TTCCGgtaaaccaaaaaacaaaaatcagattgttttgatatgcatgtttgtgattttggaatctggattataattaaaaaaaaaaatggggaaa
|
|
- Ολυμπία Βαρουξής
- 7 χρόνια πριν
- Προβολές:
Transcript
1 1
2 (a) ATGAAGAAGCGCTTAACCACTTCCACTTGTTCTTCTTCTCCATCTTCCTCTGTTTCTTCTTCTACTACTACTTCCTCTCCTATTCAGTCGGAGG CTCCAAGGCCTAAACGAGCCAAAAGGGCTAAGAAATCTTCTCCTTCTGGTGATAAATCTCATAACCCGACAAGCCCTGCTTCTACCCGACGCAG CTCTATCTACAGAGGAGTCACTAG(g/a;wri1-1)tttttatttttttggaaattaaatgattggttgttgagattggatttgggttttgtct taaaactgcatttgtaagattgcatgttgttttgtgggattttgcagacatagatggactgggagattcgaggctcatctttgggacaaaagct CTTGGAATTCGATTCAGAACAAGAAAGGCAAACAAGgtttcgtcttcttctttttttcttcgtaactcatgattttgtttgttttaataaagat ctggactttaactgataaatttggtttctttgatctgttgtttgatctcaacttcgtcacaacttcaccagtttatctgggtaagctctaattc tctgaaacaaaagatcaattgttttttactaaattgaaagagaaaaaaaaagagagagtggatttggtcagaagaatctcaactgctttcacgc gtaattgcaggagcatatgacagtgaagaagcagcagcacatacgtacgatctggctgctctcaagtactggggacccgacaccatcttgaatt TTCCGgtaaaccaaaaaacaaaaatcagattgttttgatatgcatgtttgtgattttggaatctggattataattaaaaaaaaaaatggggaaa atcaggcagagacgtacacaaaggaattggaagaaatgcagagagtgacaaaggaagaatatttggcttctctccgccgccagagcagtggttt CTCCAGAGGCGTCTCTAAATATCGCGGCGTCGCTAGg( wri1-3)ttcctttttttctctctttctttttttaatttctttagatttattttt taaatttcggaatttactaccaaattgagaaatgatttttcctattttcggatatctgaataacagaattaattattaggaaaaaatctgatca tgaaaattttgcttttagaatattctctttttcttaaaaaaaatcataaattatgtttttttcagcactgctaaagtttatggattcaatagtt tggtcattttattcttaaaaataggattatttt( wri1-5)tgttcataaaaaca(g/a;wri1-6)gcatcaccacaacggaagatgggagg CTCGGATCGGAAGAGTGTTTGGGAACAAGTACTTGTACCTCGGCACCTATAgtacgttatctcctttcccttttttcttctagtaatttttaga aaaaaatagatatgtactcttggttaatttaaaataattagcgtaattattgacttttttataacttaccgggcataacggatcctttttacct gttatgctttataatatataattttgtaagtataaaatagagtgtgataatgtttagactgttttttgttgttgtttataagagtgatttaaga atattaatttgtttagtgagacaattagaataatataatggggaagcagtggcagtggggtttgaattttacacacactgactcacgtgaggcg agagttttgacatcatgtccctttaattgatttttatcttttaatcaaatcaactttttttcttcttcttttttaattatctgatccctctgca taattaccttttaaattctgcattttttgtggatccgatactctgaatacaaaaattgagaactctgcagaagggaatattaacaacaactctt ttactgaaaagtaatcccatttttttttattgtttttgctgactcttaccgggtccttagatttatttaaggacctcctaatcttcaacaaatc tcaaatttttgaaaattagatttttttaaaaaagtaatacaaa(wri1-4 )ttgagatttgcaaaaatataggcattgttgttctataacaaa gatactttatttataccaaaaaaaagaaaagagttgtcaagagcataattacaaaaaaaaaaattgaaataagtagtagttgtgaaattttgta tagaaaaataatgtaggttacaagtgtaaaggcgcgtgtagcgcgcgtaggtcacgtgataacactctcacttcataaaaggacaaaatagttc agagaggctttaggaccaaacccgaggtcgatctggtttgctcttgtttttttggtttattaaattggattaattagttagagttgagacttgc tctgagtaggagtcacgagccctcacgtgcactgctcatctctctctatctctctaccatatctttcatctttgtcc(wri1-10)tccgaaca aaatctggtctaactttatcttcttttcttttaataattgtcttctctactttaccattatttttctctagattattctggtaccaaacttata acttaatagttgattagtgcttagagttgacactaggttggtgttttaattattgttaattaactcagtaatcgtacgttcgtgtattaattat atacacaaattgttgcgatgacttaaattaagtcacaagtttggactctttagtgtttagagcggcgcagtggaggagaaatggtctttgtaca cgcctcacatctccacacaaatcgtgtaaccctagttgtccctacaaaaacacgtcaccaaattctattgattctttgtctttattaggtatca taaattctctaatttaaatatgaaacgacaaagaagaaactcttctttttaacacttgtttggtcttatttggttatagccacttaccaggtaa tgtgaaagttaacaacaagttgcgttaactttcaaaacactgactttgtttgcattgtcttgatttagaagctttttagctaacacagttgtct atttattggttttacagatacgcaggaggaagctgctgcagcatatgacatggctgcgattgagtatcgaggcgcaaacgcggttactaatttc GACATTAGTAATTACATTGACCGGTTAAAGAAGAAAGGTGTTTTCCCGTTCCCTGTGAACCAAGCTAACCATCAAGAGGGTATTCTTGTTGAAG CCAAACAAGAAGTTGAAACGAGAGAAGCGAAGGAAGAGCCTAGAGAAGAAGTGAAACAACAGTACGTGGAAGAACCACCGCAAGAAGAAGAAGA GAAGGAAGAAGAGAAAGCAGAGCAACAAGAAGCAGAGATTGTAGGATATTCAGAAGAAGCAGCAGTGGTCAATTGCTGCATAGACTCTTCAACC ATAATGGAAATGGATCGTTGTGGGGACAACAATGAGCTGGCTTGGAACTTCTGTATGATGGATACAGGGTTTTCTCCGTTTTTGACTGATCAGA ATCTCGCGAATGAGAATCCCATAGAGTATCCGGAGCTATTCAATGAGTTAGCATTTGAGGACAACATCGACTTCATGTTCGATGATGGGAAGCA CGAGTGCTTGAACTTGGAAAATCTGGATTGTTGCGTGGTGGGAAGAGAGAGCCCACCCTCTTCTTCTTCACCATTGTCTTGCTTATCTACTGAC TCTGCTTCATCAACAACAACAACAACAACCTCGGTTTCTTGTAACTATTTGgtctgagagagagagctttgccttctagtttgaatttctattt cttccgcttcttcttcttttttttcttttgttgggttctgcttagggtttgtatttcagtttcagggcttgttcgttggttctgaataa (b) Allele Background Mutation type Position Reference wri1-1 Col-2 EMS (G-to-A) 20,115,021 Cernac & Benning (2004) wri1-2 Col-2 EMS (?) - Focks & Benning (1998) wri1-3 Col-0 T-DNA (SALK_085693) 20,115,774 Baud et al. (2007) wri1-4 Col-0 T-DNA (SALK_008559) 20,116,785 Baud et al. (2007) wri1-5 Ws-0 T-DNA (FLAG_158E08) 20,116,043 Baud et al. (2007) wri1-6 Col-0 EMS (G-to-A) 20,116,058 this study wri1-10 Col-0 T-DNA (GK109D06) 20,117,186 Maeo et al. (2009) 2
3 3
4 4
5 5
6 6
7 Chemical Shift (ppm) Chemical Shift (ppm) 7
8 Chemical Shift (ppm) Chemical Shift (ppm)
9 F2 Chemical Shift (ppm) F1 Chemical Shift (ppm) 9
10 m/z--> Abundance m/z--> Abundance m/z-->
11 11
12 Abundance α-tocomonoenol mass spectrum (TMS ether) - rapeseed oil m/z--> Abundance γ-tocomonoenol mass spectrum (TMS ether) - rapeseed oil m/z-->
13 Abundance γ-tocomonoenol mass spectrum (TMS ether) - linseed oil m/z--> Abundance α-tocomonoenol mass spectrum (TMS ether) - sunflower oil m/z-->
14 14
15 15
16 The Arabidopsis EMS-mutagenized plants screened for seed tocochromanol were originally produced to perform a screen on plant defences and carry a T-DNA with the promat1g51850:dao1 construct in the Col-0 accession. The cauliflower 35S terminator sequence from paeq-hyg was cloned into the XbaI/SacI sites of pgreen0229 ( yielding plasmid pgreen-t35. The dao1 sequence (Erikson et al., 2004) was amplified from plasmid prlm208qcz (BASF Plant Science, Limburgerhof, Germany) using the primers DaoF-EcoRI-F (5 - AATTGAATTCATGCACTCGCAGAAGCGCGTC-3 ) and DaoR-Xbal-F (5 - AATTTCTAGACTACAACTTCGACTCCCGCGCC-3 ) introducing restriction sites for EcoRI and XbaI. The PCR-fragment was cloned into the EcoRI/XbaI sites of pgreen-t35 to create the vector pgreen-dao1:t35. Subsequently, 853 bp of the promoter region of the PAMPresponsive gene At1g51850 were amplified using primers At1g51850promF-Clal (5 - AATTATCGATATGTGATTTTATGGGAAAGCAATCTTGTT-3 ) and At1g51850promR-E5 (5 -AATTGATATCTGTTCTCCTTACTGTCCACAGGAGAGC-3 ) and cloned into the ClaI and HindIII sites of pgreen-dao1:t35, fusing the promoter to the dao1 coding sequence. The construct together with helper plasmid psoup were transformed into Agrobacterium tumefaciens GV3101 pmp90 via electroporation. Arabidopsis thaliana Columbia-0 plants were transformed using the floral dip method described and transformed seedlings were selected after BASTA selection. Homozygous line containing a single copy of the dao1-cassette was selected based on segregation on BASTA-containing half-strength MS medium and southern blot analysis. For Southern blot analysis, genomic DNA was digested with EcoRV and probed with the dao1-fragment obtained via PCR from prlm208qcz using primers DaoF-EcoRI-F and DaoR-Xbal-F. 16
17 Almeida J, Azevedo MdS, Spicher L, Glauser G, vom Dorp K, Guyer L, Carranza AdV, Asis R, de Souza AP, Buckeridge M et al Down-regulation of tomato PHYTOL KINASE strongly impairs tocopherol biosynthesis and affects prenyllipid metabolism in an organ-specific manner. Journal of Experimental Botany 67: Dwiyanti MS, Yamada T, Sato M, Abe J, Kitamura K Genetic variation of tocopherol methyltransferase gene contributes to elevated -tocopherol content in soybean seeds. BMC Plant Biology 11: Fritsche S, Wang X, Li J, Stich B, Kopisch-Obuch FJ, Endrigkeit J, Leckband G, Dreyer F, Friedt W, Meng J et al A candidate gene-based association study of tocopherol content and composition in rapeseed (Brassica napus). Frontiers in Plant Science 3:129. Gilliland LU, Magallanes-Lundback M, Hemming C, Supplee A, Koornneef M, Bentsink L, DellaPenna D Genetic basis for natural variation in seed vitamin E levels in Arabidopsis thaliana. Proceedings of the National Academy of Sciences U.S.A. 103: Hass CG, Tang S, Leonard S, Traber MG, Miller JF, Knapp SJ Three nonallelic epistatically interacting methyltransferase mutations produce novel tocopherol (vitamin E) profiles in sunflower. Theoretical and Applied Genetics 113: Li Q, Yang X, Xu S, Cai Y, Zhang D, Han Y, Li L, Zhang Z, Gao S, Li J et al Genome-wide association studies identified three independent polymorphisms associated with -tocopherol content in maize kernels. PLoS ONE 7:e Lipka AE, Gore MA, Magallanes-Lundback M, Mesberg A, Lin H, Tiede T, Chen C, Buell CR, Buckler ES, Rocheford T et al Genome-wide association study and pathway-level analysis of tocochromanol levels in maize grain. G3 Genes Genomes Genetics 3: Marwede V, Gül MK, Becker HC, Ecke W Mapping of QTL controlling tocopherol content in winter oilseed rape. Plant Breeding 124:
30s 56 60s 72 60s dntp cm s s s 23
31 3 Vol 31 No 3 2012 8 JOURNAL OF OCEANOGRAPHY IN TAIWAN STRAIT Aug 2012 AFLP 1 1 2 1 1 361005 2 361005 dntp Taq Mg 2 + 300 ng DNA 5U PstI 5U MseI 4 h 16 10 50 AFLP AFLP 64 12 AFLP DOI 10 3969 /J ISSN
D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical and experimental study
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical
Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene
2001, 24 (1) : 2529 Journal of Nanjing Agricultural University rolc (, 210095) :, rolc ( Nicotiana tabacum ), GUS, PCR Southern rolc,, rolc : ; ; rolc ; : S572103513 : A : 1000Ο2030 (2001) 01Ο0025Ο05 Study
Electronic Supplementary Information
Electronic Supplementary Information Unprecedented Carbon-Carbon Bond Cleavage in Nucleophilic Aziridine Ring Opening Reaction, Efficient Ring Transformation of Aziridines to Imidazolidin-4-ones Jin-Yuan
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to facilitate intracellular survival Hongwei Gu 1,2*, Chihao Zhao 1,2*, Tianfu Zhang 1,2*, Hongwei Liang 1,2, Xiao-Ming Wang 1,
Νόσος Parkinson-Νέοι ορίζοντες Ξηροµερήσιου Γεωργία Νευρολόγος-Μέλος ερευνητικής οµάδας Νευρογενετικής Αίτια της νόσου Parkinson Περιβαλλοντικοί παράγοντες Γενετικοί παράγοντες Γενετική βλάβη (παθογόνα
Composition Analysis of Protein and Oil and Amino Acids of the Soybean Varieties in Heilongjiang Province of China
29 4 2003 7 551 556 ACTA AGRONOMICA SINICA Vol. 29, No. 4 pp. 551 556 July, 2003 (, 150030) 62,, ;,, 19 3, 9 6, Ξ, ; ; ; : S565 : A Composition Analysis of Protein and Oil and Amino Acids of the Soybean
Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic
Supplementary Information
Electronic upplementary Material (EI) for Photochemical & Photobiological ciences. This journal is The Royal ociety of Chemistry and wner ocieties 214 upplementary Information elective and sensitive fluorescence-shift
Η ΤΟΞΙΚΟΤΗΤΑ ΤΟΥ ΒΟΡΙΟΥ(B) ΣΤΗΝ ΚΑΛΛΙΕΡΓΕΙΑ ΤΗΣ ΤΟΜΑΤΑΣ
ΑΛΕΞΑΝΔΡΕΙΟ Τ.Ε.Ι. ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ ΚΑΙ ΔΙΑΤΡΟΦΗΣ ΤΜΗΜΑ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΕΡΓΑΣΤΗΡΙΟ ΑΝΑΤΟΜΙΑΣ ΚΑΙ ΦΥΣΙΟΛΟΓΙΑΣ ΦΥΤΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Η ΤΟΞΙΚΟΤΗΤΑ ΤΟΥ ΒΟΡΙΟΥ(B)
ΠΟΛΥΤΕΧΝΕΙΟ ΚΡΗΤΗΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΕΡΙΒΑΛΛΟΝΤΟΣ
ΠΟΛΥΤΕΧΝΕΙΟ ΚΡΗΤΗΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΕΡΙΒΑΛΛΟΝΤΟΣ Τομέας Περιβαλλοντικής Υδραυλικής και Γεωπεριβαλλοντικής Μηχανικής (III) Εργαστήριο Γεωπεριβαλλοντικής Μηχανικής TECHNICAL UNIVERSITY OF CRETE SCHOOL of
TABLE OF CONTENTS Page
TABLE OF CONTENTS Page Acknowledgements... VI Declaration... VII List of abbreviations... VIII 1. INTRODUCTION... 1 2. BASIC PRINCIPLES... 3 2.1. Hereditary Colorectal Cancer... 3 2.1.1. Differential diagnosis...
Supporting Information
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Supporting Information Crotonols A and B, Two Rare Tigliane Diterpenoid
Identification of Fish Species using DNA Method
5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,
Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού
Σχολή Θετικών Επιστημών Τμήμα Βιολογίας Πρόγραμμα Μεταπτυχιακών Σπουδών Κατεύθυνση: Εφαρμοσμένη γενετική και βιοτεχνολογία ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου
Floral dip Transformation of EXPA1 to Arabidopsis thaliana
Crop Biotech. Vol.2, No. 2, Spring and Summer 2012 (39-47) 1391 $%" &#!!" # EXPA1 3 2 1 5 / 6. 1 *./01 2 1 3 '()!* + *,)!" #$% &' () 2 1 2 /0 1 ' -'!",.),+ (90/12/2 :;: 4-90/11/1 :/2 4)!+ 3 Floral dip
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΙΑΤΡΙΚΗ ΣΧΟΛΗ. ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥ ΩΝ «Ιατρική Ερευνητική Μεθοδολογία» ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΙΑΤΡΙΚΗ ΣΧΟΛΗ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥ ΩΝ «Ιατρική Ερευνητική Μεθοδολογία» ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Νόσος Pompe: Νεότερα κλινικά, γενετικά, διαγνωστικά και θεραπευτικά
ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ
ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ Τμήμα Επιστήμης Φυτικής Παραγωγής Π.Μ.Σ Φυτά Μεγάλης Καλλιέργειας και Βελτίωσης Φυτών Επίδραση της οργανικής λίπανσης στην ζιζανιοχλωρίδα και στην αλληλοπάθεια του Chenopodium
SOD SNP % Cu /Zn-SOD. DAM- BE DNAStar % Mn /Fe-SOD. 6 1SNP /17. 9 bp
2011 33 6 1206-1211 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com SOD SNP 1 2 3 2 2* 1. 330004 2. 330004 3. 510006 GenBank Cu /Zn-SOD Mn /Fe-SOD
CorV CVAC. CorV TU317. 1
30 8 JOURNAL OF VIBRATION AND SHOCK Vol. 30 No. 8 2011 1 2 1 2 2 1. 100044 2. 361005 TU317. 1 A Structural damage detection method based on correlation function analysis of vibration measurement data LEI
Study on the Solubility of Kiwi Fruit Seed Oil in Supercritical Carbon Dioxide
2007,40(6):1242-1247 Scientia Agricultura Sinica 1 210037 2 712100 3 510641 4 750006 Study on the Solubility of Kiwi Fruit Seed Oil in Supercritical Carbon Dioxide WU Cai-e 1,2, XU Ke-yong 3, LI Yuan-rui
Copper-Catalyzed Oxidative Dehydrogenative N-N Bond. Formation for the Synthesis of N,N -Diarylindazol-3-ones
Electronic Supplementary Material (ESI) for Organic Chemistry Frontiers. This journal is the Partner Organisations 2016 Supporting information Copper-Catalyzed Oxidative Dehydrogenative - Bond Formation
Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2015 Supporting information An unusual bifunctional Tb-MOF for highly sensing
Differences in Contents of Neutral Aroma Components and Sensory Evaluation in Air-cured Burley Leaves from Different Curing Barns
2 0 1 0 25 3 1 13-1 1 7 1 2 2 1 1 2 2 1. 450002 2. 635000 6 > > > > > > > > > > > > > > > S572 A 1000-7091 2010 03-0113 - 05 Differences in Contents of Neutral Aroma Components and Sensory Evaluation in
Supplementary information:
Supplementary information: Monitoring changes of docosahexaenoic acid-containing lipids during the recovery process of traumatic brain injury in rat using mass spectrometry imaging Shuai Guo 1, Dan Zhou
Vol. 31,No JOURNAL OF CHINA UNIVERSITY OF SCIENCE AND TECHNOLOGY Feb
Ξ 31 Vol 31,No 1 2 0 0 1 2 JOURNAL OF CHINA UNIVERSITY OF SCIENCE AND TECHNOLOGY Feb 2 0 0 1 :025322778 (2001) 0120016205 (, 230026) : Q ( m 1, m 2,, m n ) k = m 1 + m 2 + + m n - n : Q ( m 1, m 2,, m
Metal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supporting information for Metal-free Oxidative Coupling of Amines with Sodium Sulfinates:
A new ent-kaurane diterpene from Euphorbia stracheyi Boiss
SUPPLEMENTARY MATERIAL A new ent-kaurane diterpene from Euphorbia stracheyi Boiss Tie Liu a, Qian Liang a,b, Na-Na Xiong a, Lin-Feng Dai a, Jun-Ming Wang a,b, Xiao-Hui Ji c, Wen-Hui Xu a, * a Key Laboratory
ΜΕΤΑΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ :
ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ «ΕΠΙΣΤΗΜΗ & ΤΕΧΝΟΛΟΓΙΑ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗ ΤΟΥ ΑΝΘΡΩΠΟΥ» ΕΡΓΑΣΤΗΡΙΟ: ΧΗΜΕΙΑΣ ΚΑΙ ΑΝΑΛΥΣΗΣ ΤΡΟΦΙΜΩΝ
A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
SUPPORTING INFORMATION
SUPPORTING INFORMATION Trichodermides A E: New Peptaibols isolated from Australian Termite Nestderived Fungus Trichoderma virens CMB-TN16 Wei-Hua Jiao,, Zeinab Khalil, Pradeep Dewapriya, Angela A. Salim,
ΜΕΛΕΤΗ ΤΩΝ ΣΥΝΘΗΚΩΝ ΕΚΧΥΛΙΣΗΣ ΦΑΙΝΟΛΙΚΩΝ ΣΥΣΤΑΤΙΚΩΝ ΑΠΟ ΤΟ ΦΥΤΟ Sideritis raeseri ΜΕ ΤΗ ΧΡΗΣΗ ΜΙΚΡΟΚΥΜΑΤΩΝ
ΜΕΛΕΤΗ ΤΩΝ ΣΥΝΘΗΚΩΝ ΕΚΧΥΛΙΣΗΣ ΦΑΙΝΟΛΙΚΩΝ ΣΥΣΤΑΤΙΚΩΝ ΑΠΟ ΤΟ ΦΥΤΟ Sideritis raeseri ΜΕ ΤΗ ΧΡΗΣΗ ΜΙΚΡΟΚΥΜΑΤΩΝ Ι. Σαρακατσιάνος 1,2, Κ. Αδαμόπουλος 1, Β. Σαμανίδου 3, Α. Γούλα 4 1. Εργαστήριο Τεχνολογίας Βιομηχανιών
Electronic Supplementary Information
Electronic Supplementary Information NbCl 3 -catalyzed [2+2+2] intermolecular cycloaddition of alkynes and alkenes to 1,3-cyclohexadiene derivatives Yasushi Obora,* Keisuke Takeshita and Yasutaka Ishii*
Αξιολόγηση των Φασματικού Διαχωρισμού στην Διάκριση Διαφορετικών Τύπων Εδάφους ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ. Σπίγγος Γεώργιος
ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΤΜΗΜΑ ΑΓΡΟΝΟΜΩΝ ΤΟΠΟΓΡΑΦΩΝ ΜΗΧΑΝΙΚΩΝ ΤΟΜΕΑΣ ΤΟΠΟΓΡΑΦΙΑΣ-ΕΡΓΑΣΤΗΡΙΟ ΤΗΛΕΠΙΣΚΟΠΗΣΗΣ Αξιολόγηση των Φασματικού Διαχωρισμού στην Διάκριση Διαφορετικών Τύπων Εδάφους ΔΙΠΛΩΜΑΤΙΚΗ
Divergent synthesis of various iminocyclitols from D-ribose
Electronic Supplementary Material (ESI) for rganic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 205 Divergent synthesis of various iminocyclitols from D-ribose Ramu Petakamsetty,
Διάλεξη 4. Γενετικά τροποποιημένοι οργανιςμοί. (Κ. Ματθιόπουλοσ)
Διάλεξη 4 Γενετικά τροποποιημένοι οργανιςμοί (Κ. Ματθιόπουλοσ) Μοριακή Οικολογία και Γενετικά Τροποποιημένοι Οργανισμοί (GMOs) Λίγη Ιστορία E. coli K12 (1970). No disasters attributed to cloning experiments.
, DYY-8B, ; : Centrifuge 11 R. min
40 Chinese Journal of Otology Vol. 8 No.1 2010 DNA A1555G - ( 030001) 2 12 68 DNA (polymerase chain reaction PCR) DNA A1555G 7 DNA 12S rrna 1555 A G A1555G ; DNA A1555G ; ; ; R764.433 R342.4 A 1672-2922(2010)01-040-06
Systematic Analysis of Candidate Genes for Alzheimer s Disease in a French, Genome-Wide Association Study
Journal of Alzheimer s Disease 20 (2010) 1 13 1 IOS Press Supplementary Material Systematic Analysis of Candidate Genes for Alzheimer s Disease in a French, Genome-Wide Association Study Geoffroy Laumet
Supporting Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Synthesis of 3-omosubstituted Pyrroles via Palladium- Catalyzed Intermolecular Oxidative Cyclization
Supporting Information
Supporting Information Lewis acid catalyzed ring-opening reactions of methylenecyclopropanes with diphenylphosphine oxide in the presence of sulfur or selenium Min Shi,* Min Jiang and Le-Ping Liu State
Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo
Bull. Earthq. Res. Inst. Univ. Tokyo Vol. 2.,**3 pp.,,3,.* * +, -. +, -. Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Kunihiko Shimazaki *, Tsuyoshi Haraguchi, Takeo Ishibe +, -.
1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.
2 0 1 5 7 Journal of Chinese Institute of Food Science and Technology Vol. 15 No. 7 Jul. 2 0 1 5 1,2 1 1 1 1* ( 1 315211 2 315502) : ( ) : (E-Nose), - : GC-MS, 20.98% 2.5%, 53.15% 11.2%, 0. 51% 71.86%
Single-site association results for 136 SCARB1 genotyped variants with HDL-C.
Table S9. Single-site association results for 136 SCARB1 genotyped variants with HDL-C. SNP Name a SNP ID b Chr12 Position c Location Amino Acid Change RegDB Score d MA, MAF Genotype Genotype Count Adjusted
PCR. Site-directed Mutagenesis of Sumf 1 Gene of Mouse Based on Overlap Extension PCR and Construction of Eukaryotic Expression Vector
13 5 Vol13 No5 9 10 Life Science Research Oct 9 9 PCR Sumf1 *,,,,, 481 : (chromatin immunoprecipitation assay, ChIP) activator protein-2 alpha (AP-2 α) Sumf 1 PCR, AP-2 α Sumf 1, DNA, Sumf 1 103 ~111,
Q L -BFGS. Method of Q through full waveform inversion based on L -BFGS algorithm. SUN Hui-qiu HAN Li-guo XU Yang-yang GAO Han ZHOU Yan ZHANG Pan
3 2015 12 GLOBAL GEOLOGY Vol. 3 No. Dec. 2015 100 5589 2015 0 1106 07 L BFGS Q 130026 Q 2D L BFGS Marmousi Q L BFGS P631. 3 A doi 10. 3969 /j. issn. 1005589. 2015. 0. 02 Method of Q through full waveform
JEV C RNA 11kb 3. Japanese encephalitis virus JEV JEV C 7. C E prm C 1 RNA. Gold pgbkt7 pgadt7- T pgbkt7-53 pgbkt7- JEV C PCR JEV C cdna
2012 12 4 CHINA TROPICAL MEDICINE Vol.12 No.4 April 2012 427 * JEV C PCR JEV C cdna pgbkt7 EcoRI/BamHI PEG/LiAc pgbkt7- JC pgbkt7 Gold Western- blotting BD- JC pgbkt7- JC Genebank JEV SA14-14- 2 JEV C
Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic
Supporting Information Asymmetric Binary-acid Catalysis with Chiral Phosphoric Acid and MgF 2 : Catalytic Enantioselective Friedel-Crafts Reactions of β,γ- Unsaturated-α-Ketoesters Jian Lv, Xin Li, Long
THE GENETIC TRANSFORMATION OF STRAWBERRY WITH WINTER FLOUNDER ANTIFREEZE PROTEIN GENE
2009,23 (3) :423 428 Journal of Nuclear Agricultural Sciences 423 :100028551 (2009) 032423206 1 2 1 3 3 1 4 (11, 010031 ;21, 010021 ; 31, 010010 ;41, 010070) : 2, pre pro mature 3 (AFP), 7 Km PCR PCR2Southern,6,,
Διπλωματική Εργασία. Μελέτη των μηχανικών ιδιοτήτων των stents που χρησιμοποιούνται στην Ιατρική. Αντωνίου Φάνης
Διπλωματική Εργασία Μελέτη των μηχανικών ιδιοτήτων των stents που χρησιμοποιούνται στην Ιατρική Αντωνίου Φάνης Επιβλέπουσες: Θεοδώρα Παπαδοπούλου, Ομότιμη Καθηγήτρια ΕΜΠ Ζάννη-Βλαστού Ρόζα, Καθηγήτρια
Iodine-catalyzed synthesis of sulfur-bridged enaminones and chromones via double C(sp 2 )-H thiolation
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2017 Iodine-catalyzed synthesis of sulfur-bridged enaminones and chromones via
ΠΣΤΥΙΑΚΗ ΔΡΓΑΙΑ. Μειέηε Υξόλνπ Απνζηείξσζεο Κνλζέξβαο κε Τπνινγηζηηθή Ρεπζηνδπλακηθή. Αζαλαζηάδνπ Βαξβάξα
ΣΔΥΝΟΛΟΓΙΚΟ ΔΚΠΑΙΓΔΤΣΙΚΟ ΙΓΡΤΜΑ ΘΔΑΛΟΝΙΚΗ ΥΟΛΗ ΣΔΥΝΟΛΟΓΙΑ ΣΡΟΦΙΜΩΝ & ΓΙΑΣΡΟΦΗ ΣΜΗΜΑ ΣΔΥΝΟΛΟΓΙΑ ΣΡΟΦΙΜΩΝ ΠΣΤΥΙΑΚΗ ΔΡΓΑΙΑ Μειέηε Υξόλνπ Απνζηείξσζεο Κνλζέξβαο κε Τπνινγηζηηθή Ρεπζηνδπλακηθή Αζαλαζηάδνπ Βαξβάξα
DNA G7444A, 2. Study on a new point mutation of nt7444 G A in the mitochondrial DNA in a type 2 diabetes mellitus family
HEREDITAS (Beijing) 2007 4, 29(4): 433 437 ISSN 0253-9772 www.chinagene.cn DOI: 10.1360/yc-007-0433 2 DNA G7444A,,,,,,,, 350005 : PCR-RFLP 2 DNA G7444A,, 27, 11 DNA G7444A, 11 2 5, 1,, DNA G7444A, 2 :
Electronic Supplementary Information
Electronic Supplementary Information The preferred all-gauche conformations in 3-fluoro-1,2-propanediol Laize A. F. Andrade, a Josué M. Silla, a Claudimar J. Duarte, b Roberto Rittner, b Matheus P. Freitas*,a
Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2
Free Radical Initiated Coupling Reaction of Alcohols and Alkynes: not C-O but C-C Bond Formation Zhongquan Liu,* Liang Sun, Jianguo Wang, Jie Han, Yankai Zhao, Bo Zhou Institute of Organic Chemistry, Gannan
DEIM Forum 2014 A8-1, 606 8501 E-mail: {tsukuda,ohshima,kato,tanaka}@dl.kuis.kyoto-u.ac.jp 1 2,, 1. Google 1 Yahoo 2 Bing 3 Web Web BM25 [1] HITS [2] PageRank [3] Web 1 [4] 1http://www.google.com 2http://www.yahoo.com
ΠΕΡΙΛΗΨΗ. Λέξεις κλειδιά: Υγεία και συμπεριφορές υγείας, χρήση, ψυχότροπες ουσίες, κοινωνικό κεφάλαιο.
Α.Τ.Ε.Ι. ΚΡΗΤΗΣ Σ.Ε.Υ.Π. ΤΜΗΜΑ ΚΟΙΝΩΝΙΚΗΣ ΕΡΓΑΣΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Τίτλος: «Χρήση ψυχοτρόπων ουσιών από μαθητές Α Λυκείου της Δευτεροβάθμιας Εκπαίδευσης του Νομού Ηρακλείου και ο ρόλος του Κοινωνικού
Τ.Ε.Ι. ΔΥΤΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ ΠΑΡΑΡΤΗΜΑ ΚΑΣΤΟΡΙΑΣ ΤΜΗΜΑ ΔΗΜΟΣΙΩΝ ΣΧΕΣΕΩΝ & ΕΠΙΚΟΙΝΩΝΙΑΣ
Τ.Ε.Ι. ΔΥΤΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ ΠΑΡΑΡΤΗΜΑ ΚΑΣΤΟΡΙΑΣ ΤΜΗΜΑ ΔΗΜΟΣΙΩΝ ΣΧΕΣΕΩΝ & ΕΠΙΚΟΙΝΩΝΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Η προβολή επιστημονικών θεμάτων από τα ελληνικά ΜΜΕ : Η κάλυψή τους στον ελληνικό ημερήσιο τύπο Σαραλιώτου
Journal of Ningxia Medical University BRCA2. M2610I 2405 delt stp ± t = P > %
33 6 2011 6 Journal of Ningxia Medical University 515 1674-6309 2011 06-0515 - 04 16 BRCA2 1 2 2 1 3 1. 750004 2. 750021 3. 750004 16-2 BRCA2 16 16 30 PCR BRCA2 16 3 18. 75% 2 M2610I 2405 delt stp729 1
N 2 O 15 N NH + NH 3 Rittenberg mg mmol L - 1 CuSO mg. 10 mol L. Pre-Concentration device PreCon
50 1 Vol. 50 No. 1 2013 1 ACTA PEDOLOGICA SINICA Jan. 2013 N 2 O * N 210008 N 2 O N 2 O N N 2 O N N 5 ~ 20 μg N N 2 O N S8. 3 A N N 2 O N N N NO - 3 NO - 2 N N N MgO NH 3 Rittenberg 1 Dumas N 1 2 N N 2
,,, (, 100875) 1989 12 25 1990 2 23, - 2-4 ;,,, ; -
25 3 2003 5 RESOURCES SCIENCE Vol. 25 No. 3 May 2003 ( 100875) : 500L - 2-4 - 6-8 - 10 114h - 120h 6h 1989 12 25 1990 2 23-2 - 4 : ; ; - 4 1186cm d - 1 10cm 514d ; : 714 13 317 714 119 317 : ; ; ; :P731
Βιταμίνη D και υστηματικός Ερυθηματώδης Λύκος
Βιταμίνη D και υστηματικός Ερυθηματώδης Λύκος ΛΑΜΠΡΟς ΑΘΑΝΑΙΟΤ ΕΙΔΙΚΕΤΟΜΕΝΟς ΠΑΘΟΛΟΓΙΑς, ΓΝ ΑΚΛΗΠΙΕΙΟ ΒΟΤΛΑς 10 Ο ΕΣΗΙΟ ΤΝΕΔΡΙΟ ΕΠΕΜΤ ΠΟΡΣΟ ΧΕΛΙ 4 2018 Εισαγωγή Ο συστηματικός ερυθηματώδης λύκος (ΕΛ) είναι
Computational study of the structure, UV-vis absorption spectra and conductivity of biphenylene-based polymers and their boron nitride analogues
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 Computational study of the structure, UV-vis absorption spectra and conductivity of biphenylene-based
Aus dem Institut für Pflanzenzüchtung und Pflanzenschutz
Aus dem Institut für Pflanzenzüchtung und Pflanzenschutz Advanced Backcross QTL analysis and genetic study of an introgressed powdery-mildew resistance gene derived from Avena macrostachya in oat (Avena
SCIENTIA SILVAE SINICAE. a/ b. oldhamii). The length of cab2bo1 ( GenBank accession
43 3 2 0 0 7 3 SCIENTIA SILVAE SINICAE Vol143, No13 Mar., 2 0 0 7 a/ b 3 1 1 2 1 (1. 100102 ; 2. 100091) : RT2PCR RACE a/ b cdna, cab2 BO1 ( GenBank : EF061137) 1 102 bp, 64 861 bp 1, 265 cab2bo1 64 232
Na/K (mole) A/CNK
Li, W.-C., Chen, R.-X., Zheng, Y.-F., Tang, H., and Hu, Z., 206, Two episodes of partial melting in ultrahigh-pressure migmatites from deeply subducted continental crust in the Sulu orogen, China: GSA
In vitro και in vivo φαρμακοκινητική ανάλυση των παραγώγων ανθρακινόνης σε φυτικά σκευάσματα
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΤΜΗΜΑ ΦΑΡΜΑΚΕΥΤΙΚΗΣ ΤΟΜΕΑΣ ΦΑΡΜΑΚΟΓΝΩΣΙΑΣ ΦΑΡΜΑΚΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΚΑΤΕΥΘΥΝΣΗ ΦΑΡΜΑΚΟΛΟΓΙΑ ΚΑΙ ΘΕΡΑΠΕΥΤΙΚΗ In vitro και in vivo φαρμακοκινητική
Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica
35 1 2 0 1 7 1 DOI 10. 13193 /j. issn. 1673-7717. 2017. 01. 035 1 1 1 1 2 1. 150036 2. 150040 D101 DEAE Cellulose 52 Sephacryl S - 300 - - PJP - 1a PJP - 3a 1. 34 10 3 Da 1. 70 10 7 Da - PJP - 3a 4. 56
Quantitative chemical analyses of rocks with X-ray fluorescence analyzer: major and trace elements in ultrabasic rocks
98 Scientific Note X : Quantitative chemical analyses of rocks with X-ray fluorescence analyzer: major and trace elements in ultrabasic rocks Kimiko Seno and Yoichi Motoyoshi,**- +, +, ;,**. -,/ Abstract:
Table of Contents 1 Supplementary Data MCD
Electronic Supplementary Material (ESI) for Dalton Transactions. This journal is The Royal Society of Chemistry 2017 Supporting Information for Magnetic circular dichroism and density functional theory
Rhodium-Catalyzed Oxidative Decarbonylative Heck-type Coupling of Aromatic Aldehydes with Terminal Alkenes
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information Rhodium-Catalyzed Oxidative Decarbonylative Heck-type
A strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines
1 2 Supplementary information 3 4 A strategy for the identification of combinatorial bioactive compounds contributing to the holistic effect of herbal medicines 5 6 Fang Long 1, Hua Yang 1, Yanmin Xu,
ER-Tree (Extended R*-Tree)
1-9825/22/13(4)768-6 22 Journal of Software Vol13, No4 1, 1, 2, 1 1, 1 (, 2327) 2 (, 3127) E-mail xhzhou@ustceducn,,,,,,, 1, TP311 A,,,, Elias s Rivest,Cleary Arya Mount [1] O(2 d ) Arya Mount [1] Friedman,Bentley
Bishwajit Saikia*, Preeti Rekha Boruah, Abdul Aziz Ali and Diganta Sarma. Contents
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2015 Supporting Information On-water organic synthesis: A green, highly efficient, low cost and
Landscape of genomic diversity and trait discovery in soybean
Landscape of genomic diversity and trait discovery in soybean Babu Valliyodan 1*, Dan Qiu 1*, Gunvant Patil 1*, Peng Zeng 2*, Jiaying Huang 2*, Lu Dai 2*, Chengxuan Chen 2*, Yanjun Li 2, Trupti Joshi 3,4,
No. 7 Modular Machine Tool & Automatic Manufacturing Technique. Jul TH166 TG659 A
7 2016 7 No. 7 Modular Machine Tool & Automatic Manufacturing Technique Jul. 2016 1001-2265 2016 07-0122 - 05 DOI 10. 13462 /j. cnki. mmtamt. 2016. 07. 035 * 100124 TH166 TG659 A Precision Modeling and
Malgorzata Korycka-Machala, Marcin Nowosielski, Aneta Kuron, Sebastian Rykowski, Agnieszka Olejniczak, Marcin Hoffmann and Jaroslaw Dziadek
Molecules 2017, 21, 154; doi:10.3390/molecules22010154 Supplementary Materials: Naphthalimides Selectively Inhibit the Activity of Bacterial, Replicative DNA Ligases and Display Bactericidal Effect against
* ** *** *** Jun S HIMADA*, Kyoko O HSUMI**, Kazuhiko O HBA*** and Atsushi M ARUYAMA***
J. Jpn. Soc. Soil Phys. No. +*2, p. +3,2,**2 * ** *** *** Influence Area of Stem Flow on a Soil of Deciduous Forest Floor by Electric Resistivity Survey and the Evaluation of Groundwater Recharge through
Supporting Information. Research Center for Marine Drugs, Department of Pharmacy, State Key Laboratory
Supporting Information Dysiherbols A C and Dysideanone E, Cytotoxic and NF-κB Inhibitory Tetracyclic Meroterpenes from a Dysidea sp. Marine Sponge Wei-Hua Jiao,, Guo-Hua Shi,, Ting-Ting Xu,, Guo-Dong Chen,
svari Real-time RT-PCR RSV
19 39-43 12 Real-time RS svarireal-time RSV subgroup HMPV RSV N Real-time 100 100 Real-time RSV subgroup RSV HMPV F Real-time 55.8 95.5 genotype A2 B1 TaqMan svari InfV RS RSV HMPV HRV PIV RSV HMPV RSV
Science of Sericulture
Science of Sericulture 2012 38 1 0065-0069 ISSN 0257-4799 CN 32-1115 /S E-mail CYKE@ chinajournal. net. cn 215123 25 0 ~ 24 h GSH GSSG GSH + 2GSSG GSH /GSSG S- GST TPX 23% GR 57% GSH TPX GST GSSG 61% GSH
Ρυθμιστές της Αύξησης των Φυτών BRs, )
Ρυθμιστές της Αύξησης των Φυτών BRs, ) 1 Πορεία παρουσίασης των Καθοριστικοί Σταθμοί BRs στην ανακάλυψη των ΒRs Δομή των κυριότερων ενδογενών μορφών Μεταβολισμός των BRs Βιοσύνθεση Διακίνηση Καταβολισμός
Archive of SID. نشانمند كردن ژنه يا برگرداننده باروري بوسيله تجزيه كلاس مغلوب در برنج چكيده مقدمه
نشانمند كردن ژنه يا برگرداننده باروري بوسيله تجزيه كلاس مغلوب در برنج (-), 4 3 2 1 ياراحمدي محمد مهدي سوهاني * ابوبكر جوهرعلي بابك ربيعي (// : -// : ) سعيد و ع يل 5 اكبر عبادي چكيده WA. IR42686R IR58025A
SUPPLEMENTARY MATERIAL
10.1071/CH16014_AC The Authors 2016 Australian Journal of Chemistry 2016, 69(9), 1049-1053 SUPPLEMENTARY MATERIAL A Green Approach for the Synthesis of Novel 7,11-Dihydro-6H-chromeno[3,4- e]isoxazolo[5,4-b]pyridin-6-one
The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea
2011 48 4 909 914 * 1 2** 2 2 2 2 2*** 1. 110161 2. 100081 026000 3 Calliptamus italicus L. 3 LC 50 LC 90 1. 34 14. 17 mg / L LC 50 LC 90 2. 09 45. 22 mg / L 50 mg / L 14 d 87% 100% 50 mg / L 50% The toxicity
ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ
ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ Μοριακοί Δείκτες Επιμέλεια διαφανειών Τραντάς Μάνος 1 Μοριακοί Δείκτες είναι αλληλουχίες DNA (ή πρωτεϊνών) που μπορούν να συσχετιστούν με συγκεκριμένα χαρακτηριστικά ώστε να ανιχνευτούν
Σχέση µεταξύ της Μεθόδου των ερµατοπτυχών και της Βιοηλεκτρικής Αντίστασης στον Υπολογισµό του Ποσοστού Σωµατικού Λίπους
Ερευνητική Aναζητήσεις στη Φυσική Αγωγή & τον Αθλητισµότόµος 1(3), 244 251 ηµοσιεύτηκε: 2 8 εκεµβρίου 2003 Inquiries in Sport & Physical Education Volume 1(3), 244 251 Released: December 28, 2003 www.hape.gr/emag.asp
SUPPLEMENTAL INFORMATION. Fully Automated Total Metals and Chromium Speciation Single Platform Introduction System for ICP-MS
Electronic Supplementary Material (ESI) for Journal of Analytical Atomic Spectrometry. This journal is The Royal Society of Chemistry 2018 SUPPLEMENTAL INFORMATION Fully Automated Total Metals and Chromium
Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk
32 3 2011 3 ENVIRONMENTAL SCIENCE Vol 32 No 3 Mar 2011 1 1 1 2 1 100101 2 663000 Panax notoginseng Burk F H Chen 6 9 ~ 242 0 mg kg - 1 48% 2 mg kg - 1 24% 81% 14% 57% 44% 100 mg kg - 1 ADI > > > > FAO
HPLC- ESI-MS HPLC-ESI-MS HPLC-ESI-MS HPLC 11 HPLC HPLC-ESI-MS. Asterias rollestoni Bell. LC- MS. Vol.11 No.1
HPLC- ESI-MS * 200 Vol.11 No.1 ** 266061 266061 361005 266003 - HPLC-ESI-MS HPLC-ESI-MS HPLC HPLC-ESI-MS 11 HPLC - Asterias rollestoni Bell. [1~7] [1] [5~7] - - [8~] LC- MS * ** 173 2008-11-04 200-01-06
Supporting Information One-Pot Approach to Chiral Chromenes via Enantioselective Organocatalytic Domino Oxa-Michael-Aldol Reaction
Supporting Information ne-pot Approach to Chiral Chromenes via Enantioselective rganocatalytic Domino xa-michael-aldol Reaction Hao Li, Jian Wang, Timiyin E-Nunu, Liansuo Zu, Wei Jiang, Shaohua Wei, *
DNA, , DNA, 1 D NA . DNA
29 6 2005 11 ( ) Journal of Hebei Normal University (Natural Science Edition) Vol. 29 No. 6 Nov. 2005 Ξ DNA 1, 1, 1,2, 1, 1 (1., 050016 ; 2., 053000) :DNA. RFL P,RAPD,AFL P,DNA DNA,.,,. :DNA ; ; ; DNA
Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin
2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,
Direct Palladium-Catalyzed Arylations of Aryl Bromides. with 2/9-Substituted Pyrimido[5,4-b]indolizines
Direct Palladium-Catalyzed Arylations of Aryl Bromides with 2/9-Substituted Pyrimido[5,4-b]indolizines Min Jiang, Ting Li, Linghua Meng, Chunhao Yang,* Yuyuan Xie*, and Jian Ding State Key Laboratory of
ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ
- - ό ό : Ω ί ό ί ώ.. ά ή ί ός ή ς ύ ί ί ή έ ώ ό. ή ς ά ς ής ό ός ά ς ή έ ός ή ς ί ής ί ς. ό έ ώ - ώ ή ής ή ς- ί ά ά ς ί ς. ά ί ί έ έ ά ύ ή, ό ί ά, ό ό ά έ ά ής ί ύ George Wald ή ί έ ς ί ύ ό ς ί ς ά έ
Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology
2012 34 2 382-387 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com 212018 105 W 42 2 min 0. 631 TS202. 3 A 1000-2286 2012 02-0382 - 06 Optimizing
psl1 , 90%~95%. (Oryza sativa L) *,
51 20 2006 10 psl1 * * (,, 225009. *, E-mail: ricegb@yzu.edu.cn).. 11 Co 60 6 11 F 1 F 2,., psl1, SSR psl1 2., 34 STS, psl1., psl1 BAC, 48 kb,. (Oryza sativa L), 90%~95%.,.,, [1,2].,., [3]., 1 d, 2%, 1%
RAPD. ( B rassica rapa) RFL P ( Restriction Fragment Length Polymorphism) RFL P ; RFL P, rapa. CHIN ESE BIODIV ERSIT Y 6 (2) :99 104, May, 1998 RAPD
6,2,1998 5 CHIN ESE BIODIV ERSIT Y 6 (2) :99104, May, 1998 Ξ RAPD 1 1 2 1 1 2 1 (, 100081) 2 (, 430062) RAPD, 34,Ward s : ; ;DNA 34 8,, RAPD Genetic diversity among Chinese oilseed accessions of Brassica
ELECTRONIC SUPPORTING INFORMATION
ELECTRONIC SUPPORTING INFORMATION Spectroscopic signatures of the carbon buckyonions C 60 @C 180 and C 60 @C 240 : a dispersion-corrected DFT study. Girolamo Casella, a Alessandro Bagno a and Giacomo Saielli*
, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells
2011 9 1 77 SLC26A4 HEK 293 1 2 1 1 1 1 (100853) 2 ( 050051) SLC26A4 (pegfp enhanced green fluorescent protein) SLC26A4 pegfp-slc26a4 HEK293 pegfp-slc26a4 HEK293 - (RT-PCR) SLC26A4 mrna Western Blot (
Η ανάπτυξη της μορφολογικής επίγνωσης στα Ελληνικά: μία διερευνητική μελέτη
Η ανάπτυξη της μορφολογικής επίγνωσης στα Ελληνικά: μία διερευνητική μελέτη Σ. Παντελιάδου και Κ. Μ. Ρόθου ΠΤΕΑ, Πανεπιστήμιο Θεσσαλίας spadel@uth.gr και rothou@uth.gr Abstract: The present study explores