Microarray experiments and data analysis RNA from four independent biological replicates was isolated using the RNeasy Mini kit (Qiagen).

Transcript

1 Microarray experiments and data analysis RNA from four independent biological replicates was isolated using the RNeasy Mini kit (Qiagen). RNA was quantified with a NanoDrop ND-100 spectrophotometer (NanoDrop Technologies) and quality was verified with a 2100 Bioanalyzer from Agilent Technologies. RNA processing, hybridization of microarrays and scanning was performed as previously described (Adie et al, 2007). For toc1-2 analysis, we used the two-color Arabidopsis Oligonucleotide Microarrays with oligonucleotides of 70 mer (Qiagen-Operon, Arabidopsis Genome Array Ready Oligo Set [AROS] Version 3.0). Raw data was processed using the SOLAR software (BIOALMA). Briefly, global intensities were scaled and normalized using the LOWESS procedure (Yang et al, 2002). The absolute value of the t statistic and the local z-scores were calculated as previously described (Quackenbush, 2002; Yang et al, 2002). Selection of differentially expressed genes was performed based on three-fold criteria: p-value below 0.05, a z- score above 2 and a log ratio over The ATH1 Arabidopsis GeneChips (Affymetrix) were utilized for hybridization of WT (Col-0) and TOC1-ox samples. RNA from three independent biological replicates was isolated using the PureLink Total RNA Purification System (Invitrogen), quantified with a NanoDrop ND-100 spectrophotometer (NanoDrop Technologies) and examined with a 2100 Bioanalyzer from Agilent Technologies. Labeling, hybridization and scanning was performed following the manufacturer recommendations. Raw data were normalized with the GCRMA package (Wu et al, 2004) and the differentially-expressed genes were identified using the empirical Bayes moderated t statistics from the LIMMA package (Smyth & Speed, 2003). All data were processed using the Comprehensive R based Microarray Analysis web frontend ( (Rainer et al, 2006). Genes with a false discovery rate (FDR) <5% were selected as misregulated in TOC1-ox. For promoter cis-element identification and TOC1 misexpressed genes meta-analysis only genes with FDR<5% were used. Publicly available databases were used for functional clustering of mis-expressed genes ( Selected datasets included experiments of 3-hour treatments with the hormones ABA, gibberellic acid (GA3), 1-Aminocyclopropane-1-carboxylic Acid (ACC), indole acetic acid (IAA) and Zeatin (Zeat) (ME-00334, ME00344, ME00336, ME00333, ME00343) as well as dehydration experiments (Matsui et al, 2008). Hierarchical clustering with Euclidean distance and complete linkage was performed using the TIGR Multi experiment Viewer

2 (The Institute for Genomic Research, TIGR)(Saeed et al, 2003). Significant enrichments of promoter elements within the 1000bp upstream from the ATG of the mis-regulated genes were identified using the Athena software (O'Connor et al, 2005) ( and the SCOPE suite (Carlson et al., 2007) ( Phase enrichment was analyzed using the PHASER plot web tool ( Meta-analysis and transcriptional crosstalk was performed by using publicly available datasets including: Circadian: (Covington et al, 2008), (Hazen et al, 2009); Hormone: (Nemhauser et al, 2006),(Matsui et al, 2008) ion/atgenexpress.jsp, and droughtrelated datasets (Matsui et al, 2008). The percentages of overlapping genes in different arrays were calculated taking into account the differences in the number of probes amongst the various arrays. Definitions and details of microarray analysis and labels of Supplementary Tables The SOLAR package analyses microarray data by scaling the global intensities and normalizing by the Lowess curve to correct the deviation of the M values. From each gene, normalized M (log Ratios) and A (log gene signals) values are averaged over all correct spot measures. Mean M: mean of the M values obtained from the replicates. The M values are the log differential expression ratios obtained directly by the detected intensities: M=log 2 (R/G) Where R and G are the red and green intensities corresponding to the expression level in toc1-2 and control, respectively. SD M: standard deviation of M values obtained from the replicates. z-score: the number of standard deviations that the gene is far away from the mean of the spots cloud. This value is calculated locally for each intensity range as: Z i =(M i /s n )

3 Where Z i is the local Z-score for the gene i, M i is the M value for the gene i and s n is the standard deviation of M calculated among the n genes with A values nearest to i. A is the log-intensity of a spot, which means a measure of the expression level of the corresponding gene. This parameter is calculated as: A=log 2 ((R x G) 1/2 ) p-value: the probability that the gene is not differentially expressed, calculated on the basis of the absolute value of the t statistic. Where t is: t=mean M/(SD M/(n) 1/2 ) Where M and SD M correspond to the definitions previously given and n is the number of replicates. p-values are calculated as two-tailed tests from t-distribution under the null hypothesis M=0. The number of freedom degrees is the number of replicates (n) 1. Annotation: a brief information about the locus function or putative function. Obtained from BAR (Bio-Array Resource for Arabidopsis functional genomics) ( and derived from TAIR9_pep_ merged with gene_aliases from TAIR (The Arabidopsis Information resource) ( The GCRMA package adjusts for background intensities in Affymetrix data, which include optical noise and non-specific binding (NSB) (Wu et al, 2004). GCRMA converts background adjusted probe intensities to expression measures using the same normalization and summarization as Robust Multiarray Average. The LIMMA is a package used for differential expression analysis of microarray data. The package analyzes complex experiments involving comparisons between many RNA targets simultaneously while remaining easy to use also for simple experiments. The basic statistical used for significance analysis is the moderated t-statistic, which is computed for each probe and for each contrast. BH: The Benjamini and Hochberg s method to control the false discovery rate (FDR). If all the genes with p-value below a threshold 0.05 are selected as differentially

4 expressed, then the expected proportion of false discoveries in the selected group is controlled to be less than the threshold value. Mean M: The mean of the M values obtained from the replicates. The M values represent the log2-fold change observed between the samples. Mean A: The average log2-expression for a gene across the arrays and channels in the experiment. Affy ID: Probe identifying the code for the ATH1 gene Chip by Affymetrix. CEL Files: contain the measured intensities and locations of the hybridized array. ChIP assays Seedlings were immersed in buffer A (0.4 M sucrose, 10 mm Tris ph 8, 1 mm EDTA, 1 mm PMSF, 1% formaldehyde, 0,05% Triton X-100) under vacuum for 10 min followed by additional 10 min incubation with glycine M. Seedlings were ground in liquid nitrogen and resuspended in buffer B (0.4 M sucrose, 10 mm Tris ph 8, 5 mm β-mercaptoethanol, 1 mm PMSF, 1 μg/ml aprotinin, 1 μg/ml pepstatin A, 1 μg/ml leupeptin). Nuclei were then collected by centrifugation, resuspended in lysis buffer (50 mm Tris ph 8, 10 mm EDTA, 1% SDS, 1 mm PMSF, 1μg/ml aprotinin, 1 μg/ml pepstatin A, 1 μg/ml leupeptin) and sonicated to approximately bp fragments. After centrifugation, the supernatants were incubated in dilution buffer (15 mm Tris ph 8, 150 mm NaCl, 1% Triton-X-100, 1 mm EDTA, 1 mm PMSF, 1 μg/ml aprotinin, 1 μg/ml pepstatin A, 1 μg/ml leupeptin) overnight at 4ºC with sepharose beads conjugated with a anti-gfp antibody (A11122, Invitrogen). The immune-complexes were washed four times with washing buffer (0.1 % SDS, 1% Triton X-100, 1 mm EDTA, 1 mm PMSF, 1 μg/ml aprotinin, 1 μg/ml pepstatin A, 1 μg/ml leupeptin) and eluted from the beads with 1% SDS and 0.1 M NaHCO 3. Cross-links were reversed by incubation at 65 C for 5 6h followed by proteinase K treatment for 1h at 45ºC, phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation. Pellets were washed with 70% ethanol and resuspended in TE. The results presented in the manuscript come from two biologically independent experiments, meaning independent

5 time course analysis, with independent chromatin preparations. Quantifications were performed relative to the input. As negative controls, we used other ABA-related genes (see list of primers below). Samples similarly processed but without antibody in the immunoprecipitation incubation were also used as negative controls. Primers used for ChIP assays. Gene Primer 1 Primer 2 ABAR (prom) 5 cggattaaaccggctaccc3 5 tgacaagtatttttatgttgctctcttga3 ABAR (5 UTR) 5 ttcttttttagttccttggtccgaa3 5 agaggataggagaagagatgaatcgt3 ABAR (4 th exon) 5 caagatggtggcggagctag3 5 aatatcaatgccaagcgcct3 RD29B 5 ctgagacgtggcaggacgaa3 5 tggccgaaccacctctctct3 ABA1 5 aggtgacacaatattattagtccacatcgtat3 5 gctcatagaaaataacacaagcccat3 RD20 5 tgttcttattctgaaaatgacacaaattt3 5 tcattggactaaaaaacaccaaacata3 ABI3 5 ccagatagtttatgttgtttaagattcga3 5 gatagggtttgtatgtgagtaaggaggc3 ABI5 5 gaatagctgaacagggacaagtaactg3 5 accacctaaacgacaataacaattttg3 Primers used for Q-PCR reactions. Gene Primer 1 Primer 2 COR15A 5 tgtcagagtcggccagaaaac3 5 cacctttagcggcgtagatca3 ABI5 5 aagctatgggtgtgggtgacc3 5 caaacacctgcctgaactggt3 RAB18 5 atggcgtcttaccagaaccgtc3 5 tcgtcatactgctgctggatcg3 COR15B 5 ccacaacgtaggagcaaagca3 5 ttcttgcgctgagcaacga3 At3g tcgttcccatagcttgtcca3 5 gaaatggcatccaaccaaca3 At5g ttatccagtatatcccccgcc3 5 tcgcagaaccgctcataacac3 RD29A 5 tggatacggtgaggcatcag3 5 ccgtctttgggtctcttccc3 At3g tgttgtgtccaagctacgatcg3 5 ctttgcccaatcagtccatgat3 At5g aacgagaacggttttcttcgg3 5 ccgcaagagttctaggagcttg3 RD29B 5 ggagcggtcacttcttggct3 5 ggtggtgccaagtgattgtg3 At3g atcattccaccggccttct3 5 agcaaaacgcgagctacca3 At4g gataaaaatggcggccatgc3 5 agccggagctttgattccag3 References Adie BAT, Perez-Perez J, Perez-Perez MM, Godoy M, Sanchez-Serrano J-J, Schmelz EA, Solano R (2007) ABA is an essential signal for plant resistance to pathogens affecting JA biosynthesis and the activation of defenses in Arabidopsis. Plant Cell 19(5): Covington M, Maloof J, Straume M, Kay SA, Harmer S (2008) Global transcriptome analysis reveals circadian regulation of key pathways in plant growth and development. Genome Biol 9(8): R130 Hazen SP, Naef F, Quisel T, Gendron J, Chen H, Ecker J, Borevitz J, Kay S (2009) Exploring the transcriptional landscape of plant circadian rhythms using genome tiling arrays. Genome Biol 10(2): R17

6 Matsui A, Ishida J, Morosawa T, Mochizuki Y, Kaminuma E, Endo TA, Okamoto M, Nambara E, Nakajima M, Kawashima M, Satou M, Kim J-M, Kobayashi N, Toyoda T, Shinozaki K, Seki M (2008) Arabidopsis transcriptome analysis under drought, cold, high-salinity and ABA treatment conditions using a tiling array. Plant Cell Physiol 49(8): O'Connor TR, Dyreson C, Wyrick JJ (2005) Athena: a resource for rapid visualization and systematic analysis of Arabidopsis promoter sequences Bioinformatics 21: Quackenbush J (2002) Microarray data normalization and transformation. Nat Genet Rainer J, Sánchez-Cabo F, Stocker G, Sturn A, Trajanoski Z (2006) CARMAweb: comprehensive R- and bioconductor-based web service for microarray data analysis. Nucl Acids Res 34: W Saeed A, Sharov V, White J, Li J, Liang W, Bhagabati N, Braisted J, Klapa M, Currier T, Thiagarajan M, Sturn A, Snuffin M, Rezantsev A, Popov D, Ryltsov A, Kostukovich E, Borisovsky I, Liu Z, Vinsavich A, Trush V, Quackenbush J (2003) TM4: A free, open-source system for microarray data management and analysis. Biotechniques 34: Smyth GK, Speed T (2003) Normalization of cdna microarray data. Methods 31(4): Wu Z, Irizarry R, Gentleman R, Murillo FM, Spencer F (2004) A Model-Based Background Adjustment for Oligonucleotide Expression Arrays. J Am Stat Assoc 99: Yang YH, Dudoit S, Luu P, Lin DM, Peng V, Ngai J, Speed TP (2002) Normalization for cdna microarray data: a robust composite method addressing single and multiple slide systematic variation. Nucl Acids Res 30(4): e15

7 Supplementary Figure S1 TOC1-ox ABA-related transcriptional profiles ABA-related transcriptional profiles toc1-2 ABA-related transcriptional profiles ABA-related transcriptional profiles Supplementary Figure S1. Meta-analysis of up- and down-regulated genes in TOC1- ox and toc1-2 using transcriptomic profiles from experiments with different hormone treatments. Details about the experimental conditions and treatments in each dataset are described in

8 Supplementary Figure S2 A ABA toc1-2 TOC1-ox up down up down B Other hormones toc1-2 TOC1-ox ACC Zeat IAA GA3 ACC Zeat IAA GA3 C Gene Enrichment (%) *** * * TOC1-ox toc1-2 Genome ACC BL GA3 IAA MJ CK D Cyclers E Cyclers ABA Drought 63 ABA Drought Supplementary Figure S2. Genome-wide analysis of TOC1 transcriptional networks. (A) Hierarchical clustering with transcripts regulated by ABA and (B) other hormones (gibberellic acid [GA3], 1-Aminocyclopropane-1-carboxylic Acid [ACC], indole acetic acid [IAA] and Zeatin [Zeat]). High and low expression is depicted as a log2 ratio with maximum and minimum scale of ±3. (C) Percentages of hormone-related genes at the whole-genome level and in TOC1-ox and toc1-2 transcriptomic datasets. Venn diagrams showing the overlap between cyclers, ABA- and drought-related genes in TOC1-ox (D) and toc1-2 (E) transcriptomic datasets. Details of datasets used for analysis are described in Supplementary Materials and methods. (*p-value<10-3 ; **pvalue<10-8 ; ***p-value<10-11 ).

9 Supplementary Figure S3 WT TOC1-ox WT TOC1-ox COR15A/IPP2 COR15B/IPP2 RD29A/IPP2 WT TOC1-ox WT TOC1-ox RD29B/IPP2 WT TOC1-ox WT TOC1-ox ABI5/IPP2 At3g02480/IPP2 WT TOC1-ox WT TOC1-ox RAB18/IPP2 At3g15670/IPP2 At3g17520/IPP2 WT TOC1-ox At4g21020/IPP2 At5g06760/IPP2 WT TOC1-ox WT TOC1-ox At5g44310/IPP2 WT TOC1-ox Supplementary Figure S3. Comparison of relative expression of ABA-related genes and genes involved in dehydration responses in WT and TOC1-ox plants. Analysis of mrna abundance in WT and TOC1-ox plants was performed by Quantitative-PCR (Q- PCR). mrna was quantified relative to IPP2. Data are plotted relative to the value of WT plants.

10 Supplementary Figure S4 RD29B/ACT2 WT toc1-2 ABA1/IPP2 WT toc1-2 ABI5/IPP2 WT toc1-2 ABI2/IPP2 WT toc1-2 COR15A/IPP2 WT toc1-2 At5g44310/IPP2 WT toc1-2 Supplementary Figure S4. Comparison of relative expression of ABA-related genes in WT and toc1-2 mutant plants. Analysis of mrna abundance was performed by Quantitative-PCR (Q-PCR). mrna was quantified relative to IPP2. Data are plotted relative to the maximum value.

11 Supplementary Figure S5 ABAR/ACT2 ABAR/ACT2 ABAR/ACT2 WT TOC1RNAi A Time (h) C Time (h) E Time (h) ShD LgD WT +ABA TOC1 RNAi +ABA ABAR/ACT2 ABAR/ACT2 ABAR/ACT2 WT +ABA TOC1-ox +ABA B Time (h) D Time (h) F Time (h) LL WT TOC1-ox Supplementary Figure S5. The diurnal expression of ABAR is regulated by TOC1. (A) Diurnal waveform of ABAR expression examined by Northern blot in WT plants grown under Short-Day (ShD, 8h light:16h dark) and Long-Day (LgD, 16h light:8h dark) conditions. (B) Circadian waveform of ABAR expression examined by Northern blot in WT plants synchronized under 12h light:12h dark (LD) cycles followed by 2 days under constant light conditions (LL). (C, D) Diurnal waveform of ABAR expression in TOC1 RNAi and TOC1-ox plants grown under 12h light:12h dark cycles. (E, F) Effects of ABA treatment on ABAR expression in TOC1 RNAi and TOC1-ox plants grown under 12h light:12h dark cycles.

12 Supplementary Figure S6 A ABAR 4th exon ABAR 5 UTR ABAR Prom (-450) B Relative ChIP abundance ABAR locus/input Time (h) ABAR prom ABAR 5'UTR ABAR 4th exon Supplementary Figure S6. Analysis of TOC1 binding to the ABAR locus. (A) Schematic representation of the ABAR genomic structure. Red lines indicate the position of the regions chosen for amplification in the ChIP assays. ABAR Promoter (around 450 bases from the ATG); ABAR 5 UTR (around the ABAR transcription start site); ABAR 4 th exon (around the 4 th exon of the gene). See details of the primers in Supplementary Materials and methods. (B) Q- PCR reflecting the binding of TOC1 to the ABAR locus in TMG plants synchronized under LgD cycles (16h light:8h dark) and then transferred for two days under constant light conditions. ChIP assays were performed after TOC1 immuno-precipitation with an antibody to YFP followed by amplification of the different regions of ABAR locus. Samples were analyzed at the indicated circadian times (CT3, CT15 and CT23). Details of the experimental procedure are described in Supplemental Material and methods.

13 Supplementary Figure S7 ABAR - + ABI3 - + ChIP ABA1 - + ABI5 - + ChIP ChIP RD RD Supplementary Figure S7. ChIP assays of TOC1 binding to the ABAR promoter with TMG plants after TOC1 immuno-precipitation with an antibody to YFP followed by amplification of several promoters of genes involved in ABA signalling pathways. As control, samples were similarly processed in the absence of antibody (- ). Details of the primers and experimental procedure are described in Supplemental Material and methods.

14 Supplementary Figure S8 TMG TMG+ABA ABA1 INPUT Supplementary Figure S8. ChIP assays with TMG plants after TOC1 immuno-precipitation with an antibody to YFP followed by amplification of the ABA1 promoter. TOC1 binding to the ABA1 promoter was analyzed in the presence or in the absence of ABA. Details of the primers and experimental procedure are described in Supplemental Material and methods.

15 Supplementary Figure S9 Counts / seedling / 5 sec Time (h) WT ABAR RNAi L1 ABAR RNAi L2 Supplementary Figure S9. Analysis of TOC1::LUC expression examined by luminescence assays in WT plants and several ABAR RNAi lines in the absence of ABA. Data are means +/- SEM of luminescence from 6-12 plants.

16 Supplementary Figure S10 TOC1ACT2 WT WT+ABA Time (h) TOC1ACT2 ABAR RNAi ABAR RNAi+ABA Time (h) Supplementary Figure S10. Quantification of TOC1 mrna expression by Northern blot analysis in WT and ABAR RNAi plants. Analyses were performed with RNA from twelve day-old seedlings and TOC1 expression examined in the presence or in the absence of 100 µm (±) ABA. Details of the experimental procedure are described in Supplementary Materials and methods. Data are plotted relative to the maximum value.

17 Supplementary Figure S11 A Relative ABAR mrna ABAR RNAi ABAR RNAi TOC1-ox ABAR RNAi TOC1 RNAi Supplementary Figure S11. Comparison of relative ABAR mrna abundance in different lines. Quantitative-PCR (Q-PCR) analysis of ABAR abundance in ABAR RNAi, ABAR RNAi/TOC1 RNAi and TOC1-ox/ABAR RNAi lines. ABAR mrna was quantified relative to IPP2 mrna. Data are plotted relative to the value of WT plants.

18 Supplementary Table S1. Miss-expressed genes in TOC1-ox (See Supplementary Materials and Methods and for definitions and details of analysis and labels) AGI ID Affy ID pvalue BH mean M mean A C1.CEL C3.2.CEL C3.CEL T1.CEL T3.2.CEL T3.CEL Annotation UP-REGULATED At4g _at 4,6691E-05 0, , , , , , , , , AT-BETA-AMY_ATBETA-AMY_BMY1_RAM1 BAM5 (BETA-AMYLASE 5); beta-amylase At3g _at 7,5165E-05 0, , , , , , , , , BGLU30_SRG2 DIN2 (DARK INDUCIBLE 2); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds At5g _at 7,9946E-07 0, , , , , , , , , APRR1_PRR1 TOC1 (TIMING OF CAB EXPRESSION 1); transcription regulator/ two-component response regulator At4g _at 0, , , , , , , , , , pathogenesis-related protein, putative At1g _at 0, , , , , , , , , , acyl-(acyl-carrier-protein) desaturase, putative / stearoyl-acp desaturase, putative At5g _at 0, , , , , , , , , , BCB ATBCB (ARABIDOPSIS BLUE-COPPER-BINDING PROTEIN); copper ion binding / electron carrier At5g _at 0, , , , , , , , , , CYP75B1_D501 TT7 (TRANSPARENT TESTA 7); flavonoid 3'-monooxygenase/ oxygen binding At1g03495 A265091_s_at 0, , , , , , , , , , transferase/ transferase, transferring acyl groups other than amino-acyl groups At4g _at 0, , , , , , , , , , ATPAP24 PAP24 (PURPLE ACID PHOSPHATASE 24); acid phosphatase/ protein serine/threonine phosphatase At1g _at 6,4801E-05 0, , , , , , , , , ATGSTF5 GSTF5 (GLUTATHIONE S-TRANSFERASE (CLASS PHI) 5); glutathione transferase At4g _at 0, , , , , , , , , , UDP-glucoronosyl/UDP-glucosyl transferase family protein At5g _at 5,7972E-05 0, , , , , , , , , polygalacturonase, putative / pectinase, putative At5g _at 0, , , , , , , , , , UF3GT (udp-glucose:flavonoid 3-O-glucosyltransferase); transferase, transferring glycosyl groups At3g59930 A251438_s_at 0, , , , , , , , , , Encodes a defensin-like (DEFL) family protein. At2g _at 3,1281E-06 0, , , , , , , , , LHCB4.3 (light harvesting complex PSII); chlorophyll binding At4g _at 0, , , , , , , , , , unknown protein At4g _at 4,5344E-05 0, , , , , , , , , ATEXP17_ATHEXP ALPHA 1.13 ATEXPA17 (ARABIDOPSIS THALIANA EXPANSIN A17) At3g _at 0, , , , , , , , , , AT5MAT; O-malonyltransferase/ transferase At5g _at 0, , , , , , , , , , mitochondrial substrate carrier family protein At1g _at 7,4103E-05 0, , , , , , , , , unknown protein At1g _at 0, , , , , , , , , , phosphatase At5g _at 5,2448E-05 0, , , , , , , , , FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; At5g _at 0, , , , , , , , , , glycerophosphoryl diester phosphodiesterase family protein At2g _at 0, , , , , , , , , , pathogenesis-related protein, putative At1g _at 1,6649E-05 0, , , , , , , , , AAA-type ATPase family protein At3g _at 0, , , , , , , , , , unknown protein At1g _at 0, , , , , , , , , , phosphatase At1g _at 0, , , , , , , , , , ZAT10 STZ (salt tolerance zinc finger); nucleic acid binding / transcription factor/ transcription repressor/ zinc ion binding At5g _at 0, , , , , , , , , , ATSAL2 SAL2; 3'(2'),5'-bisphosphate nucleotidase/ inositol or phosphatidylinositol phosphatase At3g _at 6,9428E-05 0, , , , , , , , , At5g _at 0, , , , , , , , , , M318_TT3 DFR (DIHYDROFLAVONOL 4-REDUCTASE); dihydrokaempferol 4-reductase At2g _at 1,4402E-05 0, , , , , , , , , UGT73C1 (UDP-GLUCOSYL TRANSFERASE 73C1); UDP-glucosyltransferase/ UDP-glycosyltransferase/ At2g _at 5,267E-05 0, , , , , , , , , AP2 domain-containing transcription factor, putative At3g _at 7,4509E-05 0, , , , , , , , , ATPAP16 PAP16 (PURPLE ACID PHOSPHATASE 16); acid phosphatase/ protein serine/threonine phosphatase At5g _at 0, , , , , , , , , , dehydrodolichyl diphosphate synthase, putative / DEDOL-PP synthase, putative At1g _at 0, , , , , , , , , , CML38 calcium-binding EF hand family protein At2g _at 4,3099E-05 0, , , , , , , , , JAL23 (JACALIN-RELATED LECTIN 23) At1g _at 0, , , , , , , , , , CL3; 4-coumarate-CoA ligase At2g _at 8,2354E-05 0, , , , , , , , , PR-1-LIKE (PATHOGENESIS-RELATED PROTEIN-1-LIKE) At1g62580 A265105_s_at 3,5562E-05 0, , , , , , , , , flavin-containing monooxygenase family protein / FMO family protein At5g _at 5,4433E-05 0, , , , , , , , , glycerophosphoryl diester phosphodiesterase family protein At4g22870 A254283_s_at 0, , , , , , , , , , leucoanthocyanidin dioxygenase, putative / anthocyanidin synthase, putative At5g _at 5,021E-06 0, , , , , , , , , KAT5_PKT1 PKT2 (PEROXISOMAL 3-KETO-ACYL-COA THIOLASE 2); acetyl-coa C-acyltransferase/ catalytic At1g _at 9,7942E-05 0, , , , , , , , , UDP-glucoronosyl/UDP-glucosyl transferase family protein At5g _at 0, , , , , , , , , , SQP1; squalene monooxygenase At5g _at 5,8482E-06 0, , , , , , , , , ATPTR3 PTR3 (PEPTIDE TRANSPORTER 3); dipeptide transporter/ transporter/ tripeptide transporter At1g _at 9,4312E-05 0, , , , , , , , , C2 domain-containing protein At3g _at 0, , , , , , , , , , LBD41 (LOB DOMAIN-CONTAINING PROTEIN 41) At5g _at 0, , , , , , , , , , unknown protein At1g _at 3,1767E-05 0, , , , , , , , , protein kinase family protein At1g _at 1,2505E-05 0, , , , , , , , , ATH8 (thioredoxin H-type 8) At5g _at 0, , , , , , , , , , ATMGD2 MGD2; 1,2-diacylglycerol 3-beta-galactosyltransferase/ UDP-galactosyltransferase/ transferase, transferring glycosyl groups At3g _at 0, , , , , , , , , , phospholipase/carboxylesterase family protein At1g _at 0, , , , , , , , , , ATADH ADH1 (ALCOHOL DEHYDROGENASE 1); alcohol dehydrogenase At3g _at 0, , , , , , , , , , F3'H_TT6 F3H (FLAVANONE 3-HYDROXYLASE); naringenin 3-dioxygenase At3g _at 3,6158E-05 0, , , , , , , , , unknown protein At1g _at 0, , , , , , , , , , ATNAS3 NAS3 (NICOTIANAMINE SYNTHASE 3); nicotianamine synthase At1g _at 0, , , , , , , , , , senescence-associated protein-related At1g _at 0, , , , , , , , , , UDP-glucoronosyl/UDP-glucosyl transferase family protein At1g _at 0, , , , , , , , , , ATGA2OX2 (GIBBERELLIN 2-OXIDASE); gibberellin 2-beta-dioxygenase At4g _at 0, , , , , , , , , , ATPMEPCRB; pectinesterase At3g _at 0, , , , , , , , , , transcription factor At2g _at 5,8677E-05 0, , , , , , , , , ZIP7 (ZINC TRANSPORTER 7 PRECURSOR); cation transmembrane transporter/ metal ion transmembrane transporter/ zinc ion transmembrane transporter At3g _at 0, , , , , , , , , , ATMRP14; ATPase, coupled to transmembrane movement of substances At2g _at 0, , , , , , , , , , ARATH GLB1_ATGLB1_GLB1_NSHB1 AHB1 (ARABIDOPSIS HEMOGLOBIN 1); oxygen binding / oxygen transporter At3g _at 4,0226E-05 0, , , , , , , , , COBL2 (COBRA-LIKE PROTEIN 2 PRECURSOR) At2g _at 5,83E-05 0, , , , , , , , , pectinesterase family protein At2g _at 5,5031E-05 0, , , , , , , , , phosphoglycerate/bisphosphoglycerate mutase family protein At5g _at 5,9219E-05 0, , , , , , , , , unknown protein At3g _at 0, , , , , , , , , , UGT84A2; UDP-glycosyltransferase/ sinapate 1-glucosyltransferase At2g _at 0, , , , , , , , , , binding At2g03020 A266772_s_at 9,6425E-05 0, , , , , , , , , heat shock protein-related At5g _at 0, , , , , , , , , , chalcone-flavanone isomerase family protein At5g _at 0, , , , , , , , , , haloacid dehalogenase-like hydrolase family protein At2g _at 9,8701E-05 0, , , , , , , , , SAG13; alcohol dehydrogenase/ oxidoreductase At1g02920 A262119_s_at 1,699E-06 0, , , , , , , , , ATGSTF7_ATGSTF8_GST11 GSTF7; copper ion binding / glutathione binding / glutathione transferase At1g _at 0, , , , , , , , , , unknown protein At3g _at 0, , , , , , , , , , short-chain dehydrogenase/reductase (SDR) family protein At3g _at 0, , , , , , , , , , SCPL7 (SERINE CARBOXYPEPTIDASE-LIKE 7); serine-type carboxypeptidase At1g71330 A259937_s_at 6,7295E-05 0, , , , , , , , , ATNAP5; ATPase, coupled to transmembrane movement of substances / transporter At4g _at 0, , , , , , , , , , peroxidase, putative At1g _at 0, , , , , , , , , , LHY1 LHY (LATE ELONGATED HYPOCOTYL); DNA binding / transcription factor At1g _at 0, , , , , , , , , , auxin-responsive family protein At5g _at 0, , , , , , , , , , CYP96A4; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxygen binding At5g _at 0, , , , , , , , , , pollen Ole e 1 allergen and extensin family protein At5g _at 0, , , , , , , , , , SQE6 (SQUALENE MONOXYGENASE 6); FAD binding / oxidoreductase/ squalene monooxygenase At1g _at 0, , , , , , , , , , branched-chain amino acid aminotransferase 6 / branched-chain amino acid transaminase 6 (BCAT6) At5g _at 5,0185E-05 0, , , , , , , , , AtMYB111 (myb domain protein 111); DNA binding / transcription factor At2g _at 0, , , , , , , , , , cinnamoyl-coa reductase-related At5g _at 0, , , , , , , , , , ATOFP1 OFP1 (OVATE FAMILY PROTEIN 1); protein binding / transcription repressor At3g _at 0, , , , , , , , , , pectinesterase family protein At3g _at 0, , , , , , , , , , kelch repeat-containing protein At5g _at 0, , , , , , , , , , acid phosphatase/ oxidoreductase/ transition metal ion binding At2g32190 A265670_s_at 0, , , , , , , , , , unknown protein At5g _at 0, , , , , , , , , , ATCHS_CHS TT4 (TRANSPARENT TESTA 4); naringenin-chalcone synthase At1g _at 0, , , , , , , , , , cinnamyl-alcohol dehydrogenase family / CAD family At2g _at 0, , , , , , , , , , ATWRKY60 WRKY60; transcription factor At5g _at 0, , , , , , , , , , oxidoreductase, 2OG-Fe(II) oxygenase family protein At5g _at 0, , , , , , , , , , pectinesterase family protein At5g _at 2,072E-06 0, , , , , , , , , AtWRKY48 WRKY48; transcription factor At5g _at 0, , , , , , , , , , FLS2 (FLAVONOL SYNTHASE 2); flavonol synthase At4g _at 0, , , , , , , , , , unknown protein At2g _at 0, , , , , , , , , , auxin-responsive protein-related At1g75388 A261114_at 0, , , , , , , , , , CPuORF5 (Conserved peptide upstream open reading frame 5) At5g _at 0, , , , , , , , , , proline oxidase, putative / osmotic stress-responsive proline dehydrogenase, putative At3g60160 A251457_s_at 1,2202E-05 0, , , , , , , , , ATMRP9; ATPase, coupled to transmembrane movement of substances At1g _at 0, , , , , , , , , , LOX3; electron carrier/ iron ion binding / lipoxygenase/ metal ion binding / oxidoreductase, acting on single donors with incorporation of molecular oxygen, At5g _at 2,2109E-06 0, , , , , , , , , ATOPT1 OPT1 (OLIGOPEPTIDE TRANSPORTER 1); oligopeptide transporter At4g _at 9,1236E-06 0, , , , , , , , , proton-dependent oligopeptide transport (POT) family protein At4g _at 0, , , , , , , , , , ATAPR3_PRH-26_PRH26 APR3 (APS REDUCTASE 3); adenylyl-sulfate reductase

19 At3g17998 A258218_at 3,2598E-05 0, , , , , , , , , CPuORF30 (Conserved peptide upstream open reading frame 30) At5g _at 0, , , , , , , , , , ATNRT3.1_NRT3.1 WR3 (WOUND-RESPONSIVE 3); nitrate transmembrane transporter At5g _at 6,811E-07 0, , , , , , , , , unknown protein At3g _at 1,2437E-06 0, , , , , , , , , ATCLC-B CLC-B (CHLORIDE CHANNEL B); anion channel/ voltage-gated chloride channel At1g _at 9,5747E-06 0, , , , , , , , , SD1-29 (S-DOMAIN-1 29); carbohydrate binding / kinase/ protein kinase At1g _at 0, , , , , , , , , , lipase, putative At5g _at 0, , , , , , , , , , UGT78D2 (UDP-GLUCOSYL TRANSFERASE 78D2); UDP-glycosyltransferase/ anthocyanidin 3-O-glucosyltransferase/ quercetin 3-O-glucosyltransferase/ At4g _at 4,2469E-05 0, , , , , , , , , APS3; sulfate adenylyltransferase (ATP) At1g _at 0, , , , , , , , , , disease resistance protein (TIR-NBS class), putative At2g _at 0, , , , , , , , , , ATMES7 MES7 (METHYL ESTERASE 7); hydrolase/ hydrolase, acting on ester bonds / methyl indole-3-acetate esterase/ methyl salicylate esterase At4g _at 0, , , , , , , , , , ATSPS4F; transferase, transferring glycosyl groups At5g _at 0, , , , , , , , , , ATASP38 PCS1 (PROMOTION OF CELL SURVIVAL 1); aspartic-type endopeptidase/ peptidase At5g _at 0, , , , , , , , , , ASUS1_atsus1 SUS1 (SUCROSE SYNTHASE 1); UDP-glycosyltransferase/ sucrose synthase At3g _at 0, , , , , , , , , , unknown protein At1g _at 9,6016E-05 0, , , , , , , , , PAO4 ATPAO4 (ARABIDOPSIS THALIANA POLYAMINE OXIDASE 4); amine oxidase/ polyamine oxidase At4g _at 0, , , , , , , , , , UGT84A3; UDP-glycosyltransferase/ sinapate 1-glucosyltransferase/ transferase, transferring glycosyl groups At1g _at 0, , , , , , , , , , EDS16_ICS1_SID2 isochorismate synthase 1 (ICS1) / isochorismate mutase At5g _at 0, , , , , , , , , , peroxidase 73 (PER73) (P73) (PRXR11) At5g _at 5,0641E-05 0, , , , , , , , , ATNAP2_ATPOP1 POP1; transporter At4g _at 4,0389E-05 0, , , , , , , , , JR2 CORI3 (CORONATINE INDUCED 1); cystathionine beta-lyase/ transaminase At5g _at 2,7306E-05 0, , , , , , , , , FLS (FLAVONOL SYNTHASE); flavonol synthase At4g _at 0, , , , , , , , , , protein kinase family protein At1g _at 0, , , , , , , , , , nodulin MtN3 family protein At1g _at 1,5105E-05 0, , , , , , , , , proton-dependent oligopeptide transport (POT) family protein At5g _at 0, , , , , , , , , , DNA-binding protein, putative _at _at 0, , , , , , , , , , At5g _at 8,0304E-06 0, , , , , , , , , ATGLK2_GPRI2 GLK2 (GOLDEN2-LIKE 2); DNA binding / transcription factor/ transcription regulator At2g _at 0, , , , , , , , , , unknown protein At3g _at 8,9711E-05 0, , , , , , , , , PHF1 (PHOSPHATE TRANSPORTER TRAFFIC FACILITATOR1); nucleotide binding At4g _at 0, , , , , , , , , , calcium-binding EF hand family protein At2g _at 0, , , , , , , , , , ATCAMBP25 (ARABIDOPSIS THALIANA CALMODULIN (CAM)-BINDING PROTEIN OF 25 KDA); calmodulin binding At3g _at 0, , , , , , , , , , disease resistance response At3g _at 7,7355E-06 0, , , , , , , , , aspartyl protease family protein At3g _at 0, , , , , , , , , , LSH4 (LIGHT SENSITIVE HYPOCOTYLS 4) At4g _at 0, , , , , , , , , , unknown protein At2g _at 0, , , , , , , , , , LSH3 (LIGHT SENSITIVE HYPOCOTYLS 3) At3g _at 0, , , , , , , , , , ATXTR8 XTR8 (XYLOGLUCAN ENDO-TRANSGLYCOSYLASE-RELATED 8); hydrolase, acting on glycosyl bonds / xyloglucan:xyloglucosyl transferase At1g _at 0, , , , , , , , , , disease resistance protein (TIR-NBS class), putative At5g _at 0, , , , , , , , , , XGD1 (XYLOGALACTURONAN DEFICIENT 1); UDP-xylosyltransferase/ catalytic At5g _at 0, , , , , , , , , , ornithine cyclodeaminase/mu-crystallin family protein At1g _at 0, , , , , , , , , , trypsin and protease inhibitor family protein / Kunitz family protein At1g _at 8,3003E-05 0, , , , , , , , , CYP89A2 (CYTOCHROME P450 89A2); electron carrier/ heme binding / iron ion binding / monooxygenase/ oxygen binding At3g _at 0, , , , , , , , , , A11_CFI TT5 (TRANSPARENT TESTA 5); chalcone isomerase At1g _at 0, , , , , , , , , , enoyl-coa hydratase/isomerase family protein At2g _at 0, , , , , , , , , , UGT74D1 (UDP-glucosyl transferase 74D1); UDP-glycosyltransferase/ abscisic acid glucosyltransferase/ transferase, transferring glycosyl groups / At4g _at 0, , , , , , , , , , kinase At1g _at 0, , , , , , , , , , thioesterase family protein At1g _at 0, , , , , , , , , , unknown protein At3g _at 7,1518E-05 0, , , , , , , , , glucosamine/galactosamine-6-phosphate isomerase family protein At3g _at 0, , , , , , , , , , unknown protein At5g _at 0, , , , , , , , , , subtilase family protein At4g _at 0, , , , , , , , , , kinesin motor family protein At1g _at 0, , , , , , , , , , SULTR1;3; sulfate transmembrane transporter At1g _at 0, , , , , , , , , , unknown protein At1g _at 0, , , , , , , , , , integral membrane protein, putative / sugar transporter family protein At1g02520 A260932_s_at 7,8467E-05 0, , , , , , , , , PGP11 (P-GLYCOPROTEIN 11); ATPase, coupled to transmembrane movement of substances At3g _at 0, , , , , , , , , , HR4 (HOMOLOG OF RPW8 4) At3g _at 7,3455E-05 0, , , , , , , , , DC1 domain-containing protein At4g _at 6,3741E-05 0, , , , , , , , , SQD1; UDPsulfoquinovose synthase/ sulfotransferase At3g _at 0, , , , , , , , , , LHCB4.2 (light harvesting complex PSII); chlorophyll binding At5g _at 0, , , , , , , , , , NHL3 At5g _at 0, , , , , , , , , , PDC2 (pyruvate decarboxylase-2); carboxy-lyase/ catalytic/ magnesium ion binding / pyruvate decarboxylase/ thiamin pyrophosphate binding At5g _at 0, , , , , , , , , , PDLP1 (PLASMODESMATA-LOCATED PROTEIN 1) At1g _at 0, , , , , , , , , , SS3 (STRICTOSIDINE SYNTHASE 3); strictosidine synthase At3g49110 A252291_s_at 0, , , , , , , , , , ATPCA_ATPRX33_PRX33 PRXCA (PEROXIDASE CA); peroxidase At3g _at 1,2029E-05 0, , , , , , , , , ATNUDT13 ATNUDX13 (ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 13); bis(5'-adenosyl)-pentaphosphatase/ hydrolase At1g _at 0, , , , , , , , , , GDSL-motif lipase/hydrolase family protein At5g _at 0, , , , , , , , , , cysteine proteinase, putative / thiol protease, putative At3g _at 5,5622E-05 0, , , , , , , , , short-chain dehydrogenase/reductase (SDR) family protein At1g _at 0, , , , , , , , , , ATUGT85A1 UGT85A1; UDP-glycosyltransferase/ cis-zeatin O-beta-D-glucosyltransferase/ glucuronosyltransferase/ trans-zeatin O-beta-D-glucosyltransferase/ transferase, At4g _at 0, , , , , , , , , , SRH1 COW1 (CAN OF WORMS1); phosphatidylinositol transporter/ transporter At4g _at 0, , , , , , , , , , SLAH2 (SLAC1 HOMOLOGUE 2); transporter At2g _at 0, , , , , , , , , , ceramide glucosyltransferase, putative At2g _at 0, , , , , , , , , , AT-CDA1_DESZ CDA1 (CYTIDINE DEAMINASE 1); cytidine deaminase At2g _at 0, , , , , , , , , , ATC4H_CYP73A5 C4H (CINNAMATE-4-HYDROXYLASE); trans-cinnamate 4-monooxygenase At5g _at 0, , , , , , , , , , ATMYB44_ATMYBR1 MYBR1 (MYB DOMAIN PROTEIN R1); DNA binding / transcription factor At3g _at 0, , , , , , , , , , UGP3 (UDP-GLUCOSE PYROPHOSPHORYLASE 3) At1g _at 0, , , , , , , , , , GST ATGSTU24 (GLUTATHIONE S-TRANSFERASE TAU 24); glutathione binding / glutathione transferase At5g _at 0, , , , , , , , , , FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 18 plant structures; protein (InterPro:IPR001107); At3g _at 0, , , , , , , , , , ADT4 (arogenate dehydratase 4); arogenate dehydratase/ prephenate dehydratase At3g _at 0, , , , , , , , , , aspartyl protease family protein At2g _at 9,8049E-05 0, , , , , , , , , defense-related protein, putative At3g _at 0, , , , , , , , , , oxidoreductase, 2OG-Fe(II) oxygenase family protein At4g14030 A245285_s_at 0, , , , , , , , , , SBP1 (selenium-binding protein 1); selenium binding At4g _at 4,4234E-05 0, , , , , , , , , AT-RLK3 CRK11 (CYSTEINE-RICH RLK11); kinase/ protein kinase At5g _at 0, , , , , , , , , , tryptophan synthase-related At2g _at 0, , , , , , , , , , ethylene-responsive protein, putative At4g _at 0, , , , , , , , , , RALFL32 (ralf-like 32); signal transducer At1g _at 0, , , , , , , , , , dehydro-3-deoxyphosphoheptonate aldolase, putative / 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase, putative / DAHP synthetase, putative At3g _at 0, , , , , , , , , , glycine-rich protein At5g _at 0, , , , , , , , , , peroxidase, putative At1g _at 0, , , , , , , , , , ATXYN1 RXF12; endo-1,4-beta-xylanase/ hydrolase, hydrolyzing O-glycosyl compounds At5g _at 0, , , , , , , , , , lectin protein kinase family protein At1g _at 0, , , , , , , , , , MLP423 (MLP-LIKE PROTEIN 423) At3g _at 0, , , , , , , , , , FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; At4g _at 5,0819E-06 0, , , , , , , , , pathogenesis-related thaumatin family protein At3g _at 0, , , , , , , , , , phosphoinositide binding At1g _at 0, , , , , , , , , , basic helix-loop-helix (bhlh) family protein At1g _at 0, , , , , , , , , , unknown protein At3g _at 9,1661E-06 0, , , , , , , , , beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative At2g43018 A265244_at 0, , , , , , , , , , CPuORF17 (Conserved peptide upstream open reading frame 17) At3g _at 0, , , , , , , , , , UGT88A1 UDP-glucoronosyl/UDP-glucosyl transferase family protein At2g _at 0, , , , , , , , , , unknown protein At1g _at 0, , , , , , , , , , CER60 KCS5 (3-KETOACYL-COA SYNTHASE 5); fatty acid elongase At2g _at 0, , , , , , , , , , HMA4; cadmium ion transmembrane transporter/ cadmium-transporting ATPase/ zinc ion transmembrane transporter At2g _at 0, , , , , , , , , , transferase, transferring glycosyl groups At4g _at 0, , , , , , , , , , unknown protein At1g _at 0, , , , , , , , , , aminotransferase class I and II family protein At5g _at 0, , , , , , , , , , ATCLC-C CLC-C (CHLORIDE CHANNEL C); anion channel/ voltage-gated chloride channel At1g _at 0, , , , , , , , , , unknown protein At5g _at 0, , , , , , , , , , AtGUS2 (Arabidopsis thaliana glucuronidase 2); beta-glucuronidase At3g _at 0, , , , , , , , , , ATDCL2 DCL2 (DICER-LIKE 2); ATP binding / ATP-dependent helicase/ RNA binding / double-stranded RNA binding / helicase/ nucleic acid binding / ribonuclease III At2g _at 0, , , , , , , , , , transcription factor At3g _at 0, , , , , , , , , , immunophilin, putative / FKBP-type peptidyl-prolyl cis-trans isomerase, putative