ιεύθυνση: N. Mιλτιάδη 1, Νέα Μουδανιά Τηλ.: , Fax: , Ε-mail: ΚΑΘΗΓΗΤΗΣ: IMΣΙΡΙ ΟΥ ΑΝΑΣΤΑΣΙΑ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ιεύθυνση: N. Mιλτιάδη 1, 63200 Νέα Μουδανιά Τηλ.: 2373065313, Fax: 2373026450, Ε-mail: imsiri@otenet.gr ΚΑΘΗΓΗΤΗΣ: IMΣΙΡΙ ΟΥ ΑΝΑΣΤΑΣΙΑ"



2 2

3 ΠΙΝΑΚΑΣ ΣΤΟΙΧΕΙΩΝ ΕΡΕΥΝΗΤΙΚΟΥ ΠΡΟΓΡΑΜΜΑΤΟΣΠΟΥ ΧΡΗΜΑΤΟ ΟΤΗΘΗΚΕ ΑΠΟ ΤΗΝ ΕΠΙΤΡΟΠΗ ΕΡΕΥΝΩΝ Τίτλος Ερευνητικού προγράµµατος: Γενετική ταυτοποίηση διαφορετικών ειδών γόνου κεφαλοειδών µε τη χρήση πυρηνικών δεικτών Συνεργαζόµενα Τµήµατα: Τµήµα Τεχνολογίας Αλιείας και Υδατοκαλλιεργειών Επιστηµονικός Υπεύθυνος: Ιµσιρίδου Αναστασία Επιστηµονικοί συνεργάτες: Όνοµα: Μίνος Γεώργιος, Θέση: Επίκουρος Καθηγητής, Ειδικότητα: Ιχθυολογία Όνοµα: Kατσαρές Βασίλειος, Θέση: Εργαστηριακός Συνεργάτης ΤΑΥ, Ειδικότητα: Γενετική Όνοµα: Τσιώρα Άννα, Θέση: Επιστηµονικός Συνεργάτης ΤΑΥ, Ειδικότητα: Ζωολογία ιάρκεια Ερευνητικού Προγράµµατος: 14/3/ /3/2007 Ποσό χρηµατοδότησης Επιτροπής Ερευνών: Ευρώ ηµοσιεύσεις/παρουσιάσεις εργασιών 3

4 1. Identification of fry of different grey mullet species with the use of nuclear 5S rdna markers. Imsiridou A., Minos G., Tsiora A., Katsares V. and Douka S. 10 th International Congress on the Zoogeography and Ecology of Greece and Adjacent Regions. Patras Greece, June Identification of different fry Mugilidae species using 5S rdna Markers (2006). Journal of Applied Ichthyology submitted. A. Imsiridou, G. Minos, V. Katsares, N. Karaiskou and A. Tsiora 4

5 ΠΕΡΙΕΧΟΜΕΝΑ ΣΥΝΤΟΜΗ ΠΑΡΟΥΣΙΑΣΗ ΤΗΣ ΕΡΕΥΝΑΣ Εισαγωγή.9 Θεωρητικό πλαίσιο 11 Ανασκόπηση της βιβλιογραφίας...12 Μεθοδολογία της έρευνας...13 Αποτελέσµατα.14 Συµπεράσµατα 19 Προτάσεις.21 Βιβλιογραφία

6 6

7 ΓΕΝΕΤΙΚΗ ΤΑΥΤΟΠΟΙΗΣΗ ΙΑΦΟΡΕΤΙΚΩΝ ΕΙ ΩΝ ΓΟΝΟΥ ΚΕΦΑΛΟΕΙ ΩΝ ΜΕ ΤΗ ΧΡΗΣΗ ΠΥΡΗΝΙΚΩΝ ΕΙΚΤΩΝ ΙΜΣΙΡΙ ΟΥ ΑΝΑΣΤΑΣΙΑ ΠΕΡΙΛΗΨΗ Η εκτροφή των κεφαλοειδών γίνεται σε µεγάλη κλίµακα και στηρίζεται σε άγριο γόνο. Η αναγνώριση των ειδών του γόνου που αλιεύεται είναι πολύ δύσκολη αλλά και σηµαντική για τους καλλιεργητές, εφόσον ο ρυθµός αύξησης διαφέρει σηµαντικά µεταξύ των ειδών. Ο σκοπός της παρούσας δουλειάς είναι η χρήση µιας απλής γενετικής µεθοδολογίας, της αλυσιδωτής αντίδρασης πολυµεράσης (PCR), για την επιβεβαίωση της συστηµατικής ταξινόµησης των διαφορετικών ειδών γόνου κεφαλοειδών και την παραπέρα διάκρισή τους. Έγινε συλλογή γόνου από έξι είδη κεφαλοειδών (M. cephalus, M. soiuy, C. labrosus, L. aurata, L. Ramada, L. saliens). Ακολούθησε συστηµατική ταξινόµηση των ατόµων, εξαγωγή DNA, ενίσχυση του γονιδίου 5S rdna µε την αλυσιδωτή αντίδραση πολυµεράσης PCR, έλεγχος των προϊόντων ενίσχυσης σε ηλεκτροφόρηση πηκτής αγαρόζης, κλωνοποίηση των προϊόντων PCR και ανάλυση 7

8 πρωτοδιάταξης. Τα δύο είδη M. so-iuy και L. saliens µπορούν να διακριθούν µε µία απλή αντίδραση PCR, εφόσον παρουσιάζουν ένα µοναδικό πρότυπο στη πηκτή αγαρόζης. Τα υπόλοιπα τέσσερα είδη M. cephalus, L. ramada, L. aurata και C. labrosus παρουσιάζουν µετά τη τεχνική της ανάλυσης πρωτοδιάταξης - µοναδικούς ειδο-ειδικούς απλότυπους, µε νουκλεοτιδικές αντικαταστάσεις σε διαφορετικές θέσεις. Η παραπάνω µεθοδολογία µπορεί να οδηγήσει σε ακριβή διάκριση διαφορετικών ειδών γόνου. 8

9 ΓΕΝΕΤΙΚΗ ΤΑΥΤΟΠΟΙΗΣΗ ΙΑΦΟΡΕΤΙΚΩΝ ΕΙ ΩΝ ΓΟΝΟΥ ΚΕΦΑΛΟΕΙ ΩΝ ΜΕ ΤΗ ΧΡΗΣΗ ΠΥΡΗΝΙΚΩΝ ΕΙΚΤΩΝ ΙΜΣΙΡΙ ΟΥ ΑΝΑΣΤΑΣΙΑ, ΜΙΝΟΣ ΓΕΩΡΓΙΟΣ, ΚΑΤΣΑΡΕΣ ΒΑΣΙΛΕΙΟΣ, ΤΣΙΩΡΑ ΑΝΝΑ ΕΙΣΑΓΩΓΗ H οικογένεια των κεφαλοειδών περιλαµβάνει 17 γένη και περισσότερα από 60 είδη (Nelson 1994). Τα κεφαλοειδή έχουν παγκόσµια εξάπλωση καθώς µπορούν να επιβιώσουν από την τροπική έως και την εύκρατη ζώνη. Τα 7 είδη των κεφαλοειδών που απαντώνται στην Ελλάδα είναι: Mugil cephalus (Linnaeus 1758), Mugil so-iuy (Basilewsky 1855), Chelon labrosus (Risso 1826), Oedalechilus labeo (Cuvier 1829), Liza aurata (Risso 1810), Liza ramada (Risso 1826) και Liza saliens (Risso 1810). Σήµερα η εκτροφή των κεφαλοειδών γίνεται σε µεγάλη κλίµακα, κυρίως σε εκτατικής µορφής καλλιέργειες, που στην Ελλάδα αντιπροσωπεύουν το 50% της αλιευτικής παραγωγής των λιµνοθαλασσών. Τα τελευταία χρόνια αρχίζει και στην Ελλάδα να υπάρχει ενδιαφέρον για την εντατική εκτροφή των 9

10 κεφαλοειδών και τον εµπλουτισµό λιµνών και λιµνοθαλασσών. Η καλλιέργεια των κεφαλοειδών στηρίζεται σε άγριο γόνο. Η αναγνώριση των ειδών του γόνου που αλιεύεται είναι προβληµατική, καθώς στηρίζεται κυρίως στη διάταξη των µελανοφόρων κυττάρων στην κοιλιακή περιοχή της κεφαλής (Perlmutter et al., 1957; Zismann, 1981; Reay & Cornel 1988; Minos et al. 2002) σε συνδυασµό µε τη διάταξη των χρωµατοφόρων κατά µήκος του σώµατος (Perlmutter et al., 1957; Zismann, 1981; Cambrony 1984; Serventi et al. 1996). Οποιαδήποτε εποχή και αν αλιευθεί ο γόνος αυτός, µπορούν να συλλεχθούν δύο έως τέσσερα διαφορετικά είδη τα οποία όµως έχουν διαφορετικές ανοχές σε αλατότητα και ο ρυθµός αύξησης διαφέρει σηµαντικά µεταξύ τους. Συνεπώς η ταυτότητα του είδους είναι πολύ σηµαντική πληροφορία για τους καλλιεργητές. Ο σκοπός της παρούσας δουλειάς είναι η χρήση µιας απλής γενετικής µεθοδολογίας, της αλυσιδωτής αντίδρασης πολυµεράσης (PCR), για την επιβεβαίωση της συστηµατικής ταξινόµησης των διαφορετικών ειδών γόνου κεφαλοειδών και την παραπέρα διάκρισή τους. 10

11 ΘΕΩΡΗΤΙΚΟ ΠΛΑΙΣΙΟ Στους ανώτερους ευκαρυώτες, το γονίδιο 5S rdna αποτελείται από µία συντηρηµένη κωδικοποιούσα περιοχή 120 ζευγών βάσεων και από µία µη µεταγραφόµενη περιοχή µεταβλητού µεγέθους (NTS). H µονάδα αυτή (120 βάσεις+nts), επαναλαµβάνεται χιλιάδες φορές επάνω στο χρωµόσωµα. Το µέγεθος της NTS διαφέρει από είδος σε είδος και είναι συνήθως χαρακτηριστική για κάθε είδος (Pendas et al. 1994; Martins & Galetti 2001; Martins et al. 2002). Σε κάποια είδη εντοπίζονται περισσότερες από µία µονάδες του γονιδίου 5S rdna, οι οποίες βρίσκονται σε διαφορετικά χρωµοσώµατα. Συνεπώς το γονίδιο 5S rdna έχει χρησιµοποιηθεί ευρέως για διάκριση και γενετική ταυτοποίηση πολλών οργανισµών, µεταξύ των οποίων και πολλά είδη ψαριών (Karaiskou et al., 2003; Aranishi 2005a, b). Με την εκπόνηση του προτεινόµενου ερευνητικού έργου έγινε εφικτή η γρήγορη γενετική ταυτοποίηση διαφορετικών ειδών γόνου κεφαλοειδών, µε την PCR ενίσχυση του γονιδίου 5S rdna. 11

12 ΑΝΑΣΚΟΠΗΣΗ ΤΗΣ ΒΙΒΛΙΟΓΡΑΦΙΑΣ Έχουν αναπτυχθεί αρκετές γενετικές µεθοδολογίες για διάκριση διαφορετικών ειδών ψαριών. Οι τεχνικές αυτές αφορούν την ηλεκτροφορητική ανάλυση πρωτεϊνών (Andrews 1998; Mackie et al. 1999), τον πολυµορφισµό µήκους περιοριστικών θραυσµάτων (RFLP) ενός τµήµατος του µιτοχονδριακού DNA ή την ανάλυση πρωτοδιάταξης (sequencing) ενός τµήµατος του µιτοχονδριακού DNA (Cespedes et al. 2000; Karaiskou et al. 2003). Έτσι, προηγούµενη γενετική διάκριση των διαφορετικών ειδών κεφαλοειδών έχει επιτευχθεί µε ανάλυση του µιτοχονδριακού DNA και χρήση ειδο-ειδικών εκκινητών, για την ενίσχυση της περιοχής D-loop του µιτοχονδριακού γενώµατος (Murgia et al. 2001). Λίγο αργότερα έγινε χρήση της τεχνικής του πολυµορφισµού µήκους περιοριστικών θραυσµάτων (RFLP) του γονιδίου 16S rrna του µιτοχονδριακού DNA (Klossa-Kilia et al. 2002), για τη διάκριση του είδους M. cephalus από άλλα τέσσερα είδη κεφαλοειδών. Και οι δύο µελέτες αποσκοπούν στην αναγνώριση της προέλευσης των αυγών (αυγοτάραχο) από διαφορετικά είδη κεφαλοειδών, µε σκοπό τον έλεγχο της 12

13 ποιότητας µεταποιηµένων προϊόντων. Η παρούσα µελέτη είναι η πρώτη που χρησιµοποιεί ανάλυση του πυρηνικού γονιδίου 5S rdna, για διάκριση διαφορετικών ειδών γόνου κεφαλοειδών. ΜΕΘΟ ΟΛΟΓΙΑ ΤΗΣ ΕΡΕΥΝΑΣ 1. Έγινε συλλογή γόνου από πέντε είδη κεφαλοειδών (M. cephalus, C. labrosus, L. aurata, L. ramada and L. saliens), στο λιµάνι των Ν. Μουδανιών Χαλκιδικής. Για το νεοεισαγόµενο είδος M. so-iuy, ενήλικα άτοµα συλλέχθηκαν από το Βόρειο Αιγαίο. Η περίοδος δειγµατοληψίας ήταν Μάρτιος 2006 Οκτώβριος Ακολούθησε συστηµατική ταξινόµηση των ατόµων, µε τη χρήση εξειδικευµένων για την περιοχή της Μεσογείου κλείδων προσδιορισµού. 3. Έγινε εξαγωγή DNA σύµφωνα µε τη µεθοδολογία CTAB (Hillis et al. 1996). 4. Ακολούθησε ενίσχυση του γονιδίου 5S rdna µε την αλυσιδωτή αντίδραση πολυµεράσης PCR. Για την ενίσχυση χρησιµοποιήθηκαν οι εκκινητές που 13

14 σχεδιάστηκαν από τους Pendas et al. (1994). 5. Έγινε έλεγχος των προϊόντων ενίσχυσης σε ηλεκτροφόρηση πηκτής αγαρόζης 1,5%. 6. Ακολούθησε εξαγωγή των προϊόντων PCR από την πηκτή αγαρόζης και καθαρισµός αυτών (εκτός από το είδος M. so-iuy, εφόσον το είδος αυτό έδωσε ένα µοναδικό πρότυπο στην πηκτή αγαρόζης). 7. Τα προϊόντα PCR κλωνοποιήθηκαν στο πλασµίδιο ΤΟΡΟ ΤΑ (Invitrogen) και στη συνέχεια χρησιµοποιήθηκαν για το µετασχηµατισµό κυττάρων Escherichia coli (strain DH5a, GibcoBRL) κλώνοι αναλύθηκαν µε την τεχνική της ανάλυσης πρωτοδιάταξης και τη χρήση του εκκινητή M13(-20). 9. Οι νουκλεοτιδικές ακολουθίες από τα πέντε είδη µελετήθηκαν µε τη χρήση των πακέτων Clustal X software (Thompson et al. 1997) και BioEdit software (Hall 1999). ΑΠΟΤΕΛΕΣΜΑΤΑ Αναλύθηκαν συνολικά 180 άτοµα 30 άτοµα από κάθε είδος µε την αλυσιδωτή αντίδραση 14

15 πολυµεράσης. Όπως φαίνεται και στην Εικόνα 1, µόνο δύο από τα έξι είδη παρουσιάζουν ειδοειδικά πρότυπα. Το είδος M. so-iuy δίνει ένα πρότυπο τριών ζωνών: µία ζώνη 280 bp και µία διπλή ζώνη 600 bp και 620 bp. Το είδος L. saliens δίνει ένα πρότυπο µίας ζώνης το µέγεθος της οποίας είναι 220 bp. Τα υπόλοιπα τέσσερα είδη M. cephalus, C. labrosus, L. aurata και L. ramada παρουσιάζουν ένα κοινό πρότυπο δύο ζωνών, 220 bp και 440 bp. εν παρατηρήθηκε ενδοειδικός πολυµορφισµός, εφόσον όλα τα άτοµα του ίδιου είδους εµφάνισαν το ίδιο πρότυπο µετά την αντίδραση PCR. Τα αποτελέσµατα της ανάλυσης πρωτοδιάταξης µετά την κλωνοποίηση των προϊόντων PCR έδειξαν ότι το τµήµα των 220 bp (στα είδη M. cephalus, C. labrosus, L. aurata και L. ramada) αντιστοιχεί σε µία µονάδα του γονιδίου 5S rdna, ενώ το τµήµα των 440 bp αποτελείται από δύο διαδοχικά επαναλαµβανόµενες µονάδες του γονιδίου (Eικόνα 2). Επίσης η ζώνη των 220 bp στο είδος L. saliens, αντιστοιχεί σε µία µονάδα του γονιδίου 5S rdna. Παρόµοια δοµή των 5S rdna επαναλήψεων έχει αποκαλυφθεί και για άλλα είδη ψαριών όπως Solea solea (Cespedes et al. 15

16 1999), Brycon cephalus (Wasko et al. 2001) και Brycon sp. (Wasko et al. 2001). Έγινε σύγκριση των νουκλεοτιδικών ακολουθιών (για τη ζώνη των 220 bp) στα πέντε είδη κεφαλοειδών M. cephalus, C. labrosus, L. aurata, L. saliens και L. ramada. Βρέθηκαν συνολικά 43 πολυµορφικές θέσεις, από τις οποίες οι τρεις εντοπίστηκαν στην κωδικοποιούσα περιοχή και οι υπόλοιπες 40 εντοπίστηκαν στην ΝΤS. Oι ακολουθίες κατατέθηκαν στη βάση δεδοµένων GenBank µε κωδικούς πρόσβασης DQ bp ladder 100 bp ladder 16

17 440 bp 620 bp 600 bp 440 bp 280 bp 220 bp Εικ. 1. Ηλεκτροφορητικό πρότυπο του ενισχυµένου 5S rdna γονιδίου για τα έξι είδη κεφαλοειδών (δύο άτοµα από κάθε είδος). Το µέγεθος των ενισχυµένων προϊόντων ελέγχθηκε µε το µοριακό µάρτυρα 100 bp DNA ladder. 17


19 ΣΥΜΠΕΡΑΣΜΑΤΑ Oι φυλογενετικές σχέσεις στην οικογένεια των κεφαλοειδών έχουν µελετηθεί µε τη βοήθεια µοριακών δεικτών, όπως δεδοµένα αλλοενζυµικής ανάλυσης (Papasotiropoulos et al. 2001), δεδοµένα πολυµορφισµού µήκους περιοριστικών θραυσµάτων του mtdna (Papasotiropoulos et al. 2002), δεδοµένα ανάλυσης πρωτοδιάταξης του mtdna (Caldara et al. 1996; Rossi et al. 2004). Όλες οι παραπάνω µελέτες συνηγορούν σε δύο βασικά σηµεία: α) τη γενετική διαφοροποίηση του είδους M. cephalus, η οποία οδηγεί πάντα σε ξεχωριστή οµαδοποίησή του β) την κοινή οµαδοποίηση των ειδών L. ramada και L. aurata. Τα αποτελέσµατα της παρούσας δουλειάς συµφωνούν απόλυτα µε αυτά των προηγούµενων µελετών εφόσον το είδος M. cephalus παρουσιάζει 37 πολυµορφικές θέσεις από τις 43 που συνολικά βρέθηκαν, ενώ τα είδη L. ramada και L. aurata µοιράζονται µόνο µία νουκλεοτιδική αντικατάσταση σε όλο το γονίδιο. Τα δύο είδη M. so-iuy και L. saliens µπορούν να διακριθούν µε µία απλή αντίδραση PCR, εφόσον παρουσιάζουν ένα µοναδικό πρότυπο στη πηκτή αγαρόζης. Το είδος M. 19

20 cephalus φαίνεται να διαφοροποιείται περισσότερο συγκρινόµενο µε τα υπόλοιπα, και παρουσιάζει ένα µοναδικό DNA απλότυπο µετά από την τεχνική της ανάλυσης πρωτοδιάταξης. Το είδος αυτό είναι το πιο σηµαντικό για τους καλλιεργητές καθώς έχει τον υψηλότερο ρυθµό αύξησης σε µονάδες ιχθυοκαλλιέργειας, και το αυγοτάραχο το οποίο παράγεται από τα ώριµα θηλυκά έχει υψηλή τιµή στην αγορά. Κάθε ένα από τα υπόλοιπα τρία είδη L. ramada, L. aurata και C. labrosus παρουσιάζει επίσης ένα µοναδικό ειδο-ειδικό απλότυπο, µε νουκλεοτιδικές αντικαταστάσεις σε διαφορετικές θέσεις. Συµπερασµατικά λοιπόν, µία απλή αντίδραση PCR η οποία συνοδεύεται από την τεχνική της ανάλυσης πρωτοδιάταξης του 5S rdna γονιδίου, µπορεί να οδηγήσει σε ακριβή διάκριση των διαφορετικών ειδών γόνου κεφαλοειδών που θα γεµίσουν τα εκκολαπτήρια. Επιπλέον, η µεθοδολογία αυτή µπορεί να χρησιµοποιηθεί και για την επιβεβαίωση της µορφολογικής διάκρισης και παραπέρα συστηµατικής ταξινόµησης των ειδών αυτών. 20

21 ΠΡΟΤΑΣΕΙΣ Η παρούσα προτεινόµενη εργασία παρέχει µια γρήγορη και κυρίως αδιαµφισβήτητη µεθοδολογία (εφόσον το γενετικό υλικό των οργανισµών δεν επηρεάζεται από εξωτερικούς παράγοντες), για την ταυτοποίηση των διαφορετικών ειδών γόνου. Οι συγκεκριµένες γενετικές τεχνικές οι οποίες θα έπονται της αρχικής αναγνώρισης και συστηµατικής ταξινόµησης των ειδών έρχονται να επιβεβαιώσουν ή τυχόν να αναιρέσουν την αρχική κατάταξη. Κάθε ένα από τα έξι είδη κεφαλοειδών χαρακτηρίζεται από διαφορετικό πρότυπο του γονιδίου 5S rdna. Έτσι εάν ένας ιχθυοκαλλιεργητής έχει τυχόν αµφιβολίες για το είδος του γόνου µε το οποίο γεµίζει τις δεξαµενές του, µπορεί να επισκεφτεί το Τµήµα µας και σε χρονικό διάστηµα δύο έως τριών ηµερών θα είναι σίγουρος για το είδος του γόνου µε το οποίο κάνει τη δουλειά του. ΒΙΒΛΙΟΓΡΑΦΙΑ Andrews A.T., Electrophoretic methods. In: Analytical Methods of Food 21

22 Authentication. Eds: P. R. Ashurt; M. J. Dennis, London, UK. pp Aranishi F., 2005a. Rapid PCR-RFLP method for discrimination of imported and domestic mackerel. Marine Biotechnology, 7: Aranishi F., 2005b. PCR-RFLP analysis of nuclear nontranscribed spacer for mackerel species identification. Journal of Agricultural and Food Chemistry, 53: Caldara F., Bargelloni L., Ostellari L., Penzo E., Colombo L. & T. Patarnello, Molecular phylogeny of grey mullets based on mitochondrial DNA sequence analysis: Evidence of a different rate of evolution at the intrafamily level. Molecular Phylogenetics and Evolution, 6 (3): Cambrony M., Identification et périodicité du recrutement des juvéniles de mugilidae dans les étangs littoraux du Languedoc- Rosillon. Vie Milieu, 34 (4): Cespedes A., Garcia T., Carrera E., Gonzalez I., Fernandez A., Hernandez P.E., & R. Martin, Identification of sole (Solea solea) and greenland halibut (Reinhardtius 22

23 hippoglossoides) by PCR amplification of the 5S rdna gene. Journal of Agricultural and Food Chemistry, 47: Cespedes A. Garcia T., Carrera E., Gonzalez L., Fernandez A., Asensio L., Hernandez P.E. & R. Martin, Genetic differentiation between sole (Solea solea) and Greenland halibut (Reinhardtius hippoglossoides) by PCR RFLP analysis of a 12S rrna gene fragment. Journal of the Science of Food and Agriculture, 80: Hall T.A., BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41: Hillis D.M., Moritz C. & B.K. Mable, Molecular Systematics. Sunderland, MA: Sinauer Associates Karaiskou N., Triantafyllidis A. & C. Triantaphyllidis, Discrimination of three Trachurus species using both mitochondrial and nuclear based DNA approaches. Journal of Agricultural and Food Chemistry, 51:

24 Klossa Killia E., Papasotiropoulos V., Killias G. & S. Alahiotis, Authentication of Messolongi (Greece) fish roe using PCR- RFLP analysis of 16S rrna mtdna segment. Food Control, 13: Mackie I.M., Pryde S.E., Gonzales-Sotelo C., Medina I., Pérez-Martin R., Quinteiro J., Rey-Mendez M. & H. Rehbein, Challenges in the identification of species of canned fish. Food Science and Technology, 10: Martins C. &. P.M. Galetti, Organization of 5S rdna in species of the fish Leporinus: two different genomic locations are characterized by distinct nontranscribed spacers. Genome, 44: Martins C., Wasko A.P., Oliveira C., Porto- Foresti F., Parise-Maltempi P.P., Wright J.M. & F. Foresti, Dynamics of 5S rdna in the tilapia (Oreochromis niloticus) genome: repeat units, inverted sequences, pseudogenes and chromosome loci. Cytogenetic and Genome Research, 98: Minos G., Katselis G., Ondrias I. & I.J. Harrison, Use of melanophore patterns on the 24

25 ventral side of the head to identify fry of grey mullets (Teleostei : Mugilidae). Israeli Journal of Aquaculture:Bamidgeh, 54 (1): Murgia R., Tola G., Archer S.N., Vallegra S. & J. Hirano, Genetic identification of grey mullet species (mugilidae) by analysis of mitochondrial DNA sequence: application to identify the origin of processed ovary products (Bottarga). Marine Biotechnology, 21: Nelson J.S., Fishes of the World. Wiley, New York. Papasotiropoulos V., Klossa-Killia E., Killias G. & S. Alahiotis, Genetic divergence and phylogenetic relationships in grey mullets (Teleostei: Mugilidae) using allozyme data. Biochemical Genetics, 39 (5/6): Papasotiropoulos V., Klossa-Killia E., Killias G. & S. Alahiotis, Genetic divergence and phylogenetic relationships in grey mullets (Teleostei: Mugilidae) based on PCR-RFLP analysis of mtdna segments. Biochemical Genetics, 40 (3/4): Pendas A.M., Moran P., Freije J.L. & E. Garcia- Vazquez, 1994: Chromosomal mapping and 25

26 nucleotide sequence of two tandem repeats of Atlantic salmon 5S rrna. Cytogenetic and Genome Research, 67: Perlmutter A., Bograd L. & J. Pruginin, Use of the estuarine and sea fish of the family Mugilidae (grey mullets) for pond culture in Israel. Gen. Fish. Coun. Med. Proc. Tech. Pap. 4: Reay P.J. & V. Cornell, Identification of grey mullet (Teleostei: Mugilidae) juveniles from British waters. Journal of Fish Biology, 32: Rossi A.R., Ungaro A., De Innocentiis S., Crosetti D. & L. Sola, Phylogenetic analysis of Mediterranean mugilids by allozymes and 16S mtrrna genes species of investigation: are the Mediterranean Liza monophyletic? Biochemical Genetics, 42 (9-10): Serventi M., Harrison I.J., Torricelli P. & G. Gandolfi, The use of pigmentation and morphological characters to identify Italian mullet fry. Journal of Fish Biology, 49: Thompson, J.D., Gibson T.J., Plewniak F., Jeanmougin F. & D.G. Higgins, The 26

27 CLUSTAL X windows interface: Flexible strategies for multiple alignment aided by quality analysis tool. Nucleic Acids Research, 25: Wasko A.P., Martins C., Wright J.M. & P.M. Galetti, Molecular organization of 5S rdna in fishes of the genus Brycon. Genome, 44: Zismannn L., Means of identification of grey mullet fry for culture In: Aquaculture of grey mullets. Ed: O. H. Oren. Cambridge, UK. pp

15 o Πανελλήνιο Συνέδριο Ιχθυολόγων ΠΡΑΚΤΙΚΑ

15 o Πανελλήνιο Συνέδριο Ιχθυολόγων ΠΡΑΚΤΙΚΑ 15 o Πανελλήνιο Συνέδριο Ιχθυολόγων ΠΡΑΚΤΙΚΑ Θεσσαλονίκη 10-13 Οκτωβρίου 2013 15 ο Πανελλήνιο Συνέδριο Ιχθυολόγων Θεσσαλονίκη 2013 Πρώτη έκδοση 2013 Τυπώθηκε στη Θεσσαλονίκη από τις Εκδόσεις Γιαχούδη ISBN

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ ΚΑΙ ΑΝΑΛΥΣΗ ΕΡΕΥΝΗΤΙΚΟΥ ΕΡΓΟΥ. Ελένη Κλώσσα-Κίλια Επίκουρη Καθηγήτρια Τμήματος Βιολογίας Πανεπιστημίου Πατρών

ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ ΚΑΙ ΑΝΑΛΥΣΗ ΕΡΕΥΝΗΤΙΚΟΥ ΕΡΓΟΥ. Ελένη Κλώσσα-Κίλια Επίκουρη Καθηγήτρια Τμήματος Βιολογίας Πανεπιστημίου Πατρών ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ ΚΑΙ ΑΝΑΛΥΣΗ ΕΡΕΥΝΗΤΙΚΟΥ ΕΡΓΟΥ Ελένη Κλώσσα-Κίλια Επίκουρη Καθηγήτρια Τμήματος Βιολογίας Πανεπιστημίου Πατρών Πάτρα 2011 ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ 1. ΠΡΟΣΩΠΙΚΑ ΣΤΟΙΧΕΙΑ Επώνυμο: Κλώσσα-Κίλια

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» Η Συμβολή της Μοριακής Βιολογίας

Διαβάστε περισσότερα

Μικροβιολογία Τροφίμων Ι Εργαστήριο

Μικροβιολογία Τροφίμων Ι Εργαστήριο Μικροβιολογία Τροφίμων Ι Εργαστήριο Ενότητα 10: Μοριακή Βιολογία και Μικροβιολογία Τροφίμων (1/2), 1ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Ευστάθιος Ζ. Πανάγου Πασχαλίτσα

Διαβάστε περισσότερα

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία)

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Βιοτεχνολογία Φυτών ΔΠΘ / Τμήμα Αγροτικής Ανάπτυξης ΠΜΣ Αειφορικά Συστήματα Παραγωγής και Περιβάλλον στη Γεωργία Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Αριστοτέλης Χ. Παπαγεωργίου Εργαστήριο

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιοπληροφορική Ι. Παντελής Μπάγκος. Παν/µιο Στερεάς Ελλάδας

Βιοπληροφορική Ι. Παντελής Μπάγκος. Παν/µιο Στερεάς Ελλάδας Βιοπληροφορική Ι Παντελής Μπάγκος Παν/µιο Στερεάς Ελλάδας Λαµία 2006 1 Βιοπληροφορική Ι Εισαγωγή: Ορισµός της Βιοπληροφορικής, Υποδιαιρέσεις της Βιοπληροφορικής, Τα είδη των δεδοµένων στη Βιοπληροφορική.

Διαβάστε περισσότερα

Ανάλυση αυθεντικότητας προϊόντων κρέατος με μεθόδους DNA: Η περίπτωση νοθείας με κρέας αλόγου Στέλιος Σπανιόλας Τεχνολόγος Τροφίμων, MSc PhD

Ανάλυση αυθεντικότητας προϊόντων κρέατος με μεθόδους DNA: Η περίπτωση νοθείας με κρέας αλόγου Στέλιος Σπανιόλας Τεχνολόγος Τροφίμων, MSc PhD Ανάλυση αυθεντικότητας προϊόντων κρέατος με μεθόδους DNA: Η περίπτωση νοθείας με κρέας αλόγου Στέλιος Σπανιόλας Τεχνολόγος Τροφίμων, MSc PhD 1. ΕΙΣΑΓΩΓΗ Η σημασία της νοθείας των τροφίμων, τόσο από την

Διαβάστε περισσότερα

Department of Biological Sciences, Texas Tech University, MS 43131, Lubbock,Texas 79409-3131. 3

Department of Biological Sciences, Texas Tech University, MS 43131, Lubbock,Texas 79409-3131. 3 1 Τμήμα Βιολογίας, Πανεπιστήμιο Κρήτης, Ηράκλειο Κρήτης. 2 Department of Biological Sciences, Texas Tech University, MS 43131, Lubbock,Texas 79409-3131. 3 Department of Biology, Faculty of Science, Dokuz

Διαβάστε περισσότερα


Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης ΕΙΣΑΓΩΓΗ Σύμφωνα με την ΠΟΥ το 1/3 περίπου του παγκόσμιου πληθυσμού είναι μολυσμένο

Διαβάστε περισσότερα


ΝΕΕΣ MΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΓΙΑ ΤΗΝ ΤΥΠΟΠΟΙΗΣΗ ΤΩΝ ΒΑΚΤΗΡΙΩΝ ΝΕΕΣ MΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΓΙΑ ΤΗΝ ΤΥΠΟΠΟΙΗΣΗ ΤΩΝ ΒΑΚΤΗΡΙΩΝ ΑΠΟΣΤΟΛΟΣ ΒΑΝΤΑΡΑΚΗΣ ΒΙΟΛΟΓΟΣ (M.Sc, Ph.D) Επιδημίες μολυσματικών ασθενειών συχνά οφείλονται σε έκθεση σε μία κοινή πηγή ενός αιτιολογικού παράγοντα.

Διαβάστε περισσότερα

θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν κλπ

θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν κλπ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 4 ο ΚΕΦΑΛΑΙΟ 1. Προβλήματα που αναφέρονται στα κομμάτια που θα κοπεί το DNA, στις θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν

Διαβάστε περισσότερα


ΙΝΣΤΙΤΟΥΤΟ ΘΑΛΑΣΣΙΑΣ ΒΙΟΛΟΓΙΑΣ ΚΑΙ ΓΕΝΕΤΙΚΗΣ \ ΙΝΣΤΙΤΟΥΤΟ ΘΑΛΑΣΣΙΑΣ ΒΙΟΛΟΓΙΑΣ ΚΑΙ ΓΕΝΕΤΙΚΗΣ Ερευνητικών Προγραµµάτων ΤΕΧΝΙΚΕΣ ΕΚΘΕΣΕΙΣ 2005 BRIDGING GENOMES: An integrated genomic approach toward genetic improvement of aquacultured fish species

Διαβάστε περισσότερα

Νόσος Parkinson-Νέοι ορίζοντες Ξηροµερήσιου Γεωργία Νευρολόγος-Μέλος ερευνητικής οµάδας Νευρογενετικής Αίτια της νόσου Parkinson Περιβαλλοντικοί παράγοντες Γενετικοί παράγοντες Γενετική βλάβη (παθογόνα

Διαβάστε περισσότερα

«Η συμβολή της βιοπληροφορικής στη μελέτη της ποικιλότητας των πληθυσμών της πεταλούδας Carassius gibelio»

«Η συμβολή της βιοπληροφορικής στη μελέτη της ποικιλότητας των πληθυσμών της πεταλούδας Carassius gibelio» «Η συμβολή της βιοπληροφορικής στη μελέτη της ποικιλότητας των πληθυσμών της πεταλούδας Carassius gibelio» Γεώργιος Τσιπάς 1, Μαρία Τάτση 2 1 Καθηγητής Βιολόγος Ph.D., Γυμνάσιο Καινουργίου Αιτωλοακαρνανίας

Διαβάστε περισσότερα

Ο Ελληνικός βούβαλος.

Ο Ελληνικός βούβαλος. ΑΛΕΞΑΝ ΡΕΙΟ Τ.Ε.Ι. ΘΕΣΣΑΛΟΝΙΚΗΣ, ΤΜΗΜΑ ΖΩΙΚΗΣ ΠΑΡΑΓΩΓΗΣ 3Ο ΠΑΝΕΛΛΗΝΙΟ ΣΥΝΕ ΡΙΟ ΤΕΧΝΟΛΟΓΙΑΣ ΖΩΙΚΗΣ ΠΑΡΑΓΩΓΗΣ 1Η ΑΝΑΚΟΙΝΩΣΗ 3ο Πανελλήνιο Συνέδριο Τεχνολογίας Ζωικής Παραγωγής Φεβρουάριος 2011, Θεσσαλονίκη

Διαβάστε περισσότερα


ΔΥΝΑΤΟΤΗΤΕΣ ΠΑΡΑΓΩΓΗΣ ΑΛΛΑΝΤΙΚΩΝ ΑΕΡΟΣ ΧΑΜΗΛΗΣ ΛΙΠΟΠΕΡΙΕΚΤΙΚΟΤΗΤΑΣ ΜΕ ΠΡΟΣΘΗΚΗ ΕΛΑΙΟΛΑΔΟΥ ΟΔΗΓΙΕΣ ΣΥΓΓΡΑΦΗΣ ΤΗΣ ΠΤΥΧΙΑΚΗΣ ΔΙΑΤΡΙΒΗΣ ΤΩΝ ΦΟΙΤΗΤΩΝ Εξώφυλλο Το εξώφυλλο θα περιλαμβάνει τα εξής: 1. Το όνομα του Πανεπιστημίου, του Τμήματος και του Τομέα 2. Το όνομα του φοιτητή στη γενική 3. Τις

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) 1 ΦΟΡΕΙΣ πλασµίδια βακτηρίων βακτηριοφάγοι ιοί συνδυασµός πλασµιδίου βακτηριοφάγου (κοσµίδια) 2 ΦΟΡΕΙΣ Βακτηριοφάγοι Χαρακτηριστικά

Διαβάστε περισσότερα

Γενετικά Τροποποιηµένα. Κλωνοποίηση - Πατέντα

Γενετικά Τροποποιηµένα. Κλωνοποίηση - Πατέντα Γενετικά Τροποποιηµένα Φυτά Κλωνοποίηση - Πατέντα Τεχνική της κλωνοποίησης Πανοµοιότυπα αντίγραφα σταθερότητα παραγωγής α) Φυτά: εγγενής αγενής αναπαραγωγή β) Ζώα: διασταυρώσεις Αντιδράσεις Κλωνοποίηση

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Βιολογία Θετικής Κατεύθυνσης 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία ανασυνδυασμένου DNA Αναπτύχθηκε λόγω της ανακάλυψης: i. Περιοριστικών ενδονουκλεασών ii. Ειδικών φορέων DNA Έδωσε

Διαβάστε περισσότερα


ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. (Μοριακή Βελτίωση) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ (Μοριακή Βελτίωση) 1 Βασίζεται στη χρήση μοριακών δεικτών που είναι συνδεδεμένοι με επιθυμητές χρωμοσωμικές περιοχές. Μοριακοί δείκτες είναι τυχαία επιλεγμένα τμήματα DNA χωρίς

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ 1 ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ άμεση πρόσβαση στο γενετικό υλικό εφαρμογές στην υγεία, βελτίωση φυτών και ζώων, προστασία

Διαβάστε περισσότερα

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Vasilis Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus http://en.wikipedia.org/wiki/image:cyprus_topo.png

Διαβάστε περισσότερα

Μέθοδοι Μοριακής Βιολογίας με Εφαρμογή στη Βακτηριολογία

Μέθοδοι Μοριακής Βιολογίας με Εφαρμογή στη Βακτηριολογία Μέθοδοι Μοριακής Βιολογίας με Εφαρμογή στη Βακτηριολογία Γενετική Βακτηρίων Κατανόηση μηχανισμών λειτουργίας ευκαρυωτικών κυττάρων Ταξινόμηση βακτηρίων Διάγνωση λοιμωδών νοσημάτων Επιδημιολογική μελέτη

Διαβάστε περισσότερα



Διαβάστε περισσότερα

TreeTOPS. ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα. Teacher s Guide. ELLS European Learning Laboratory for the Life Sciences

TreeTOPS. ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα. Teacher s Guide. ELLS European Learning Laboratory for the Life Sciences TreeTOPS ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα Teacher s Guide ELLS European Learning Laboratory for the Life Sciences 1 Γενικός σκοπός Το συγκεκριμένο παιχνίδι έχει ως στόχο να εισάγει τους

Διαβάστε περισσότερα

Τρυφωνόπουλος Γιώργος

Τρυφωνόπουλος Γιώργος Βιογραφικό σημείωμα Προσωπικές πληροφορίες Επώνυμο / Όνομα Διεύθυνση Διεύθυνση ηλεκτρονικού ταχυδρομείου Τρυφωνόπουλος Γιώργος Ξηροπηγαδο Τ.Κ.: 22001, Αρκαδία (Ελλάδα) Τηλέφωνο +306946378761 Υπηκοότητα

Διαβάστε περισσότερα

πληθυσμών του αρουραίου (Rattus rattus)σε συμπλέγματα νησιών και βραχονησίδων των ελληνικών θαλασσών

πληθυσμών του αρουραίου (Rattus rattus)σε συμπλέγματα νησιών και βραχονησίδων των ελληνικών θαλασσών Γενετική δομή και πρότυπα διαφοροποίησης των πληθυσμών του αρουραίου (Rattus rattus)σε συμπλέγματα νησιών και βραχονησίδων των ελληνικών θαλασσών Δημήτρης Τσαπάρης Jacob Fric Αθήνα, Οκτώβριος 2012 Jon

Διαβάστε περισσότερα

ΑΣΚΗΣΗ 1η Αναζήτηση πληροφορίας σε Βιβλιογραφικές Βάσεις εδοµένων

ΑΣΚΗΣΗ 1η Αναζήτηση πληροφορίας σε Βιβλιογραφικές Βάσεις εδοµένων ΑΣΚΗΣΗ 1η Αναζήτηση πληροφορίας σε Βιβλιογραφικές Βάσεις εδοµένων ΕΙΣΑΓΩΓΗ Η αναζήτηση και µελέτη της επιστηµονικής βιβλιογραφίας αποτελεί βασική προϋπόθεση για την επίλυση ερευνητικών προβληµάτων. Η βιβλιογραφική

Διαβάστε περισσότερα


Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα



Διαβάστε περισσότερα

σπανίων φυλών των ζώων

σπανίων φυλών των ζώων Προβλήματα διατήρησης των σπανίων φυλών των ζώων Problems of conservation of rare breeds of animals Ανεξέλεγκτες διασταυρώσεις στα ποίμνια Μικρό μέγεθος Ελεγχο ομομειξίας μ Αδυναμία κατάταξης των ζώων

Διαβάστε περισσότερα

Ταξινόµιση οργανισµών

Ταξινόµιση οργανισµών Ταξινόµιση οργανισµών Ιεραρχική κατηγοριοποίηση/ οµαδοποίηση οργανισµών. Linnaeus (1707-1778) οµαδοποίησε οργανισµούς µε βάση κοινούς χαρακτήρες. Αργότερα, η ταξινόµιση προσαρµόστηκε στην εξελικτική θεωρία

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Γεωπονικό Πανεπιστήμιο Αθηνών. (2006-2008) Βαθμός: «Άριστα» (9,25/10)

Γεωπονικό Πανεπιστήμιο Αθηνών. (2006-2008) Βαθμός: «Άριστα» (9,25/10) ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ ΓΕΩΠΟΝΟΣ ΓΠΣ MSc- ΒΙΟΤΕΧΝΟΛΟΓΟΣ ΠΡΟΣΩΠΙΚΑ ΣΤΟΙΧΕΙΑ Τηλέφωνο: 6972314589 / 210-8221676 E-mail: tmaltez@otenet.gr, tasosmalt@yahoo.gr Στρατιωτική θητεία: Ολοκληρωμένη ΕΚΠΑΙΔΕΥΣΗ - Μεταπτυχιακό

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

Αϖοµόνωση και γενετική διαφοροϖοίηση ϖληθυσµών του ζαρκαδιού (Capreoluscapreolus) στην Ελλάδα νέα δεδοµένα για αϖοτελεσµατικότερη διαχείριση και διατήρηση ηµήτρης Τσαϖάρης Παναγιώτης Κασαϖίδης Κωνσταντίνος

Διαβάστε περισσότερα

Συνδεδεµένα Γονίδια. Γενετικός Ανασυνδυασµός Κλασσική Γενετική Χαρτογράφηση ΑΘΑΝΑΣΙΟΣ ΜΑΥΡΟΜΑΤΗΣ - ΤΑΝΙΑ ΜΑΡΚΟΠΟΥΛΟΥ

Συνδεδεµένα Γονίδια. Γενετικός Ανασυνδυασµός Κλασσική Γενετική Χαρτογράφηση ΑΘΑΝΑΣΙΟΣ ΜΑΥΡΟΜΑΤΗΣ - ΤΑΝΙΑ ΜΑΡΚΟΠΟΥΛΟΥ 8η ιάλεξη Συνδεδεµένα Γονίδια Γενετικός Ανασυνδυασµός Κλασσική Γενετική Χαρτογράφηση ΑΘΑΝΑΣΙΟΣ ΜΑΥΡΟΜΑΤΗΣ - ΤΑΝΙΑ ΜΑΡΚΟΠΟΥΛΟΥ Εργαστήριο Γενετικής & Βελτίωσης φυτών Κύρια σηµεία - Ορισµοί Συνταινικά =

Διαβάστε περισσότερα

9 th Symposium on Oceanography & Fisheries, Proceedings, Volume ΙΙ

9 th Symposium on Oceanography & Fisheries, Proceedings, Volume ΙΙ 9 th Symposium on Oceanography & Fisheries, 2009 - Proceedings, Volume ΙΙ ΑΝΑΠΤΥΞΗ ΜΙΚΡΟΔΟΡΥΦΟΡΙΚΩΝ ΓΕΝΕΤΙΚΩΝ ΔΕΙΚΤΩΝ ΣΤΟΝ ΕΥΡΩΠΑΪΚΟ ΓΑΥΡΟ (Engraulis encrasicolus) ΚΑΙ ΜΕΛΕΤΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΔΟΜΗΣ ΤΩΝ ΠΛΗΘΥΣΜΩΝ

Διαβάστε περισσότερα

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Chain Reaction (pcr)- Αλυσιδωτή αντίδραση πολυμεράσης.η

Διαβάστε περισσότερα


Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

Βιβλιογραφική εργασία

Βιβλιογραφική εργασία Εργαστήριο Αμπελουργίας ΑΡΓΥΡΩ ΜΠΕΚΑΤΩΡΟΥ Επίκουρος Καθηγήτρια Χημείας & Τεχνολογίας Τροφίμων Πάτρα 2016 Τι είναι βιβλιογραφική εργασία (review); Παραθέτει δεδομένα (data/results) αποδείξεις (evidence)

Διαβάστε περισσότερα


ΒΙΒΛΙΟΓΡΑΦΙΑ ΑΝΑΦΟΡΕΣ ΔΕΟΝΤΟΛΟΓΙΑ ΒΙΒΛΙΟΓΡΑΦΙΑ ΑΝΑΦΟΡΕΣ ΔΕΟΝΤΟΛΟΓΙΑ 1 ΒΙΒΛΙΟΓΡΑΦΙΑ ΑΞΙΟΛΟΓΗΣΗ ΤΩΝ ΠΗΓΩΝ ΤΟΥ ΔΙΑΔΙΚΤΥΟΥ Αναρωτηθείτε: Ποιοι είναι οι συγγραφείς αυτής της σελίδας; Τι γνωρίζετε για αυτούς; Τους έχετε συναντήσει στη βιβλιογραφία;

Διαβάστε περισσότερα

Μοριακή ταυτοποίηςη: είδοσ, άτομο, φφλο

Μοριακή ταυτοποίηςη: είδοσ, άτομο, φφλο Διάλεξη 2 Μοριακή ταυτοποίηςη: είδοσ, άτομο, φφλο (Κ. Ματθιόπουλοσ) Τι είναι «είδος»; Μοριακή ταυτοποίηση: είδος, άτομο,, φύλο Πόσο αξίζει μια ομάδα οργανισμών τις προσπάθειες διατήρησής τους Δηλαδή: πόσο

Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Β ΦΑΣΗ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ ΤΑΞΗ: ΜΑΘΗΜΑ: 3 η ΤΑΞΗ ΕΠΑ.Λ. (Β ΟΜΑ Α) ΒΙΟΛΟΓΙΑ ΙΙ Ηµεροµηνία: Παρασκευή 19 Απριλίου 2015 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α Α1-β, Α2-γ, Α3-γ, Α4-α, Α5-α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Με τη µέθοδο της επιλογής

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Α. Βιοϊατρικός Κύκλος

Α. Βιοϊατρικός Κύκλος ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΤΗΣ ΓΝΩΣΗΣ ΑΠΟΦΟΙΤΩΝ ΑΝΩΤΕΡΩΝ ΕΚΠΑΙ ΕΥΤΙΚΩΝ Ι ΡΥΜΑΤΩΝ ΣΕ ΣΥΓΧΡΟΝΕΣ ΕΦΑΡΜΟΓΕΣ ΣΤΙΣ ΒΙΟΕΠΙΣΤΗΜΕΣ Περιεχόµενο Προγράµµατος (µαθήµατα, ώρες κλπ): Το Πρόγραµµα Σπουδών διαχωρίζεται σε δύο Κύκλους

Διαβάστε περισσότερα

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA 1. Γιατί οι περιοριστικές ενδονουκλεάσες και οι φορείς κλωνοποίησης είναι απαραίτητα εργαλεία για τη Γενετική Μηχανική; Οι περιοριστικές ενδονουκλεάσες είναι

Διαβάστε περισσότερα

Φπκαηίσζε: ε επηδεκηνινγηθή δηεξεύλεζε θξνπζκάησλ κε κνξηαθέο ηερληθέο

Φπκαηίσζε: ε επηδεκηνινγηθή δηεξεύλεζε θξνπζκάησλ κε κνξηαθέο ηερληθέο Φπκαηίσζε: ε επηδεκηνινγηθή δηεξεύλεζε θξνπζκάησλ κε κνξηαθέο ηερληθέο Λοσκία Ζέρβα Εργαστήριο Κλινικής Μικροβιολογίας Αττικό Νοσοκομείο, Πανεπιστήμιο Αθηνών ΔΗΑΓΩΓΖ Από ηα ηέιε ηνπ 1980: εθαξκνγή κνξηαθώλ

Διαβάστε περισσότερα

Τεχνολογία του ανασυνδυασμένου DNA

Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία του ανασυνδυασμένου DNA Ε Ι Σ Α Γ Ω Γ Η Φώτης Καρβέλης Ιστορική αναδρομή Ανακάλυψη του DNA Μελέτη αντιγραφής Απομόνωση ενζύμων Μελέτη της δράσης τους Αποκάλυψη των περιοριστικών ενδονουκλεασών

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Δοκιμές (Συστήματα) παροδικής έκφρασης γονιδίων

Δοκιμές (Συστήματα) παροδικής έκφρασης γονιδίων Δοκιμές (Συστήματα) παροδικής έκφρασης γονιδίων Λειτουργία γονιδίου Ανάλυση προαγωγέων Συμπληρωματικότητα διαγονιδίων Παραγωγή πρωτεϊνών Πλεονεκτήματα σε σχέση με σταθερό μετασχηματισμό ταχύτατη προσέγγιση

Διαβάστε περισσότερα


ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ ΓΕΩΡΓΙΟΥ ΧΩΤΟΥ ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ ΓΕΩΡΓΙΟΥ ΧΩΤΟΥ Γεώργιος Ν. Χώτος, Καθηγητής Τεχνολογικό Εκπαιδευτικό Ιδρυμα (Τ.Ε.Ι.) Δυτικής Ελλάδας (πρ. Τ.Ε.Ι. Μεσολογγίου και πρ. Τ.Ε.Ι. Πάτρας) Τμήμα Τεχνολογίας Αλιείας Υδατοκαλλιεργειών

Διαβάστε περισσότερα


ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ Η συµβολή της µοριακής ανάλυσης Eλισάβετ Οικονοµάκη Βιολόγος Αιµοπαθολογοανατοµικό Εργαστήριο ΠΓΝΑ > ΜΟΡΙΑΚΕΣ ΜΕΘΟ ΟΙ (Μη µορφολογικές) Αλυσιδωτή Αντίδραση Πολυµεράσης

Διαβάστε περισσότερα

Η διδασκαλία της θεωρίας της εξέλιξης στη δευτεροβάθμια εκπαίδευση

Η διδασκαλία της θεωρίας της εξέλιξης στη δευτεροβάθμια εκπαίδευση Η διδασκαλία της θεωρίας της εξέλιξης στη δευτεροβάθμια εκπαίδευση Πανελλήνιο συνέδριο με θέμα: Βιολογικές και Φυσικές Επιστήμες στην Εκπαίδευση Αθήνα, 11-13/04/2008 Κώστας Καμπουράκης Εκπαιδευτήρια Γείτονα,

Διαβάστε περισσότερα

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 25ης Μαρτίου 111 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 20 990-210 50 27 990 25ης Μαρτίου 74 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 50 658-210 50 60 845 Γραβιάς 85 -

Διαβάστε περισσότερα

Η Κυτταρογενετική στις αιματολογικές κακοήθειες

Η Κυτταρογενετική στις αιματολογικές κακοήθειες Εργαστήριο Υγειοφυσικής & Περιβαλλοντικής Υγείας, ΙΠΤ-Α, Ε.Κ.Ε.Φ.Ε. «Δημόκριτος» Η Κυτταρογενετική στις αιματολογικές κακοήθειες Μανωλά Καλλιόπη, Ph.D Ερευνήτρια Γ Κυτταρογενετική Κλάδος της Γενετικής

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Εξελίξεις στην Προεμφυτευτική Γενετική Ανάλυσητο μέλλον

Εξελίξεις στην Προεμφυτευτική Γενετική Ανάλυσητο μέλλον 1 ο Επιμορφωτικό Σεμινάριο Γενετικής ΤΙ ΝΕΟΤΕΡΟ ΣΤΗΝ ΕΡΓΑΣΤΗΡΙΑΚΗ ΓΕΝΕΤΙΚΗ ΑΝΑΛΥΣΗ Εξελίξεις στην Προεμφυτευτική Γενετική Ανάλυσητο μέλλον Γεωργία Κάκουρου, PhD ΕΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ,

Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια ΚΕΦΑΛΑΙΟ 4ο: Η τεχνολογία του ανασυνδυασµένου DNA έδωσε στον άνθρωπο την ικανότητα όχι µόνο να ερευνά αλλά και να τροποποιεί το γενετικό υλικό των οργανισµών ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA Η τεχνολογία

Διαβάστε περισσότερα

Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών

Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών Αντιµεταλλαξιγόνο δράση ανίχνευση ουσιών που προστατεύουν το DNA από µεταλλαξιγόνα που προκαλούν µεταλλάξεις

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 2/12/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΔΑ: ΒΙΞ446914Γ-ΧΡΖ. Βαθμός Ασφαλείας. Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων. Μεγ.

ΑΔΑ: ΒΙΞ446914Γ-ΧΡΖ. Βαθμός Ασφαλείας. Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων. Μεγ. ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ (Τ.Ε.Ι.) ΔΥΤΙΚΗΣ ΕΛΛΑΔΑΣ Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων Μεγ.

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ πληθυσμιακη δομη του μελανουριου, Oblada melanura L., με χρηση μικροδορυφορικου DNA.

ΓΕΝΕΤΙΚΗ πληθυσμιακη δομη του μελανουριου, Oblada melanura L., με χρηση μικροδορυφορικου DNA. 8ο Πανελλήνιο Συμποσιο Ωκεανογραφίας & Αλιείας 393 ΓΕΝΕΤΙΚΗ πληθυσμιακη δομη του μελανουριου, Oblada melanura L., με χρηση μικροδορυφορικου DNA. 1 Γκάφας Γ, 2 Τσαλαβούτα Μ, 2 Τσιγγενόπουλος Κ, 2 Μαγουλάς

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

ΖΩΟΤΕΧΝΙΑ Διδάσκουσα: Κουτσούλη Παναγιώτα Τμήμα: Επιστήμης Ζωικής Παραγωγής & Υδατοκαλλιεργειών

ΖΩΟΤΕΧΝΙΑ Διδάσκουσα: Κουτσούλη Παναγιώτα Τμήμα: Επιστήμης Ζωικής Παραγωγής & Υδατοκαλλιεργειών ΖΩΟΤΕΧΝΙΑ Χαρακτηριστικά των αγροτικών ζώων με οικονομική σημασία Διδάσκουσα: Κουτσούλη Παναγιώτα Τμήμα: Επιστήμης Ζωικής Παραγωγής & Υδατοκαλλιεργειών 1. Μονογονιδιακά χαρακτηριστικά στους πληθυσμούς

Διαβάστε περισσότερα

H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων

H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων Dr. Παναγιώτης Μαδέσης pmadesis@certh.gr Ι. Γανόπουλος,

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β. Σωστό το β

ΘΕΜΑ Α ΘΕΜΑ Β. Σωστό το β ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και, δίπλα, το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 γ Α3 γ Α4 α Α5 δ ΘΕΜΑ Β Β1. Το βακτήριο Agrobacterium tumefaciens, το οποίο ζει στο έδαφος,

Διαβάστε περισσότερα

Τι συµβαίνει σε ένα Εργαστήριο Γενετικής?

Τι συµβαίνει σε ένα Εργαστήριο Γενετικής? 12 εργαστήριο ίσως ελέγξει τα αποθηκευµένα δείγµατα (ιδιαίτερα εάν ο αρχικός έλεγχος δεν έδωσε αποτέλεσµα), αλλά µόνο εάν έχετε δώσει τη γραπτή σας συγκατάθεση για κάτι τέτοιο. Με αυτό τον τρόπο οι ασθενείς

Διαβάστε περισσότερα

Βιοπληροφορική. Μαργαρίτα Θεοδωροπούλου. Πανεπιστήμιο Θεσσαλίας, Λαμία 2016

Βιοπληροφορική. Μαργαρίτα Θεοδωροπούλου. Πανεπιστήμιο Θεσσαλίας, Λαμία 2016 Βιοπληροφορική Μαργαρίτα Θεοδωροπούλου Πανεπιστήμιο Θεσσαλίας, Λαμία 2016 Βιοπληροφορική Εισαγωγή στη Μοριακή Βιολογία, Γενωμική και Βιοπληροφορική. Βάσεις Βιολογικών Δεδομένων. Ακολουθίες Πρωτεϊνών και

Διαβάστε περισσότερα

ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ. Βιοπληροφορική. Ενότητα 5 η : Φυλογενετική ανάλυση 2. Ηλίας Καππάς Τμήμα Βιολογίας

ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ. Βιοπληροφορική. Ενότητα 5 η : Φυλογενετική ανάλυση 2. Ηλίας Καππάς Τμήμα Βιολογίας ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Ενότητα 5 η : Φυλογενετική ανάλυση 2 Ηλίας Καππάς Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες χρήσης Creative Commons.

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Παραδοτέο Π.1 (Π.1.1) Εκθέσεις για προµήθεια εκπαιδευτικού υλικού

Παραδοτέο Π.1 (Π.1.1) Εκθέσεις για προµήθεια εκπαιδευτικού υλικού 1 ΕΛΛΗΝΙΚΗ ΗΜΟΚΡΑΤΙΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΜΑΚΕ ΟΝΙΑΣ ΟΙΚΟΝΟΜΙΚΩΝ ΚΑΙ ΚΟΙΝΩΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΕΠΕΑΕΚ ΙΙ Μέτρο 2.2 Αναµόρφωση Προγραµµάτων Προπτυχιακών Σπουδών ιεύρυνση Τριτοβάθµιας Κατ. Πράξης 2.2.2.α Αναµόρφωση Προγραµµάτων

Διαβάστε περισσότερα

Splice site recognition between different organisms


Διαβάστε περισσότερα

8ο Πανελλήνιο Συμποσιο Ωκεανογραφίας & Αλιείας 411

8ο Πανελλήνιο Συμποσιο Ωκεανογραφίας & Αλιείας 411 8ο Πανελλήνιο Συμποσιο Ωκεανογραφίας & Αλιείας 411 Genome resources for the gilthead seabream (Sparus auratα) produced within the EU project BRIDGE-MAP Kotoulas G 1., E. Sarropoulou 1,3., L. Bargelloni

Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα



Διαβάστε περισσότερα