARS-CoV N * 1** 1 1 1 1 1 2** 1 1 1., 100052 2., 361005 Specificity and Epitope Mapping of Four Monoclonal Antibodies against SARS-CoV Nucleocapsid
Quick algorithm f or computing core attribute
24 5 Vol. 24 No. 5 Cont rol an d Decision 2009 5 May 2009 : 100120920 (2009) 0520738205 1a, 2, 1b (1. a., b., 239012 ; 2., 230039) :,,.,.,. : ; ; ; : TP181 : A Quick algorithm f or computing core attribute
Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin
2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,
Chinese Journal of Biochemistry and Molecular Biology. CHO., 3 hfgl2p ( ) LUC hfgl2p ( - 997) LUC hfgl2p ( - 816) LUC ; hfgl2p (2468)LUC
ISSN 100727626 CN 1123870ΠQ 2007 2 Chinese Journal of Biochemistry and Molecular Biology 23 (2) :130 135 hfgl2 SARS,,,,, (,, 430030) 3 SARS hfgl2, PCR Western hfgl2 mrna SARS, hfgl2 5, hfgl2, SARS CHO,
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to facilitate intracellular survival Hongwei Gu 1,2*, Chihao Zhao 1,2*, Tianfu Zhang 1,2*, Hongwei Liang 1,2, Xiao-Ming Wang 1,
Chinese Journal of Biochemistry and Molecular Biology. p38mapk
ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2008 6 24 (6) :537 542 Grx1 HEK293T H 2 O 2 p38mapk 1), 2), 1), 1), 3), 1), 1) 3 ( 1), 150081 ; 2), 150081 ; 3), 161042)
2 0 1 2 2 Journal of Shanghai Normal University Natural Sciences Feb. 2 0 1 2 SNAT2. HEK293T Western blot SNAT2 - HA Q 31 A 1000-5137 2012 01-0083-06
4 1 1 Vol 41 No 1 2 0 1 2 2 Journal of Shanghai Normal University Natural Sciences Feb 2 0 1 2 SNAT2 - HA * 200234 SNAT2 - SNAT2 PCR HA SNAT2 C pbk - CMVΔ 1098-1300 - SNAT2 - HA HEK293T Western blot SNAT2
Basic & Clinical Medicine PLGA MUC1 MUC1 IC 50 MUC1 +
2011 7 31 7 1001-6325 2011 07-0751 -05 July 2011 Vol. 31 No. 7 MUC1 1 1 1 2 1 1* 1. 100005 2. 100190 MUC1 PLGA MUC1 MUC1 MUC1 MCF-7 HepG2 MTS IC 50 MUC1 225. 3 ± 9. 2 nm 83. 6% ± 1. 7% MUC1 + MCF-7 P
FENXI HUAXUE Chinese Journal of Analytical Chemistry. Savitzky-Golay. n = SG SG. Savitzky-Golay mmol /L 5700.
38 2010 3 FENXI HUAXUE Chinese Journal of Analytical Chemistry 3 342 ~ 346 DOI 10. 3724 /SP. J. 1096. 2010. 00342 Savitzky-Golay 1 * 1 2 1 3 1 1 510632 2 510632 3 200444 PLS Savitzky-Golay SG 10000 ~ 5300
Gene Expression and Biotoxicological Properties of Recombinant Human Brain Acetylcholinesterase
ISSN 100727626 CN 1123870ΠQ 2002 2 Chinese Journal of Biochemistry and Molecular Biology 18 (1) :44 49 1) 2) 1) 1) 3,,, ( 1), 100850 ; 2) 0, 100039) cdna pcdna3 1, pcdna2 AChE 293, rhache rhache AChE rhache
, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells
2011 9 1 77 SLC26A4 HEK 293 1 2 1 1 1 1 (100853) 2 ( 050051) SLC26A4 (pegfp enhanced green fluorescent protein) SLC26A4 pegfp-slc26a4 HEK293 pegfp-slc26a4 HEK293 - (RT-PCR) SLC26A4 mrna Western Blot (
Distribution of Mercury and Selenium in the Proteins of Porcine Liver and Kidney Under Different Mercury Exposure Level
ISSN 100727626 CN 1123870ΠQ 2003 6 Chinese Journal of Biochemistry and Molecular Biology 19 (3) :377 382, 3,, (, 918 100039), (, 550002) (Sephadex G2100),, ;, ;, 11 kd (MT),,,,,,,,, Q51,X132 Distribution
Research Papers. TNF-α. L929 LPS Carswell [1] BCG. pet-41d TNF).TNF. NEB TNF-α cdna Invitrogen DNA. 75 ku TNF TransTaq High %
Research Papers Progress in Biochemistry and Biophysics 2009, 36(4): 424~430 wwwpibbaccn * TNF-α 1, 2) 1) 1)** ( 1) 100101 2) 100039) TNF-α TNF-α TNF-α TNF-α TNF-α TNF-α 9C6 TNF-α 29~40 TNF-α 9C6 TNF-α
2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _
41 Vol.41, No. 01 RARE METAL MATERIALS AND ENGINEERING March 01 Pb O 4 PbO ( 710049) SnO -Sb Pb O 4 Pb O 4 100.5 h 970 h XRF XRD SEM Pb O 4 PbO PbO TG146.1 + A 100-185X(01)0-046-05 [1,] 1 PbO PbO Sn-Sb
Stress Relaxation Test and Constitutive Equation of Saturated Soft Soil
8 7 011 7 Journal of Highway and Transportation Research and Development Vol. 8 No. 7 Jul. 011 100-068 011 07-0014 - 05 1 1. 0009. 710064 k 0 Merchant 4 Merchant U416. 1 + 6 A Stress Relaxation Test and
Approximation Expressions for the Temperature Integral
20 7Π8 2008 8 PROGRSS IN CHMISRY Vol. 20 No. 7Π8 Aug., 2008 3 3 3 3 3 ( 230026),,,, : O64311 ; O64213 : A : 10052281X(2008) 07Π821015206 Approimation pressions for the emperature Integral Chen Haiiang
Advance in Nanorealgar Studies
21 5 2009 5 PROGRESS IN CHEMISTRY Vol. 21 No. 5 May, 2009 1 1 2 3 (1. 430074 ; 2. 430074),,, ;,, : O61316 ; R284 : A : 10052281X(2009) 0520934206 Advance in Nanorealgar Studies Ye Xiaochuan 1 Yang Xiangliang
Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone
ISSN 100727626 CN 1123870ΠQ 2002 12 Chinese Journal of Biochemistry and Molecular Biology 18 (6) :693 697 cdna, 3, (, 150030) RNA, cdna cdna PCR, 380 bp cdna pmd2182t2verctor 3,,, 96 %, 95 %,, 74 %, 95
,,, (, 100875) 1989 12 25 1990 2 23, - 2-4 ;,,, ; -
25 3 2003 5 RESOURCES SCIENCE Vol. 25 No. 3 May 2003 ( 100875) : 500L - 2-4 - 6-8 - 10 114h - 120h 6h 1989 12 25 1990 2 23-2 - 4 : ; ; - 4 1186cm d - 1 10cm 514d ; : 714 13 317 714 119 317 : ; ; ; :P731
A System Dynamics Model on Multiple2Echelon Control
2007 9 9 :100026788 (2007) 0920107208 1, 1, 1, 2 (11, 100876 ;21, 100044) :..,,.,.,. : ;;; : TP39119 : A A System Dynamics Model on Multiple2Echelon Control YANG Tian2jian 1, LV Ting2jie 1, ZHANG Xiao2hang
Congruence Classes of Invertible Matrices of Order 3 over F 2
International Journal of Algebra, Vol. 8, 24, no. 5, 239-246 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/.2988/ija.24.422 Congruence Classes of Invertible Matrices of Order 3 over F 2 Ligong An and
IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2
344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.
Angioarrestin( harp1) C FD
ISSN 100727626 CN 1123870ΠQ 2007 2 Chinese Journal of Biochemistry and Molecular Biology 23 (2) :136 140 Angioarrestin( harp1) C FD,,,,, ( 200433) 3 Angioarrestin DNA angioarrestin C hfd cdna (MBP) pmal2c
Analysis on construction application of lager diameter pile foundation engineering in Guangdong coastal areas
29 2 2010 6 GLOBAL GEOLOGY Vol. 29 No. 2 Jun. 2010 1004-5589 2010 02-0341 - 06 1 2 3 4 5 6 1. 130032 2. 130012 3. 134000 4. 130021 5. 130012 6. 130012 1# 2# TU473 A doi 10. 3969 /j. issn. 1004-5589. 2010.
A ne w method for spectral analysis of the potential field and conversion of derivative of gravity-anomalies : cosine transform
49 1 006 1 CHINESE JOURNAL OF EOPHYSICS Vol. 49, No. 1 Jan., 006,,..,006,49 (1) :4448 Zhang F X, Meng L S, Zhang F Q, et al. A new method for spectral analysis of the potential field and conversion of
CorV CVAC. CorV TU317. 1
30 8 JOURNAL OF VIBRATION AND SHOCK Vol. 30 No. 8 2011 1 2 1 2 2 1. 100044 2. 361005 TU317. 1 A Structural damage detection method based on correlation function analysis of vibration measurement data LEI
LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing
2003 61 3, 435 439 ACTA CHIMICA SINICA Vol 61, 2003 No 3, 435 439 2 ΞΞ ( 400715), 2, 2, 2, 3/ 2 2,, 2,, Ne w Methods for the Determination of the Inclusion Constant between Procaine Hydrochloride and 2Cyclodextrin
Application of Statistical Process Control in Pretreatment Production Process of Gardenia jasminoides
DOI:0.3422/j.cnki.syfjx.202..02 8 202 6 Vol. 8 No. Jun. 202 3 2 2* 2*. 0002 2. 0002 3. 0300 Shewhart EWMA SPE Shewhart EWMA R283. 6 A 005-9903 202-006-05 Application of Statistical Process Control in Pretreatment
( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;
28 1 2006 1 RESOURCES SCIENCE Vol. 28 No. 1 Jan. 2006 :1007-7588(2006) 01-0002 - 07 20 1 1 2 (11 100101 ; 21 101149) : 1978 1978 2001 ; 2010 ; ; ; : ; ; 24718kg 1) 1990 26211kg 260kg 1995 2001 238kg( 1)
D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical and experimental study
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical
PACS: Pj, Gg
* 1)2) 2) 3) 2) 1) 1) (, 310023 ) 2) (, 315211 ) 3) (, 510006 ) ( 2011 6 16 ; 2011 10 31 ),..,,.,.,. :,,, PACS: 07.05.Pj, 05.45.Gg 1,.,, [1,2].,,, [3,4].,, [5,6].,. [7 9]., [10 17].,.,, [10]., [18 20],
. O 2 + 2H 2 O + 4e 4OH -
16 1 Vol 16 No 1 2010 2 ELECTROCHEMISTRY Feb 2010 1006-3471 2010 01-0060-05 * 361005 O646 A 1 2 ph > 12 5 2-3 5-7 ph Fe Fe 2 + + 2e Cl - 4 O 2 + 2H 2 O + 4e 4OH - Cl - CO 2 / 8 Cl - CO 2 H 2 O O 2 9-10
Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application
31 5 2011 5 Acta Scientiae Circumstantiae Vol 31 No 5 May 2011 2011 - J 31 5 935-940 Huang Y M Yuan D X Peng Y Z et al 2011 Rapid determination of soluble reactive silicate in seawater by flow injection
Chinese Journal of Biochemistry and Molecular Biology ERR . I2 (TNNI2) GST2TNNI2, 1. 1
ISSN 100727626 CN 1123870ΠQ 2005 10 Chinese Journal of Biochemistry and Molecular Biology 21 (5) :656 660 I2 ERR 1,,,,, (, 400038) 3 1 ( ERR 1) I2 (TNNI2) TNNI2 ERR 1, GST2TNNI2, 35 S ERR 1, GST,TNNI2
,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78
ISSN 100727626 CN 1123870ΠQ 2002 4 Chinese Journal of Biochemistry and Molecular Biology 18 (2) :245 249 HLA2B2704 3 2) ( 2) 100044) HLA2B2704 286 HLA2B2704 DNA ( HLA2B2704 DNA) PCR F0 F1 RT2PCR HLA2B2704
College of Life Science, Dalian Nationalities University, Dalian , PR China.
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2018 Postsynthetic modification
Nov Journal of Zhengzhou University Engineering Science Vol. 36 No FCM. A doi /j. issn
2015 11 Nov 2015 36 6 Journal of Zhengzhou University Engineering Science Vol 36 No 6 1671-6833 2015 06-0056 - 05 C 1 1 2 2 1 450001 2 461000 C FCM FCM MIA MDC MDC MIA I FCM c FCM m FCM C TP18 A doi 10
Construction and Identification of Transforming Growth Factor-β1 shrna Expressing Vector
2010 30 5 975 -β1shrna 215123 TGF -β1 RNA shrna TGF-β1 mrna Ambion Target Finder TGF-β1shRNA BglⅡ HindⅢ psuper gfp-neo shrna psuper gfp-neo DH5a ELISA TGF-β1shRNA ELISA shrna-a shrna-b shrna-c TGF-β1 shrna-b
P450 CYP4G19. Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody , 518060; 2.
2009 6 9 6 [ ] 1672-3619(2009)06-0591-06 591 P450 CYP4G19 1,2 1,2*,, 2, 2, 2, 2 1, (1., 518060; 2., 518020) P450 CYP4G19, CYP4G19 RT-PCR CYP4G19, T-A, pet-28a, BL21 (DE3),,,, ELISA Western-blot cdna 771bp,
Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements
5 5 2012 10 Chinese Optics Vol. 5 No. 5 Oct. 2012 1674-2915 2012 05-0525-06 - * 100190-14 - - 14. 51 μm 81. 4 μm - 1. 64 μm / O436. 1 TH703 A doi 10. 3788 /CO. 20120505. 0525 Correction of chromatic aberration
Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water
31 1 2010 1 ENVIRONMENTAL SCIENCE Vol. 31,No. 1 Jan.,2010, 3, (,, 100084) :,.,, ( Microcystis aeruginosa),3 (A 2 O ) 10 6 ml - 1,> 0139 d - 1. A 2 O222,. TP ( K max ) ( R max ), Monod. :; ; ; ; :X173 :A
Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2015 Supporting information An unusual bifunctional Tb-MOF for highly sensing
ScFv-Fc. China Biotechnology ScFv PCR. ScFv-Fc. ppiczα. Fc 2 ScFv-Fc ScFv. ppiczα /Fc. protein A. PCR ELISA Western blotting
China Biotechnology 2011 31 8 110-117 * ScFv-Fc 1** 2 1 4 1 3 2 1 510006 2 130021 3 510632 4 130021 ScFv ScFv-Fc RT- PCR IgG1 Fc ppiczα ppiczα/fc Fc 2 ScFv-Fc ScFv ScFv ppiczα/fc 1L protein A PCR ELISA
Construction and Evaluation of Lentiviral Vector pita-hbp1
ISSN 1007-7626 CN 11-3870 / Q 2010 11 Chinese Journal of Biochemistry and Molecular Biology 26 11 1044 ~ 1049 pita-hbp1 1 2 3 4 4 * 1 100191 2 100086 3 050031 4 100191 1 HBP1 pita-hbp1 Western HBP1 Q78
Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene
2001, 24 (1) : 2529 Journal of Nanjing Agricultural University rolc (, 210095) :, rolc ( Nicotiana tabacum ), GUS, PCR Southern rolc,, rolc : ; ; rolc ; : S572103513 : A : 1000Ο2030 (2001) 01Ο0025Ο05 Study
Antimicrobial Ability of Limonene, a Natural and Active Monoterpene
2010,32 (1) :24 28 http :/ / xuebao. jlau. edu. cn Journal of Jilin Agricultural University E2mail : jlndxb @vip. sina. com Ξ,,,, ΞΞ, 200062 : : 320 mg/ L,; ph 4 9, ; 80, 100,121 : : ; ; : TS20213 : A
Optimization of fermentation process for achieving high product concentration high yield and high productivity
1128 CHEMICAL INDUSTRY AND ENGINEERING PROGRESS 2006 25 10 ( 214036) (1) (2) (3) (4) (5) TQ 92 A 1000 6613 2006 10 1128 06 Optimization of fermentation process for achieving high product concentration
PNS mg kg - 1. Rb 1
94 2 3 3. 53002 2. 53000 3. 543000 86. 2 mg kg -. 8 mg kg - R Rg Rb 3P97 AUC 0 - R Rg Rb R 0. 8 ± 0. 09 vs 0. 6 ± 0. 06 h Rg 2. 03 ± 0. 76 vs. 74 ± 0. 27 h Rb 0. 76 ± 0. 39 vs 0. 74 ± 0. 7 h R 0. 96 ±
Rapid Raman spectra identification and determination of levofloxacin hydrochloride injection *
DOI:0.655/j.0254-793.20.09.039 75 * 2 2 3. 200435 2. 20203 3. 20000 ph R97 A 0254-793 20 09-75 - 05 Rapid Raman spectra identification and determination of levofloxacin hydrochloride injection * CHEN Bin
J. of Math. (PRC) Banach, , X = N(T ) R(T + ), Y = R(T ) N(T + ). Vol. 37 ( 2017 ) No. 5
Vol. 37 ( 2017 ) No. 5 J. of Math. (PRC) 1,2, 1, 1 (1., 225002) (2., 225009) :. I +AT +, T + = T + (I +AT + ) 1, T +. Banach Hilbert Moore-Penrose.. : ; ; Moore-Penrose ; ; MR(2010) : 47L05; 46A32 : O177.2
Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...
III Contents I II III Abstract... I Zusammenfassung... II Contents... III 1 Aim of the work... 1 2 Introduction... 2 2.1 Short overview of Chinese hamster ovary cell lines... 2 2.2 Unspecific mutations:
Differential Expression of DNMTs Between Gastric Tissues with and without H. Pylori Infection
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2011 11 27 11 1032 ~ 1038 DNMT 1 2 3 1 1 4 1 * 1 400016 2 400016 3 400016 4 400016 DNA DNA
Journal of Central South University (Science and Technology) May Bragg TU443 A (2011)
42 5 ( ) Vol.42 No.5 2011 5 Journal of Central South University (Science and Technology) May 2011 Bragg 1 1 1 2 2 (1. 330099 2. 330038) ( ) D10 Bragg TU443 A 1672 7207(2011)05 1442 05 Fiber Bragg grating
ACTA MATHEMATICAE APPLICATAE SINICA Nov., ( µ ) ( (
35 Þ 6 Ð Å Vol. 35 No. 6 2012 11 ACTA MATHEMATICAE APPLICATAE SINICA Nov., 2012 È ÄÎ Ç ÓÑ ( µ 266590) (E-mail: jgzhu980@yahoo.com.cn) Ð ( Æ (Í ), µ 266555) (E-mail: bbhao981@yahoo.com.cn) Þ» ½ α- Ð Æ Ä
High order interpolation function for surface contact problem
3 016 5 Journal of East China Normal University Natural Science No 3 May 016 : 1000-564101603-0009-1 1 1 1 00444; E- 00030 : Lagrange Lobatto Matlab : ; Lagrange; : O41 : A DOI: 103969/jissn1000-56410160300
Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang
13 4 2015 7 Chinese Journal of Bioprocess Engineering Vol. 13 No. 4 Jul. 2015 doi 10. 3969 /j. issn. 1672-3678. 2015. 04. 012 1 2 2 2 2 1. 830054 2. 361005 L- 50% IC 50 0. 27 mg /ml K I - K IS 0. 218 0.
þÿ Ç»¹º ³µÃ ± : Ãż²» Ä Â
Neapolis University HEPHAESTUS Repository School of Economic Sciences and Business http://hephaestus.nup.ac.cy Master Degree Thesis 2015 þÿ Ç»¹º ³µÃ ± : Ãż²» Ä Â þÿãå½±¹ã ¼±Ä¹º  ½ ¼ Ãͽ  þÿ±à ĵ»µÃ¼±Ä¹º
8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,
31 2003 8 (FENXI HUAXUE) 8 Chinese Journal of Analytical Chemistry 976 980 22( 82 252 272 )21,82 23,62 3 (, 510631) 22(82 252 272 )21,82 23,62 (BSA), 8Q5SAC BSA 298K, 35 40 6. 1 10 5 LΠmol 8Q5SAC, ph =
1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.
2 0 1 5 7 Journal of Chinese Institute of Food Science and Technology Vol. 15 No. 7 Jul. 2 0 1 5 1,2 1 1 1 1* ( 1 315211 2 315502) : ( ) : (E-Nose), - : GC-MS, 20.98% 2.5%, 53.15% 11.2%, 0. 51% 71.86%
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή Εργασία. Κόπωση και ποιότητα ζωής ασθενών με καρκίνο.
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή Εργασία Κόπωση και ποιότητα ζωής ασθενών με καρκίνο Μαργαρίτα Μάου Λευκωσία 2012 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ
Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic
NIRF Can Significantly Inhibit the Expression of Hepatitis B Virus Antigens in vitro and in vivo
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2012 11 28 11 1026 ~ 1032 NIRF 1 1 1 1 2 * 1 2 400016 NIRF Np95 / ICBP-90 like RING finger
Shiraia sp. Slf14 III
39 4 Vol 39 No 4 2015 7 Journal of Jiangxi Normal University Natural Science Jul 2015 1000-5862 2015 04-0430-05 Shiraia sp Slf14 III 1 1 2 1 1 1 2* 1 330022 2 330013 Polyketide synthase PKS Shiraia sp
Quantum dot sensitized solar cells with efficiency over 12% based on tetraethyl orthosilicate additive in polysulfide electrolyte
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2017 Supplementary Information (SI) Quantum dot sensitized solar cells with
No. 7 Modular Machine Tool & Automatic Manufacturing Technique. Jul TH166 TG659 A
7 2016 7 No. 7 Modular Machine Tool & Automatic Manufacturing Technique Jul. 2016 1001-2265 2016 07-0122 - 05 DOI 10. 13462 /j. cnki. mmtamt. 2016. 07. 035 * 100124 TH166 TG659 A Precision Modeling and
Supplementary information:
Supplementary information: Monitoring changes of docosahexaenoic acid-containing lipids during the recovery process of traumatic brain injury in rat using mass spectrometry imaging Shuai Guo 1, Dan Zhou
Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2
Free Radical Initiated Coupling Reaction of Alcohols and Alkynes: not C-O but C-C Bond Formation Zhongquan Liu,* Liang Sun, Jianguo Wang, Jie Han, Yankai Zhao, Bo Zhou Institute of Organic Chemistry, Gannan
Supporting Information
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Supporting Information Crotonols A and B, Two Rare Tigliane Diterpenoid
Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo
Bull. Earthq. Res. Inst. Univ. Tokyo Vol. 2.,**3 pp.,,3,.* * +, -. +, -. Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Kunihiko Shimazaki *, Tsuyoshi Haraguchi, Takeo Ishibe +, -.
Supporting Information
Supporting Information Mitochondria-Targeting Polydopamine Nanocomposites as Chemophotothermal Therapeutics for Cancer Zhuo Wang *,, Yuzhi Chen, Hui Zhang, Yawen Li, Yufan Ma, Jia Huang, Xiaolei Liu, Fang
Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk
32 3 2011 3 ENVIRONMENTAL SCIENCE Vol 32 No 3 Mar 2011 1 1 1 2 1 100101 2 663000 Panax notoginseng Burk F H Chen 6 9 ~ 242 0 mg kg - 1 48% 2 mg kg - 1 24% 81% 14% 57% 44% 100 mg kg - 1 ADI > > > > FAO
Nguyen Hien Trang* **
152 Nippon Shokuhin Kagaku Kogaku Kaishi Vol.., No.., +,+3 (,**1) 10 Nguyen Hien Trang* ** * Department of Food Science and Technology, Hue University of Agriculture and Forestry ** Properties of "Shishibishio
Preparation and Characterization of a Novel Recombinant Imaging Agent Directing Thrombus
ISSN 100727626 CN 1123870ΠQ 2001 12 Chinese Journal of Biochemistry and Molecular Biology 17 (6) :781 785,,,, (, 100871) 3 2 GMP2140 SZ51, 1 SZ51 (ScFv2SZ51) 1 (MT2 ) cdna, BL21 (DE3) plyss, HLMT 40 mgπl
Application of Wavelet Transform in Fundamental Study of Measurement of Blood Glucose Concentration with Near2Infrared Spectroscopy
37 6 2004 6 Journal of Tianjin University Vol. 37 No. 6 Jun. 2004 Ξ 1,2, 1,2, 3 (1., 300072 ; 2. 2, 300072 ; 3., 300072) :,,,.,,(RMSEP) 53 %58 %.. : ; ; : O657. 33 : A : 04932 2137 (2004) 062 05352 05
, DYY-8B, ; : Centrifuge 11 R. min
40 Chinese Journal of Otology Vol. 8 No.1 2010 DNA A1555G - ( 030001) 2 12 68 DNA (polymerase chain reaction PCR) DNA A1555G 7 DNA 12S rrna 1555 A G A1555G ; DNA A1555G ; ; ; R764.433 R342.4 A 1672-2922(2010)01-040-06
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity Jian-Long Li 1,a, Wei Zhao 1,a, Chen Zhou 1,a, Ya-Xuan
Science of Sericulture
Science of Sericulture 2012 38 1 0065-0069 ISSN 0257-4799 CN 32-1115 /S E-mail CYKE@ chinajournal. net. cn 215123 25 0 ~ 24 h GSH GSSG GSH + 2GSSG GSH /GSSG S- GST TPX 23% GR 57% GSH TPX GST GSSG 61% GSH
ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ
- - ό ό : Ω ί ό ί ώ.. ά ή ί ός ή ς ύ ί ί ή έ ώ ό. ή ς ά ς ής ό ός ά ς ή έ ός ή ς ί ής ί ς. ό έ ώ - ώ ή ής ή ς- ί ά ά ς ί ς. ά ί ί έ έ ά ύ ή, ό ί ά, ό ό ά έ ά ής ί ύ George Wald ή ί έ ς ί ύ ό ς ί ς ά έ
PCR. Site-directed Mutagenesis of Sumf 1 Gene of Mouse Based on Overlap Extension PCR and Construction of Eukaryotic Expression Vector
13 5 Vol13 No5 9 10 Life Science Research Oct 9 9 PCR Sumf1 *,,,,, 481 : (chromatin immunoprecipitation assay, ChIP) activator protein-2 alpha (AP-2 α) Sumf 1 PCR, AP-2 α Sumf 1, DNA, Sumf 1 103 ~111,
Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer
Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer Naomi Morota Newman M Key Words woman diagnosed with breast cancer, rehabilitation nursing care program, the
Expression and Purification of HIV-1 Protease and the Establishment. of a Method for Protease Inhibitor Screening
21 2 212126-130 2006 3 VIROLOGICA SINICA March 2006 HIV-1 * 1,3 1,3 1 2 2 1,** (1 650223; 2 650231; 3 100039) Expression and Purification of HIV-1 Protease and the Establishment of a Method for Protease
# School of Pharmaceutical Sciences, Zhengzhou University, 100 Kexue Avenue, Zhengzhou, Henan , China.
upporting Information Triazole-dithiocarbamate based LD1 selective inactivators inhibit gastric cancer cell growth, invasion and migration Yi-Chao Zheng, #, Ying-Chao Duan, #, Jin-Lian Ma, # Rui-Min Xu,
Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil
J. Jpn. Soc. Soil Phys. No. +*0, p.- +*,**1 Eh * ** Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil Daisuke MURAKAMI* and Tatsuaki KASUBUCHI** * The United Graduate
Apr Vol.26 No.2. Pure and Applied Mathematics O157.5 A (2010) (d(u)d(v)) α, 1, (1969-),,.
2010 4 26 2 Pure and Applied Matheatics Apr. 2010 Vol.26 No.2 Randić 1, 2 (1., 352100; 2., 361005) G Randić 0 R α (G) = v V (G) d(v)α, d(v) G v,α. R α,, R α. ; Randić ; O157.5 A 1008-5513(2010)02-0339-06
Octretide joint proton pump inhibitors in treating non-variceal gastrointestinal bleeding a Metaanalysis
528 2012 6 21 6 Chin J Gastroenterol Hepatol Jun 2012 Vol. 21 No. 6 doi 10. 3969 /j. issn. 1006-5709. 2012. 06. 011 Meta 430060 Cochrane Library Pubmed 2 Revman 5. 0 6 484 Meta Meta R573. 2 A 1006-5709
AH6 Western Blot Western Blot RIPA 90V 160V 100V 1.5 3%BSA 15 AH6 1 4000 4 1 1000 30 Prionics -Check WESTERN 100% 99.4% 100% 100% Western Blot
WESTERN BLOT * AH6 Western Blot Western Blot RIPA 90V 160V 100V 1.5 3%BSA 15 AH6 140004 11000 30 Prionics -Check WESTERN 100% 99.4% 100%100% Western Blot (Transmissible Spongiform Encephalopathy, TSE)
HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332
,**1 The Japanese Society for AIDS Research The Journal of AIDS Research +,, +,, +,, + -. / 0 1 +, -. / 0 1 : :,**- +,**. 1..+ - : +** 22 HIV AIDS HIV HIV AIDS : HIV AIDS HIV :HIV AIDS 3 :.1 /-,**1 HIV
http://doc.rero.ch To whom correspondence should be addressed: Dr. Beat Schwaller, Unit of Anatomy,
Published in "" which should be cited to refer to this work. Calretinin is essential for mesothelioma cell growth/survival in vitro: a potential new target for malignant mesothelioma therapy? Anatomy,
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology HBx HBxΔ127
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2011 5 27 5 426 ~ 430 X HBxΔ127 ERK 1 * * 300071 hepatitis B virus HBV X HBx HBx HBxΔ127 1
[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,
in vitro αα In Vitro α-glucosidase and α-amylase Inhibitory Effects of Herbal Tea Leaves from Yacon (Smallanthus sonchifolius) 1, 1, 1, 2, 1, 2, 3, 1, 2, 1, 2, 1, 2, 1, 2 1, 2, *, 1 2, 3 Yuto Ueda 1, Shintaro
High mobility group 1 HMG1
Vol. 29, pp.705 ~ 711, 2001 High mobility group 1 HMG1 13 12 20 anti-neutrophil cytoplasmic antibodies, ANCA ANCA 1982 Davies 1980 1 high mobility group HMG1 HMG2 30 kd high mobility group HMGHMG HMG1