,, ; 3,, *, Da 84% 80% 77% 78% 82%
|
|
- ῬαΧάβ Αλεβίζος
- 6 χρόνια πριν
- Προβολές:
Transcript
1 Genomics and Applied Biology, 2009, Vol.28, No.2, Research Report NTA 1,2 3 2* 1* 1,, ; 2,,, ; 3,, *, gaojian@icbr.ac.cn; xinshen77@126.com RT-PCR NTA NTA 698 bp 516 bp Da 84% 80% 77% 78% 82% alpha-d (QXDXNXVXY), NTA,,, Cloning and Sequence Analysis of the Lectin Ortholog NTA from Chinese Narcissus (Narcissus tazetta var. Chinensis Roem) and Structure Prediction the Protein Liu Wenfeng 1,2 Hou Chenglin 3 Gao Jian 2* Shen Xin 1* 1 Beijing Forestry University, College of Biological Sciences and Biotechnology, Beijing, ; 2 International Centre for Bamboo and Rattan, Key Laboratory of Bamboo and Rattan Science and Technology of the SFA, Beijing, ; 3 Capital Normal University, College of Life Science, Beijing, * Corresponding authors, gaojian@icbr.ac.cn; xinshen77@126.com Abstract Lectins are carbohydrate-binding proteins which are important in immune responses. A full-length cdna of a lectin gene designated as NTA was cloned from Chinese Narcissus with the method of RT-PCR. With a size of 698 bp including an 516 bp open reading frame, the NTA encode a precursor lectin with 172 amino acids. The pi and M.W. of the protein NTA were predicted to be 5.84 and Da, respectively. The homologous analysis showed that the sequence similarity between NTA and those from species as Narcissus hybrid cultivar agglutinin, Galanthus nivalis agglutinin, Clivia miniata agglutinin, Lycoris radiata agglutinin and Hippeastrum vittatum agglutinin were 84%, 80%, 77%, 78%, 82%, respectively. The prediction of the protein structure indicated that tertiary protein structure of lectin from Narcissus was similar to that of Narcissus pseudonarcissus, containing three functional domains specific for agglutination with the consensus sequence motif QXDXNXVXY involved in alpha-d-mannose recognition. Narcissus tazetta var. Chinensis Roem, NTA, Gene cloning, Sequence analysis, Protein structure pre- Keywords diction ( C07)
2 NTA 217 Cloning and Sequence Analysis of the Lectin Ortholog NTA from Chinensis Narcissus, 2003;, 2001;, 1999) zga (Ye et al., 2008) (, 2001) Hilder (1995) GNA (, 2006) (GNA) (Narcissus pseudonarcissus) (NPL) (, 2005) (HIV) (FIV) (Lopez et al., 2003) (Narcissus tazetta var. Chinensis Roem) (, 2001) ~25 (, 2006) RNA 7 (monocot mannose-binding lectin, MBL) Taq DNA pmd18 T 3' Full RACE (TaKaRa) RT-PCR (galanthus nivalis agglutinin, GNA) (Promega) Trizol reagent (Invitrogen) DNA ( ) Sigma GNA 1.3 RNA cdna (, 1998) (, 2001) RNA Invitrogen Trizol reagent GNA 0.1 g 1.5 ml RNase 4 (, Trizol 1 ml 5 min 200 μl 1998;, 2002;, 2000; Poppy, 1997; 15 s 2~3 min g
3 218 Genomics and Applied Biology min pmd18 T (E. 500 μl 10 min g 4 cdna Promega RT-PCR coli) TOP10 PCR 10 min 1 ml 75% g 4 5 min 100 μl DEPC-ddH 2 O 2 28S 18S 2.1 NTA 5' 3' RACE A 260 / 280 RNA RNA 80 lectin LE01F LE01R RNA cdna Kit PCR PCR 1% 300 bp 20 3' RACE cdna TaKaRa 3' Full RACE ( 1A) PCR RACE-PCR 20 lectin 5' 327 bp 1.4 NTA LE02F lectin RNA 3' RACE LE01F (5' TACAAAATGGCTAAGTcDNA 3' RACE-PCR 1% CAAGT 3') LE01R (5' ACCATTCTCGCCTCCAG 3' RACE-PCR 500 bp ( 1B) TGT 3') cdna PCR 532 bp 94 4 min s s 72 1 min min 2.2 NTA PCR 1 μl 5' 3' 4 μl pmd18 T 698 bp lectin (Escherichia coli) TOP bp PCR RNA NTA LE02F cdna PCR (5' GACAAGCCTATCTGGGCAACC 3') lectin 3' RACE cdna ( 1C) 94 3 min s 57 PCR 1 D 30 s 72 1 min min PCR ( 2) lectin 1 μl 4 μl 516 bp PCR : A: NTA 5' (327 bp, ); B: 3' RACE-PCR (532 bp, ); C: 1~3: NTA PCR ( ); D: NTA PCR, 1~2: ( ) Figure 1 PCR products checked by electrophoresis Note: A: NTA gene 5' fragment PCR product (327 bp, marked with arrow); B: 3' RACE-PCR products (532 bp, marked with arrow); C: 1~3: PCR products of NTA gene ORF (marked with arrow); D: Lawn PCR of NTA gene ORF, 1~2: Positive clones (marked with arrow)
4 NTA 219 Cloning and Sequence Analysis of the Lectin Ortholog NTA from Chinensis Narcissus 2 NTA Figure 2 The cdna sequence and its coding amino acids sequence of the NTA of Chinese Narcissus 18 26~ Da 5.84 NTA 2.2 NTA lectin (NPL) ( 5B) (Sauerborn et al., 1999) 5A 5B NCBI Blast NTA NTA (Lycoris radiate) (Clivia miniata) (Hippeastrum vittatum) (Pang et al., 2002) NTA NTA alpha-d ( 2) 82% NTA 51~59 82~90 114~122 NTA (Narcissus hybrid cultivar) ( 5C ) ( 5 D) QXDXNXVXY 3 (AAA33549 ) (JE0136) (Hester and Wright, 1996; Chandra et al., 1999) (Clivia miniata) (AAA19913) (Lycoris radiata) (BAD98797) 3 (Amaryllis vittata) (agglutinin, AAP57409) 84% 80% 77% 78% 82% Blast DNAMAN DNAStar Cluster W NTA ( 3) lectin 172 NCBI ( 4) NTA NTA 82% NTA % NTA NCBI SWISS MODEL (MBL) NTA ( 5 A) NTA
5 220 Genomics and Applied Biology 3 NTA lectin : (AAA33549); (JE0136); (AAA19913); (BAD98797); (AAW22055); (AAP57409); Figure 3 Multiple alignment of the proteins encoded by NTA and other lectin proteins Note: Narcissus hybrid cultivar (AAA33549); Galanthus nivalis (JE0136); Clivia miniata (AAA19913); Lycoris radiata (BAD98797); Lycoris sp. (AAW22055); Amaryllis vittata (AAP57409); The same as below 4 NTA lectin : (AAP37975); (AAW22055); (AAO595-06); (BAD67183); (AAW48531); (AAW82332) Figure 4 Phylogenetic tree analysis of the proteins encoded by NTA and other lectin proteins Note: Zephyranthes grandiflora (AAP37975); Lycoris sp. (AAW22-055); Crinum asiaticum var. sinicum (AAO59506); Dioscorea polysachya (BAD67183); Allium sativum (AAW48531); Polygonatum roseum (AAW82332) 5 Figure 5 Tertiary protein structure of lectin from Chinensis Narcissus and Narcissus pseudonarcissus
6 NTA 221 Cloning and Sequence Analysis of the Lectin Ortholog NTA from Chinensis Narcissus NTA (GNA) (NPL) (HIV) (FIV) ExPasy SWISS MODEL (Lopez et al., 2003) NTA 3 QXDXNXVXY 3 Chandra N.R., Ramachandraiah G., Bachhawat K., Dam T.K., 4 Surolia A., and Vijayan M., 1999, Crystal structure of a beta-prism dimeric mannose-specific agglutinin from garlic: quaternary fold 3 association and carbohydrate specificity, J. Mol. Biol., 285 (3): (Hester and Wright, 1996) Guo W.J., Li Y., Tang K.X., Dong Z., Ye M.M., and Shen D.L., 1998, Preliminary study of the introduction and expression of GNA gene in lettuce (L. sativa), Fudan Xuebao (Journal NTA of Fudan University (Natural Science), 37(4): ( NPL GNA,,,,,, 1998, GNA 4 (L. sativa), ( ), 37(4): ) beta-prism Hester G., and Wright C.S., 1996, The mannose-specific bulb fold lectin from Galanthus nivalis (snowdrop) binds mono- and dimannosides at distinct sites. Structure analysis of refined NTA complexes at 2.3 A and 3.0 A resolution., J. Mol. Biol., 262 (4): Hilder V.A., Powell K.S., Gatehuse A.M.R., Gatehouse J.A., Gatehouse L.N., Shi Y., Hamilton W.D.O., Merryweather A., Newell C.A., Timans J.C., Peumans W.J., Damme E., and (Stagonospora curtisii) Boulter D., 1995, Expression of snowdrop lectin in transgenic tobacco plants results in added protectin against aphids, Transgenic Research, 4(1): l8-25 Hu Y.H., 2001, A biological study of Lectin, Jiangxi Jiaoyu Xueyuan Xuebao (Journal of Jiangxi Institute of Education), 22(6): (, 2001,,, 22(6): 47-49) Li F.L., Xu P.Z., Xiao Y., Zhang H.Y., Wang X.D., and Wu X.J., 2006, Plant lectin and its application in the genetic engineering of plant resistance to insects, Anhui Nongye Kexue (Journal of Anhui Agricultural Science), 34(3): ,439 (,,,,,, 2006, (MBL),, (MBL) 34(3): ,439) Li Q.J., Dong Y.T., and Shi B., 2002, Advances on the insect-resistance gene of plant, Linye Keji (Forestry Science and Technology), 27(2): (,,, 2002, (MSLs),, 27(2): 22-25) N Liu W.B., Liang F., and Chang T.J., 2000, Construction of a plant
7 222 Genomics and Applied Biology medial expression vector containing snowdrop lectin (GNA) ueyuan Xuebao (Journal of Ningxia Agricultural College), gene for Agrobacterium tumefaciens mediated transformation, 22(2): (,,,, 2001, Shangqiu Shifan Xueyuan Xuebao (Journal of,, 22(2): 25-27) Shangqiu Teachers College), 2(16): (,, Sauerborn M.K., Wright L.M., Reynolds C.D., Grossmann J.G.,, 2000, and Rizkallah P.J., 1999, Insights into carbohydrate recognition by Narcissus pseudonarcissus lectin: the crystal struc- (GNA),, 2(16): ) Lopez S., Armand-Ugon M., Bastida J., Viladomat F., Este J.A., Stewart D., and Codina C., 2003, Anti-human immunodeficiency ture at 2 魡 resolution in complex with alpha1 3 mannobiose, J. Mol. Biol, 290: Wang Z.B., Li X.Y., and Guo S.D., 1998, PIant lectins and ansus virus type 1 (HIV 1) activity of lectins from Narcisti-insect genetic engineering, Shengwu Jishu Tongbao species, Planta Med., 69(2): Luo S.L., and Zhangsun D.T., 2001, Snowdrop lectin gene and its application, Shengwuxue Tongbao (Bulletin of Biology), 36 (Biotechnology Bulletin), (2): 5-l0 (,,, 1998,,, (2): 5-l0) (12): 9-10 (,, 2001, Ye S.H., Chen S., Zhang F., Wang W., Tian Q., Liu J.Z., Chen F.,,, 36(12): 9-10) Ming K., Wan S.Q., and Gu D.J., 2003, Advances in researches of the introduction and expression of snowdrop lectin gene on insect-resistant transgenic plants, Shijie Nongyao (World and Bao J.K., 2008, Transgenic tobacco expressing Zephyranthes grandiflora agglutinin confers enhanced resistance to aphids, Appl Biochem Biotechnol (online) Zhao Y.S., 2001, The biological function and application of Pesticides), 25(5): (,,, 2003, lectin, Anhui Nongye Daxue Xuebao (Journal of Anbui A-,, 25(5): gricultural University (Natural Science Edition)), 28 (4): 27-30) (, 2001,, Pang Y.Z., Yao J.H., Shen G.A., Tang K.X., and Tan F., 2002, Molecular cloning of lectin gene from Zephyranthes Candida, Journal of Southwest China Normal University (Natural Science Edition), 27(3): (Chinese Journal In English) Poppy G.M., 1997, Tritrophie interactions: Improving ecological understanding and biological control? Endeavour, 21 (2): Qu L., Wu B., CaoY.L., and Luo Q., 2001, Discussion on issue in study on transgenic Chinese wolfberry, Ningxia Nongx-, 28(4): ) Zhu Y., 2005, The function and application of agglutinin, Shuichan Kexue (Fisheries Science), 24(12): (, 2005,,, 24(12): 48-49) Zhu Y., Zhu Z., and Xu H.L., 1999, Cloning and sequencing of snowdrop lectin cdna and polymorphism analysis, Gaojishu Tongxun (High Technology Letters), 9(9): (,,, 1999,,, 9(9): 36-41)
SCIENTIA SILVAE SINICAE. a/ b. oldhamii). The length of cab2bo1 ( GenBank accession
43 3 2 0 0 7 3 SCIENTIA SILVAE SINICAE Vol143, No13 Mar., 2 0 0 7 a/ b 3 1 1 2 1 (1. 100102 ; 2. 100091) : RT2PCR RACE a/ b cdna, cab2 BO1 ( GenBank : EF061137) 1 102 bp, 64 861 bp 1, 265 cab2bo1 64 232
Chalkou I. C. [PROJECT] Ανάθεση εργασιών.
Πληροφορική της Υγείας 2014 Chalkou I. C. [PROJECT] Ανάθεση εργασιών. Περιεχόμενα 1. Ομάδα ΣΤ... 3 1.1 ΜΑΡΚΟΠΟΥΛΟΥ- ΣΠΥΡΟΠΟΥΛΟΥ -ΚΩΝΣΤΑΝΤΟΠΟΥΛΟΥ... 3 1.2 ΜΑΡΚΟΣ- ΚΟΥΤΣΟΠΟΥΛΟΣ ΑΥΓΕΡΗ - ΜΠΟΥΖΑΛΑ... 3 1.3
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to facilitate intracellular survival Hongwei Gu 1,2*, Chihao Zhao 1,2*, Tianfu Zhang 1,2*, Hongwei Liang 1,2, Xiao-Ming Wang 1,
Shiraia sp. Slf14 III
39 4 Vol 39 No 4 2015 7 Journal of Jiangxi Normal University Natural Science Jul 2015 1000-5862 2015 04-0430-05 Shiraia sp Slf14 III 1 1 2 1 1 1 2* 1 330022 2 330013 Polyketide synthase PKS Shiraia sp
The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea
2011 48 4 909 914 * 1 2** 2 2 2 2 2*** 1. 110161 2. 100081 026000 3 Calliptamus italicus L. 3 LC 50 LC 90 1. 34 14. 17 mg / L LC 50 LC 90 2. 09 45. 22 mg / L 50 mg / L 14 d 87% 100% 50 mg / L 50% The toxicity
CBF1. Study on CBF1 Gene Transferred from Transgenic Strawberry to Nontransgenic
2007 5 3 309 313 Molecular Plant Breeding, 2007, Vol.5, No.3, 309 313 Research Report CBF1 1,3 2 1 3 1 1* 1,, 100093; 2,, 1000871; 3,, 010019 *, jinwanmei@sohu.com CBF1 PCR 640 bpcbf1 20 16 2CBF1, CBF1,,
Apr Vol.26 No.2. Pure and Applied Mathematics O157.5 A (2010) (d(u)d(v)) α, 1, (1969-),,.
2010 4 26 2 Pure and Applied Matheatics Apr. 2010 Vol.26 No.2 Randić 1, 2 (1., 352100; 2., 361005) G Randić 0 R α (G) = v V (G) d(v)α, d(v) G v,α. R α,, R α. ; Randić ; O157.5 A 1008-5513(2010)02-0339-06
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN
BIOTECHNOLOGY BULLETIN 2011 3 α 1 2-300457 PCR Helicobacter pylori HP DNA α 1 2- α 1 2-fucosyltransferase α 1 2-fuct 906 bp pet-22b + pet-fuct BL21 DE3 25 0. 1 mmol /L IPTG 4 h SDS-PAGE 33 kd α 1 2- BL21
SOD SNP % Cu /Zn-SOD. DAM- BE DNAStar % Mn /Fe-SOD. 6 1SNP /17. 9 bp
2011 33 6 1206-1211 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com SOD SNP 1 2 3 2 2* 1. 330004 2. 330004 3. 510006 GenBank Cu /Zn-SOD Mn /Fe-SOD
LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing
2003 61 3, 435 439 ACTA CHIMICA SINICA Vol 61, 2003 No 3, 435 439 2 ΞΞ ( 400715), 2, 2, 2, 3/ 2 2,, 2,, Ne w Methods for the Determination of the Inclusion Constant between Procaine Hydrochloride and 2Cyclodextrin
Antimicrobial Ability of Limonene, a Natural and Active Monoterpene
2010,32 (1) :24 28 http :/ / xuebao. jlau. edu. cn Journal of Jilin Agricultural University E2mail : jlndxb @vip. sina. com Ξ,,,, ΞΞ, 200062 : : 320 mg/ L,; ph 4 9, ; 80, 100,121 : : ; ; : TS20213 : A
Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
33 2 2011 4 Vol. 33 No. 2 Apr. 2011 1002-8412 2011 02-0096-08 1 1 1 2 3 1. 361005 3. 361004 361005 2. 30 TU746. 3 A Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2
344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.
Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic
Supporting Information Asymmetric Binary-acid Catalysis with Chiral Phosphoric Acid and MgF 2 : Catalytic Enantioselective Friedel-Crafts Reactions of β,γ- Unsaturated-α-Ketoesters Jian Lv, Xin Li, Long
Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica
35 1 2 0 1 7 1 DOI 10. 13193 /j. issn. 1673-7717. 2017. 01. 035 1 1 1 1 2 1. 150036 2. 150040 D101 DEAE Cellulose 52 Sephacryl S - 300 - - PJP - 1a PJP - 3a 1. 34 10 3 Da 1. 70 10 7 Da - PJP - 3a 4. 56
Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene
2001, 24 (1) : 2529 Journal of Nanjing Agricultural University rolc (, 210095) :, rolc ( Nicotiana tabacum ), GUS, PCR Southern rolc,, rolc : ; ; rolc ; : S572103513 : A : 1000Ο2030 (2001) 01Ο0025Ο05 Study
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity Jian-Long Li 1,a, Wei Zhao 1,a, Chen Zhou 1,a, Ya-Xuan
Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin
2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,
Supplementary Information for
Supplentary Information for Aggregation induced blue-shifted ission molecular picture from QM/MM study Qunyan Wu, a Tian Zhang, a Qian Peng,* b Dong Wang, a and Zhigang Shuai* a a Key Loratory of Organic
Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone
ISSN 100727626 CN 1123870ΠQ 2002 12 Chinese Journal of Biochemistry and Molecular Biology 18 (6) :693 697 cdna, 3, (, 150030) RNA, cdna cdna PCR, 380 bp cdna pmd2182t2verctor 3,,, 96 %, 95 %,, 74 %, 95
ER-Tree (Extended R*-Tree)
1-9825/22/13(4)768-6 22 Journal of Software Vol13, No4 1, 1, 2, 1 1, 1 (, 2327) 2 (, 3127) E-mail xhzhou@ustceducn,,,,,,, 1, TP311 A,,,, Elias s Rivest,Cleary Arya Mount [1] O(2 d ) Arya Mount [1] Friedman,Bentley
A new ent-kaurane diterpene from Euphorbia stracheyi Boiss
SUPPLEMENTARY MATERIAL A new ent-kaurane diterpene from Euphorbia stracheyi Boiss Tie Liu a, Qian Liang a,b, Na-Na Xiong a, Lin-Feng Dai a, Jun-Ming Wang a,b, Xiao-Hui Ji c, Wen-Hui Xu a, * a Key Laboratory
Identification of Fish Species using DNA Method
5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,
Table S1. Summary of data collections and structure refinements for crystals 1Rb-1h, 1Rb-2h, and 1Rb-4h.
Supporting Information [NH 3 CH 3 ] [In SbS 9 SH]: A novel methylamine-directed indium thioantimonate with Rb + ion-exchange property Kai-Yao Wang a,b, Mei-Ling Feng a, Jian-Rong Li a and Xiao-Ying Huang
Approximation Expressions for the Temperature Integral
20 7Π8 2008 8 PROGRSS IN CHMISRY Vol. 20 No. 7Π8 Aug., 2008 3 3 3 3 3 ( 230026),,,, : O64311 ; O64213 : A : 10052281X(2008) 07Π821015206 Approimation pressions for the emperature Integral Chen Haiiang
D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical and experimental study
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical
Journal of Central South University (Science and Technology) May Bragg TU443 A (2011)
42 5 ( ) Vol.42 No.5 2011 5 Journal of Central South University (Science and Technology) May 2011 Bragg 1 1 1 2 2 (1. 330099 2. 330038) ( ) D10 Bragg TU443 A 1672 7207(2011)05 1442 05 Fiber Bragg grating
Supporting Information
Supporting Information for AgOTf-catalyzed one-pot reactions of 2-alkynylbenzaldoximes with α,β-unsaturated carbonyl compounds Qiuping Ding 1, Dan Wang 1, Puying Luo* 2, Meiling Liu 1, Shouzhi Pu* 3 and
[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,
in vitro αα In Vitro α-glucosidase and α-amylase Inhibitory Effects of Herbal Tea Leaves from Yacon (Smallanthus sonchifolius) 1, 1, 1, 2, 1, 2, 3, 1, 2, 1, 2, 1, 2, 1, 2 1, 2, *, 1 2, 3 Yuto Ueda 1, Shintaro
ΕΦΑΡΜΟΓΗ ΕΥΤΕΡΟΒΑΘΜΙΑ ΕΠΕΞΕΡΓΑΣΜΕΝΩΝ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΕ ΦΥΣΙΚΑ ΣΥΣΤΗΜΑΤΑ ΚΛΙΝΗΣ ΚΑΛΑΜΙΩΝ
ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙ ΕΥΤΙΚΟ Ι ΡΥΜΑ ΚΡΗΤΗΣ ΤΜΗΜΑ ΦΥΣΙΚΩΝ ΠΟΡΩΝ ΚΑΙ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΕΦΑΡΜΟΓΗ ΕΥΤΕΡΟΒΑΘΜΙΑ ΕΠΕΞΕΡΓΑΣΜΕΝΩΝ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΕ ΦΥΣΙΚΑ ΣΥΣΤΗΜΑΤΑ ΚΛΙΝΗΣ ΚΑΛΑΜΙΩΝ ΕΠΙΜΕΛΕΙΑ: ΑΡΜΕΝΑΚΑΣ ΜΑΡΙΝΟΣ ΧΑΝΙΑ
Quick algorithm f or computing core attribute
24 5 Vol. 24 No. 5 Cont rol an d Decision 2009 5 May 2009 : 100120920 (2009) 0520738205 1a, 2, 1b (1. a., b., 239012 ; 2., 230039) :,,.,.,. : ; ; ; : TP181 : A Quick algorithm f or computing core attribute
( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;
28 1 2006 1 RESOURCES SCIENCE Vol. 28 No. 1 Jan. 2006 :1007-7588(2006) 01-0002 - 07 20 1 1 2 (11 100101 ; 21 101149) : 1978 1978 2001 ; 2010 ; ; ; : ; ; 24718kg 1) 1990 26211kg 260kg 1995 2001 238kg( 1)
CorV CVAC. CorV TU317. 1
30 8 JOURNAL OF VIBRATION AND SHOCK Vol. 30 No. 8 2011 1 2 1 2 2 1. 100044 2. 361005 TU317. 1 A Structural damage detection method based on correlation function analysis of vibration measurement data LEI
Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic
Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...
III Contents I II III Abstract... I Zusammenfassung... II Contents... III 1 Aim of the work... 1 2 Introduction... 2 2.1 Short overview of Chinese hamster ovary cell lines... 2 2.2 Unspecific mutations:
Vol. 31,No JOURNAL OF CHINA UNIVERSITY OF SCIENCE AND TECHNOLOGY Feb
Ξ 31 Vol 31,No 1 2 0 0 1 2 JOURNAL OF CHINA UNIVERSITY OF SCIENCE AND TECHNOLOGY Feb 2 0 0 1 :025322778 (2001) 0120016205 (, 230026) : Q ( m 1, m 2,, m n ) k = m 1 + m 2 + + m n - n : Q ( m 1, m 2,, m
Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang
13 4 2015 7 Chinese Journal of Bioprocess Engineering Vol. 13 No. 4 Jul. 2015 doi 10. 3969 /j. issn. 1672-3678. 2015. 04. 012 1 2 2 2 2 1. 830054 2. 361005 L- 50% IC 50 0. 27 mg /ml K I - K IS 0. 218 0.
P450 CYP4G19. Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody , 518060; 2.
2009 6 9 6 [ ] 1672-3619(2009)06-0591-06 591 P450 CYP4G19 1,2 1,2*,, 2, 2, 2, 2 1, (1., 518060; 2., 518020) P450 CYP4G19, CYP4G19 RT-PCR CYP4G19, T-A, pet-28a, BL21 (DE3),,,, ELISA Western-blot cdna 771bp,
þÿ Ç»¹º ³µÃ ± : Ãż²» Ä Â
Neapolis University HEPHAESTUS Repository School of Economic Sciences and Business http://hephaestus.nup.ac.cy Master Degree Thesis 2015 þÿ Ç»¹º ³µÃ ± : Ãż²» Ä Â þÿãå½±¹ã ¼±Ä¹º  ½ ¼ Ãͽ  þÿ±à ĵ»µÃ¼±Ä¹º
Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology
2012 34 2 382-387 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com 212018 105 W 42 2 min 0. 631 TS202. 3 A 1000-2286 2012 02-0382 - 06 Optimizing
DNA G7444A, 2. Study on a new point mutation of nt7444 G A in the mitochondrial DNA in a type 2 diabetes mellitus family
HEREDITAS (Beijing) 2007 4, 29(4): 433 437 ISSN 0253-9772 www.chinagene.cn DOI: 10.1360/yc-007-0433 2 DNA G7444A,,,,,,,, 350005 : PCR-RFLP 2 DNA G7444A,, 27, 11 DNA G7444A, 11 2 5, 1,, DNA G7444A, 2 :
,,, (, 100875) 1989 12 25 1990 2 23, - 2-4 ;,,, ; -
25 3 2003 5 RESOURCES SCIENCE Vol. 25 No. 3 May 2003 ( 100875) : 500L - 2-4 - 6-8 - 10 114h - 120h 6h 1989 12 25 1990 2 23-2 - 4 : ; ; - 4 1186cm d - 1 10cm 514d ; : 714 13 317 714 119 317 : ; ; ; :P731
Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2
Free Radical Initiated Coupling Reaction of Alcohols and Alkynes: not C-O but C-C Bond Formation Zhongquan Liu,* Liang Sun, Jianguo Wang, Jie Han, Yankai Zhao, Bo Zhou Institute of Organic Chemistry, Gannan
Chalkou I. C. [PROJECT] Ανάθεση εργασιών.
Πληροφορική της Υγείας 2014 Chalkou I. C. [PROJECT] Ανάθεση εργασιών. Περιεχόμενα 1. Ομάδα Δ... 3 1.1 Σκιαδά Σαϊσανά Σιδέρη- Γεωργίου... 3 1.2 ΜΗΤΡΟΥ - ΜΠΑΡΑ... 3 1.3 ΜΠΟΧΑΤΖΙΑΡ Α.- ΜΠΟΧΑΤΖΙΑΡ Φ. - ΠΛΕΥΡΙΑ...
Αξιολόγηση της αισθητικής αξίας δασογεωργικών και γεωργικών συστημάτων
Αξιολόγηση της αισθητικής αξίας δασογεωργικών και γεωργικών συστημάτων Α. Σιδηροπούλου 1, M. Βραχνάκης 2, Γ. Φωτιάδης 3 και Δ. Μπούσμπουρας 4 1 Εργαστήριο Λιβαδικής Οικολογίας, Τ.Θ. 286, Α.Π.Θ., Τ.Κ. 54124,
Supporting Information
Supporting Information Mitochondria-Targeting Polydopamine Nanocomposites as Chemophotothermal Therapeutics for Cancer Zhuo Wang *,, Yuzhi Chen, Hui Zhang, Yawen Li, Yufan Ma, Jia Huang, Xiaolei Liu, Fang
SUPPLEMENTARY INFORMATION
Sensitivity of [Ru(phen) 2 dppz] 2+ Light Switch Emission to Ionic Strength, Temperature, and DNA Sequence and Conformation Andrew W. McKinley, Per Lincoln and Eimer M. Tuite* SUPPLEMENTARY INFORMATION
Advance in Nanorealgar Studies
21 5 2009 5 PROGRESS IN CHEMISTRY Vol. 21 No. 5 May, 2009 1 1 2 3 (1. 430074 ; 2. 430074),,, ;,, : O61316 ; R284 : A : 10052281X(2009) 0520934206 Advance in Nanorealgar Studies Ye Xiaochuan 1 Yang Xiangliang
ΙΩΑΝΝΗ ΑΘ. ΠΑΠΑΪΩΑΝΝΟΥ
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΓΕΩΠΟΝΙΑΣ, ΔΑΣΟΛΟΓΙΑΣ ΚΑΙ ΦΥΣΙΚΟΥ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΤΜΗΜΑ ΓΕΩΠΟΝΙΑΣ ΤΟΜΕΑΣ ΑΓΡΟΤΙΚΗΣ ΟΙΚΟΝΟΜΙΑΣ ΙΩΑΝΝΗ ΑΘ. ΠΑΠΑΪΩΑΝΝΟΥ Πτυχιούχου Γεωπόνου Κατόχου Μεταπτυχιακού
Supporting Information. Generation Response. Physics & Chemistry of CAS, 40-1 South Beijing Road, Urumqi , China. China , USA
Supporting Information Pb 3 B 6 O 11 F 2 : A First Noncentrocentric Lead Fluoroborate with Large Second Harmonic Generation Response Hongyi Li, a Hongping Wu, a * Xin Su, a Hongwei Yu, a,b Shilie Pan,
Congruence Classes of Invertible Matrices of Order 3 over F 2
International Journal of Algebra, Vol. 8, 24, no. 5, 239-246 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/.2988/ija.24.422 Congruence Classes of Invertible Matrices of Order 3 over F 2 Ligong An and
Chalkou I. C. [PROJECT] Ανάθεση εργασιών.
Πληροφορική της Υγείας 2014 Chalkou I. C. [PROJECT] Ανάθεση εργασιών. Περιεχόμενα 1. Ομάδα Γ... 3 1.1 Σαψάκη Δ. - Σαψάκη Π.... 3 1.2 Βλάχου - Γεωργοπούλου... 3 1.3 Μπέρτσου - Τσάμη... 4 1.4 Καραγιάννη
J. of Math. (PRC) Banach, , X = N(T ) R(T + ), Y = R(T ) N(T + ). Vol. 37 ( 2017 ) No. 5
Vol. 37 ( 2017 ) No. 5 J. of Math. (PRC) 1,2, 1, 1 (1., 225002) (2., 225009) :. I +AT +, T + = T + (I +AT + ) 1, T +. Banach Hilbert Moore-Penrose.. : ; ; Moore-Penrose ; ; MR(2010) : 47L05; 46A32 : O177.2
Research on Economics and Management
36 5 2015 5 Research on Economics and Management Vol. 36 No. 5 May 2015 490 490 F323. 9 A DOI:10.13502/j.cnki.issn1000-7636.2015.05.007 1000-7636 2015 05-0052 - 10 2008 836 70% 1. 2 2010 1 2 3 2015-03
Supporting Information. Research Center for Marine Drugs, Department of Pharmacy, State Key Laboratory
Supporting Information Dysiherbols A C and Dysideanone E, Cytotoxic and NF-κB Inhibitory Tetracyclic Meroterpenes from a Dysidea sp. Marine Sponge Wei-Hua Jiao,, Guo-Hua Shi,, Ting-Ting Xu,, Guo-Dong Chen,
Metal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supporting information for Metal-free Oxidative Coupling of Amines with Sodium Sulfinates:
High mobility group 1 HMG1
Vol. 29, pp.705 ~ 711, 2001 High mobility group 1 HMG1 13 12 20 anti-neutrophil cytoplasmic antibodies, ANCA ANCA 1982 Davies 1980 1 high mobility group HMG1 HMG2 30 kd high mobility group HMGHMG HMG1
Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water
31 1 2010 1 ENVIRONMENTAL SCIENCE Vol. 31,No. 1 Jan.,2010, 3, (,, 100084) :,.,, ( Microcystis aeruginosa),3 (A 2 O ) 10 6 ml - 1,> 0139 d - 1. A 2 O222,. TP ( K max ) ( R max ), Monod. :; ; ; ; :X173 :A
HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332
,**1 The Japanese Society for AIDS Research The Journal of AIDS Research +,, +,, +,, + -. / 0 1 +, -. / 0 1 : :,**- +,**. 1..+ - : +** 22 HIV AIDS HIV HIV AIDS : HIV AIDS HIV :HIV AIDS 3 :.1 /-,**1 HIV
Gateway cdna. cdna. pdest TM ~ cfu/ ml ~ cfu bp
2010 32 4 0791-0796 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com Gateway cdna * * 350002 cdna cdna Gateway RNA mrna 3 cdna BP LR cdna pdest TM
Journal of the CUN(Natural Sciences Edition) ...
2007 2 16 1 ( ) Journal of the CUN(Natural Sciences Edition) Feb. 2007 Vol. 16 No. 1 1,2, 1, 1, 2 (11, 100081 ; 21, 100875) :. 2,42D NAA 62BA.,.. : ; ; ; :Q94513 :A :100528036 (2007) 0120023206 : (1),
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ Πτυχιακή εργασία ΜΕΛΕΤΗ ΠΟΛΥΦΑΙΝΟΛΩΝ ΚΑΙ ΑΝΤΙΟΞΕΙΔΩΤΙΚΗΣ ΙΚΑΝΟΤΗΤΑΣ ΣΟΚΟΛΑΤΑΣ Αναστασία Σιάντωνα Λεμεσός
Tan Xiaofeng Chen Hongpeng Zhang Dangquan Zeng Yanling Li Wei Jiang Yao Xie Lushan Hu Xiaoyi Hu Fangming. and Technology Changsha 410004)
44 3 2 0 0 8 3 SCIENTIA SILVAE SINICAE Vol144,No13 Mar.,2 0 0 8 FAD2 cdna ( 410004) : FAD2, EST, 5 RACE PCR FAD2 cdna 1 682 bp, 1 149 bp, 382, FAD2, FAD2 FAD2 : ; EST ; FAD2 ; RACE; PCR ; :S718146 ;Q94312
Reading Order Detection for Text Layout Excluded by Image
19 5 JOURNAL OF CHINESE INFORMATION PROCESSING Vol119 No15 :1003-0077 - (2005) 05-0067 - 09 1, 1, 2 (11, 100871 ; 21IBM, 100027) :,,, PMRegion,, : ; ; ; ; :TP391112 :A Reading Order Detection for Text
ph Maillard MRPs maillard reaction products Maillard ph kDa Maillard Maillard DOI /j. issn
2015 29 1 0063 ~ 0069 Journal of Nuclear Agricultural Sciences 63 1000-8551 2015 01-0063-07 ph Maillard 1 1 2 2 2 2 2 1 400067 2 / 100193 ph Maillard MRPs maillard reaction products ph ph 5 7 9 100. 11
Research on explaining porosity in carbonate reservoir by capture cross section method
33 4 2014 12 GLOBAL GEOLOGY Vol. 33 No. 4 Dec. 2014 1004-5589 2014 04-0875 - 05 1 2 1 2 1. 130026 2. 830011 PND SIGMA CATO SIGMA CNL 0. 91 SIGMA CATO P631. 325 A doi 10. 3969 /j. issn. 1004-5589. 2014.
Table of Contents 1 Supplementary Data MCD
Electronic Supplementary Material (ESI) for Dalton Transactions. This journal is The Royal Society of Chemistry 2017 Supporting Information for Magnetic circular dichroism and density functional theory
30s 56 60s 72 60s dntp cm s s s 23
31 3 Vol 31 No 3 2012 8 JOURNAL OF OCEANOGRAPHY IN TAIWAN STRAIT Aug 2012 AFLP 1 1 2 1 1 361005 2 361005 dntp Taq Mg 2 + 300 ng DNA 5U PstI 5U MseI 4 h 16 10 50 AFLP AFLP 64 12 AFLP DOI 10 3969 /J ISSN
Electronic Supplementary Information (ESI)
Electronic Supplementary Information (ESI) Lanthanide metal-organic frameworks constructed by asymmetric 2-nitro-biphenyl-4,4 -dicarboxylate ligand: syntheses, structures, luminescence and magnetic investigations
Supporting Information. Enhanced energy storage density and high efficiency of lead-free
Supporting Information Enhanced energy storage density and high efficiency of lead-free CaTiO 3 -BiScO 3 dielectric ceramics Bingcheng Luo 1, Xiaohui Wang 1*, Enke Tian 2, Hongzhou Song 3, Hongxian Wang
Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk
32 3 2011 3 ENVIRONMENTAL SCIENCE Vol 32 No 3 Mar 2011 1 1 1 2 1 100101 2 663000 Panax notoginseng Burk F H Chen 6 9 ~ 242 0 mg kg - 1 48% 2 mg kg - 1 24% 81% 14% 57% 44% 100 mg kg - 1 ADI > > > > FAO
Resistance monitoring and target gene cloning of Bemisia tabaci Q-biotype from Jiangsu Province
Chinese Journal of Applied Entomology 2011 48 1 48 53 * Q 1 2 1 1 2 1 1. 225009 2. 100081 3 Q Bemisia tabaci Gennadius 5 Q RCR 287 bp 184 bp ace1 para- Q F331W L925I T929V Resistance monitoring and target
Supporting Information
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Supporting Information Crotonols A and B, Two Rare Tigliane Diterpenoid
Differences in Contents of Neutral Aroma Components and Sensory Evaluation in Air-cured Burley Leaves from Different Curing Barns
2 0 1 0 25 3 1 13-1 1 7 1 2 2 1 1 2 2 1. 450002 2. 635000 6 > > > > > > > > > > > > > > > S572 A 1000-7091 2010 03-0113 - 05 Differences in Contents of Neutral Aroma Components and Sensory Evaluation in
Nguyen Hien Trang* **
152 Nippon Shokuhin Kagaku Kogaku Kaishi Vol.., No.., +,+3 (,**1) 10 Nguyen Hien Trang* ** * Department of Food Science and Technology, Hue University of Agriculture and Forestry ** Properties of "Shishibishio
No. 7 Modular Machine Tool & Automatic Manufacturing Technique. Jul TH166 TG659 A
7 2016 7 No. 7 Modular Machine Tool & Automatic Manufacturing Technique Jul. 2016 1001-2265 2016 07-0122 - 05 DOI 10. 13462 /j. cnki. mmtamt. 2016. 07. 035 * 100124 TH166 TG659 A Precision Modeling and
1 (forward modeling) 2 (data-driven modeling) e- Quest EnergyPlus DeST 1.1. {X t } ARMA. S.Sp. Pappas [4]
212 2 ( 4 252 ) No.2 in 212 (Total No.252 Vol.4) doi 1.3969/j.issn.1673-7237.212.2.16 STANDARD & TESTING 1 2 2 (1. 2184 2. 2184) CensusX12 ARMA ARMA TU111.19 A 1673-7237(212)2-55-5 Time Series Analysis
(1) A lecturer at the University College of Applied Sciences in Gaza. Gaza, Palestine, P.O. Box (1514).
1439 2017, 3,29, 1658 7677: 1439 2017,323 299, 3,29, 1 1438 09 06 ; 1438 02 23 : 33,,,,,,,,,,, : The attitudes of lecturers at the University College of Applied Sciences in Gaza (BA - Diploma) towards
Science of Sericulture
Science of Sericulture 2012 38 1 0065-0069 ISSN 0257-4799 CN 32-1115 /S E-mail CYKE@ chinajournal. net. cn 215123 25 0 ~ 24 h GSH GSSG GSH + 2GSSG GSH /GSSG S- GST TPX 23% GR 57% GSH TPX GST GSSG 61% GSH
Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo
Bull. Earthq. Res. Inst. Univ. Tokyo Vol. 2.,**3 pp.,,3,.* * +, -. +, -. Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Kunihiko Shimazaki *, Tsuyoshi Haraguchi, Takeo Ishibe +, -.
2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _
41 Vol.41, No. 01 RARE METAL MATERIALS AND ENGINEERING March 01 Pb O 4 PbO ( 710049) SnO -Sb Pb O 4 Pb O 4 100.5 h 970 h XRF XRD SEM Pb O 4 PbO PbO TG146.1 + A 100-185X(01)0-046-05 [1,] 1 PbO PbO Sn-Sb
Σχέση στεφανιαίας νόσου και άγχους - κατάθλιψης
Τρίμηνη, ηλεκτρονική έκδοση του Τμήματος Νοσηλευτικής Α, Τεχνολογικό Εκπαιδευτικό Ίδρυμα Αθήνας _ΑΝΑΣΚΟΠΗΣΗ_ Πολυκανδριώτη Μαρία 1, Φούκα Γεωργία 2 1. Καθηγήτρια Εφαρμογών Νοσηλευτικής Α, ΤΕΙ Αθήνας 2.
Supplementary Information. Living Ring-Opening Polymerization of Lactones by N-Heterocyclic Olefin/Al(C 6 F 5 ) 3
Supplementary Information Living Ring-Opening Polymerization of Lactones by N-Heterocyclic Olefin/Al(C 6 F 5 ) 3 Lewis Pairs: Structures of Intermediates, Kinetics, and Mechanism Qianyi Wang, Wuchao Zhao,
A Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn
56 [ ] 167-3619(009)03-056-05 Journal of Tropical Medicine Vol.9 No.3 Mar.009 * ( 510515) (PCT) CNKI VIP PCT QUADAS Metadisc1.4 DOR (SROC) SROC (AUC) Review Manager5 Meta 8 ; 7 8 (χ =3.8P=0.858I =0.0%)
Preparation and Application of Amorphous Alloy Catalyst
17 4 2005 7 PROGRESS IN CHEMISTRY Vol. 17 No. 4 Jul., 2005 3 ( 300072), XRD EXAFS DSC SEM TEM XPS : O643136 ; TQ42618 : A : 10052281X(2005) 0420614208 Preparation and Application of Amorphous Alloy Catalyst
ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ
ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΣΧΟΛΗ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΜΗΧΑΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ ΤΕΧΝΟΛΟΓΙΑΣ ΠΛΗΡΟΦΟΡΙΚΗΣ ΚΑΙ ΥΠΟΛΟΓΙΣΤΩΝ Σύστημα Διαχείρισης Διαχρονικών Δεδομένων για Γονίδια ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ
ΠΕΡΙΛΗΨΗ. Λέξεις κλειδιά: Υγεία και συμπεριφορές υγείας, χρήση, ψυχότροπες ουσίες, κοινωνικό κεφάλαιο.
Α.Τ.Ε.Ι. ΚΡΗΤΗΣ Σ.Ε.Υ.Π. ΤΜΗΜΑ ΚΟΙΝΩΝΙΚΗΣ ΕΡΓΑΣΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Τίτλος: «Χρήση ψυχοτρόπων ουσιών από μαθητές Α Λυκείου της Δευτεροβάθμιας Εκπαίδευσης του Νομού Ηρακλείου και ο ρόλος του Κοινωνικού
Study on the Solubility of Kiwi Fruit Seed Oil in Supercritical Carbon Dioxide
2007,40(6):1242-1247 Scientia Agricultura Sinica 1 210037 2 712100 3 510641 4 750006 Study on the Solubility of Kiwi Fruit Seed Oil in Supercritical Carbon Dioxide WU Cai-e 1,2, XU Ke-yong 3, LI Yuan-rui
College of Life Science, Dalian Nationalities University, Dalian , PR China.
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2018 Postsynthetic modification
ΠΟΛΥΤΕΧΝΕΙΟ ΚΡΗΤΗΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΕΡΙΒΑΛΛΟΝΤΟΣ
ΠΟΛΥΤΕΧΝΕΙΟ ΚΡΗΤΗΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΕΡΙΒΑΛΛΟΝΤΟΣ Τομέας Περιβαλλοντικής Υδραυλικής και Γεωπεριβαλλοντικής Μηχανικής (III) Εργαστήριο Γεωπεριβαλλοντικής Μηχανικής TECHNICAL UNIVERSITY OF CRETE SCHOOL of
Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2015 Supporting information An unusual bifunctional Tb-MOF for highly sensing
Supporting Information
Supporting Information rigin of the Regio- and Stereoselectivity of Allylic Substitution of rganocopper Reagents Naohiko Yoshikai, Song-Lin Zhang, and Eiichi Nakamura* Department of Chemistry, The University
Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements
5 5 2012 10 Chinese Optics Vol. 5 No. 5 Oct. 2012 1674-2915 2012 05-0525-06 - * 100190-14 - - 14. 51 μm 81. 4 μm - 1. 64 μm / O436. 1 TH703 A doi 10. 3788 /CO. 20120505. 0525 Correction of chromatic aberration
Novel and Selective Palladium-Catalyzed Annulation of 2-Alkynylphenols to Form 2-Substituted 3-Halobenzo[b]furans. Supporting Information
Novel and Selective Palladium-Catalyzed Annulation of 2-Alkynylphenols to Form 2-Substituted 3-Halobenzo[b]furans Liang Yun, Shi Tang, Xu-Dong Zhang, Li-Qiu Mao, Ye-Xiang Xie and Jin-Heng Li* Key Laboratory
,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78
ISSN 100727626 CN 1123870ΠQ 2002 4 Chinese Journal of Biochemistry and Molecular Biology 18 (2) :245 249 HLA2B2704 3 2) ( 2) 100044) HLA2B2704 286 HLA2B2704 DNA ( HLA2B2704 DNA) PCR F0 F1 RT2PCR HLA2B2704
Schedulability Analysis Algorithm for Timing Constraint Workflow Models
CIMS Vol.8No.72002pp.527-532 ( 100084) Petri Petri F270.7 A Schedulability Analysis Algorithm for Timing Constraint Workflow Models Li Huifang and Fan Yushun (Department of Automation, Tsinghua University,
Η οικολογία της σχολικής τάξης ΙΙ
Όλγα Ηµέλλου PhD Περίληψη Μετά την ψήφιση του νόµου 2817/2000, την πρόσφατη συµπλήρωση και αναθεώρησή του και την υπογραφή των σχετικών υπουργικών αποφάσεων και εγκυκλίων, η εκπαίδευση των παιδιών και
90 [, ] p Panel nested error structure) : Lagrange-multiple LM) Honda [3] LM ; King Wu, Baltagi, Chang Li [4] Moulton Randolph ANOVA) F p Panel,, p Z
00 Chinese Journal of Applied Probability and Statistics Vol6 No Feb 00 Panel, 3,, 0034;,, 38000) 3,, 000) p Panel,, p Panel : Panel,, p,, : O,,, nuisance parameter), Tsui Weerahandi [] Weerahandi [] p
, DYY-8B, ; : Centrifuge 11 R. min
40 Chinese Journal of Otology Vol. 8 No.1 2010 DNA A1555G - ( 030001) 2 12 68 DNA (polymerase chain reaction PCR) DNA A1555G 7 DNA 12S rrna 1555 A G A1555G ; DNA A1555G ; ; ; R764.433 R342.4 A 1672-2922(2010)01-040-06
Identification of Salmonella,Campylobacter jejuni and Enterohemorrhagic E.coli by Denaturing High-performance Liquid Chromatography
BIOTECHNOLOGY BULLETIN 2009 3 116015 PCR multiplex PCR mpcr denaturing high-performance liquid chromatography DHPLC O157 H7 fimy gyra O157 H7 rfbe 3 O157 H7 PCR 284 159 499 bp PCR O157 H7 1.5 CFU/ ml 15