Research Paper Corynebacterium crenatum γ- EC γ-glutamyl kinase prob. prob PCR. prob prob. C. crenatum ΔproB
|
|
- Τιτάνια Λιάπης
- 6 χρόνια πριν
- Προβολές:
Transcript
1 Acta Microbiologica Sinica November 2011 ISSN CN / Q http / / journals. im. ac. cn / actamicrocn Research Paper γ- L * L- L- L Corynebacterium crenatum γ- EC γ-glutamyl kinase prob prob PCR prob prob C. crenatum prob ΔproB ΔproB ΔproB PCR γ- prob ΔproB 9. 6% L % α- prob γ- L- Q814 A L- L- L- N- 1-2 L- γ- 3 γ- L N- L- car L- argi 8 * Tel / Fax dingjy@ sun. im. ac. cn mypicture@ 163. com
2 γ- L / N L γ- L- L- 1 Fig. 1 Diagram of the central metabolism and the biosynthesis of several amino acids of C. glutamicum. Abbreviations PEPCk PEP carboxykinase PEPCx PEP carboxylase PYC pyruvate carboxylase argj ornithine acetyltransferase ProB γ-glutamyl kinase NAG N- Acetyl-glutamate γ-gp γ-glutamylphosphate. Dashed arrows indicate pathways consisting of several reactions solid arrows indicate single reactions LB E. coli C. crenatum 2LB 4% C. crenatum 13 3LB 10% TaKaRa L- BBI 4 PEP Sigma 20 g NH 4 2 SO 4 7 g ATP Bio Basic Inc NADH K 2 HPO 4 3H 2 O 0. 3 g KH 2 PO g MgSO 4 7H 2 O Ameresco 0. 4 g NaCl 0. 1 g FeSO 4 7H 2 O 25 mg MnSO 4 H 2 O MJ PTC mg CaCl 2 H 2 O 50 mg 0. 4 mg BIO-RAD MicroPulser TM Beckman DU800 Alphalmager EC Agilent mg 50 mg 400 mg
3 1478 Xiaoman Li et al. / Acta Microbiologica Sinica Table 1 1 The strains and plasmids used in this work Strains or plasmids Characteristics Source Escherichia coli DH5α C. crenatum φ80 LacZΔM15 deor reca1 enda1 hsdr17 Stored in this lab his - SG R This lab ΔproB his - SG R pro with prob knock-out This study ΔproB-C his - SG R ΔproB complemented with pbs57-prob This study Plasmids pmd19-t T-vector 2. 7 kb Amp R lacz TaKaRa Co. pk18mobsacb Mobilizable E. coli vector Km R Suc S Sch fer A 11 pt-fprob pmd19-t containing prob upstream fragment from This study pt-bprob pmd19-t containing prob downstream fragment from This study pt-prob pmd19-t containing 1. 2kb PCR fragment of prob gene This study pk18-fprob pk18mobsacb containing prob upstream fragment from This study pk18-δprob pk18mobsacb containing prob in-frame deletion fragment ΔproB from This study pbs57 E. coli-c. glutamicum shuttle expression vector Km R This lab pbs57-prob pbs57 containing prob from to generate prob expression or complementation for ΔproB This study his - no cell growth without histidine addition on minimal medium SG sulfaguanidine pro - no cell growth without proline addition on minimal medium. ΔproB ph g NH 4 2 SO 4 35g K 2 HPO 4 3H 2 O 1 g Table 2 Primers for gene amplification and gene disruption KH 2 PO g MgSO 4 7H 2 O 0. 4 g FeSO 4 7H 2 O Primers Sequences 5' 3' Size / bp Restriction site 20 mg MnSO 4 H 2 O 20 mg 0. 1 mg ΔproB ph % E. coli 0. 2 mg CaCO 30 g 50 mg 400 mg P2 P1 AAGTGACAGAGCTTCCCGAC TCTAGA TTATGCGCGCCTG GCGTAGTTGG TTTAAA TAAGGAAGCTA XbaⅠ DraⅠ 37 C. crenatum μg / ml P3 50 μg / ml GGT AAGCTT AGCCAGCGCC CTCGCATTGT 29 HindⅢ CGG TCTAGA ACTGCGCCAG 1. 2 DNA P4 AGGACACAAC E. coli 12 E. coli 29 XbaⅠ CaCl 2 C. crenatum GAC TCTAGA TGATGATGGC P5 29 XbaⅠ 1. 3 prob PCR C. glutamicum R γ- prob GenBank accession number AP prob prob 2 Primer premier 5. 0 P3 P4 prob FproB P5 P6 prob BproB PCR 20 μl Tris-HCl ph s 68 1 min μl EasyTaq DNA min P6 GCGGTGGAAG CAC GAATTC TGGCTGTCAG GAAGTGGCTC 29 EcoRⅠ Boxed bases indicate restriction sites bold bases indicate Shine-Dalgarno sequence underlined bases indicate homologous sequences with prob P1 P2 prob γ ΔproB ΔproB-C h 50 mmol / L r / min 15 min min
4 γ- L / ml 55 g / L FeCl 3 20 g / L SBA-40C 21 ml / L HCl γ- A 535 γ r / min 250 L mol - 1 cm - 1 γ- Agilent nmol γ Agilent A 40mmol / L NaH 2 PO 4 ph7. 8 B 193-ΔproB 4 30 ACN MeOH v / v / v 18 2 DAD 338 nm 262 nm r / min 15 min 10 min r / min 10 min μm 15 A 340 NADH Agilent L mol - 1 cm mmol / L H 2 SO ml / min 1 nmol NADH NAD μl DAD 210 nm ΔproB h 50 mmol / L Tris-HCl ph mmol / L NaCl 2 HEPES 100 mmol / L 20% - 20 PCR 1. 2 kb 3% CTAB pmd19-t E. coli DH5α 0. 3% 1 min LB prob 1246 bp 1221 bp 16 A 340 C. crenatum prob 1 nmol NADH % GenBank 17 JF ΔproB prob DraⅠ XbaⅠ r / min 12 h 12 h 100 mmol / L Tris- HCl ph % 5 coli DH5α LB r / min 12 h prob pbs mol / L HCl prob 600 nm 2. 2 pk18-δprob 10 min μm Zorbax Eclipse-AAA 2. 0 ml / min Aminex HPX-87H BioRad prob DNA P1 P2 pt-prob ORF GTG 406 C. glutamicum R prob % 8 DraⅠ Xba Ⅰ pt-prob pbs57 prob E DNA P3
5 1480 Xiaoman Li et al. / Acta Microbiologica Sinica P4 P5 P6 PCR 1. 1 kb 2. 4 prob pmd19-t E. coli DH5α LB PCR pt-fprob pt-bprob HindⅢ XbaⅠ pt-fprob FproB Hind Ⅲ Xba Ⅰ ΔproB pk18mobsacb FproB PCR bp E. coli DH5α LB 2 prob pk18-fprob Xba E. coli DH5α LB prob DNA pk18-δprob prob 2 Fig. 2 prob PCR 2. 3 prob of prob of PCR fragment of prob of ΔproB. pk18-δprob LB ΔproB ΔproB-C pk18-δprob h pk18-δprob DNA DNA ΔproB ΔproB-C 3 3 prob pk18-δprob sacb DNA Ⅰ EcoRⅠ pt-bprob BproB Xba Ⅰ EcoR Ⅰ pk18- FproB BproB PCR prob prob 3 prob ΔproB ΔproB-C ΔproB 2. 1 pbs57-prob Fig. 3 The growth of ΔproB and ΔproB-C on prob ΔproB minimal medium. Ⅰ Minimal medium containing histidine Ⅱ LB Minimal medium containing histidine and proline. a C. crenatum b C. crenatum ΔproB c C. crenatum ΔproB-C ΔproB prob ΔproB DNA P3 P6 PCR PCR Characterization of defined prob knock-out mutant by PCR analysis. M. DNA marker Trans5K DNA Marker 1. PCR fragment ΔproB-C.
6 γ- L / γ ΔproB ± U / mg ΔproB-C ± U / mg % prob ΔproB ΔproB prob 2. 5 prob prob L ΔproB % 4-A L ΔproB ΔproB L g / L % 4-B Fig. 4 prob production profiles ΔproB A B Time course of and ΔproB fermentation A cell growth profiles B glucose consumption and L-arginine Strains 3 Table 3 Comparison of fermentation parameters of the two strains Parameters P Arg / g / L X max / g / L Q S / g / L h R X / g / L h Y P / S g / g Y X / S g / g Φ g / L h ΔproB P Arg Arginine Production X max The maximum Cell Dry weight Q S Glucose consumption rate R X Average Growth Rate Y P / S Arginine yield on Glucose Y X / S Biomass yield on Glucose Φ Arginine productivity ΔproB ΔproB % 31. 2% α- 145% 194% 70% 9. 1% 31. 4% 49. 7% 5
7 1482 Xiaoman Li et al. / Acta Microbiologica Sinica Table 4 4 The analysis of by-product amino acids in fermentation broth c Amino acid / mg / L Strains Aspartate Asparagine Isoleucine Lysine Threonine ± ± ± ± ± ΔproB ± ± ± ± ± Methionine Glutamate Glutamine Citrulline Serine ± ± ± ± ± ΔproB ± ± ± ± ± Tyrosine Phenylalanine Alanine Valine Leucine ± ± ± ± ± ΔproB ± ± ± ± ± Table 5 5 The analysis of organic acids in fermentation broth c Organic acid / g / L Strains Citirc acid Acetic acid Lactic acid Succinic acid Malic acid ± ± ± ± ± ΔproB ± ± ± ± ± Pyruvate α-ketoglutaric acid PEP ± ± ± ΔproB ± ± ± prob α- 3 α- L γ- prob L- L- prob 2. 6 γ- L- prob L % prob α- ΔproB prob α- 75% 44% ΔproB L ΔproB 50% α- Table 6 Specific activity of PEPCx and PYC of and ΔproB Strains PEPCx / U / mg protein Specific enzyme activity PYC / U / mg cell dry weight ± ± ΔproB ± ± 13. 9
8 γ- L / Xu Y Labedan B Glansdorff N. Surprising Arginine prob Biosynthesis a Reappraisal of the Enzymology and Evolution of the Pathway in Microorganisms. Micorobiology and molecular biology review prob Reengineering of a Corynebacterium glutamicum L ΔproB Arginine and L-Citrulline Producer. Applied and prob Environmental Microbiology prob 10. N-. Acta Microbiologica Sinica Sh fer A Tauch A J ger W Kalinowski J Thierbach ΔproB G Pühler. A. Small mobilizable multi-purpose cloning ArgR vectors derived from the Escherichia coli plasmids pk18 argr and pk19 selection of defined deletions in the N- argb chromosome of Corynebacterium glutamicum. Gene Sambrook J Russell DW ΔproB argr argb Jang KH Britz ML. Improved electrotransformation frequencies of Corynebacterium glutamicum using cellsurface mutants. Biotechnology Letters Flynn NE Meininger CJ Haynes TE Wu G. The 545. metabolic basis of arginine nutrition and 14 Hayzer DJ Leisinger T. The gene-enzyme relationships pharmacotherapy. Biomedicine & Pharmacotherapy of proline biosynthesis in Escherichia coli. Journal of de Jonge WJ Kwikkers KL te Velde AA van Deventer SJ Nolte MA Mebius RE Ruijter JM Lamers MC general microbiology O' Regan M Thierbach G Bachmann B Villeval D Lepage P Viret JF Lemoine Y. Cloning and nucleotide Lamers WH. Arginine deficiency affects early B cell sequence of the phosphoenolpyruvate carboxylase-coding maturation and lymphoid organ development in transgenic gene of Corynebacterium glutamicum ATCC Gene mice. Journal of Clinical Investigation Bian K Murad F. Nitric oxide NO - biogeneration regulation and relevence to human diseases. Frontiers in 16. CD945. Acta Microbiologica Sinica bioscience Lu CD. Pathways and regulation of bacterial arginine metabolism and perspectives for obtaining arginine overproducing strains. Applied Microbiology and Biotechnology Food Science prob ΔproB. L- argh prob γ-. China Biotechnology proa 1kb proa Tuchman M Rajagopal BS McCann MT Malamy MH. -5- proc Enhanced production of arginine and urea by genetically prob engineered Escherichia coli K-12 strains. Applied and 600bp Environmental Microbiology bp prob ORF 9 Ikeda M Mitsuhashi S Tanaka K Hayashi M Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry
9 1484 Xiaoman Li et al. / Acta Microbiologica Sinica Henderson JW Ricker RD Bidlingmeyer BA Woodward C. Rapid Accurate Sensitive and Reproducible HPLC Analysis of Amino Acids. AAA Techical note P Publication No Chinnici F Spinabelli U Riponi C Amati A. Optimization of the determination of organic acids and sugars in fruit juices by ion-exclusion liquid chromatography. Food Composition and Analysis Ankri S Serebrijski I Reyes O Leblon G. Mutations in the Corynebacterium glutamicum proline biosynthetic pathway A natural bypass of the proa step. Journal of Bacteriology Serebrijski I Wojcik F Reyes O Leblon G. Multicopy Suppression by Asd Gene and Osmotic Stress-Dependent Complementation by Heterologous proa in proa Mutants. Journal of Bacteriology Lee SY Park JM Lee JH Chang ST Park JS Kim YH Min J. Interaction of Transcriptional Repressor ArgR with Transcriptional Regulator FarR at the argb Promoter Region in Corynebacterium glutamicum. Applied and Environmental Microbiology Lee SY Shin HS Park JS Kim YH Min J. Proline reduces the binding of transcriptional regulator ArgR to upstream of argb in Corynebacterium glutamicum. Applied Microbiology and Biotechnology Effect of gamma-glutamyl kinase gene knock-out on metabolism in L-arginine-producing strain Corynebacterium crenatum Xiaoman Li 1 2 Zhi Zhao 1 Yingzi Zhang 1 Yu Wang 1 Jiuyuan Ding 1* 1 Institute of Microbiology Chinese Academy of Sciences Beijing China 2 Graduate School of the Chinese Academy of Sciences Beijing China Abstract Objective In order to optimize precursor supply for L-arginine biosynthesis we constructed a Corynebacterium crenatum mutant with gamma-glutamyl kinase gene prob in-frame deletion. The effects of prob knock-out on physiological characteristics of the mutant were investigated. Methods The upstream and downstream fragments of prob were cloned from C. crenatum chromosome and ligated to integration vector. The mutant C. crenatum ΔproB was obtained by homologous recombination. The mutant phenotype can be reversed by complementation with prob gene from the expression vector. The physiological characteristics of the mutant were investigated by measurement of the activities of phosphoenolpyruvate carboxylase PEPCx and pyruvate carboxylase PYC. Results The prob gene in-frame deletion was screened and confirmed by PCR gamma-glutamyl kinase determination and complementation. The mutant lost the ability of growth on minimal medium without proline addition. The prob knock-out mutant resulted a decrease of cell mass by 9. 6% and an increase of L-arginine accumulation by 13. 6% compared with that of the parent strain. The analysis of by-products of fermentation broth showed that the concentrations of glutamate-related and aspartate-related amino acids increased and the concentrations of α-ketoglutaric acid PEP and succinic acid decreased. The specific activities of PEPCx and PYC increased in ΔproB. Conclusion The prob gene knock-out of the strain blocked branch catabolism of L-glutamate and improved efficiency of the glucose utilization and L-arginine accumulation. Keywords Corynebacterium crenatum gamma-glutamyl kinase gene knock-out L-arginine Corresponding author. Tel / Fax dingjy@ sun. im. ac. cn Received 4 May 2011 / Revised 27 May 2011
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN
BIOTECHNOLOGY BULLETIN 2011 3 α 1 2-300457 PCR Helicobacter pylori HP DNA α 1 2- α 1 2-fucosyltransferase α 1 2-fuct 906 bp pet-22b + pet-fuct BL21 DE3 25 0. 1 mmol /L IPTG 4 h SDS-PAGE 33 kd α 1 2- BL21
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΓΕΩΠΟΝΙΚΗ ΣΧΟΛΗ ΤΟΜΕΑΣ ΕΠΙΣΤΗΜΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ ΜΑΡΙΑΣ ΦΩΤΙΟΥ ΠΤΥΧΙΟΥΧΟΥ ΓΕΩΠΟΝΟΥ
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΓΕΩΠΟΝΙΚΗ ΣΧΟΛΗ ΤΟΜΕΑΣ ΕΠΙΣΤΗΜΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ ΜΑΡΙΑΣ ΦΩΤΙΟΥ ΠΤΥΧΙΟΥΧΟΥ ΓΕΩΠΟΝΟΥ Συγκέντρωση των ελεύθερων αµινοξέων στο αµνιακό υγρό σε σχέση µε την εβδοµάδα
Γεωπονικό Πανεπιςτήμιο Αθηνών Τμήμα Αξιοποίηςησ Φυςικών Πόρων και Γεωργικήσ Μηχανικήσ
Γεωπονικό Πανεπιςτήμιο Αθηνών Τμήμα Αξιοποίηςησ Φυςικών Πόρων και Γεωργικήσ Μηχανικήσ Εργαςτήριο Γεωργικών Καταςκευών ΠΜΣ Ενεργειακά Συςτήματα και Ανανεώςιμεσ Πηγέσ Ενέργειασ Διδακτορική διατριβή Καιιηέξγεηα
Analysis on the Ratio of Flesh Content and Nutritional. Quality of Esox lucius
Chinese Journal of Zoology 2009,44 (3) :7075 3 ( 830000) : 6 ( Esox lucius), :6418 %,1911 %114 %,17 17138 %,7 8114 %,6136 % 45173 %,,WHOΠFAO 76135,,,,, : ; ; ; ; :Q955 :A :025023263 (2009) 03270206 Analysis
Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic
JOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3. PCR bp BCCP. pet-28a Escherichia coli BL21 DE3 Ni-NTA
6 2011 5 31 3 JOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3 A ACC CT * 430070 PCR A ACC 2 42 ~ 147 bp 315 ~ 677 bp 6 801 bp A 3 BC BCCP CT CT pet-28a Escherichia coli BL21 DE3 Ni-NTA CT 1. 8 mg /ml ACC
Supplementary Table 1. Construct List with key Biophysical Properties of the expression
SPINE Benchmark Target ID Well Code Tag (N or C) Fusion MW (kda) Fusion pi Cleavage site Prot MW (Da) Prot pi 1 A1 OPPF 2585 N-His6 21.75 6.41 Protease 3C 19.77 5.43 2 B1 OPPF 2586 N-His6 15.6 6.27 Protease
Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin
2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,
Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk
32 3 2011 3 ENVIRONMENTAL SCIENCE Vol 32 No 3 Mar 2011 1 1 1 2 1 100101 2 663000 Panax notoginseng Burk F H Chen 6 9 ~ 242 0 mg kg - 1 48% 2 mg kg - 1 24% 81% 14% 57% 44% 100 mg kg - 1 ADI > > > > FAO
1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.
2 0 1 5 7 Journal of Chinese Institute of Food Science and Technology Vol. 15 No. 7 Jul. 2 0 1 5 1,2 1 1 1 1* ( 1 315211 2 315502) : ( ) : (E-Nose), - : GC-MS, 20.98% 2.5%, 53.15% 11.2%, 0. 51% 71.86%
N 2 O 15 N NH + NH 3 Rittenberg mg mmol L - 1 CuSO mg. 10 mol L. Pre-Concentration device PreCon
50 1 Vol. 50 No. 1 2013 1 ACTA PEDOLOGICA SINICA Jan. 2013 N 2 O * N 210008 N 2 O N 2 O N N 2 O N N 5 ~ 20 μg N N 2 O N S8. 3 A N N 2 O N N N NO - 3 NO - 2 N N N MgO NH 3 Rittenberg 1 Dumas N 1 2 N N 2
Antimicrobial Ability of Limonene, a Natural and Active Monoterpene
2010,32 (1) :24 28 http :/ / xuebao. jlau. edu. cn Journal of Jilin Agricultural University E2mail : jlndxb @vip. sina. com Ξ,,,, ΞΞ, 200062 : : 320 mg/ L,; ph 4 9, ; 80, 100,121 : : ; ; : TS20213 : A
Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent
Supplementary information for the paper Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent Yang Xue, Ling-Po Li, Yan-Hong He * & Zhi Guan * School of Chemistry and Chemical Engineering,
Studies on purification and characteristics of glycosyltransferase from an engineering strain
DOI:10.16774/j.cnki.issn.1674-2214.2015.02.001 2015 2 4 44 2,, (, 310014) : pet28b-valg BL21(DE3), 10~40 C ph 5~11,, ph 30 C 8.0 1 mmol/l Ca 2+ Mg 2+ Mn 2+ Co 2+, Cu 2+ Zn 2+, 8 μmol/l 2 μmol/l A, K mb
Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application
31 5 2011 5 Acta Scientiae Circumstantiae Vol 31 No 5 May 2011 2011 - J 31 5 935-940 Huang Y M Yuan D X Peng Y Z et al 2011 Rapid determination of soluble reactive silicate in seawater by flow injection
Shiraia sp. Slf14 III
39 4 Vol 39 No 4 2015 7 Journal of Jiangxi Normal University Natural Science Jul 2015 1000-5862 2015 04-0430-05 Shiraia sp Slf14 III 1 1 2 1 1 1 2* 1 330022 2 330013 Polyketide synthase PKS Shiraia sp
BL21 (D E3)2p E T28a ( + )2bgl 2
28 2 2009 3 Journal of Food Science and Biotechnology 28 No. 2 Vol. Mar. 2009 :167321689 (2009) 0220250206 BL21 (D E3)2p E T28a ( + )2bgl 2,, 3, (, 214122) : 2E. coli BL21 (DE3)2p ET28a ( + )2bgl LB, p
Room Temperature Ionic Liquids from 20 Natural Amino Acids. Kenta Fukumoto, Masahiro Yoshizawa, and Hiroyuki Ohno
S1 Room Temperature Ionic Liquids from 20 Natural Amino Acids Kenta Fukumoto, Masahiro Yoshizawa, and Hiroyuki Ohno 1-Ethyl-3-methylimidazolium L-α-aminopropionic acid salt ([emim][ala]). From 1.0g (5.2mmol)
Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic
Supporting Information Asymmetric Binary-acid Catalysis with Chiral Phosphoric Acid and MgF 2 : Catalytic Enantioselective Friedel-Crafts Reactions of β,γ- Unsaturated-α-Ketoesters Jian Lv, Xin Li, Long
Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica
35 1 2 0 1 7 1 DOI 10. 13193 /j. issn. 1673-7717. 2017. 01. 035 1 1 1 1 2 1. 150036 2. 150040 D101 DEAE Cellulose 52 Sephacryl S - 300 - - PJP - 1a PJP - 3a 1. 34 10 3 Da 1. 70 10 7 Da - PJP - 3a 4. 56
Autoxidation of Commercial Edible Oils and Emulsified Liquid Type Dressing by the Simple Method for the Determination of Peroxide Value
368 Nippon Shokuhin Kagaku Kogaku Kaishi Vol. /., No.2, -02-1- (,**1) 6 Autoxidation of Commercial Edible Oils and Emulsified Liquid Type Dressing by the Simple Method for the Determination of Peroxide
Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis
HPLC * 271016 HPLC - DAD DiamonsilC 18 250 mm 4. 6 mm 5 μm - -1% 370 nm 1. 0 ml /min 40 R282. 7 A 1001-1528 2011 01-0001-05 Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus
Optimization of fermentation process for achieving high product concentration high yield and high productivity
1128 CHEMICAL INDUSTRY AND ENGINEERING PROGRESS 2006 25 10 ( 214036) (1) (2) (3) (4) (5) TQ 92 A 1000 6613 2006 10 1128 06 Optimization of fermentation process for achieving high product concentration
Screening of Respiration-deficient Saccharomyces cerevisiae Strains with Sugar-and Thermo-tolerances
3 3 Vol3 No3 3 9 Life Science Research June 9 *,,, 535 :, 3, 5- (TTC), 3,, T,, ; (5~5 μ 375~5 μ),, 5% (W/V), 55,, 55% 9% : ; ; ; ; :Q39 + :A :7-77(9)3-99-5 Screening of Respiration-deficient Saccharomyces
Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology
2012 34 2 382-387 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com 212018 105 W 42 2 min 0. 631 TS202. 3 A 1000-2286 2012 02-0382 - 06 Optimizing
SOD SNP % Cu /Zn-SOD. DAM- BE DNAStar % Mn /Fe-SOD. 6 1SNP /17. 9 bp
2011 33 6 1206-1211 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com SOD SNP 1 2 3 2 2* 1. 330004 2. 330004 3. 510006 GenBank Cu /Zn-SOD Mn /Fe-SOD
Science of Sericulture
Science of Sericulture 2012 38 1 0065-0069 ISSN 0257-4799 CN 32-1115 /S E-mail CYKE@ chinajournal. net. cn 215123 25 0 ~ 24 h GSH GSSG GSH + 2GSSG GSH /GSSG S- GST TPX 23% GR 57% GSH TPX GST GSSG 61% GSH
The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea
2011 48 4 909 914 * 1 2** 2 2 2 2 2*** 1. 110161 2. 100081 026000 3 Calliptamus italicus L. 3 LC 50 LC 90 1. 34 14. 17 mg / L LC 50 LC 90 2. 09 45. 22 mg / L 50 mg / L 14 d 87% 100% 50 mg / L 50% The toxicity
IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2
344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.
( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;
28 1 2006 1 RESOURCES SCIENCE Vol. 28 No. 1 Jan. 2006 :1007-7588(2006) 01-0002 - 07 20 1 1 2 (11 100101 ; 21 101149) : 1978 1978 2001 ; 2010 ; ; ; : ; ; 24718kg 1) 1990 26211kg 260kg 1995 2001 238kg( 1)
Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo
Bull. Earthq. Res. Inst. Univ. Tokyo Vol. 2.,**3 pp.,,3,.* * +, -. +, -. Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Kunihiko Shimazaki *, Tsuyoshi Haraguchi, Takeo Ishibe +, -.
Nguyen Hien Trang* **
152 Nippon Shokuhin Kagaku Kogaku Kaishi Vol.., No.., +,+3 (,**1) 10 Nguyen Hien Trang* ** * Department of Food Science and Technology, Hue University of Agriculture and Forestry ** Properties of "Shishibishio
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to facilitate intracellular survival Hongwei Gu 1,2*, Chihao Zhao 1,2*, Tianfu Zhang 1,2*, Hongwei Liang 1,2, Xiao-Ming Wang 1,
Comparative Study on Determinations of BTEX in Soils from Industrial Contaminated Sites
32 3 2011 3 ENVIRONMENTAL SCIENCE Vol 32 No 3 Mar 2011 1 2 1* 1 3 2 1 100101 2 430070 3 100089 3 95 2% ~ 98 2% 99 2% ~ 101 3% 60 mg / kg 12 6% ~ 37 6% X508 A 0250-3301 2011 03-0842-07 Comparative Study
8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,
31 2003 8 (FENXI HUAXUE) 8 Chinese Journal of Analytical Chemistry 976 980 22( 82 252 272 )21,82 23,62 3 (, 510631) 22(82 252 272 )21,82 23,62 (BSA), 8Q5SAC BSA 298K, 35 40 6. 1 10 5 LΠmol 8Q5SAC, ph =
LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing
2003 61 3, 435 439 ACTA CHIMICA SINICA Vol 61, 2003 No 3, 435 439 2 ΞΞ ( 400715), 2, 2, 2, 3/ 2 2,, 2,, Ne w Methods for the Determination of the Inclusion Constant between Procaine Hydrochloride and 2Cyclodextrin
PCR. Site-directed Mutagenesis of Sumf 1 Gene of Mouse Based on Overlap Extension PCR and Construction of Eukaryotic Expression Vector
13 5 Vol13 No5 9 10 Life Science Research Oct 9 9 PCR Sumf1 *,,,,, 481 : (chromatin immunoprecipitation assay, ChIP) activator protein-2 alpha (AP-2 α) Sumf 1 PCR, AP-2 α Sumf 1, DNA, Sumf 1 103 ~111,
ΠΕΡΙΛΗΨΗ ΧΑΡΑΚΤΗΡΙΣΤΙΚΩΝ ΤΟΥ ΠΡΟΙΟΝΤΟΣ (SPC) (AMINOVEN 3.5% Glucose / Electrolytes)
ΠΕΡΙΛΗΨΗ ΧΑΡΑΚΤΗΡΙΣΤΙΚΩΝ ΤΟΥ ΠΡΟΙΟΝΤΟΣ (SPC) (AMINOVEN 3.5% Glucose / Electrolytes) 1. ΕΜΠΟΡΙΚΗ ΟΝΟΜΑΣΙΑ ΤΟΥ ΦΑΡΜΑΚΕΥΤΙΚΟΥ ΠΡΟΙΟΝΤΟΣ: AMINOVEN 3.5% Glucose / Electrolytes 2. ΠΟΙΟΤΙΚΗ ΚΑΙ ΠΟΣΟΤΙΚΗ ΣΥΝΘΕΣΗ
Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang
13 4 2015 7 Chinese Journal of Bioprocess Engineering Vol. 13 No. 4 Jul. 2015 doi 10. 3969 /j. issn. 1672-3678. 2015. 04. 012 1 2 2 2 2 1. 830054 2. 361005 L- 50% IC 50 0. 27 mg /ml K I - K IS 0. 218 0.
74.3 % ~ 89.1 % 1.08 h
31 Traditional Chinese Drug Research & Clinical Pharmacology 11 May Vol.22 No.3 /μg ml -1 2 - Figure 2 Concentration-time curve of the puerarin in compound puerarin or puerarin injection 2 4 6 6 413-414.
Supporting Information
Supporting Information Lewis acid catalyzed ring-opening reactions of methylenecyclopropanes with diphenylphosphine oxide in the presence of sulfur or selenium Min Shi,* Min Jiang and Le-Ping Liu State
Identification of Fish Species using DNA Method
5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,
Original Article. Corynebacterium. (
> >>?> @ >> @ 88 82 > ??> Corynebacterium glutamicum?> ddh @E @? > > > > 4 4 3 2 @ < < >? < @>>? > < >>> < 7 6 5 @?? > < @? >? < > @> > @ @ >@ < > >>?> @ >>
Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...
III Contents I II III Abstract... I Zusammenfassung... II Contents... III 1 Aim of the work... 1 2 Introduction... 2 2.1 Short overview of Chinese hamster ovary cell lines... 2 2.2 Unspecific mutations:
Table S1. Summary of data collections and structure refinements for crystals 1Rb-1h, 1Rb-2h, and 1Rb-4h.
Supporting Information [NH 3 CH 3 ] [In SbS 9 SH]: A novel methylamine-directed indium thioantimonate with Rb + ion-exchange property Kai-Yao Wang a,b, Mei-Ling Feng a, Jian-Rong Li a and Xiao-Ying Huang
ΠΟΛΥΤΕΧΝΕΙΟ ΚΡΗΤΗΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΕΡΙΒΑΛΛΟΝΤΟΣ
ΠΟΛΥΤΕΧΝΕΙΟ ΚΡΗΤΗΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΕΡΙΒΑΛΛΟΝΤΟΣ Τομέας Περιβαλλοντικής Υδραυλικής και Γεωπεριβαλλοντικής Μηχανικής (III) Εργαστήριο Γεωπεριβαλλοντικής Μηχανικής TECHNICAL UNIVERSITY OF CRETE SCHOOL of
Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements
5 5 2012 10 Chinese Optics Vol. 5 No. 5 Oct. 2012 1674-2915 2012 05-0525-06 - * 100190-14 - - 14. 51 μm 81. 4 μm - 1. 64 μm / O436. 1 TH703 A doi 10. 3788 /CO. 20120505. 0525 Correction of chromatic aberration
Identification of Salmonella,Campylobacter jejuni and Enterohemorrhagic E.coli by Denaturing High-performance Liquid Chromatography
BIOTECHNOLOGY BULLETIN 2009 3 116015 PCR multiplex PCR mpcr denaturing high-performance liquid chromatography DHPLC O157 H7 fimy gyra O157 H7 rfbe 3 O157 H7 PCR 284 159 499 bp PCR O157 H7 1.5 CFU/ ml 15
ACTA SCIENTIAE CIRCUMSTANTIAE. 16S rrna PNAN5 ( Rhodococcus sp. strain PNAN5). 20. ( Institute of Microbiology, Chinese Academy of Sciences,
24 3 2004 5 ACTA SCIENTIAE CIRCUMSTANTIAE Vol. 24,No. 3 May,2004 :025322468 (2004) 0320482205 :X523 :A PNAN5 ( Rhodococcus sp. strain PNAN5),,, 3 (, 100080) :, 16S rrna PNAN5 ( Rhodococcus sp. strain PNAN5).
April 2013 Chinese Journal of Chromatography 380 ~ A
2013 4 Vol. 31 No. 4 April 2013 Chinese Journal of Chromatography 380 ~ 385 DOI 10. 3724 /SP. J. 1123. 2012. 10037-1 2 2 2 3* 1. 361005 2. 362006 3. 361005 - UHPLC-MS /MS BS EN 14362-1 2012 ISO 17234-1
Affinity chromatography for the purification of glutathione S-transferase from Oxya chinensis
20 48 4 826 830 * S - 2 **. 030006 2. 03080 GSH-agarose Oxya chinensis Thunberg 5 S - glutathione S-transferases GSTs 60% ~ 80% GSTs 90% 0. 3046 μmol / min / mg protein. 82 GSH-agarose 8. 585 μmol / min
Nov Journal of Zhengzhou University Engineering Science Vol. 36 No FCM. A doi /j. issn
2015 11 Nov 2015 36 6 Journal of Zhengzhou University Engineering Science Vol 36 No 6 1671-6833 2015 06-0056 - 05 C 1 1 2 2 1 450001 2 461000 C FCM FCM MIA MDC MDC MIA I FCM c FCM m FCM C TP18 A doi 10
Guo_Fig. S1. Atg7 +/+ Atg7 -/- FBP_M+6 DHAP_M+3. Glucose Uptake Rate G6P_M+6. nmol/ul cell/hr
Guo_Fig. S1 A C D nmol/ul cell/hr nmol/ul cell/hr Glucose Uptake Rate.3.2.1 *. Lactate Secretion Rate.4.3.2.1. Atg7-/- B Glucose G3P Lac Glucose G6P FBP 3-PG Pyr DHAP cycle Carbon from labeled glucose
Aronia. melanocarpa. Επιβλεπονηερ καθηγηηερ:
Αλεξάνδπειο Τεσνολογικό Εκπαιδεςηικό Ίδπςμα Θεζζαλονίκηρ Σσολή Τεσνολογίαρ Γεωπονίαρ Και Τεσνολογίαρ Τποθίμων Διαηποθήρ Aronia melanocarpa Αξιολόγηζη ηηρ επίδπαζηρ Ελληνικών απομονώζεων ηος γένοςρ Trichoderma
ΤΑ ΤΕΧΝΟΛΟΓΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΟΞΥΓΑΛΑΚΤΙΚΩΝ ΒΑΚΤΗΡΙΩΝ ΚΑΙ Ο ΡΟΛΟΣ ΤΟΥΣ ΣΤΗ ΠΟΙΟΤΗΤΑ ΚΑΙ ΠΑΡΑΓΩΓΗ ΖΥΜΟΥΜΕΝΩΝ ΤΡΟΦΙΜΩΝ
Σχολή Γεωτεχνικών Επιστημών και Διαχείρισης Περιβάλλοντος Μεταπτυχιακή διατριβή ΤΑ ΤΕΧΝΟΛΟΓΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΟΞΥΓΑΛΑΚΤΙΚΩΝ ΒΑΚΤΗΡΙΩΝ ΚΑΙ Ο ΡΟΛΟΣ ΤΟΥΣ ΣΤΗ ΠΟΙΟΤΗΤΑ ΚΑΙ ΠΑΡΑΓΩΓΗ ΖΥΜΟΥΜΕΝΩΝ ΤΡΟΦΙΜΩΝ Αγαθοκλέα
30s 56 60s 72 60s dntp cm s s s 23
31 3 Vol 31 No 3 2012 8 JOURNAL OF OCEANOGRAPHY IN TAIWAN STRAIT Aug 2012 AFLP 1 1 2 1 1 361005 2 361005 dntp Taq Mg 2 + 300 ng DNA 5U PstI 5U MseI 4 h 16 10 50 AFLP AFLP 64 12 AFLP DOI 10 3969 /J ISSN
The pathway of the ozonation of 2,4,62trichlorophenol in aqueous solution
25 12 2005 12 Acta Scientiae Circumstantiae Vol. 25,No. 12 Dec., 2005,. 2,4,62 [J ].,2005,25 (12) :1619-1623 PI Yunzheng, WANGJianglong. The pathway of the ozonation of 2,4,62trichlorophenol in aqueous
1-4 certified reference material CRM. DSC HPLC ± 0. 4 % k = 2 P = GBW
2014 6 33 6 779 * 1 1 2 3 1 2 1. 100050 2. 277500 3. 100050 DSC HPLC 99. 5 ± 0. 4 % k 2 P 0. 95 GBW09587 R978. 7 R927. 1 A 1004-0781 2014 06-0779 - 06 Purity Determination and Uncertainty Evaluation of
Air Drying Process of Granules and Characteristics of Their Structure
2 8 2011 8 ENVIRONMENTAL SCIENCE Vol 2 No 8 Aug 2011 710055 SBR 18 2 27 d 79% 8% 6% COD SOUR 1 29 1 26 X70 1 A 0250-01 2011 08-25-05 Air Drying Process of Granules and Characteristics of Their Structure
Research Paper. glda. glda AT glda-wt. glda-4 pet- 32a + E. coli U / ml E. coli-wt U / ml 3 A Q814
Acta Microbiologica Sinica 51 4 504-509 4 April 2011 ISSN 0001-6209 CN 11-1995 / Q http / / journals. im. ac. cn / actamicrocn Research Paper 1 1 1 1 2* 1 361021 2 361005 glda glda AT AT PCR glda-wt glda-4
,,, (, 100875) 1989 12 25 1990 2 23, - 2-4 ;,,, ; -
25 3 2003 5 RESOURCES SCIENCE Vol. 25 No. 3 May 2003 ( 100875) : 500L - 2-4 - 6-8 - 10 114h - 120h 6h 1989 12 25 1990 2 23-2 - 4 : ; ; - 4 1186cm d - 1 10cm 514d ; : 714 13 317 714 119 317 : ; ; ; :P731
Research Paper. Streptomyces sp. FJ3 HPLC LC-MS. 16S rdna. Doskochilova HPLC LC-MS A Q935. Ochi
Research Paper Acta Microbiologica Sinica 51 7 934-940 4 July 2011 ISSN 0001-6209 CN 11-1995 / Q http / / journals. im. ac. cn / actamicrocn Streptomyces sp. FJ3 * 400716 HPLC LC-MS 16S rdna FJ3 MIC 0.
Research on Economics and Management
36 5 2015 5 Research on Economics and Management Vol. 36 No. 5 May 2015 490 490 F323. 9 A DOI:10.13502/j.cnki.issn1000-7636.2015.05.007 1000-7636 2015 05-0052 - 10 2008 836 70% 1. 2 2010 1 2 3 2015-03
2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _
41 Vol.41, No. 01 RARE METAL MATERIALS AND ENGINEERING March 01 Pb O 4 PbO ( 710049) SnO -Sb Pb O 4 Pb O 4 100.5 h 970 h XRF XRD SEM Pb O 4 PbO PbO TG146.1 + A 100-185X(01)0-046-05 [1,] 1 PbO PbO Sn-Sb
Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil
J. Jpn. Soc. Soil Phys. No. +*0, p.- +*,**1 Eh * ** Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil Daisuke MURAKAMI* and Tatsuaki KASUBUCHI** * The United Graduate
9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer catalysts
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2014 9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer
6 T-DNA PCR TAIL-PCR T-DNA. 69% 30% T-DNA left border LB right border RB T-DNA A T-DNA
Research Paper Acta Microbiologica Sinica 51 2 203-207 4 February 2011 ISSN 0001-6209 CN 11-1995 / Q http / / journals. im. ac. cn / actamicrocn Botrytis cinerea T-DNA * 310014 Botrytis cinerea T-DNA Agrobactirium
ΜΕΤΑΠΤΥΧΙΑΚΗ ΕΡΕΥΝΗΤΙΚΗ ΔΙΑΤΡΙΒΗ
ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ & ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ ΕΡΓΑΣΤΗΡΙΟ ΠΟΙΟΤΙΚΟΥ ΕΛΕΓΧΟΥ & ΥΓΙΕΙΝΗΣ ΤΡΟΦΙΜΩΝ ΚΑΙ ΠΟΤΩΝ Π.Μ.Σ. «ΕΠΙΣΤΗΜΗ & ΤΕΧΝΟΛΟΓΙΑ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗ ΤΟΥ ΑΝΘΡΩΠΟΥ» Η ΕΠΙΔΡΑΣΗ
, Litrrow. Maxwell. Helmholtz Fredholm, . 40 Maystre [4 ], Goray [5 ], Kleemann [6 ] PACC: 4210, 4110H
57 6 2008 6 100023290Π2008Π57 (06) Π3486208 ACTA PHYSICA SINICA Vol. 57,No. 6,June,2008 ν 2008 Chin. Phys. Soc. 3 1) 2) 1) g 1) (, 130033) 2) (, 100049) (2007 9 11 ;2007 11 14 ),Littrow,,.,., Litrrow.
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity Jian-Long Li 1,a, Wei Zhao 1,a, Chen Zhou 1,a, Ya-Xuan
Supplementary File. Table S1. Metabolic model.
Supplementary File Table S. Metabolic model. Flux number Reaction Carbon transitions r Glucose --> G6P ABCDEF --> ABCDEF r2 G6P --> F6P ABCDEF --> ABCDEF r3 F6P --> G6P ABCDEF --> ABCDEF r4 F6P --> FBP
. K HPLC. 2 ~ 50 μg / ml r ~ mg / kg 15
HPLC 527 2 ECONOMOU A FIELDEN P R. Applications potentialities and limitations of adsorptive stripping analysis on mercury film electrodesj. Trends Anal Chem 1997 16 5 286-292. 3 OL IVEIRA M FSACZK A AOKUMURA
College of Life Science, Dalian Nationalities University, Dalian , PR China.
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2018 Postsynthetic modification
ΜΕΛΕΤΗ ΤΩΝ ΣΥΝΘΗΚΩΝ ΕΚΧΥΛΙΣΗΣ ΦΑΙΝΟΛΙΚΩΝ ΣΥΣΤΑΤΙΚΩΝ ΑΠΟ ΤΟ ΦΥΤΟ Sideritis raeseri ΜΕ ΤΗ ΧΡΗΣΗ ΜΙΚΡΟΚΥΜΑΤΩΝ
ΜΕΛΕΤΗ ΤΩΝ ΣΥΝΘΗΚΩΝ ΕΚΧΥΛΙΣΗΣ ΦΑΙΝΟΛΙΚΩΝ ΣΥΣΤΑΤΙΚΩΝ ΑΠΟ ΤΟ ΦΥΤΟ Sideritis raeseri ΜΕ ΤΗ ΧΡΗΣΗ ΜΙΚΡΟΚΥΜΑΤΩΝ Ι. Σαρακατσιάνος 1,2, Κ. Αδαμόπουλος 1, Β. Σαμανίδου 3, Α. Γούλα 4 1. Εργαστήριο Τεχνολογίας Βιομηχανιών
ΘΕΡΜΟΚΗΠΙΑΚΕΣ ΚΑΛΛΙΕΡΓΕΙΕΣ ΕΚΤΟΣ ΕΔΑΦΟΥΣ ΘΡΕΠΤΙΚΑ ΔΙΑΛΥΜΑΤΑ
ΘΕΡΜΟΚΗΠΙΑΚΕΣ ΚΑΛΛΙΕΡΓΕΙΕΣ ΕΚΤΟΣ ΕΔΑΦΟΥΣ ΘΡΕΠΤΙΚΑ ΔΙΑΛΥΜΑΤΑ Θρεπτικό διάλυμα Είναι ένα αραιό υδατικό διάλυμα όλων των θρεπτικών στοιχείων που είναι απαραίτητα για τα φυτά, τα οποία βρίσκονται διαλυμένα
SCIENTIA SILVAE SINICAE. a/ b. oldhamii). The length of cab2bo1 ( GenBank accession
43 3 2 0 0 7 3 SCIENTIA SILVAE SINICAE Vol143, No13 Mar., 2 0 0 7 a/ b 3 1 1 2 1 (1. 100102 ; 2. 100091) : RT2PCR RACE a/ b cdna, cab2 BO1 ( GenBank : EF061137) 1 102 bp, 64 861 bp 1, 265 cab2bo1 64 232
ER-Tree (Extended R*-Tree)
1-9825/22/13(4)768-6 22 Journal of Software Vol13, No4 1, 1, 2, 1 1, 1 (, 2327) 2 (, 3127) E-mail xhzhou@ustceducn,,,,,,, 1, TP311 A,,,, Elias s Rivest,Cleary Arya Mount [1] O(2 d ) Arya Mount [1] Friedman,Bentley
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΙΑΤΡΙΚΗ ΣΧΟΛΗ. ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥ ΩΝ «Ιατρική Ερευνητική Μεθοδολογία» ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΙΑΤΡΙΚΗ ΣΧΟΛΗ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥ ΩΝ «Ιατρική Ερευνητική Μεθοδολογία» ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Νόσος Pompe: Νεότερα κλινικά, γενετικά, διαγνωστικά και θεραπευτικά
ΠΣΤΥΙΑΚΗ ΔΡΓΑΙΑ. Μειέηε Υξόλνπ Απνζηείξσζεο Κνλζέξβαο κε Τπνινγηζηηθή Ρεπζηνδπλακηθή. Αζαλαζηάδνπ Βαξβάξα
ΣΔΥΝΟΛΟΓΙΚΟ ΔΚΠΑΙΓΔΤΣΙΚΟ ΙΓΡΤΜΑ ΘΔΑΛΟΝΙΚΗ ΥΟΛΗ ΣΔΥΝΟΛΟΓΙΑ ΣΡΟΦΙΜΩΝ & ΓΙΑΣΡΟΦΗ ΣΜΗΜΑ ΣΔΥΝΟΛΟΓΙΑ ΣΡΟΦΙΜΩΝ ΠΣΤΥΙΑΚΗ ΔΡΓΑΙΑ Μειέηε Υξόλνπ Απνζηείξσζεο Κνλζέξβαο κε Τπνινγηζηηθή Ρεπζηνδπλακηθή Αζαλαζηάδνπ Βαξβάξα
Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water
31 1 2010 1 ENVIRONMENTAL SCIENCE Vol. 31,No. 1 Jan.,2010, 3, (,, 100084) :,.,, ( Microcystis aeruginosa),3 (A 2 O ) 10 6 ml - 1,> 0139 d - 1. A 2 O222,. TP ( K max ) ( R max ), Monod. :; ; ; ; :X173 :A
Electronic Supplementary Information
Electronic Supplementary Information Unprecedented Carbon-Carbon Bond Cleavage in Nucleophilic Aziridine Ring Opening Reaction, Efficient Ring Transformation of Aziridines to Imidazolidin-4-ones Jin-Yuan
VBA Microsoft Excel. J. Comput. Chem. Jpn., Vol. 5, No. 1, pp (2006)
J. Comput. Chem. Jpn., Vol. 5, No. 1, pp. 29 38 (2006) Microsoft Excel, 184-8588 2-24-16 e-mail: yosimura@cc.tuat.ac.jp (Received: July 28, 2005; Accepted for publication: October 24, 2005; Published on
Fe II aq Fe III oxide electron transfer and Fe exchange: effect of organic carbon
Supplementary materials Fe II aq Fe III oxide electron transfer and Fe exchange: effect of organic carbon Timothy Pasakarnis, A Michael L. McCormick, B Gene F. Parkin, A Aaron Thompson C and Michelle M.
A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
«Συντήρηση αχλαδιών σε νερό. υπό την παρουσία σπόρων σιναπιού (Sinapis arvensis).»
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΓΕΩΠΟΝΙΚΗ ΣΧΟΛΗ ΤΟΜΕΑΣ ΕΠΙΣΤΗΜΗΣ & ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ ΕΛΕΝΗ Π. ΠΑΠΑΤΣΑΡΟΥΧΑ Πτυχιούχος Τεχνολόγος Τροφίμων της Γεωπονικής Σχολής (Α.Π.Θ.) «Συντήρηση αχλαδιών σε
ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ. ΘΕΜΑ: «ιερεύνηση της σχέσης µεταξύ φωνηµικής επίγνωσης και ορθογραφικής δεξιότητας σε παιδιά προσχολικής ηλικίας»
ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΙΓΑΙΟΥ ΣΧΟΛΗ ΑΝΘΡΩΠΙΣΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΩΝ ΤΗΣ ΠΡΟΣΧΟΛΙΚΗΣ ΑΓΩΓΗΣ ΚΑΙ ΤΟΥ ΕΚΠΑΙ ΕΥΤΙΚΟΥ ΣΧΕ ΙΑΣΜΟΥ «ΠΑΙ ΙΚΟ ΒΙΒΛΙΟ ΚΑΙ ΠΑΙ ΑΓΩΓΙΚΟ ΥΛΙΚΟ» ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ που εκπονήθηκε για τη
Studies on Synthesis and Biological Activities of 2( 1 H21,2,42 Triazol212yl)2 2Arylthioethyl Substituted Phenyl Ketones
2002 60 7, 1303 1310 ACTA CHIMICA SINICA Vol. 60, 2002 No. 7, 1303 1310 2( 1 H21,2,42 212 )2 2 ( 300071) Ξ Ξ 22(1 H21,2,42 212 )222 212 (2) 1,42, 3,,. R 1, R 1 = (CH 3 ) 3 C, R 1 = Ar, Ar., 1,42,, Studies
E#ects of Drying on Bacterial Activity and Iron Formation in Acid Sulfate Soils
J. Jpn. Soc. Soil Phys. No. 3+, p..3 /1,**, * ** ** E#ects of Drying on Bacterial Activity and Iron Formation in Acid Sulfate Soils Kaoru UENO*, Tadashi ADACHI** and Hajime NARIOKA** * The Graduate School
Improved Peptide and Protein Torsional Energetics with the OPLS-AA Force Field
Improved Peptide and Protein Torsional Energetics with the OPLS-AA Force Field Supplementary Information Michael J. Robertson, Julian Tirado-Rives, and William L. Jorgensen* Department of Chemistry, Yale
Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene
2001, 24 (1) : 2529 Journal of Nanjing Agricultural University rolc (, 210095) :, rolc ( Nicotiana tabacum ), GUS, PCR Southern rolc,, rolc : ; ; rolc ; : S572103513 : A : 1000Ο2030 (2001) 01Ο0025Ο05 Study
Copper-Catalyzed Oxidative Dehydrogenative N-N Bond. Formation for the Synthesis of N,N -Diarylindazol-3-ones
Electronic Supplementary Material (ESI) for Organic Chemistry Frontiers. This journal is the Partner Organisations 2016 Supporting information Copper-Catalyzed Oxidative Dehydrogenative - Bond Formation
Enzymatic Synthesis of Dithiolopyrrolone Antibiotics Using Cell-Free Extract of Saccharothrix
Enzymatic Synthesis of Dithiolopyrrolone Antibiotics Using Cell-Free Extract of Saccharothrix algeriensis NRRL B-24137 and Biochemical Characterization of Two Pyrrothine N-Acyltransferases in This Extract.
TGFp FSH INH INH
(210095) E-mail ( genlinwang@hotmail.com) - -(Strept Avidin-Biotin-Peroxidase Complex SABC), 1 32,, 1 inhibin INH α 32 000 TGFp FSH FSH [1] INHα Sertoli Noguchi 1997 [2] Meunier et al.1988 [3] INH INH
*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G
J. Hot Spring Sci. /2 +.,.,**2 + + + +, - +3 ++ -*,* + -+ Evaluation of the E# ect of Hyperthermia on Bedrock Bath Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G + + + HNAMI KOUCHI
Malgorzata Korycka-Machala, Marcin Nowosielski, Aneta Kuron, Sebastian Rykowski, Agnieszka Olejniczak, Marcin Hoffmann and Jaroslaw Dziadek
Molecules 2017, 21, 154; doi:10.3390/molecules22010154 Supplementary Materials: Naphthalimides Selectively Inhibit the Activity of Bacterial, Replicative DNA Ligases and Display Bactericidal Effect against
, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells
2011 9 1 77 SLC26A4 HEK 293 1 2 1 1 1 1 (100853) 2 ( 050051) SLC26A4 (pegfp enhanced green fluorescent protein) SLC26A4 pegfp-slc26a4 HEK293 pegfp-slc26a4 HEK293 - (RT-PCR) SLC26A4 mrna Western Blot (
Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil
354 Nippon Shokuhin Kagaku Kogaku Kaishi Vol. /-, No.0, -/.-0* (,**0) 38 * * Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil Tomoko Kawakami, Kyoko Ohashi* and Atsuko Shimada Graduate
Distribution of Mercury and Selenium in the Proteins of Porcine Liver and Kidney Under Different Mercury Exposure Level
ISSN 100727626 CN 1123870ΠQ 2003 6 Chinese Journal of Biochemistry and Molecular Biology 19 (3) :377 382, 3,, (, 918 100039), (, 550002) (Sephadex G2100),, ;, ;, 11 kd (MT),,,,,,,,, Q51,X132 Distribution
Archive of SID. (Tg)
* (// : // : ).... (Tg).. : E-mail: dehghan.n82@gmail.com - : - : : * (). / PSI..[Kurjan-1960] ()... [Parker and.saindon-1978] (). [Backman and.hakanson-1987]. ()... 2 - Non woven 3 - Fluid Filter... (
Enantioselective Organocatalytic Michael Addition of Isorhodanines. to α, β-unsaturated Aldehydes
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2016 Enantioselective Organocatalytic Michael Addition of Isorhodanines to α,