Increasing of Maize Amylose Content by Sense RNA Interference

Transcript

1 RNAi RNAi sbeⅡb RNAi pbac506 pbac508 35S Adh1-intron1 epsps bar Zea mays 44 PCR PCR-Southern 30 9 Southern-blotting 7 T % % RNAi S336 A Increasing of Maize Amylose Content by Sense RNA Interference ZHANG Gui-tang 1 2 LU Dong-chang-cheng 1 2 SUN Chong-xia 1 2 LIANG Rong-qi 3 YANG Feng-ping 2 ZHANG Xiao-dong 2 1. College of Life Science Capital Normal University Beijing China 2. Beijing Agrobiotechnology Research Center Beijing Academy of Agriculture and Forestry Science Beijing China 3. Key Lab of Crop Genomics & Genetic Improvement Beijing Key Lab of Crop Genetic Improvement College of Agronomy and Biotechnology China Agricμltural University Beijing China Abstract In order to explore the effect of sense RNAi RNA interference on increase the amylose content of maize Zea mays two sense-rnai vectors pbac506 and pbac508 with the sense sbeⅡb and selection gene epsps or bar were constructed and transformed to maize callus induced from immature embryos of the elite inbred lines by biolistic PDS1000 / He. Forty-four T 0 transformed plantlets were regenerated and thirty plants were positive by analysis of PCR and PCR-Southern hybridization. Southern-blotting results of 9 strong PCR-positive plants showed that the RNAi constructs in 7 plants were successful integrated into their genomes 4 with one copy of transgene 2 with two copies and 1 with three copies. The amylose content of 2 T 2 transgenic lines were % and % respectively. The results suggested that a big transgenic population was necessary for screening the transgenic plants with multi-copy transgene and high amylose content. Key words Maize Starch branching enzyme Sense-RNAi Amylose 70% Amylose Amylopectin

2 4 RNAi 93 Re- sistant starch RS 1 ~ Starch branching enzymes SBE α sense-rnai 3 sbei sbeiia sbeiib sbeiib sbeiib sense-rnai ae % sense-rnai 50% 80 ae Zea mays % ~ % 6 60% ~ 70% 7 pgem-t easy Vector 70% ~ 80% 7 Promega Escherichia coli ae DH5α Promega Taq IPTG X-gal S1127ae / ae HZ32ae / ae T 4 DNA DNA ND-AE-0201 Promega Promega NEB TaKaRa RNaseA Promega 401 DIG Roche Diagnostics GmbH Sigma Promega BECKMAN CEQ2000XL DNA Analysis System Cosuppresion Accession No AF SacII Sac Ⅰ 3'-UTR sbeiib 2225 ~ 2660 RNA RNA dsrna Inverted repeat RNA in- terference IR-RNAi RNA RNA RNAi Sense RNA interference Sense-RNAi 10 1 sbeiib mrna GenBank 1 sense-rnai Fig 1 Schematic map of expression 11 sense-rnai vector pbac506 and pbac508 1 pbac506 pbac508

3 Southern-bloting 10 ~ 11 d 1 ~ 2 mm N6 Nos' + 10 mg / L AgNO mg / L + 2 mg / L 2 4- D + 30 g / L + 7 g / L TCGGTGATGACGGTGAAA -3' pbac506 PDS1000 / He 0. 1 mg / L 0. 2 mg / L Bialaphos N mg / L AgNO mg / L 2 ~ % mg / L KT + 30 g / L + 7 g / L X 3 ~ 4 mg / L 0. 1 mg / L Bialaphos h PCR-Southern 1 /2 MS mg / L mg / L mg / L NAA + 30 g / L + 7 g / L 3 ~ 5 d Unicam UV-Visible Spectrometry Helios Alpha 1. 3 PCR CTAB DNA pbac506 GB DNA DNA sbeiib PCR sbeiib Nos' P '-CCGCGGGAGGAGGATAAGGT- GATTGTG -3' 5'- CTCATAAATAACGT- CATGCATTAC -3' DNA 1. 0 μl 10 PCR Reaction Buffer 2. 5 μl dntps 2. 5 mmol / L 2. 0 μl 5' 10 μmol / L 1. 0 μl 3' 10 μmol / L 1. 0 μl Taq DNA 2. 5 U / μl 0. 5 μl ddh 2 O 15 μl DNA 1. 0 μl 10 PCR Reaction Buffer 2. 5 μl dntps 2. 5 mmol / L 2. 0 μl 5' 10 μmol / L 1. 0 μl 3' 10 μmol / L 1. 0 μl Taq DNA 2. 5 U / μl 0. 5 μl ddh 2 O 15 μl T12 T13 T14 T15 T16 T20 T21 T22 T23 T min s T26 T27 T28 T29 T30 T32 T35 T36 T41 T43 s s min 0. 8% 1. 4 PCR-Southern Roche PCR DIG Probe Synthesis Kit 5'- ATGATTAGAGTCCCGCAATT -3' 5'- sbeiib DIG 600 bp sbeiib-nos3' DNA PCR 32 T 0 PCR- sbeiib Southern Bio-Rad DNA 2 Roche DIG DNA labeling and Detection Kit Southern Southern PCR P6 Hind III 150 μg DNA mol / L HCl 15 min 3 2 PDS1000 / He d PCR sbeiib Nos3' P5 sbeiib P5 32 PCR bp 2 T1 T2 T3 T4 T5 T6 T7 T8 T10 T11 30 sbeiib 2. 3 sbeiib PCR-Southern 3 30

4 4 RNAi sbeiib M. 1 kb ladder pbac ck1 4 ~ ~ M. 1 kb ladder Plasmid pbac Blank Negative maize ck Different transgenic plants. The same as below. 2 Fig. 2 sbeiib PCR PCR analysis result of sbeiib in transgenic plants 3 Fig Southern-blotting sbeiib-nos3' PCR-Southern PCR-Southern analysis result of sbeiib-nos3' in transgenic plants T30 T29 2 T pbac T20 5. T17 6. T35 7. T21 8. T30 9. T T T T29 1. Plasmid pbac Negative maize CK1 3. Blank 4. T20 5. T17 6. T35 7. T21 8. T30 9. T T T T29. 4 Fig. 4 Southern-blotting analysis of vector in transgenic plants % Nos' Southern % PCR P T 0 9 Tab. 1 The content of amylose of transgenic maize seeds / % / % DNA Southern 4 Serial number Amylose Frenquency increment CK ± ae CK ± T ± T17 T10 T30 T36 T ± T37 T43 T29 Southern-blotting ae T20 T17 T10 T36 T37 1 T21. Note ae. High amylase maize line 501. CK T20 T21. Positive transgenic lines. 3 RNAi RNAi RNAi 3' 3'-UTR mrna poly A 3'- UTR mrna mrna mrna Southern 13 3'-UTR mrna poly A ' 7 Southern 5' 3' RNA 3' 5' T20 T21 1 mrna 14 mrna 3'-UTR

5 96 25 Ohnishi 15 3'-UTR RISCs 5 Smith A M Denyer K Martin C. The synthesis of the- RNAi starch granule J. Annu Rev Plant Physiol Plant Mol Biol RISCs 6 Fergason V. High amylose and waxy corns C / / Hallauer A R. Specialty corn. Boca Rotan 1994 CRC Press. 7. J Napoli C Lemicux C Jorgensen R. Introduction of a chalcone synthasa gene into Petunia results in reversibe co- WO A2 sbeiib cdna suppression of homologous gene in trans J. Plant Cell zein Van der Krol A P Mur L A Beld M et al. Flavonoid sbeiib 3' 5' sbeiib cdna sbe sbeiib sirna 11 Que Q Wang H Y English J J et al The frequency and degree of cosuppression by sense chalcone synthase transgenes are dependent on transgene promoter strength and are reduced by premature nonsense cordons in the 50% 18 sbeiib transgene coding cequence J. Plant Cell sbeiib 12 ZHANG Xiaodong LIANG Rongqi CHEN xuqing et al. T 1 Transgene inheritance and quality improvement by expressing novel HMW glutenin subunit HMW-GS genes in winter wheat J. Chinese Science Bulletin % 23. 1% 15. 6% 13 Pesole G Liuni S Grillo G et al. UTRdb and UTRsite specialize databases of sequences and functional elements of 5' and 3' untranslated regions of eukaryotic % 24. 6% mrnas J. Nucleic Acids Research % sense-rnai 14. M Ohnishi Y Tokunaga K Hohjoh H. Influence of assembly of sirna elements into RNA-induced silencing complex by fork-sirna duplex carrying nucleotide mismatches at the 3'- or 5'-end of the sense-stranded sirna element J. Biochemical and Biophysical Research Communications J J J J ~ 4 Visser R G FJacobsen E. Towards modifying plants foraltered starch content and composition J. Trends Biotech- 11nt 95% nol genes in petunia Addition of a limited number of gene copies may lead to a suppression of gene expression J. Plant Cell Jorgensen R A Ma C L Doetsch N. Functional genomics by sense-rnai a forward genetic approach for cell-typetargeted mutagenesis C. Plant Genomics in China Ⅵ RNA J. 18. RNAi J