ιεύθυνση: N. Mιλτιάδη 1, Νέα Μουδανιά Τηλ.: , Fax: , Ε-mail: ΚΑΘΗΓΗΤΗΣ: IMΣΙΡΙ ΟΥ ΑΝΑΣΤΑΣΙΑ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ιεύθυνση: N. Mιλτιάδη 1, 63200 Νέα Μουδανιά Τηλ.: 2373065313, Fax: 2373026450, Ε-mail: imsiri@otenet.gr ΚΑΘΗΓΗΤΗΣ: IMΣΙΡΙ ΟΥ ΑΝΑΣΤΑΣΙΑ"

Transcript

1 ΑΛΕΞΑΝ ΡΕΙΟ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙ ΕΥΤΙΚΟ Ι ΡΥΜΑ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ TEXNOΛOΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΤΜΗΜΑ ΤΕΧΝΟΛΟΓΙΑΣ ΑΛΙΕΙΑΣ ΚΑΙ Υ ΑΤΟΚΑΛΛΙΕΡΓΕΙΩΝ ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΕΤΙΚΗΣ ιεύθυνση: N. Mιλτιάδη 1, Νέα Μουδανιά Τηλ.: , Fax: , Ε-mail: ΚΑΘΗΓΗΤΗΣ: IMΣΙΡΙ ΟΥ ΑΝΑΣΤΑΣΙΑ ΓΕΝΕΤΙΚΗ ΤΑΥΤΟΠΟΙΗΣΗ ΙΑΦΟΡΕΤΙΚΩΝ ΕΙ ΩΝ ΓΟΝΟΥ ΚΕΦΑΛΟΕΙ ΩΝ ΜΕ ΤΗ ΧΡΗΣΗ ΠΥΡΗΝΙΚΩΝ ΕΙΚΤΩΝ ΙΜΣΙΡΙ ΟΥ ΑΝΑΣΤΑΣΙΑ, ΜΙΝΟΣ ΓΕΩΡΓΙΟΣ, ΚΑΤΣΑΡΕΣ ΒΑΣΙΛΕΙΟΣ, ΤΣΙΩΡΑ ΑΝΝΑ Θεσσαλονίκη,

2 2

3 ΠΙΝΑΚΑΣ ΣΤΟΙΧΕΙΩΝ ΕΡΕΥΝΗΤΙΚΟΥ ΠΡΟΓΡΑΜΜΑΤΟΣΠΟΥ ΧΡΗΜΑΤΟ ΟΤΗΘΗΚΕ ΑΠΟ ΤΗΝ ΕΠΙΤΡΟΠΗ ΕΡΕΥΝΩΝ Τίτλος Ερευνητικού προγράµµατος: Γενετική ταυτοποίηση διαφορετικών ειδών γόνου κεφαλοειδών µε τη χρήση πυρηνικών δεικτών Συνεργαζόµενα Τµήµατα: Τµήµα Τεχνολογίας Αλιείας και Υδατοκαλλιεργειών Επιστηµονικός Υπεύθυνος: Ιµσιρίδου Αναστασία Επιστηµονικοί συνεργάτες: Όνοµα: Μίνος Γεώργιος, Θέση: Επίκουρος Καθηγητής, Ειδικότητα: Ιχθυολογία Όνοµα: Kατσαρές Βασίλειος, Θέση: Εργαστηριακός Συνεργάτης ΤΑΥ, Ειδικότητα: Γενετική Όνοµα: Τσιώρα Άννα, Θέση: Επιστηµονικός Συνεργάτης ΤΑΥ, Ειδικότητα: Ζωολογία ιάρκεια Ερευνητικού Προγράµµατος: 14/3/ /3/2007 Ποσό χρηµατοδότησης Επιτροπής Ερευνών: Ευρώ ηµοσιεύσεις/παρουσιάσεις εργασιών 3

4 1. Identification of fry of different grey mullet species with the use of nuclear 5S rdna markers. Imsiridou A., Minos G., Tsiora A., Katsares V. and Douka S. 10 th International Congress on the Zoogeography and Ecology of Greece and Adjacent Regions. Patras Greece, June Identification of different fry Mugilidae species using 5S rdna Markers (2006). Journal of Applied Ichthyology submitted. A. Imsiridou, G. Minos, V. Katsares, N. Karaiskou and A. Tsiora 4

5 ΠΕΡΙΕΧΟΜΕΝΑ ΣΥΝΤΟΜΗ ΠΑΡΟΥΣΙΑΣΗ ΤΗΣ ΕΡΕΥΝΑΣ Εισαγωγή.9 Θεωρητικό πλαίσιο 11 Ανασκόπηση της βιβλιογραφίας...12 Μεθοδολογία της έρευνας...13 Αποτελέσµατα.14 Συµπεράσµατα 19 Προτάσεις.21 Βιβλιογραφία

6 6

7 ΓΕΝΕΤΙΚΗ ΤΑΥΤΟΠΟΙΗΣΗ ΙΑΦΟΡΕΤΙΚΩΝ ΕΙ ΩΝ ΓΟΝΟΥ ΚΕΦΑΛΟΕΙ ΩΝ ΜΕ ΤΗ ΧΡΗΣΗ ΠΥΡΗΝΙΚΩΝ ΕΙΚΤΩΝ ΙΜΣΙΡΙ ΟΥ ΑΝΑΣΤΑΣΙΑ ΠΕΡΙΛΗΨΗ Η εκτροφή των κεφαλοειδών γίνεται σε µεγάλη κλίµακα και στηρίζεται σε άγριο γόνο. Η αναγνώριση των ειδών του γόνου που αλιεύεται είναι πολύ δύσκολη αλλά και σηµαντική για τους καλλιεργητές, εφόσον ο ρυθµός αύξησης διαφέρει σηµαντικά µεταξύ των ειδών. Ο σκοπός της παρούσας δουλειάς είναι η χρήση µιας απλής γενετικής µεθοδολογίας, της αλυσιδωτής αντίδρασης πολυµεράσης (PCR), για την επιβεβαίωση της συστηµατικής ταξινόµησης των διαφορετικών ειδών γόνου κεφαλοειδών και την παραπέρα διάκρισή τους. Έγινε συλλογή γόνου από έξι είδη κεφαλοειδών (M. cephalus, M. soiuy, C. labrosus, L. aurata, L. Ramada, L. saliens). Ακολούθησε συστηµατική ταξινόµηση των ατόµων, εξαγωγή DNA, ενίσχυση του γονιδίου 5S rdna µε την αλυσιδωτή αντίδραση πολυµεράσης PCR, έλεγχος των προϊόντων ενίσχυσης σε ηλεκτροφόρηση πηκτής αγαρόζης, κλωνοποίηση των προϊόντων PCR και ανάλυση 7

8 πρωτοδιάταξης. Τα δύο είδη M. so-iuy και L. saliens µπορούν να διακριθούν µε µία απλή αντίδραση PCR, εφόσον παρουσιάζουν ένα µοναδικό πρότυπο στη πηκτή αγαρόζης. Τα υπόλοιπα τέσσερα είδη M. cephalus, L. ramada, L. aurata και C. labrosus παρουσιάζουν µετά τη τεχνική της ανάλυσης πρωτοδιάταξης - µοναδικούς ειδο-ειδικούς απλότυπους, µε νουκλεοτιδικές αντικαταστάσεις σε διαφορετικές θέσεις. Η παραπάνω µεθοδολογία µπορεί να οδηγήσει σε ακριβή διάκριση διαφορετικών ειδών γόνου. 8

9 ΓΕΝΕΤΙΚΗ ΤΑΥΤΟΠΟΙΗΣΗ ΙΑΦΟΡΕΤΙΚΩΝ ΕΙ ΩΝ ΓΟΝΟΥ ΚΕΦΑΛΟΕΙ ΩΝ ΜΕ ΤΗ ΧΡΗΣΗ ΠΥΡΗΝΙΚΩΝ ΕΙΚΤΩΝ ΙΜΣΙΡΙ ΟΥ ΑΝΑΣΤΑΣΙΑ, ΜΙΝΟΣ ΓΕΩΡΓΙΟΣ, ΚΑΤΣΑΡΕΣ ΒΑΣΙΛΕΙΟΣ, ΤΣΙΩΡΑ ΑΝΝΑ ΕΙΣΑΓΩΓΗ H οικογένεια των κεφαλοειδών περιλαµβάνει 17 γένη και περισσότερα από 60 είδη (Nelson 1994). Τα κεφαλοειδή έχουν παγκόσµια εξάπλωση καθώς µπορούν να επιβιώσουν από την τροπική έως και την εύκρατη ζώνη. Τα 7 είδη των κεφαλοειδών που απαντώνται στην Ελλάδα είναι: Mugil cephalus (Linnaeus 1758), Mugil so-iuy (Basilewsky 1855), Chelon labrosus (Risso 1826), Oedalechilus labeo (Cuvier 1829), Liza aurata (Risso 1810), Liza ramada (Risso 1826) και Liza saliens (Risso 1810). Σήµερα η εκτροφή των κεφαλοειδών γίνεται σε µεγάλη κλίµακα, κυρίως σε εκτατικής µορφής καλλιέργειες, που στην Ελλάδα αντιπροσωπεύουν το 50% της αλιευτικής παραγωγής των λιµνοθαλασσών. Τα τελευταία χρόνια αρχίζει και στην Ελλάδα να υπάρχει ενδιαφέρον για την εντατική εκτροφή των 9

10 κεφαλοειδών και τον εµπλουτισµό λιµνών και λιµνοθαλασσών. Η καλλιέργεια των κεφαλοειδών στηρίζεται σε άγριο γόνο. Η αναγνώριση των ειδών του γόνου που αλιεύεται είναι προβληµατική, καθώς στηρίζεται κυρίως στη διάταξη των µελανοφόρων κυττάρων στην κοιλιακή περιοχή της κεφαλής (Perlmutter et al., 1957; Zismann, 1981; Reay & Cornel 1988; Minos et al. 2002) σε συνδυασµό µε τη διάταξη των χρωµατοφόρων κατά µήκος του σώµατος (Perlmutter et al., 1957; Zismann, 1981; Cambrony 1984; Serventi et al. 1996). Οποιαδήποτε εποχή και αν αλιευθεί ο γόνος αυτός, µπορούν να συλλεχθούν δύο έως τέσσερα διαφορετικά είδη τα οποία όµως έχουν διαφορετικές ανοχές σε αλατότητα και ο ρυθµός αύξησης διαφέρει σηµαντικά µεταξύ τους. Συνεπώς η ταυτότητα του είδους είναι πολύ σηµαντική πληροφορία για τους καλλιεργητές. Ο σκοπός της παρούσας δουλειάς είναι η χρήση µιας απλής γενετικής µεθοδολογίας, της αλυσιδωτής αντίδρασης πολυµεράσης (PCR), για την επιβεβαίωση της συστηµατικής ταξινόµησης των διαφορετικών ειδών γόνου κεφαλοειδών και την παραπέρα διάκρισή τους. 10

11 ΘΕΩΡΗΤΙΚΟ ΠΛΑΙΣΙΟ Στους ανώτερους ευκαρυώτες, το γονίδιο 5S rdna αποτελείται από µία συντηρηµένη κωδικοποιούσα περιοχή 120 ζευγών βάσεων και από µία µη µεταγραφόµενη περιοχή µεταβλητού µεγέθους (NTS). H µονάδα αυτή (120 βάσεις+nts), επαναλαµβάνεται χιλιάδες φορές επάνω στο χρωµόσωµα. Το µέγεθος της NTS διαφέρει από είδος σε είδος και είναι συνήθως χαρακτηριστική για κάθε είδος (Pendas et al. 1994; Martins & Galetti 2001; Martins et al. 2002). Σε κάποια είδη εντοπίζονται περισσότερες από µία µονάδες του γονιδίου 5S rdna, οι οποίες βρίσκονται σε διαφορετικά χρωµοσώµατα. Συνεπώς το γονίδιο 5S rdna έχει χρησιµοποιηθεί ευρέως για διάκριση και γενετική ταυτοποίηση πολλών οργανισµών, µεταξύ των οποίων και πολλά είδη ψαριών (Karaiskou et al., 2003; Aranishi 2005a, b). Με την εκπόνηση του προτεινόµενου ερευνητικού έργου έγινε εφικτή η γρήγορη γενετική ταυτοποίηση διαφορετικών ειδών γόνου κεφαλοειδών, µε την PCR ενίσχυση του γονιδίου 5S rdna. 11

12 ΑΝΑΣΚΟΠΗΣΗ ΤΗΣ ΒΙΒΛΙΟΓΡΑΦΙΑΣ Έχουν αναπτυχθεί αρκετές γενετικές µεθοδολογίες για διάκριση διαφορετικών ειδών ψαριών. Οι τεχνικές αυτές αφορούν την ηλεκτροφορητική ανάλυση πρωτεϊνών (Andrews 1998; Mackie et al. 1999), τον πολυµορφισµό µήκους περιοριστικών θραυσµάτων (RFLP) ενός τµήµατος του µιτοχονδριακού DNA ή την ανάλυση πρωτοδιάταξης (sequencing) ενός τµήµατος του µιτοχονδριακού DNA (Cespedes et al. 2000; Karaiskou et al. 2003). Έτσι, προηγούµενη γενετική διάκριση των διαφορετικών ειδών κεφαλοειδών έχει επιτευχθεί µε ανάλυση του µιτοχονδριακού DNA και χρήση ειδο-ειδικών εκκινητών, για την ενίσχυση της περιοχής D-loop του µιτοχονδριακού γενώµατος (Murgia et al. 2001). Λίγο αργότερα έγινε χρήση της τεχνικής του πολυµορφισµού µήκους περιοριστικών θραυσµάτων (RFLP) του γονιδίου 16S rrna του µιτοχονδριακού DNA (Klossa-Kilia et al. 2002), για τη διάκριση του είδους M. cephalus από άλλα τέσσερα είδη κεφαλοειδών. Και οι δύο µελέτες αποσκοπούν στην αναγνώριση της προέλευσης των αυγών (αυγοτάραχο) από διαφορετικά είδη κεφαλοειδών, µε σκοπό τον έλεγχο της 12

13 ποιότητας µεταποιηµένων προϊόντων. Η παρούσα µελέτη είναι η πρώτη που χρησιµοποιεί ανάλυση του πυρηνικού γονιδίου 5S rdna, για διάκριση διαφορετικών ειδών γόνου κεφαλοειδών. ΜΕΘΟ ΟΛΟΓΙΑ ΤΗΣ ΕΡΕΥΝΑΣ 1. Έγινε συλλογή γόνου από πέντε είδη κεφαλοειδών (M. cephalus, C. labrosus, L. aurata, L. ramada and L. saliens), στο λιµάνι των Ν. Μουδανιών Χαλκιδικής. Για το νεοεισαγόµενο είδος M. so-iuy, ενήλικα άτοµα συλλέχθηκαν από το Βόρειο Αιγαίο. Η περίοδος δειγµατοληψίας ήταν Μάρτιος 2006 Οκτώβριος Ακολούθησε συστηµατική ταξινόµηση των ατόµων, µε τη χρήση εξειδικευµένων για την περιοχή της Μεσογείου κλείδων προσδιορισµού. 3. Έγινε εξαγωγή DNA σύµφωνα µε τη µεθοδολογία CTAB (Hillis et al. 1996). 4. Ακολούθησε ενίσχυση του γονιδίου 5S rdna µε την αλυσιδωτή αντίδραση πολυµεράσης PCR. Για την ενίσχυση χρησιµοποιήθηκαν οι εκκινητές που 13

14 σχεδιάστηκαν από τους Pendas et al. (1994). 5. Έγινε έλεγχος των προϊόντων ενίσχυσης σε ηλεκτροφόρηση πηκτής αγαρόζης 1,5%. 6. Ακολούθησε εξαγωγή των προϊόντων PCR από την πηκτή αγαρόζης και καθαρισµός αυτών (εκτός από το είδος M. so-iuy, εφόσον το είδος αυτό έδωσε ένα µοναδικό πρότυπο στην πηκτή αγαρόζης). 7. Τα προϊόντα PCR κλωνοποιήθηκαν στο πλασµίδιο ΤΟΡΟ ΤΑ (Invitrogen) και στη συνέχεια χρησιµοποιήθηκαν για το µετασχηµατισµό κυττάρων Escherichia coli (strain DH5a, GibcoBRL) κλώνοι αναλύθηκαν µε την τεχνική της ανάλυσης πρωτοδιάταξης και τη χρήση του εκκινητή M13(-20). 9. Οι νουκλεοτιδικές ακολουθίες από τα πέντε είδη µελετήθηκαν µε τη χρήση των πακέτων Clustal X software (Thompson et al. 1997) και BioEdit software (Hall 1999). ΑΠΟΤΕΛΕΣΜΑΤΑ Αναλύθηκαν συνολικά 180 άτοµα 30 άτοµα από κάθε είδος µε την αλυσιδωτή αντίδραση 14

15 πολυµεράσης. Όπως φαίνεται και στην Εικόνα 1, µόνο δύο από τα έξι είδη παρουσιάζουν ειδοειδικά πρότυπα. Το είδος M. so-iuy δίνει ένα πρότυπο τριών ζωνών: µία ζώνη 280 bp και µία διπλή ζώνη 600 bp και 620 bp. Το είδος L. saliens δίνει ένα πρότυπο µίας ζώνης το µέγεθος της οποίας είναι 220 bp. Τα υπόλοιπα τέσσερα είδη M. cephalus, C. labrosus, L. aurata και L. ramada παρουσιάζουν ένα κοινό πρότυπο δύο ζωνών, 220 bp και 440 bp. εν παρατηρήθηκε ενδοειδικός πολυµορφισµός, εφόσον όλα τα άτοµα του ίδιου είδους εµφάνισαν το ίδιο πρότυπο µετά την αντίδραση PCR. Τα αποτελέσµατα της ανάλυσης πρωτοδιάταξης µετά την κλωνοποίηση των προϊόντων PCR έδειξαν ότι το τµήµα των 220 bp (στα είδη M. cephalus, C. labrosus, L. aurata και L. ramada) αντιστοιχεί σε µία µονάδα του γονιδίου 5S rdna, ενώ το τµήµα των 440 bp αποτελείται από δύο διαδοχικά επαναλαµβανόµενες µονάδες του γονιδίου (Eικόνα 2). Επίσης η ζώνη των 220 bp στο είδος L. saliens, αντιστοιχεί σε µία µονάδα του γονιδίου 5S rdna. Παρόµοια δοµή των 5S rdna επαναλήψεων έχει αποκαλυφθεί και για άλλα είδη ψαριών όπως Solea solea (Cespedes et al. 15

16 1999), Brycon cephalus (Wasko et al. 2001) και Brycon sp. (Wasko et al. 2001). Έγινε σύγκριση των νουκλεοτιδικών ακολουθιών (για τη ζώνη των 220 bp) στα πέντε είδη κεφαλοειδών M. cephalus, C. labrosus, L. aurata, L. saliens και L. ramada. Βρέθηκαν συνολικά 43 πολυµορφικές θέσεις, από τις οποίες οι τρεις εντοπίστηκαν στην κωδικοποιούσα περιοχή και οι υπόλοιπες 40 εντοπίστηκαν στην ΝΤS. Oι ακολουθίες κατατέθηκαν στη βάση δεδοµένων GenBank µε κωδικούς πρόσβασης DQ bp ladder 100 bp ladder 16

17 440 bp 620 bp 600 bp 440 bp 280 bp 220 bp Εικ. 1. Ηλεκτροφορητικό πρότυπο του ενισχυµένου 5S rdna γονιδίου για τα έξι είδη κεφαλοειδών (δύο άτοµα από κάθε είδος). Το µέγεθος των ενισχυµένων προϊόντων ελέγχθηκε µε το µοριακό µάρτυρα 100 bp DNA ladder. 17

18 L. ramada TACGCCCGATCTCGTCCGATCTCGGAAGCTAAGCAGGGTCGGGCCTGGTTAGTACTTGGATGGGAGACCG CCTGGGAATACCAGGTGCTGTAAGCTTTTGATTTCCGTCAGTAGTAATAGGAACATTCGCATCATAATGA TGGACACAATGATGATTTCCATCATCTATTAATACTCTTTCTGTGACTACAGCAAAAGCTTACGGCCATA CCAGCCTGAACACGCCCGATCTCGTCTGATCTCGGAAGCTAAGCAGGGTCGGGCCTGGTTAGTACTTGGA TGGGAGACCGCCTGGGAATACCAGGTGCTGTAAGCTTTTGATTTTCATCACGAGTAATAGGAACATTCAC ATCATAGTGATGGACACAATGATGATTTCCATCATCTATTAATACTCTTTCTGTGACTACAGCAAAAGCT TACGGCCATACCAGCCTGAA M. cephalus TACGCCCGATCTCGTCCGATCTCGGAAGCTAAGCACGGTCGGGCCTGGTTAGTACTTGGATCGGAGACCG CCTGGGAATACTAGGTGCTGTAAGCCTTTCATTTTCATCAGGAGACATGGTAATATTTACATCATCAAAA TACATGCAATGATGATTTTGAGCACTTATATATACTGCGTTTGTGACAGTTACCATTGCTTACGGCCATA CCAGCCTGATTACGCCCGATCTCGTCCGATCTCGGAAGCTAAGCAGTGTAGGGCCTGGTTAGTATTTGGA TGGGAGACCGCCTGGGAATACCAGGTGCTGTAACCTTTTCATTCTCATCAGGAAACATGGTAACATTTAC ATCATCAAAATACATGCAATGATCATTTTGACCACTTATATATACTGCTTTAGTGACATTTGACATTGCT TACGGCCATACCAGCCTGAA Εικ. 2. Οι δύο διαδοχικά επαναλαµβανόµενες µονάδες του γονιδίου 5S rdna για τα είδη L. ramada and M. Cephalus. Η κωδικοποιούσα περιοχή δίνεται µε έντονα γράµµατα. Οι εκκινητές που χρησιµοποιήθηκαν για την ενίσχυση είναι υπογραµµισµένοι. 18

19 ΣΥΜΠΕΡΑΣΜΑΤΑ Oι φυλογενετικές σχέσεις στην οικογένεια των κεφαλοειδών έχουν µελετηθεί µε τη βοήθεια µοριακών δεικτών, όπως δεδοµένα αλλοενζυµικής ανάλυσης (Papasotiropoulos et al. 2001), δεδοµένα πολυµορφισµού µήκους περιοριστικών θραυσµάτων του mtdna (Papasotiropoulos et al. 2002), δεδοµένα ανάλυσης πρωτοδιάταξης του mtdna (Caldara et al. 1996; Rossi et al. 2004). Όλες οι παραπάνω µελέτες συνηγορούν σε δύο βασικά σηµεία: α) τη γενετική διαφοροποίηση του είδους M. cephalus, η οποία οδηγεί πάντα σε ξεχωριστή οµαδοποίησή του β) την κοινή οµαδοποίηση των ειδών L. ramada και L. aurata. Τα αποτελέσµατα της παρούσας δουλειάς συµφωνούν απόλυτα µε αυτά των προηγούµενων µελετών εφόσον το είδος M. cephalus παρουσιάζει 37 πολυµορφικές θέσεις από τις 43 που συνολικά βρέθηκαν, ενώ τα είδη L. ramada και L. aurata µοιράζονται µόνο µία νουκλεοτιδική αντικατάσταση σε όλο το γονίδιο. Τα δύο είδη M. so-iuy και L. saliens µπορούν να διακριθούν µε µία απλή αντίδραση PCR, εφόσον παρουσιάζουν ένα µοναδικό πρότυπο στη πηκτή αγαρόζης. Το είδος M. 19

20 cephalus φαίνεται να διαφοροποιείται περισσότερο συγκρινόµενο µε τα υπόλοιπα, και παρουσιάζει ένα µοναδικό DNA απλότυπο µετά από την τεχνική της ανάλυσης πρωτοδιάταξης. Το είδος αυτό είναι το πιο σηµαντικό για τους καλλιεργητές καθώς έχει τον υψηλότερο ρυθµό αύξησης σε µονάδες ιχθυοκαλλιέργειας, και το αυγοτάραχο το οποίο παράγεται από τα ώριµα θηλυκά έχει υψηλή τιµή στην αγορά. Κάθε ένα από τα υπόλοιπα τρία είδη L. ramada, L. aurata και C. labrosus παρουσιάζει επίσης ένα µοναδικό ειδο-ειδικό απλότυπο, µε νουκλεοτιδικές αντικαταστάσεις σε διαφορετικές θέσεις. Συµπερασµατικά λοιπόν, µία απλή αντίδραση PCR η οποία συνοδεύεται από την τεχνική της ανάλυσης πρωτοδιάταξης του 5S rdna γονιδίου, µπορεί να οδηγήσει σε ακριβή διάκριση των διαφορετικών ειδών γόνου κεφαλοειδών που θα γεµίσουν τα εκκολαπτήρια. Επιπλέον, η µεθοδολογία αυτή µπορεί να χρησιµοποιηθεί και για την επιβεβαίωση της µορφολογικής διάκρισης και παραπέρα συστηµατικής ταξινόµησης των ειδών αυτών. 20

21 ΠΡΟΤΑΣΕΙΣ Η παρούσα προτεινόµενη εργασία παρέχει µια γρήγορη και κυρίως αδιαµφισβήτητη µεθοδολογία (εφόσον το γενετικό υλικό των οργανισµών δεν επηρεάζεται από εξωτερικούς παράγοντες), για την ταυτοποίηση των διαφορετικών ειδών γόνου. Οι συγκεκριµένες γενετικές τεχνικές οι οποίες θα έπονται της αρχικής αναγνώρισης και συστηµατικής ταξινόµησης των ειδών έρχονται να επιβεβαιώσουν ή τυχόν να αναιρέσουν την αρχική κατάταξη. Κάθε ένα από τα έξι είδη κεφαλοειδών χαρακτηρίζεται από διαφορετικό πρότυπο του γονιδίου 5S rdna. Έτσι εάν ένας ιχθυοκαλλιεργητής έχει τυχόν αµφιβολίες για το είδος του γόνου µε το οποίο γεµίζει τις δεξαµενές του, µπορεί να επισκεφτεί το Τµήµα µας και σε χρονικό διάστηµα δύο έως τριών ηµερών θα είναι σίγουρος για το είδος του γόνου µε το οποίο κάνει τη δουλειά του. ΒΙΒΛΙΟΓΡΑΦΙΑ Andrews A.T., Electrophoretic methods. In: Analytical Methods of Food 21

22 Authentication. Eds: P. R. Ashurt; M. J. Dennis, London, UK. pp Aranishi F., 2005a. Rapid PCR-RFLP method for discrimination of imported and domestic mackerel. Marine Biotechnology, 7: Aranishi F., 2005b. PCR-RFLP analysis of nuclear nontranscribed spacer for mackerel species identification. Journal of Agricultural and Food Chemistry, 53: Caldara F., Bargelloni L., Ostellari L., Penzo E., Colombo L. & T. Patarnello, Molecular phylogeny of grey mullets based on mitochondrial DNA sequence analysis: Evidence of a different rate of evolution at the intrafamily level. Molecular Phylogenetics and Evolution, 6 (3): Cambrony M., Identification et périodicité du recrutement des juvéniles de mugilidae dans les étangs littoraux du Languedoc- Rosillon. Vie Milieu, 34 (4): Cespedes A., Garcia T., Carrera E., Gonzalez I., Fernandez A., Hernandez P.E., & R. Martin, Identification of sole (Solea solea) and greenland halibut (Reinhardtius 22

23 hippoglossoides) by PCR amplification of the 5S rdna gene. Journal of Agricultural and Food Chemistry, 47: Cespedes A. Garcia T., Carrera E., Gonzalez L., Fernandez A., Asensio L., Hernandez P.E. & R. Martin, Genetic differentiation between sole (Solea solea) and Greenland halibut (Reinhardtius hippoglossoides) by PCR RFLP analysis of a 12S rrna gene fragment. Journal of the Science of Food and Agriculture, 80: Hall T.A., BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41: Hillis D.M., Moritz C. & B.K. Mable, Molecular Systematics. Sunderland, MA: Sinauer Associates Karaiskou N., Triantafyllidis A. & C. Triantaphyllidis, Discrimination of three Trachurus species using both mitochondrial and nuclear based DNA approaches. Journal of Agricultural and Food Chemistry, 51:

24 Klossa Killia E., Papasotiropoulos V., Killias G. & S. Alahiotis, Authentication of Messolongi (Greece) fish roe using PCR- RFLP analysis of 16S rrna mtdna segment. Food Control, 13: Mackie I.M., Pryde S.E., Gonzales-Sotelo C., Medina I., Pérez-Martin R., Quinteiro J., Rey-Mendez M. & H. Rehbein, Challenges in the identification of species of canned fish. Food Science and Technology, 10: Martins C. &. P.M. Galetti, Organization of 5S rdna in species of the fish Leporinus: two different genomic locations are characterized by distinct nontranscribed spacers. Genome, 44: Martins C., Wasko A.P., Oliveira C., Porto- Foresti F., Parise-Maltempi P.P., Wright J.M. & F. Foresti, Dynamics of 5S rdna in the tilapia (Oreochromis niloticus) genome: repeat units, inverted sequences, pseudogenes and chromosome loci. Cytogenetic and Genome Research, 98: Minos G., Katselis G., Ondrias I. & I.J. Harrison, Use of melanophore patterns on the 24

25 ventral side of the head to identify fry of grey mullets (Teleostei : Mugilidae). Israeli Journal of Aquaculture:Bamidgeh, 54 (1): Murgia R., Tola G., Archer S.N., Vallegra S. & J. Hirano, Genetic identification of grey mullet species (mugilidae) by analysis of mitochondrial DNA sequence: application to identify the origin of processed ovary products (Bottarga). Marine Biotechnology, 21: Nelson J.S., Fishes of the World. Wiley, New York. Papasotiropoulos V., Klossa-Killia E., Killias G. & S. Alahiotis, Genetic divergence and phylogenetic relationships in grey mullets (Teleostei: Mugilidae) using allozyme data. Biochemical Genetics, 39 (5/6): Papasotiropoulos V., Klossa-Killia E., Killias G. & S. Alahiotis, Genetic divergence and phylogenetic relationships in grey mullets (Teleostei: Mugilidae) based on PCR-RFLP analysis of mtdna segments. Biochemical Genetics, 40 (3/4): Pendas A.M., Moran P., Freije J.L. & E. Garcia- Vazquez, 1994: Chromosomal mapping and 25

26 nucleotide sequence of two tandem repeats of Atlantic salmon 5S rrna. Cytogenetic and Genome Research, 67: Perlmutter A., Bograd L. & J. Pruginin, Use of the estuarine and sea fish of the family Mugilidae (grey mullets) for pond culture in Israel. Gen. Fish. Coun. Med. Proc. Tech. Pap. 4: Reay P.J. & V. Cornell, Identification of grey mullet (Teleostei: Mugilidae) juveniles from British waters. Journal of Fish Biology, 32: Rossi A.R., Ungaro A., De Innocentiis S., Crosetti D. & L. Sola, Phylogenetic analysis of Mediterranean mugilids by allozymes and 16S mtrrna genes species of investigation: are the Mediterranean Liza monophyletic? Biochemical Genetics, 42 (9-10): Serventi M., Harrison I.J., Torricelli P. & G. Gandolfi, The use of pigmentation and morphological characters to identify Italian mullet fry. Journal of Fish Biology, 49: Thompson, J.D., Gibson T.J., Plewniak F., Jeanmougin F. & D.G. Higgins, The 26

27 CLUSTAL X windows interface: Flexible strategies for multiple alignment aided by quality analysis tool. Nucleic Acids Research, 25: Wasko A.P., Martins C., Wright J.M. & P.M. Galetti, Molecular organization of 5S rdna in fishes of the genus Brycon. Genome, 44: Zismannn L., Means of identification of grey mullet fry for culture In: Aquaculture of grey mullets. Ed: O. H. Oren. Cambridge, UK. pp

15 o Πανελλήνιο Συνέδριο Ιχθυολόγων ΠΡΑΚΤΙΚΑ

15 o Πανελλήνιο Συνέδριο Ιχθυολόγων ΠΡΑΚΤΙΚΑ 15 o Πανελλήνιο Συνέδριο Ιχθυολόγων ΠΡΑΚΤΙΚΑ Θεσσαλονίκη 10-13 Οκτωβρίου 2013 15 ο Πανελλήνιο Συνέδριο Ιχθυολόγων Θεσσαλονίκη 2013 Πρώτη έκδοση 2013 Τυπώθηκε στη Θεσσαλονίκη από τις Εκδόσεις Γιαχούδη ISBN

Διαβάστε περισσότερα

ΑΝΑΛΥΤΙΚΟ ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ ΑΝΑΣΤΑΣΙΑ ΙΜΣΙΡΙΔΟΥ

ΑΝΑΛΥΤΙΚΟ ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ ΑΝΑΣΤΑΣΙΑ ΙΜΣΙΡΙΔΟΥ ΑΝΑΛΥΤΙΚΟ ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ ΑΝΑΣΤΑΣΙΑ ΙΜΣΙΡΙΔΟΥ ΘΕΣΣΑΛΟΝΙΚΗ 2015 ΠΕΡΙΕΧΟΜΕΝΑ 1. ΠΡΟΣΩΠΙΚΑ ΣΤΟΙΧΕΙΑ.3 2. ΣΠΟΥΔΕΣ..3 3. ΕΠΙΣΤΗΜΟΝΙΚΕΣ ΔΗΜΟΣΙΕΥΣΕΙΣ Α. Εργασίες δημοσιευμένες σε διεθνή περιοδικά..3 Β. Άρθρα

Διαβάστε περισσότερα

Department of Biological Sciences, Texas Tech University, MS 43131, Lubbock,Texas 79409-3131. 3

Department of Biological Sciences, Texas Tech University, MS 43131, Lubbock,Texas 79409-3131. 3 1 Τμήμα Βιολογίας, Πανεπιστήμιο Κρήτης, Ηράκλειο Κρήτης. 2 Department of Biological Sciences, Texas Tech University, MS 43131, Lubbock,Texas 79409-3131. 3 Department of Biology, Faculty of Science, Dokuz

Διαβάστε περισσότερα

Ανάλυση αυθεντικότητας προϊόντων κρέατος με μεθόδους DNA: Η περίπτωση νοθείας με κρέας αλόγου Στέλιος Σπανιόλας Τεχνολόγος Τροφίμων, MSc PhD

Ανάλυση αυθεντικότητας προϊόντων κρέατος με μεθόδους DNA: Η περίπτωση νοθείας με κρέας αλόγου Στέλιος Σπανιόλας Τεχνολόγος Τροφίμων, MSc PhD Ανάλυση αυθεντικότητας προϊόντων κρέατος με μεθόδους DNA: Η περίπτωση νοθείας με κρέας αλόγου Στέλιος Σπανιόλας Τεχνολόγος Τροφίμων, MSc PhD 1. ΕΙΣΑΓΩΓΗ Η σημασία της νοθείας των τροφίμων, τόσο από την

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

Βιοπληροφορική Ι. Παντελής Μπάγκος. Παν/µιο Στερεάς Ελλάδας

Βιοπληροφορική Ι. Παντελής Μπάγκος. Παν/µιο Στερεάς Ελλάδας Βιοπληροφορική Ι Παντελής Μπάγκος Παν/µιο Στερεάς Ελλάδας Λαµία 2006 1 Βιοπληροφορική Ι Εισαγωγή: Ορισµός της Βιοπληροφορικής, Υποδιαιρέσεις της Βιοπληροφορικής, Τα είδη των δεδοµένων στη Βιοπληροφορική.

Διαβάστε περισσότερα

ιδασκόµενα Μαθήµατα: ΒΙΟΛΟΓΙΑ, ΜΙΚΡΟΒΙΟΛΟΓΙΑ, ΓΕΝΕΤΙΚΗ, ΦΑΡΜΑΚΟΛΟΓΙΑ, ΒΙΟΣΤΑΤΙΣΤΙΚΗ, ΑΡΧΕΣ ΠΛΗΡΟΦΟΡΙΚΗΣ & ΕΦΑΡΜΟΓΕΣ ΣΤΗΝ ΥΓΕΙΑ.

ιδασκόµενα Μαθήµατα: ΒΙΟΛΟΓΙΑ, ΜΙΚΡΟΒΙΟΛΟΓΙΑ, ΓΕΝΕΤΙΚΗ, ΦΑΡΜΑΚΟΛΟΓΙΑ, ΒΙΟΣΤΑΤΙΣΤΙΚΗ, ΑΡΧΕΣ ΠΛΗΡΟΦΟΡΙΚΗΣ & ΕΦΑΡΜΟΓΕΣ ΣΤΗΝ ΥΓΕΙΑ. Ονοµατεπώνυµο: ΓΕΩΡΓΙΟΣ ΜΙΝΟΣ Βαθµίδα: ΑΝΑΠΛΗΡΩΤΗΣ ΚΑΘΗΓΗΤΗΣ Γνωστικό Αντικείµενο: ΣΥΣΤΗΜΑΤΙΚΗ & ΒΙΟΜΕΤΡΙΑ ΙΧΘΥΩΝ ιδασκόµενα Μαθήµατα: ΒΙΟΛΟΓΙΑ, ΜΙΚΡΟΒΙΟΛΟΓΙΑ, ΓΕΝΕΤΙΚΗ, ΦΑΡΜΑΚΟΛΟΓΙΑ, ΒΙΟΣΤΑΤΙΣΤΙΚΗ, ΑΡΧΕΣ

Διαβάστε περισσότερα

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης ΕΙΣΑΓΩΓΗ Σύμφωνα με την ΠΟΥ το 1/3 περίπου του παγκόσμιου πληθυσμού είναι μολυσμένο

Διαβάστε περισσότερα

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

Νόσος Parkinson-Νέοι ορίζοντες Ξηροµερήσιου Γεωργία Νευρολόγος-Μέλος ερευνητικής οµάδας Νευρογενετικής Αίτια της νόσου Parkinson Περιβαλλοντικοί παράγοντες Γενετικοί παράγοντες Γενετική βλάβη (παθογόνα

Διαβάστε περισσότερα

Ο Ελληνικός βούβαλος.

Ο Ελληνικός βούβαλος. ΑΛΕΞΑΝ ΡΕΙΟ Τ.Ε.Ι. ΘΕΣΣΑΛΟΝΙΚΗΣ, ΤΜΗΜΑ ΖΩΙΚΗΣ ΠΑΡΑΓΩΓΗΣ 3Ο ΠΑΝΕΛΛΗΝΙΟ ΣΥΝΕ ΡΙΟ ΤΕΧΝΟΛΟΓΙΑΣ ΖΩΙΚΗΣ ΠΑΡΑΓΩΓΗΣ 1Η ΑΝΑΚΟΙΝΩΣΗ 3ο Πανελλήνιο Συνέδριο Τεχνολογίας Ζωικής Παραγωγής Φεβρουάριος 2011, Θεσσαλονίκη

Διαβάστε περισσότερα

«Η συμβολή της βιοπληροφορικής στη μελέτη της ποικιλότητας των πληθυσμών της πεταλούδας Carassius gibelio»

«Η συμβολή της βιοπληροφορικής στη μελέτη της ποικιλότητας των πληθυσμών της πεταλούδας Carassius gibelio» «Η συμβολή της βιοπληροφορικής στη μελέτη της ποικιλότητας των πληθυσμών της πεταλούδας Carassius gibelio» Γεώργιος Τσιπάς 1, Μαρία Τάτση 2 1 Καθηγητής Βιολόγος Ph.D., Γυμνάσιο Καινουργίου Αιτωλοακαρνανίας

Διαβάστε περισσότερα

ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΕΡΓΑΣΤΗΡΙΟ ΓΕΩΡΓΙΚΗΣ ΖΩΟΛΟΓΙΑΣ ΚΑΙ ΕΝΤΟΜΟΛΟΓΙΑΣ

ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΕΡΓΑΣΤΗΡΙΟ ΓΕΩΡΓΙΚΗΣ ΖΩΟΛΟΓΙΑΣ ΚΑΙ ΕΝΤΟΜΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΕΡΓΑΣΤΗΡΙΟ ΓΕΩΡΓΙΚΗΣ ΖΩΟΛΟΓΙΑΣ ΚΑΙ ΕΝΤΟΜΟΛΟΓΙΑΣ Χρήση μοριακών δεικτών για τη διάκριση πληθυσμών των ειδών εντόμων Macrolophus pygmaeus και

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο)

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) 1 ΦΟΡΕΙΣ πλασµίδια βακτηρίων βακτηριοφάγοι ιοί συνδυασµός πλασµιδίου βακτηριοφάγου (κοσµίδια) 2 ΦΟΡΕΙΣ Βακτηριοφάγοι Χαρακτηριστικά

Διαβάστε περισσότερα

ΑΠΟΣΤΟΛΟΣ Π. ΑΠΟΣΤΟΛΙΔΗΣ

ΑΠΟΣΤΟΛΟΣ Π. ΑΠΟΣΤΟΛΙΔΗΣ ΑΠΟΣΤΟΛΟΣ Π. ΑΠΟΣΤΟΛΙΔΗΣ ΑΝΑΠΛΗΡΩΤΗΣ ΚΑΘΗΓΗΤΗΣ ΤΟΥ ΤΟΜΕΑ ΖΩΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΤΟΥ ΤΜΗΜΑΤΟΣ ΓΕΩΠΟΝΙΑΣ ΤΗΣ ΣΧΟΛΗΣ ΓΕΩΠΟΝΙΑΣ, ΔΑΣΟΛΟΓΙΑΣ & ΦΥΣΙΚΟΥ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΤΟΥ Α.Π.Θ. ΣΥΝΤΟΜΟ ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ ΘΕΣΣΑΛΟΝΙΚΗ

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

Τρυφωνόπουλος Γιώργος

Τρυφωνόπουλος Γιώργος Βιογραφικό σημείωμα Προσωπικές πληροφορίες Επώνυμο / Όνομα Διεύθυνση Διεύθυνση ηλεκτρονικού ταχυδρομείου Τρυφωνόπουλος Γιώργος Ξηροπηγαδο Τ.Κ.: 22001, Αρκαδία (Ελλάδα) Τηλέφωνο +306946378761 Υπηκοότητα

Διαβάστε περισσότερα

σπανίων φυλών των ζώων

σπανίων φυλών των ζώων Προβλήματα διατήρησης των σπανίων φυλών των ζώων Problems of conservation of rare breeds of animals Ανεξέλεγκτες διασταυρώσεις στα ποίμνια Μικρό μέγεθος Ελεγχο ομομειξίας μ Αδυναμία κατάταξης των ζώων

Διαβάστε περισσότερα

Τ.Ε.Ι. ΔΥΤΙΚΗΣ ΕΛΛΑΔΑΣ ΤΜΗΜΑ ΤΕΧΝΟΛΟΓΙΑΣ ΑΛΙΕΙΑΣ-ΥΔΑΤΟΚΑΛΛΙΕΡΓΕΙΩΝ ΜΑΘΗΜΑ: ΥΔΑΤΟΚΑΛΛΙΕΡΓΕΙΕΣ Ι

Τ.Ε.Ι. ΔΥΤΙΚΗΣ ΕΛΛΑΔΑΣ ΤΜΗΜΑ ΤΕΧΝΟΛΟΓΙΑΣ ΑΛΙΕΙΑΣ-ΥΔΑΤΟΚΑΛΛΙΕΡΓΕΙΩΝ ΜΑΘΗΜΑ: ΥΔΑΤΟΚΑΛΛΙΕΡΓΕΙΕΣ Ι 1 Τ.Ε.Ι. ΔΥΤΙΚΗΣ ΕΛΛΑΔΑΣ ΤΜΗΜΑ ΤΕΧΝΟΛΟΓΙΑΣ ΑΛΙΕΙΑΣ-ΥΔΑΤΟΚΑΛΛΙΕΡΓΕΙΩΝ ΜΑΘΗΜΑ: ΥΔΑΤΟΚΑΛΛΙΕΡΓΕΙΕΣ Ι ΣΗΜΕΙΩΣΕΙΣ ΠΕΡΙ ΛΙΜΝΟΘΑΛΑΣΣΩΝ Δρ. Γεώργιος Χώτος Καθηγητής «Η Ιχθυοπανίδα των λιμνοθαλασσών» Στις λιμνοθάλασσες

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

TreeTOPS. ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα. Teacher s Guide. ELLS European Learning Laboratory for the Life Sciences

TreeTOPS. ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα. Teacher s Guide. ELLS European Learning Laboratory for the Life Sciences TreeTOPS ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα Teacher s Guide ELLS European Learning Laboratory for the Life Sciences 1 Γενικός σκοπός Το συγκεκριμένο παιχνίδι έχει ως στόχο να εισάγει τους

Διαβάστε περισσότερα

Αϖοµόνωση και γενετική διαφοροϖοίηση ϖληθυσµών του ζαρκαδιού (Capreoluscapreolus) στην Ελλάδα νέα δεδοµένα για αϖοτελεσµατικότερη διαχείριση και διατήρηση ηµήτρης Τσαϖάρης Παναγιώτης Κασαϖίδης Κωνσταντίνος

Διαβάστε περισσότερα

πληθυσμών του αρουραίου (Rattus rattus)σε συμπλέγματα νησιών και βραχονησίδων των ελληνικών θαλασσών

πληθυσμών του αρουραίου (Rattus rattus)σε συμπλέγματα νησιών και βραχονησίδων των ελληνικών θαλασσών Γενετική δομή και πρότυπα διαφοροποίησης των πληθυσμών του αρουραίου (Rattus rattus)σε συμπλέγματα νησιών και βραχονησίδων των ελληνικών θαλασσών Δημήτρης Τσαπάρης Jacob Fric Αθήνα, Οκτώβριος 2012 Jon

Διαβάστε περισσότερα

Γεωπονικό Πανεπιστήμιο Αθηνών. (2006-2008) Βαθμός: «Άριστα» (9,25/10)

Γεωπονικό Πανεπιστήμιο Αθηνών. (2006-2008) Βαθμός: «Άριστα» (9,25/10) ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ ΓΕΩΠΟΝΟΣ ΓΠΣ MSc- ΒΙΟΤΕΧΝΟΛΟΓΟΣ ΠΡΟΣΩΠΙΚΑ ΣΤΟΙΧΕΙΑ Τηλέφωνο: 6972314589 / 210-8221676 E-mail: tmaltez@otenet.gr, tasosmalt@yahoo.gr Στρατιωτική θητεία: Ολοκληρωμένη ΕΚΠΑΙΔΕΥΣΗ - Μεταπτυχιακό

Διαβάστε περισσότερα

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Vasilis Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus http://en.wikipedia.org/wiki/image:cyprus_topo.png

Διαβάστε περισσότερα

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Chain Reaction (pcr)- Αλυσιδωτή αντίδραση πολυμεράσης.η

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Συνδεδεµένα Γονίδια. Γενετικός Ανασυνδυασµός Κλασσική Γενετική Χαρτογράφηση ΑΘΑΝΑΣΙΟΣ ΜΑΥΡΟΜΑΤΗΣ - ΤΑΝΙΑ ΜΑΡΚΟΠΟΥΛΟΥ

Συνδεδεµένα Γονίδια. Γενετικός Ανασυνδυασµός Κλασσική Γενετική Χαρτογράφηση ΑΘΑΝΑΣΙΟΣ ΜΑΥΡΟΜΑΤΗΣ - ΤΑΝΙΑ ΜΑΡΚΟΠΟΥΛΟΥ 8η ιάλεξη Συνδεδεµένα Γονίδια Γενετικός Ανασυνδυασµός Κλασσική Γενετική Χαρτογράφηση ΑΘΑΝΑΣΙΟΣ ΜΑΥΡΟΜΑΤΗΣ - ΤΑΝΙΑ ΜΑΡΚΟΠΟΥΛΟΥ Εργαστήριο Γενετικής & Βελτίωσης φυτών Κύρια σηµεία - Ορισµοί Συνταινικά =

Διαβάστε περισσότερα

ΑΣΚΗΣΗ 1η Αναζήτηση πληροφορίας σε Βιβλιογραφικές Βάσεις εδοµένων

ΑΣΚΗΣΗ 1η Αναζήτηση πληροφορίας σε Βιβλιογραφικές Βάσεις εδοµένων ΑΣΚΗΣΗ 1η Αναζήτηση πληροφορίας σε Βιβλιογραφικές Βάσεις εδοµένων ΕΙΣΑΓΩΓΗ Η αναζήτηση και µελέτη της επιστηµονικής βιβλιογραφίας αποτελεί βασική προϋπόθεση για την επίλυση ερευνητικών προβληµάτων. Η βιβλιογραφική

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 α Α2 γ Α3 δ Α4 β Α5 γ ΘΕΜΑ Β Β1. Σελ. 120 σχολ. βιβλίου: «Για την επιλογή οργάνων

Διαβάστε περισσότερα

Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών

Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών Αντιµεταλλαξιγόνο δράση ανίχνευση ουσιών που προστατεύουν το DNA από µεταλλαξιγόνα που προκαλούν µεταλλάξεις

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

Φπκαηίσζε: ε επηδεκηνινγηθή δηεξεύλεζε θξνπζκάησλ κε κνξηαθέο ηερληθέο

Φπκαηίσζε: ε επηδεκηνινγηθή δηεξεύλεζε θξνπζκάησλ κε κνξηαθέο ηερληθέο Φπκαηίσζε: ε επηδεκηνινγηθή δηεξεύλεζε θξνπζκάησλ κε κνξηαθέο ηερληθέο Λοσκία Ζέρβα Εργαστήριο Κλινικής Μικροβιολογίας Αττικό Νοσοκομείο, Πανεπιστήμιο Αθηνών ΔΗΑΓΩΓΖ Από ηα ηέιε ηνπ 1980: εθαξκνγή κνξηαθώλ

Διαβάστε περισσότερα

Η Κυτταρογενετική στις αιματολογικές κακοήθειες

Η Κυτταρογενετική στις αιματολογικές κακοήθειες Εργαστήριο Υγειοφυσικής & Περιβαλλοντικής Υγείας, ΙΠΤ-Α, Ε.Κ.Ε.Φ.Ε. «Δημόκριτος» Η Κυτταρογενετική στις αιματολογικές κακοήθειες Μανωλά Καλλιόπη, Ph.D Ερευνήτρια Γ Κυτταρογενετική Κλάδος της Γενετικής

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Μοριακή ταυτοποίηςη: είδοσ, άτομο, φφλο

Μοριακή ταυτοποίηςη: είδοσ, άτομο, φφλο Διάλεξη 2 Μοριακή ταυτοποίηςη: είδοσ, άτομο, φφλο (Κ. Ματθιόπουλοσ) Τι είναι «είδος»; Μοριακή ταυτοποίηση: είδος, άτομο,, φύλο Πόσο αξίζει μια ομάδα οργανισμών τις προσπάθειες διατήρησής τους Δηλαδή: πόσο

Διαβάστε περισσότερα

Α. Βιοϊατρικός Κύκλος

Α. Βιοϊατρικός Κύκλος ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΤΗΣ ΓΝΩΣΗΣ ΑΠΟΦΟΙΤΩΝ ΑΝΩΤΕΡΩΝ ΕΚΠΑΙ ΕΥΤΙΚΩΝ Ι ΡΥΜΑΤΩΝ ΣΕ ΣΥΓΧΡΟΝΕΣ ΕΦΑΡΜΟΓΕΣ ΣΤΙΣ ΒΙΟΕΠΙΣΤΗΜΕΣ Περιεχόµενο Προγράµµατος (µαθήµατα, ώρες κλπ): Το Πρόγραµµα Σπουδών διαχωρίζεται σε δύο Κύκλους

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ ΓΕΩΡΓΙΟΥ ΧΩΤΟΥ

ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ ΓΕΩΡΓΙΟΥ ΧΩΤΟΥ ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ ΓΕΩΡΓΙΟΥ ΧΩΤΟΥ Γεώργιος Ν. Χώτος, Καθηγητής Τεχνολογικό Εκπαιδευτικό Ιδρυμα (Τ.Ε.Ι.) Δυτικής Ελλάδας (πρ. Τ.Ε.Ι. Μεσολογγίου και πρ. Τ.Ε.Ι. Πάτρας) Τμήμα Τεχνολογίας Αλιείας Υδατοκαλλιεργειών

Διαβάστε περισσότερα

ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ Ν.Κ. ΜΟΣΧΟΝΑ (Νοεμβριος 2013)

ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ Ν.Κ. ΜΟΣΧΟΝΑ (Νοεμβριος 2013) ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ Ν.Κ. ΜΟΣΧΟΝΑ (Νοεμβριος 2013) 1. ΑΤΟΜΙΚΑ ΣΤΟΙΧΕΙΑ Όνομα: Νικόλαος Κ. Μοσχονάς Ημερομηνία Γεννήσεως: 21 Νοεμβρίου 1952 Οικογενειακή Κατάσταση: Έγγαμος, δύο παιδία 2. ΣΠΟΥΔΕΣ 1979-1981:

Διαβάστε περισσότερα

ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ

ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ Η συµβολή της µοριακής ανάλυσης Eλισάβετ Οικονοµάκη Βιολόγος Αιµοπαθολογοανατοµικό Εργαστήριο ΠΓΝΑ > ΜΟΡΙΑΚΕΣ ΜΕΘΟ ΟΙ (Μη µορφολογικές) Αλυσιδωτή Αντίδραση Πολυµεράσης

Διαβάστε περισσότερα

Η διδασκαλία της θεωρίας της εξέλιξης στη δευτεροβάθμια εκπαίδευση

Η διδασκαλία της θεωρίας της εξέλιξης στη δευτεροβάθμια εκπαίδευση Η διδασκαλία της θεωρίας της εξέλιξης στη δευτεροβάθμια εκπαίδευση Πανελλήνιο συνέδριο με θέμα: Βιολογικές και Φυσικές Επιστήμες στην Εκπαίδευση Αθήνα, 11-13/04/2008 Κώστας Καμπουράκης Εκπαιδευτήρια Γείτονα,

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΤΕΧΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ. Πτυχιακή εργασία

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΤΕΧΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ. Πτυχιακή εργασία ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΤΕΧΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ Πτυχιακή εργασία ΕΛΕΓΧΟΣ ΓΟΝΙΔΙΑΚΩΝ ΣΥΧΝΟΤΗΤΩΝ ACAA2 ΣΤΟ ΕΞΩΝΙΟ 10 ΣΤΑ ΠΡΟΒΑΤΑ ΧΙΟΥ Μύρια Χατζηκώστα Λεμεσός, 2013

Διαβάστε περισσότερα

ΑΔΑ: ΒΙΞ446914Γ-ΧΡΖ. Βαθμός Ασφαλείας. Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων. Μεγ.

ΑΔΑ: ΒΙΞ446914Γ-ΧΡΖ. Βαθμός Ασφαλείας. Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων. Μεγ. ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ (Τ.Ε.Ι.) ΔΥΤΙΚΗΣ ΕΛΛΑΔΑΣ Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων Μεγ.

Διαβάστε περισσότερα

Τεχνολογία του ανασυνδυασμένου DNA

Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία του ανασυνδυασμένου DNA Ε Ι Σ Α Γ Ω Γ Η Φώτης Καρβέλης Ιστορική αναδρομή Ανακάλυψη του DNA Μελέτη αντιγραφής Απομόνωση ενζύμων Μελέτη της δράσης τους Αποκάλυψη των περιοριστικών ενδονουκλεασών

Διαβάστε περισσότερα

Splice site recognition between different organisms

Splice site recognition between different organisms NATIONAL AND KAPODISTRIAN UNIVERSITY OF ATHENS SCHOOL OF SCIENCE DEPARTMENT OF INFORMATICS AND TELECOMMUNICATIONS INTERDEPARTMENTAL POSTGRADUATE PROGRAM "INFORMATION TECHNOLOGIES IN MEDICINE AND BIOLOGY"

Διαβάστε περισσότερα

Εξελίξεις στην Προεμφυτευτική Γενετική Ανάλυσητο μέλλον

Εξελίξεις στην Προεμφυτευτική Γενετική Ανάλυσητο μέλλον 1 ο Επιμορφωτικό Σεμινάριο Γενετικής ΤΙ ΝΕΟΤΕΡΟ ΣΤΗΝ ΕΡΓΑΣΤΗΡΙΑΚΗ ΓΕΝΕΤΙΚΗ ΑΝΑΛΥΣΗ Εξελίξεις στην Προεμφυτευτική Γενετική Ανάλυσητο μέλλον Γεωργία Κάκουρου, PhD ΕΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ,

Διαβάστε περισσότερα

Παραδοτέο Π.1 (Π.1.1) Εκθέσεις για προµήθεια εκπαιδευτικού υλικού

Παραδοτέο Π.1 (Π.1.1) Εκθέσεις για προµήθεια εκπαιδευτικού υλικού 1 ΕΛΛΗΝΙΚΗ ΗΜΟΚΡΑΤΙΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΜΑΚΕ ΟΝΙΑΣ ΟΙΚΟΝΟΜΙΚΩΝ ΚΑΙ ΚΟΙΝΩΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΕΠΕΑΕΚ ΙΙ Μέτρο 2.2 Αναµόρφωση Προγραµµάτων Προπτυχιακών Σπουδών ιεύρυνση Τριτοβάθµιας Κατ. Πράξης 2.2.2.α Αναµόρφωση Προγραµµάτων

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων

H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων Dr. Παναγιώτης Μαδέσης pmadesis@certh.gr Ι. Γανόπουλος,

Διαβάστε περισσότερα

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr Παρουσιάσεις μαθήματος http://users.auth.gr/~palexios/

Διαβάστε περισσότερα

Τι συµβαίνει σε ένα Εργαστήριο Γενετικής?

Τι συµβαίνει σε ένα Εργαστήριο Γενετικής? 12 εργαστήριο ίσως ελέγξει τα αποθηκευµένα δείγµατα (ιδιαίτερα εάν ο αρχικός έλεγχος δεν έδωσε αποτέλεσµα), αλλά µόνο εάν έχετε δώσει τη γραπτή σας συγκατάθεση για κάτι τέτοιο. Με αυτό τον τρόπο οι ασθενείς

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α 1 : α Α 2 : γ Α 3 : δ Α 4 : β Α 5 : γ ΘΕΜΑ Β Β 1 : σελ. 120 σχολικού: >. Β 2 :

Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280)

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280) «Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια» Παραδοτέο Π1.18 Ενημέρωση με τα στοιχεία από τα ευρήματα της έρευνας για τη δραστηριότητα

Διαβάστε περισσότερα

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία της Δημόσιας Υγείας Α. Βανταράκης Εργαστήριο Υγιεινής, Ιατρική Σχολή,

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΚΡΗΤΗΣ ΣΧΟΛΗ ΔΙΟΙΚΗΣΗΣ ΚΑΙ ΟΙΚΟΝΟΜΙΑΣ (ΣΔΟ) ΤΜΗΜΑ ΛΟΓΙΣΤΙΚΗΣ ΚΑΙ ΧΡΗΜΑΤΟΟΙΚΟΝΟΜΙΚΗΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΚΡΗΤΗΣ ΣΧΟΛΗ ΔΙΟΙΚΗΣΗΣ ΚΑΙ ΟΙΚΟΝΟΜΙΑΣ (ΣΔΟ) ΤΜΗΜΑ ΛΟΓΙΣΤΙΚΗΣ ΚΑΙ ΧΡΗΜΑΤΟΟΙΚΟΝΟΜΙΚΗΣ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΚΡΗΤΗΣ ΣΧΟΛΗ ΔΙΟΙΚΗΣΗΣ ΚΑΙ ΟΙΚΟΝΟΜΙΑΣ (ΣΔΟ) ΤΜΗΜΑ ΛΟΓΙΣΤΙΚΗΣ ΚΑΙ ΧΡΗΜΑΤΟΟΙΚΟΝΟΜΙΚΗΣ «ΧΡΗΜΑΤΟΟΙΚΟΝΟΜΙΚΗ ΑΝΑΛΥΣΗ ΛΟΓΙΣΤΙΚΩΝ ΚΑΤΑΣΤΑΣΕΩΝ ΤΩΝ ΕΤΑΙΡΕΙΩΝ ΚΡΕΤΑ ΦΑΡΜ Α.Β.Ε.Ε. &

Διαβάστε περισσότερα

Γεώργιος ΚΑΤΣΕΛΗΣ ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ. Καθηγητής Τμήμα Τεχνολογίας Αλιείας Υδατοκαλλιεργειών TEI Δυτικής Ελλάδας

Γεώργιος ΚΑΤΣΕΛΗΣ ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ. Καθηγητής Τμήμα Τεχνολογίας Αλιείας Υδατοκαλλιεργειών TEI Δυτικής Ελλάδας Γεώργιος ΚΑΤΣΕΛΗΣ ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ Καθηγητής Τμήμα Τεχνολογίας Αλιείας Υδατοκαλλιεργειών TEI Δυτικής Ελλάδας Μεσολόγγι, ΜΑΡΤΙΟΣ 2014 2 ΣΥΝΟΠΤΙΚΗ ΠΑΡΟΥΣΙΑΣΗ ΒΙΟΓΡΑΦΙΚΟΥ Ο κ. Γεώργιος Κατσέλης, είναι

Διαβάστε περισσότερα

Η Συμβολή της Βιοτεχνολογίας και της Μοριακής Βιολογίας στην Προστασία και ιαχείριση του Περιβάλλοντος

Η Συμβολή της Βιοτεχνολογίας και της Μοριακής Βιολογίας στην Προστασία και ιαχείριση του Περιβάλλοντος Η Συμβολή της Βιοτεχνολογίας και της Μοριακής Βιολογίας στην Προστασία και ιαχείριση του Περιβάλλοντος Δρ Ζήσης Μαμούρης Καθηγητής Γενετικής Τμήμα Βιοχημείας & Βιοτεχνολογίας Πανεπιστήμιο Θεσσαλίας Μοριακή

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

Μοριακή ταυτοποίηση επιλεγμένων κλώνων φυτών ρίγανης για την αντιμετώπιση παθογόνων ψαριών και ζωοπλαγκτόν.

Μοριακή ταυτοποίηση επιλεγμένων κλώνων φυτών ρίγανης για την αντιμετώπιση παθογόνων ψαριών και ζωοπλαγκτόν. Μοριακή ταυτοποίηση επιλεγμένων κλώνων φυτών ρίγανης για την αντιμετώπιση παθογόνων ψαριών και ζωοπλαγκτόν. Μιχάλης Κ. Στεφανάκης, Γιώργος Τσικαλάς, Ελευθέριος Τουλουπάκης, Λαζανάκη Μαρία, Χαράλαμπος Ε.

Διαβάστε περισσότερα

ΟΙ ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΣΤΗΝ ΙΑΤΡΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Eφη. Πετεινάκη

ΟΙ ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΣΤΗΝ ΙΑΤΡΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Eφη. Πετεινάκη ΟΙ ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΣΤΗΝ ΙΑΤΡΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Eφη Πετεινάκη ΠΡΟΒΛΗΜΑΤΑ ΡΟΥΤΙΝΑΣ ΕΝΟΣ ΚΛΙΝΙΚΟΥ ΜΙΚΡΟΒΙΟΛΟΓΙΚΟΥ ΕΡΓΑΣΤΗΡΙΟΥ ταυτοποίηση κάποιων βακτηρίων ο έλεγχος ευαισθησίας διάγνωση λοιμώξεων από μικροοργανισμούς

Διαβάστε περισσότερα

(Στάδια τεχνολογίας rdna)

(Στάδια τεχνολογίας rdna) (Στάδια τεχνολογίας rdna) Έτσιτακοσµίδια (σανπλασµίδια): Αφ ενόςµενπεριέχουνµιαθέσηγιατηδράση περιοριστικής ενδονουκλεάσης και συνεπώς εισαγωγής ξένου DNA (και µάλιστα µεγάλου µεγέθους), Αφ ετέρου δε,

Διαβάστε περισσότερα

Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp.

Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp. Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp. 5 ο Πανελλήνιο Συνέδριο Ιατρικής Βιοπαθολογίας Η εφαρμογή μοριακών

Διαβάστε περισσότερα

Chalkou I. C. [PROJECT] Ανάθεση εργασιών.

Chalkou I. C. [PROJECT] Ανάθεση εργασιών. Πληροφορική της Υγείας 2014 Chalkou I. C. [PROJECT] Ανάθεση εργασιών. Περιεχόμενα 1. Ομάδα Γ... 3 1.1 Σαψάκη Δ. - Σαψάκη Π.... 3 1.2 Βλάχου - Γεωργοπούλου... 3 1.3 Μπέρτσου - Τσάμη... 4 1.4 Καραγιάννη

Διαβάστε περισσότερα

Πανεπιστήμιο Δυτικής Μακεδονίας. Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών. Βιοπληροφορική. Ενότητα 1: Εισαγωγή στη Βιοπληροφορική

Πανεπιστήμιο Δυτικής Μακεδονίας. Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών. Βιοπληροφορική. Ενότητα 1: Εισαγωγή στη Βιοπληροφορική Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών Βιοπληροφορική Ενότητα 1: Εισαγωγή στη Βιοπληροφορική Αν. καθηγητής Αγγελίδης Παντελής e-mail: paggelidis@uowm.gr ΕΕΔΙΠ Μπέλλου Σοφία e-mail: sbellou@uowm.gr

Διαβάστε περισσότερα

ΠΡΑΚΤΙΚΑ PROCEEDINGS

ΠΡΑΚΤΙΚΑ PROCEEDINGS ΕΛΛΗΝΙΚΗ ΕΤΑΙΡΕΙΑ ΒΙΟΛΟΓΙΚΩΝ ΕΠΙΣΤΗΜΩΝ HELLENIC SOCIETY FOR BIOLOGICAL SCIENCES 29 ο ΕΤΗΣΙΟ ΣΥΝΕΔΡΙΟ 29 th ANNUAL CONFERENCE ΠΡΑΚΤΙΚΑ PROCEEDINGS 17 η 19 η Μαΐου 2007 May 17 19, 2007 ΚΑΒΑΛΑ ii ΕΚΔΟΤΗΣ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

Ταξινόμηση και διαχρονική παρακολούθηση των βοσκόμενων δασικών εκτάσεων στη λεκάνη απορροής του χειμάρρου Μπογδάνα Ν. Θεσσαλονίκης

Ταξινόμηση και διαχρονική παρακολούθηση των βοσκόμενων δασικών εκτάσεων στη λεκάνη απορροής του χειμάρρου Μπογδάνα Ν. Θεσσαλονίκης Ταξινόμηση και διαχρονική παρακολούθηση των βοσκόμενων δασικών εκτάσεων στη λεκάνη απορροής του χειμάρρου Μπογδάνα Ν. Θεσσαλονίκης Α. Αϊναλής 1, Ι. Μελιάδης 2, Π. Πλατής 3 και Κ. Τσιουβάρας 4 1 Διεύθυνση

Διαβάστε περισσότερα

ΙΝΣΤΙΤΟΥΤΟ Υ ΑΤΟΚΑΛΙΕΡΓΕΙΩΝ

ΙΝΣΤΙΤΟΥΤΟ Υ ΑΤΟΚΑΛΙΕΡΓΕΙΩΝ \ ΙΝΣΤΙΤΟΥΤΟ Υ ΑΤΟΚΑΛΙΕΡΓΕΙΩΝ Ερευνητικών Προγραµµάτων ΤΕΧΝΙΚΕΣ ΕΚΘΕΣΕΙΣ 2005 Ανάπτυξη Τεχνολογιών Παραγωγής Καινοτόµων ιατροφής για εκτρεφόµενα είδη µεσογειακών ψαριών ( ΙΑΤΡΟΦΗ ΜΕΣΟΓΕΙΑΚΩΝ ΨΑΡΙΩΝ).

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Long-term changes of fisheries landing patterns of most important species in Amvrakikos lagoonal system

Long-term changes of fisheries landing patterns of most important species in Amvrakikos lagoonal system 9 ο Πανελλήνιο Συμπόσιο Ωκεανογραφίας & Αλιείας 2009 - Πρακτικά, Τόμος ΙΙ ΔΙΑΧΡΟΝΙΚΕΣ ΑΛΛΑΓΕΣ ΣΤΟ ΠΡΟΤΥΠΟ ΤΗΣ ΑΛΙΕΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΤΩΝ ΚΥΡΙΟΤΕΡΩΝ ΕΙΔΩΝ ΤΩΝ Λ/Θ ΤΟΥ ΑΜΒΡΑΚΙΚΟΥ ΚΟΛΠΟΥ Μουτόπουλος Δ.Κ. 1,

Διαβάστε περισσότερα

Η πρόληψη των κατακλίσεων σε βαριά πάσχοντες και η χρήση ειδικών στρωμάτων για την πρόληψη και αντιμετώπιση των κατακλίσεων

Η πρόληψη των κατακλίσεων σε βαριά πάσχοντες και η χρήση ειδικών στρωμάτων για την πρόληψη και αντιμετώπιση των κατακλίσεων ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Η πρόληψη των κατακλίσεων σε βαριά πάσχοντες και η χρήση ειδικών στρωμάτων για την πρόληψη και αντιμετώπιση των κατακλίσεων Ονοματεπώνυμο

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

Μορφομετρική σύγκριση άγριων πληθυσμών τσιπούρας (Sparus aurata) σε διαφορετικές συνθήκες ανάπτυξης

Μορφομετρική σύγκριση άγριων πληθυσμών τσιπούρας (Sparus aurata) σε διαφορετικές συνθήκες ανάπτυξης 8ο Πανελλήνιο Συμποσιο Ωκεανογραφίας & Αλιείας 1093 Μορφομετρική σύγκριση άγριων πληθυσμών τσιπούρας (Sparus aurata) σε διαφορετικές συνθήκες ανάπτυξης Ιωάννης Ρογδάκης 1, Βασιλική Βαβαρούτα 2, Θεόδωρος

Διαβάστε περισσότερα

Σύντομο Βιογραφικό Σημείωμα

Σύντομο Βιογραφικό Σημείωμα Έτος και τόπος γεννήσεως Διεύθυνση οικίας Διεύθυνση εργασίας Γεώργιος Κ. Ροδάκης 1948, Χίος Ούλωφ Πάλμε 34, 157 71 Ζωγράφου Εθνικό & Καποδιστριακό Πανεπιστήμιο Αθηνών Τμήμα Βιολογίας Τομέας Βιοχημείας

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA.

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο

Διαβάστε περισσότερα

Βαθμός Ασφαλείας Πάτρα 18-11-2014 Αριθμ. Πρωτ. 54276. Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων

Βαθμός Ασφαλείας Πάτρα 18-11-2014 Αριθμ. Πρωτ. 54276. Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ (Τ.Ε.Ι.) ΔΥΤΙΚΗΣ ΕΛΛΑΔΑΣ Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων Μεγ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β )

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 β Α2 γ Α3 α Α4 δ Α5 γ ΘΕΜΑ Β Β1: 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β Β2:

Διαβάστε περισσότερα

Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας. ΝΕΕΣ Κοργιαλένειο Μπενάκειο

Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας. ΝΕΕΣ Κοργιαλένειο Μπενάκειο Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας ΝΕΕΣ Κοργιαλένειο Μπενάκειο Καταφεύγουµε στις µοριακές τεχνικές Συλλέγουµε το δείγµα για µοριακές τεχνικές ιάσπαση ιστικών δοµών ιαχωρισµός των κυττάρων ιάσπαση

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ο µέγιστος αριθµός διαφορετικών

Διαβάστε περισσότερα

Ωρολόγιο Πρόγραμμα Χειμερινού Εξαμήνου Ακαδημαϊκό Έτος 2014-2015

Ωρολόγιο Πρόγραμμα Χειμερινού Εξαμήνου Ακαδημαϊκό Έτος 2014-2015 ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙ ΑΣ Τ Μ Η Μ Α Ι ΑΤ Ρ Ι ΚΗΣ Π Ρ Ο Γ Ρ ΑΜ Μ Α Μ Ε Τ Α Π Τ Υ Χ Ι ΑΚ Ω Ν Σ Π Ο Υ Δ Ω Ν «Β Ι Ο Λ Ο Γ Ι Α Τ Η Σ Α Ν Α Π Α Ρ Α Γ Ω Γ Η Σ» Βιόπολις, 41110 Λάρισα E-mail:

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς

Διαβάστε περισσότερα

Εκτιμηση της βιομαζας του αποθεματος του γαυρου στο Αιγαιο με την ακουστικη μεθοδο (Ιουνιοσ 2003 και Ιουνιοσ 2004)

Εκτιμηση της βιομαζας του αποθεματος του γαυρου στο Αιγαιο με την ακουστικη μεθοδο (Ιουνιοσ 2003 και Ιουνιοσ 2004) 8ο Πανελλήνιο Συμποσιο Ωκεανογραφίας & Αλιείας 997 Εκτιμηση της βιομαζας του αποθεματος του γαυρου στο Αιγαιο με την ακουστικη μεθοδο (Ιουνιοσ 23 και Ιουνιοσ 24) Γιαννουλάκη M.*, Μαχιάς Α.*, Σωμαράκης

Διαβάστε περισσότερα

Θέματα Γονιδιωματικής, Πρωτεομικής και Βιοτεχνολογίας Γονιδιώματα

Θέματα Γονιδιωματικής, Πρωτεομικής και Βιοτεχνολογίας Γονιδιώματα Θέματα Γονιδιωματικής, Πρωτεομικής και Βιοτεχνολογίας Γονιδιώματα Το γονιδίωμα περιλαμβάνει τόσο τα γονίδια όσο και τις μη κωδικοποιούσες ακολουθίες DNA. Ο όρος προτάθηκε το 1920 από τον καθηγητή Hans

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΠΡΟ ΙΑΘΕΣΗ ΓΙΑ ΚΑΡΚΙΝΟ ΜΑΣΤΟΥ/ΩΟΘΗΚΩΝ. Στο δυτικό κόσµο 1 στις 8 γυναίκες θα αναπτύξει καρκίνο του µαστού κατά τη διάρκεια

ΓΕΝΕΤΙΚΗ ΠΡΟ ΙΑΘΕΣΗ ΓΙΑ ΚΑΡΚΙΝΟ ΜΑΣΤΟΥ/ΩΟΘΗΚΩΝ. Στο δυτικό κόσµο 1 στις 8 γυναίκες θα αναπτύξει καρκίνο του µαστού κατά τη διάρκεια ΓΕΝΕΤΙΚΗ ΠΡΟ ΙΑΘΕΣΗ ΓΙΑ ΚΑΡΚΙΝΟ ΜΑΣΤΟΥ/ΩΟΘΗΚΩΝ ρ. Ελένη Κοντογιάννη, Ph.D Γενετίστρια ιευθύντρια IVF & Genetics Στο δυτικό κόσµο 1 στις 8 γυναίκες θα αναπτύξει καρκίνο του µαστού κατά τη διάρκεια της ζωής

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα