Cloning and Characterization of a Novel Human Gene ACB P5 cd NA
|
|
- Περσεφόνη Σπανός
- 6 χρόνια πριν
- Προβολές:
Transcript
1 ISSN CN ΠQ Chinese Journal of Biochemistry and Molecular Biology 21 (2) : ACB P5 cdna Π 1, 2) 1) 2) 1) 3) 1, 2) 1, 3) 3,,,,,, ( 1), ; 2), ; 3) Forsyth, 02115) ACB P5 RT2PCR, RT2PCR, A (acyl2coa binding protein,acbp) ACB P5 ACB P5 cdna 1083 bp 1 7,6 354 bp 118 ACB P5 RT2PCR,ACB P5 ACB P5 ACBP5,, A, Q74,Q78 Cloning and Characterization of a Novel Human Gene ACB P5 cd NA WANGLuan 1,2), XUE Peng 1), CHENG Rui 2), FU Jia2Qi 1), CHEN Wei 3), CI Hong2Liang 1,2), LI Yi2Ping 1,3 ) 3 ( 1) Biomedical Research Institute, College of Life Sciences, Beijing Normal University, Beijing , China ; 3) 2) Zhejiang Cell Biomedical Research College, Hangzhou , China ; Forsyth Institute, Harvard School of Dental Medicine, Boston, MA 02115, USA) Abstract Based on the bioinformatics, a novel human gene ACB P5 (acyl2coa binding protein 5) cdna was found and cloned into pcmv2sport6 The full length of ACB P5 cdna is bp and contains 7 exons and 6 introns Its open reading frame (ORF) encodes a protein of 118 amino acid residues The whole2mount in situ hybridization (WISH) of mouse and chicken embryo showed that the gene was specially expressed in the brain and mainly in the isthmus The result of reverse transcriptase2polymerase chain reaction ( RT2PCR) of the mature mouse tissues showed that it was widely expressed in many organs The result indicates that ACB P5 gene may have an essential role in the development of brain and the maintenance of the organs normal functions Key words ACB P5 gene, bioinformatics, acyl2coa binding protein domain, brain A (acyl2coa) 3, [1 ] ACBP A (acyl2coa2binding protein,acbp) : : ACBP 90 3 Tel : ,E2mail : org 10 kd,nmr ACBP 5 Received :April ; Accepted : May 27, Corresponding author Tel : ,E2mail : org China Academic Journal Electronic Publishing House All rights reserved
2 2 : ACB P5 cdna Π 165 A [2 ], ; [3 ] 112 ACB P5, RIKEN (peroxisome proliferator2activated receptor gamma,ppar2 motif2containing protein cdna ), 13 PPAR2 PPAR2 ACB P5 BRL49653 [4 ] : 24 ( hepatocyte nuclear factor24alpha, HNF24 ) [5 ] sirna HeLa, Hep G2 Chang ACBP ( http :ΠΠwww ncbi nlm nih govπgenomeπseqπpage cgi? F = HsBlast html && [6 ],ACBP ORG= Hs) ; (3) 2 ( gamma2aminobutyric acid2 [7 ergic, GABAergic) ] ( http :ΠΠgenes mit eduπ,acbp GENSCAN html) ; ACBP ; ; RT2 PCR RT2PCR RIKEN pcmv2sport6 cdna 113 ACB P bp ACB P5 118, : ACBP cdna 85 %, ncbi nlm nih govπgorfπgorf html) (2) : ( http :ΠΠwww ncbi nlm nih govπgenomeπseqπ page cgi? F = HsBlast html &&ORG= Hs) ;M2 (4) : ( http :ΠΠgenome MLV Invitrogen ; PFU DNA ; Roche ; (5) : ExPASy 2 ; ProtParam ; QIAquick Gel Extration Kit QIAGEN ; Trizol pcmv2 embl2heidelberg deπ) SPORT6 Stratagene ; DH5 (1) motif2containing protein (2) BLAST GenScan (4) EST (1) (ORF) : (http :ΠΠwww (3) : (http :ΠΠwww expasy orgπcgi2binπprotscale pl) cbs dtu dkπservicesπtmhmmπ) (6) : ( http :ΠΠsmart China Academic Journal Electronic Publishing House All rights reserved
3 RT2PCR cdna,rt2pcr 2 P1 (sense) : 5 2 TGAAAGATGAAGAGGGTAG2 3 3 P2 ( antisense ) : 5 2CAGAACTGATTTTATTAGCC2 HeLa 80 % Trizol ( Invitrogen) RNA, Fig gπl, M2MLV 212 ACB P5 (Invitrogen) mrna : oligo (dt) ORF finder ACB P5, RNase 1014 l,5 RT 410 l,dntp (250 molπl) 116 l,mrna (011 gπ L) 110 l,oligo (dt) l, :65 MUΠL) min PCR : 2 l :10 PCR 3 l,215 mmolπl dntps 3 l, 1 l (10 pmol), 1 l (10 pmol),ddh 2 O 10 l, 215 U Taq PCR :94 35 s,55 1 min,72 35 s,32 72, 7 min 115 [8 ] pcmv2sport6 N kb ACB P5 cdna ACBP 83 (Fig14) DIG (Roche) 213 ACB P5 DIG RNA RT2PCR ACB P5 pcmv2sport % ( ) [9,10 ] CNB P 116 RT2PCR acbp5 : 5 2TGAAAGATGAAGAGGGTAG23 5 2CAGAACTGATTTTATTAGCC bp dpc (Fig15 C) GA PDH 1015 dpc ( Fig15 D) 5 2ACCACAGTCCATGCCATCAC23 5 2TCCACCACCCTGTTGCTGTA23, 32,72 7 min PCR 10 l 2 % 211 ACB P5 ACB P5, cdna 1083 bp 118, 354 bp, ACB P5 cdna ATG TGA 5 min,37 60 min,75 5 min,mmlv (200 Poly A AATAAA (Fig11 ) ACB P5 ACB P kb 7,6 (Fig12) ACB P5 AK %(Fig13) ACB P dpc (Fig15 A), ACB P5, 9125 dpc (Fig15 B),ACB P ( HH 452 bp 100 mg ) ( Fig15 G) Trizol ( Invitrogen) 17 ( Fig15 H), RNA M2MLV ( Invitrogen), 19 ( ) PCR : (Fig15 I) 94 5 min,94 45 s, min,72 1 min China Academic Journal Electronic Publishing House All rights reserved
4 2 : ACB P5 cdna Π 167 Fig 1 cdna sequence of the human ACBP5 gene Coding sequences are shown together with the translated amino acid sequence Initiative code (ATG) and stop code (TGA) are underlined The polyadenylation signal sequences (AATAAA) are also underlined Fig 2 Genomic organization of ACB P5 gene The human ACB P5 gene is composed of 7 exons and 6 introns distributed over approximately 210 kb Solid bars represent exons The locations of initiative code ATG, stop code TGA and polyadenylation signal (PolyA signal) are indicated Fig 3 Alignment of human ACB P5 amino acid sequence with mouse AK The consensus sequences are shadowed They share 84 7 % similarity China Academic Journal Electronic Publishing House All rights reserved
5 Fig 4 Predicted domains of ACBP5 protein The red one represents ACBP domain Fig 5 Whole2mount in2situ hybridization of mouse embryo and chicken embryo A D show the in2situ hybridization result of mouse embryo (according to day post coitum, dpc) A1 715 dpc ; B dpc ; C1 915 dpc ; D dpc ; E Negative control ; F Positive control (CNBP as probe) G J show the result of in2situ hybridization in the chicken embryo (following Hamburger & Hamilton Stages) G Stage 12 ; H Stage 17 ; I Stage 19 ; J Negative control Arrow shows the stained part 215 RT2PCR Fig 6 polya, 166 ACBP ( ),ACB P5 3 ACB P5 A A China Academic Journal Electronic Publishing House All rights reserved
6 2 : ACB P5 cdna Π 169 Fig 6 RT2PCR result of matured mouse organs Upper pattern M:Marker ; 1 :Negative2control ;2 :eye ;3 :cerebella ;4 :uterus ;5 :heart ;6 :lung ;7 :muscle ;8 :brain ; 9 :testis ;10 :kidney ;11 :spleen ;12 :intestines ;13 :liver GAPDH was displayed lower to control for differences in loading 910 dpc ACBP5, [11 ] 9125 dpc, ACB P5, 915 dpc, 915 dpc, ( References) 1015 dpc 1015 dpc En21 FGF8 ACBP [12,13 ] RT2PCR, ACB P5, ACB P5, ACB P5, : ACB P5 A 1 Andersen KV, Poulsen F M Three2dimensional structure in solution of acyl2coenzyme A binding protein from bovine liver J Mol Biol,1992, 226 (4) : Cavagnari B M, Milikowski D, Haller J F, Zanek M C, Santome J A, Ermacora M R Optical characterization of armadillo acyl2coa binding protein Int J Biol Macromol, 2002, 31(123) : Li H Y, Chye M L Membrane localization of arabidopsis acyl2coa binding protein ACBP2, ( ) Plant Mol Biol, 2003, 51(4) : Ugale R R, Hirani K, Morelli M, Chopde C T Role of adipocyte lipid2 binding protein ( ALBP) and acyl2coa binding protein ( ACBP) in PPAR2mediated transactivation Mol Cell Biochem, 2002, 239 (122) : 5 Petrescu A D, Payne H R, Boedecker A, Chao H, Hertz R, Bar2Tana J, Schroeder F, Kier A B Physical and functional interaction of acyl2 CoA binding protein ( ACBP) with hepatocyte nuclear factor24alpha (HNF24alpha ) J Biol Chem,2003,278 (51) : Faergeman N J, Knudsen J Acyl2CoA binding protein is an essential protein in mammalian cell lines Biochem J, 2002, 368 ( Pt 3) : Marquardt H, Todaro GJ, Shoyab M Complete amino acid sequences of bovine and human endozepines Homology with rat diazepam binding inhibitor J Biol Chem,1986, 261 (21) : Wilkinson D G, In situ hybridization In : Stern C D, Holland P W H eds Essential Development Biology : A Pratical Approach Oxford : IRL Press, 1993 : Chen, W, Liang, Y, Deng W, Shimizu K, Ashique A M, Li E, Li, Y P The zinc2finger protein, CNBP, is required for forebrain development Development,2003, 130 : Shimizu, K, Chen, W, Liang Y, Shimizu K, Deng W, Li Y P China Academic Journal Electronic Publishing House All rights reserved
7 Characterization of CNBP Gene, the Gene Promoter and the Gene Expression Gene,2003, 306 : , :, ( Yu Hui2zhu, Ye Bai2kuan ed Embryonic Development on Mice Beijing : Science Press) 12 Preparation and characterization of two oligopeptides linked by a (Ma Bai2Kun, Xu Dong2Gang,Wang Jia2 Xi,Pen Shan2Yun,Li Li,Wang Li2Hong, Zou Min2Ji Construction and expression of human angiogeninπgfp fusion gene and its biological function Chin J Biochem Mol Biol), 2002,18(4) : NGF 2 (Li Xian2Hui,Chen Gui2Ying,Dou He2 Rong, Zhang Qing2Peng, Zhao Guo2Fa, Niu Yun2Tong, Li Ji2Sheng disulfide bridge with nerve growth promoting activity Chin J Biochem Mol Biol),2002,18 (4) : ,, ,1949 8,1953 6,1956 4,, ( ) , 2000, ! China Academic Journal Electronic Publishing House All rights reserved
SCIENTIA SILVAE SINICAE. a/ b. oldhamii). The length of cab2bo1 ( GenBank accession
43 3 2 0 0 7 3 SCIENTIA SILVAE SINICAE Vol143, No13 Mar., 2 0 0 7 a/ b 3 1 1 2 1 (1. 100102 ; 2. 100091) : RT2PCR RACE a/ b cdna, cab2 BO1 ( GenBank : EF061137) 1 102 bp, 64 861 bp 1, 265 cab2bo1 64 232
Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone
ISSN 100727626 CN 1123870ΠQ 2002 12 Chinese Journal of Biochemistry and Molecular Biology 18 (6) :693 697 cdna, 3, (, 150030) RNA, cdna cdna PCR, 380 bp cdna pmd2182t2verctor 3,,, 96 %, 95 %,, 74 %, 95
TGFp FSH INH INH
(210095) E-mail ( genlinwang@hotmail.com) - -(Strept Avidin-Biotin-Peroxidase Complex SABC), 1 32,, 1 inhibin INH α 32 000 TGFp FSH FSH [1] INHα Sertoli Noguchi 1997 [2] Meunier et al.1988 [3] INH INH
IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2
344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.
ER-Tree (Extended R*-Tree)
1-9825/22/13(4)768-6 22 Journal of Software Vol13, No4 1, 1, 2, 1 1, 1 (, 2327) 2 (, 3127) E-mail xhzhou@ustceducn,,,,,,, 1, TP311 A,,,, Elias s Rivest,Cleary Arya Mount [1] O(2 d ) Arya Mount [1] Friedman,Bentley
Chalkou I. C. [PROJECT] Ανάθεση εργασιών.
Πληροφορική της Υγείας 2014 Chalkou I. C. [PROJECT] Ανάθεση εργασιών. Περιεχόμενα 1. Ομάδα ΣΤ... 3 1.1 ΜΑΡΚΟΠΟΥΛΟΥ- ΣΠΥΡΟΠΟΥΛΟΥ -ΚΩΝΣΤΑΝΤΟΠΟΥΛΟΥ... 3 1.2 ΜΑΡΚΟΣ- ΚΟΥΤΣΟΠΟΥΛΟΣ ΑΥΓΕΡΗ - ΜΠΟΥΖΑΛΑ... 3 1.3
( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;
28 1 2006 1 RESOURCES SCIENCE Vol. 28 No. 1 Jan. 2006 :1007-7588(2006) 01-0002 - 07 20 1 1 2 (11 100101 ; 21 101149) : 1978 1978 2001 ; 2010 ; ; ; : ; ; 24718kg 1) 1990 26211kg 260kg 1995 2001 238kg( 1)
Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene
2001, 24 (1) : 2529 Journal of Nanjing Agricultural University rolc (, 210095) :, rolc ( Nicotiana tabacum ), GUS, PCR Southern rolc,, rolc : ; ; rolc ; : S572103513 : A : 1000Ο2030 (2001) 01Ο0025Ο05 Study
Supplementary information:
Supplementary information: Monitoring changes of docosahexaenoic acid-containing lipids during the recovery process of traumatic brain injury in rat using mass spectrometry imaging Shuai Guo 1, Dan Zhou
Distribution of Mercury and Selenium in the Proteins of Porcine Liver and Kidney Under Different Mercury Exposure Level
ISSN 100727626 CN 1123870ΠQ 2003 6 Chinese Journal of Biochemistry and Molecular Biology 19 (3) :377 382, 3,, (, 918 100039), (, 550002) (Sephadex G2100),, ;, ;, 11 kd (MT),,,,,,,,, Q51,X132 Distribution
ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ
- - ό ό : Ω ί ό ί ώ.. ά ή ί ός ή ς ύ ί ί ή έ ώ ό. ή ς ά ς ής ό ός ά ς ή έ ός ή ς ί ής ί ς. ό έ ώ - ώ ή ής ή ς- ί ά ά ς ί ς. ά ί ί έ έ ά ύ ή, ό ί ά, ό ό ά έ ά ής ί ύ George Wald ή ί έ ς ί ύ ό ς ί ς ά έ
Tan Xiaofeng Chen Hongpeng Zhang Dangquan Zeng Yanling Li Wei Jiang Yao Xie Lushan Hu Xiaoyi Hu Fangming. and Technology Changsha 410004)
44 3 2 0 0 8 3 SCIENTIA SILVAE SINICAE Vol144,No13 Mar.,2 0 0 8 FAD2 cdna ( 410004) : FAD2, EST, 5 RACE PCR FAD2 cdna 1 682 bp, 1 149 bp, 382, FAD2, FAD2 FAD2 : ; EST ; FAD2 ; RACE; PCR ; :S718146 ;Q94312
Congruence Classes of Invertible Matrices of Order 3 over F 2
International Journal of Algebra, Vol. 8, 24, no. 5, 239-246 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/.2988/ija.24.422 Congruence Classes of Invertible Matrices of Order 3 over F 2 Ligong An and
Antimicrobial Ability of Limonene, a Natural and Active Monoterpene
2010,32 (1) :24 28 http :/ / xuebao. jlau. edu. cn Journal of Jilin Agricultural University E2mail : jlndxb @vip. sina. com Ξ,,,, ΞΞ, 200062 : : 320 mg/ L,; ph 4 9, ; 80, 100,121 : : ; ; : TS20213 : A
8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,
31 2003 8 (FENXI HUAXUE) 8 Chinese Journal of Analytical Chemistry 976 980 22( 82 252 272 )21,82 23,62 3 (, 510631) 22(82 252 272 )21,82 23,62 (BSA), 8Q5SAC BSA 298K, 35 40 6. 1 10 5 LΠmol 8Q5SAC, ph =
High mobility group 1 HMG1
Vol. 29, pp.705 ~ 711, 2001 High mobility group 1 HMG1 13 12 20 anti-neutrophil cytoplasmic antibodies, ANCA ANCA 1982 Davies 1980 1 high mobility group HMG1 HMG2 30 kd high mobility group HMGHMG HMG1
,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78
ISSN 100727626 CN 1123870ΠQ 2002 4 Chinese Journal of Biochemistry and Molecular Biology 18 (2) :245 249 HLA2B2704 3 2) ( 2) 100044) HLA2B2704 286 HLA2B2704 DNA ( HLA2B2704 DNA) PCR F0 F1 RT2PCR HLA2B2704
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN
BIOTECHNOLOGY BULLETIN 2011 3 α 1 2-300457 PCR Helicobacter pylori HP DNA α 1 2- α 1 2-fucosyltransferase α 1 2-fuct 906 bp pet-22b + pet-fuct BL21 DE3 25 0. 1 mmol /L IPTG 4 h SDS-PAGE 33 kd α 1 2- BL21
M. marburgensis DX01 M. thermoautotrophicus M. marburgensis Marburg. MCR I mrna
2010 32 4 0797-0801 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com DX01 1 2 2* 1. 337000 2. 310058 DX01 Methanothermobacter marburgensis DX01 DX01
Shiraia sp. Slf14 III
39 4 Vol 39 No 4 2015 7 Journal of Jiangxi Normal University Natural Science Jul 2015 1000-5862 2015 04-0430-05 Shiraia sp Slf14 III 1 1 2 1 1 1 2* 1 330022 2 330013 Polyketide synthase PKS Shiraia sp
Molecular evolutionary dynamics of respiratory syncytial virus group A in
Molecular evolutionary dynamics of respiratory syncytial virus group A in recurrent epidemics in coastal Kenya James R. Otieno 1#, Charles N. Agoti 1, 2, Caroline W. Gitahi 1, Ann Bett 1, Mwanajuma Ngama
2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _
41 Vol.41, No. 01 RARE METAL MATERIALS AND ENGINEERING March 01 Pb O 4 PbO ( 710049) SnO -Sb Pb O 4 Pb O 4 100.5 h 970 h XRF XRD SEM Pb O 4 PbO PbO TG146.1 + A 100-185X(01)0-046-05 [1,] 1 PbO PbO Sn-Sb
The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea
2011 48 4 909 914 * 1 2** 2 2 2 2 2*** 1. 110161 2. 100081 026000 3 Calliptamus italicus L. 3 LC 50 LC 90 1. 34 14. 17 mg / L LC 50 LC 90 2. 09 45. 22 mg / L 50 mg / L 14 d 87% 100% 50 mg / L 50% The toxicity
Quick algorithm f or computing core attribute
24 5 Vol. 24 No. 5 Cont rol an d Decision 2009 5 May 2009 : 100120920 (2009) 0520738205 1a, 2, 1b (1. a., b., 239012 ; 2., 230039) :,,.,.,. : ; ; ; : TP181 : A Quick algorithm f or computing core attribute
Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin
2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,
rp, ribosomal protein 60S rp mrna rpl30 rps14 RT-PCR mrna nonsense-mediated mrna decay smg-2 smg-2 mrna rp rpl-1 rpl-1
rp, ribosomal protein 60S 47 rpl 40S 32 rps rp mrna rpl30 rps14 rpl12 rpl3 rps13 rp mrna nonsense-mediated mrna decay (NMD) C. elegans smg-2 smg-2 mrna 50 rp 7 rp 4 rpl 4 rp NMD mrna 6 rp mrna rp mrna
Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application
31 5 2011 5 Acta Scientiae Circumstantiae Vol 31 No 5 May 2011 2011 - J 31 5 935-940 Huang Y M Yuan D X Peng Y Z et al 2011 Rapid determination of soluble reactive silicate in seawater by flow injection
Journal of the CUN(Natural Sciences Edition) ...
2007 2 16 1 ( ) Journal of the CUN(Natural Sciences Edition) Feb. 2007 Vol. 16 No. 1 1,2, 1, 1, 2 (11, 100081 ; 21, 100875) :. 2,42D NAA 62BA.,.. : ; ; ; :Q94513 :A :100528036 (2007) 0120023206 : (1),
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to facilitate intracellular survival Hongwei Gu 1,2*, Chihao Zhao 1,2*, Tianfu Zhang 1,2*, Hongwei Liang 1,2, Xiao-Ming Wang 1,
Supporting Information
Supporting Information Mitochondria-Targeting Polydopamine Nanocomposites as Chemophotothermal Therapeutics for Cancer Zhuo Wang *,, Yuzhi Chen, Hui Zhang, Yawen Li, Yufan Ma, Jia Huang, Xiaolei Liu, Fang
College of Life Science, Dalian Nationalities University, Dalian , PR China.
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2018 Postsynthetic modification
Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes
Supporting Information for Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes Changkun Li and Jianbo Wang* Beijing National Laboratory
svari Real-time RT-PCR RSV
19 39-43 12 Real-time RS svarireal-time RSV subgroup HMPV RSV N Real-time 100 100 Real-time RSV subgroup RSV HMPV F Real-time 55.8 95.5 genotype A2 B1 TaqMan svari InfV RS RSV HMPV HRV PIV RSV HMPV RSV
Science of Sericulture
Science of Sericulture 2012 38 1 0065-0069 ISSN 0257-4799 CN 32-1115 /S E-mail CYKE@ chinajournal. net. cn 215123 25 0 ~ 24 h GSH GSSG GSH + 2GSSG GSH /GSSG S- GST TPX 23% GR 57% GSH TPX GST GSSG 61% GSH
, Litrrow. Maxwell. Helmholtz Fredholm, . 40 Maystre [4 ], Goray [5 ], Kleemann [6 ] PACC: 4210, 4110H
57 6 2008 6 100023290Π2008Π57 (06) Π3486208 ACTA PHYSICA SINICA Vol. 57,No. 6,June,2008 ν 2008 Chin. Phys. Soc. 3 1) 2) 1) g 1) (, 130033) 2) (, 100049) (2007 9 11 ;2007 11 14 ),Littrow,,.,., Litrrow.
Αθήνα, 15 Οκτωβρίου 2014 Αρ. Πρωτ.: 2988
ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΓΕΝΙΚΗ ΓΡΑΜΜΑΤΕΙΑ ΕΡΕΥΝΑΣ & ΤΕΧΝΟΛΟΓΙΑΣ Αθήνα, 15 Οκτωβρίου 2014 Αρ. Πρωτ.: 2988 Θέμα: Έγκριση πρόσκλησης εκδήλωσης ενδιαφέροντος με απευθείας ανάθεση
Cloning of Stage2specific Gene Fragments in Rabbit Embryos
Chinese Journal of Zoology 2009,44 (4) :41 46 3 ( 271016 ; 100101 ; 236041) :, mrna ( Oryctolagus cuniculus domestica) 42, 5 NCBI EMBL, EMBL,, 8 16, : ;mrna ;; :Q132 :A :025023263 (2009) 04241206 Cloning
J. of Math. (PRC) Banach, , X = N(T ) R(T + ), Y = R(T ) N(T + ). Vol. 37 ( 2017 ) No. 5
Vol. 37 ( 2017 ) No. 5 J. of Math. (PRC) 1,2, 1, 1 (1., 225002) (2., 225009) :. I +AT +, T + = T + (I +AT + ) 1, T +. Banach Hilbert Moore-Penrose.. : ; ; Moore-Penrose ; ; MR(2010) : 47L05; 46A32 : O177.2
Introduction to Bioinformatics
Introduction to Bioinformatics 260.602.01 September 2, 2005 Jonathan Pevsner, Ph.D. pevsner@jhmi.edu bioinformatics medical informatics Tool-users public health informatics databases algorithms Tool-makers
Mouse Gene 2.0 ST Array Shn3. Runx2 Shn3. Runx2 Shn3 Runx2. adult. (Schnurri, Shn)3/Hivep3. Runx2 Shn/Hivep. ST2 BMP-2 Shn3
adult (Schnurri, Shn)3/Hivep3 Runx2 Shn/Hivep Shn3 Shn3 Shn3 Shn3 Shn1 Shn2 Shn3 gain-of-function loss-of-function Shn3 in vivo mimic MC3T3-E1 ST-2 ATDC5 C3H10T1/2 ALP RT-PCR alcian blue RT-PCR Affymetrix
Chinese Journal of Biochemistry and Molecular Biology RNA.
ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2009 8 25 (8) :759 763 RNA 1), 2), 1) 3, 1) 1),2), ( 1), 400014 ; 2), 400014) RNA, (CTGF) RNA. EcoR Hind, ptm12 CTGF PCR
Ινσουλίνη και καρδιά. Ηλιάδης Φώτης Λέκτορας Α.Π.Θ.
Ινσουλίνη και καρδιά Ηλιάδης Φώτης Λέκτορας Α.Π.Θ. Επίδραση ινσουλίνης στο ήπαρ, στους μυς και στον λιπώδη ιστό : Διατήρηση ευγλυκαιμίας Nature 2001;414:799 806 Ινσουλίνη? Λειτουργικότητα Μορφολογία Βιωσιμότητα
A summation formula ramified with hypergeometric function and involving recurrence relation
South Asian Journal of Mathematics 017, Vol. 7 ( 1): 1 4 www.sajm-online.com ISSN 51-151 RESEARCH ARTICLE A summation formula ramified with hypergeometric function and involving recurrence relation Salahuddin
MUL TIL EVEL2USER2ORIENTED AGRICUL TURAL INFORMATION CLASSIFICATION
25 2 2003 3 RESOURCES SCIENCE Vol. 25 No. 2 Mar. 2003 1 2 1 (11 100101 21 410083) : : 7 : :F06215 F3 TP393107 :A :1007-7588(2003) 02-0020 - 06 MUL TIL EVEL2USER2ORIENTED AGRICUL TURAL INFORMATION CLASSIFICATION
JOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3. PCR bp BCCP. pet-28a Escherichia coli BL21 DE3 Ni-NTA
6 2011 5 31 3 JOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3 A ACC CT * 430070 PCR A ACC 2 42 ~ 147 bp 315 ~ 677 bp 6 801 bp A 3 BC BCCP CT CT pet-28a Escherichia coli BL21 DE3 Ni-NTA CT 1. 8 mg /ml ACC
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity Jian-Long Li 1,a, Wei Zhao 1,a, Chen Zhou 1,a, Ya-Xuan
Mean bond enthalpy Standard enthalpy of formation Bond N H N N N N H O O O
Q1. (a) Explain the meaning of the terms mean bond enthalpy and standard enthalpy of formation. Mean bond enthalpy... Standard enthalpy of formation... (5) (b) Some mean bond enthalpies are given below.
The Structure of Lecithin Cholesterol Acyltransferase( LCAT)
ISSN 100727626 CN 1123870ΠQ 2002 2 Chinese Journal of Biochemistry and Molecular Biology 18 (1) :64 69 cdna,, 3,,, 1) (, 100005) (LCAT) cdna, mrna cdna, SMART2 RACE, LCAT cdna, LCAT cdna ( GenBank AF324887)
CPT. Tsuchiya. beta. quantitative RT PCR QIAGEN IGFBP. Fect Transfection Reagent sirna. RT PCR RNA Affymetrix GeneChip Expression Array
7 PTEN p Tsuchiya DNA Hepatocyte nuclear factor beta HNF beta HNFbeta IGFBP GLUT G Pase MODY maturity onset diabetes of the young Tsuchiya HNFbeta HNFbeta HNFbeta sirna CPT HNFbeta HNFbeta TOVG KOC ESMCAS
Cellular Physiology and Biochemistry
Original Paper 2016 The Author(s). 2016 Published The Author(s) by S. Karger AG, Basel Published online: November 25, 2016 www.karger.com/cpb Published by S. Karger AG, Basel 486 www.karger.com/cpb Accepted:
Novel and Selective Palladium-Catalyzed Annulation of 2-Alkynylphenols to Form 2-Substituted 3-Halobenzo[b]furans. Supporting Information
Novel and Selective Palladium-Catalyzed Annulation of 2-Alkynylphenols to Form 2-Substituted 3-Halobenzo[b]furans Liang Yun, Shi Tang, Xu-Dong Zhang, Li-Qiu Mao, Ye-Xiang Xie and Jin-Heng Li* Key Laboratory
Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic
Supporting Information Asymmetric Binary-acid Catalysis with Chiral Phosphoric Acid and MgF 2 : Catalytic Enantioselective Friedel-Crafts Reactions of β,γ- Unsaturated-α-Ketoesters Jian Lv, Xin Li, Long
Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2015 Supporting information An unusual bifunctional Tb-MOF for highly sensing
Advances in the study of to0in in halobios
11 3 Vol.11 No.3 2002 9 J0URNAL 0F SHANGHAI FISHERIES UNIVERSITY Sep. 2002!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! 1004-7271 2002 03-0283 - 06 Advances in the study of to0in in halobios
Electronic Supplementary Information DFT Characterization on the Mechanism of Water Splitting Catalyzed by Single-Ru-substituted Polyoxometalates
Electronic Supplementary Information DFT Characterization on the Mechanism of Water Splitting Catalyzed by Single-Ru-substituted Polyoxometalates Zhong-Ling Lang, Guo-Chun Yang, Na-Na Ma, Shi-Zheng Wen,
SCITECH Volume 13, Issue 2 RESEARCH ORGANISATION Published online: March 29, 2018
Journal of rogressive Research in Mathematics(JRM) ISSN: 2395-028 SCITECH Volume 3, Issue 2 RESEARCH ORGANISATION ublished online: March 29, 208 Journal of rogressive Research in Mathematics www.scitecresearch.com/journals
Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2
Free Radical Initiated Coupling Reaction of Alcohols and Alkynes: not C-O but C-C Bond Formation Zhongquan Liu,* Liang Sun, Jianguo Wang, Jie Han, Yankai Zhao, Bo Zhou Institute of Organic Chemistry, Gannan
SOD SNP % Cu /Zn-SOD. DAM- BE DNAStar % Mn /Fe-SOD. 6 1SNP /17. 9 bp
2011 33 6 1206-1211 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com SOD SNP 1 2 3 2 2* 1. 330004 2. 330004 3. 510006 GenBank Cu /Zn-SOD Mn /Fe-SOD
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή Εργασία. Κόπωση και ποιότητα ζωής ασθενών με καρκίνο.
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή Εργασία Κόπωση και ποιότητα ζωής ασθενών με καρκίνο Μαργαρίτα Μάου Λευκωσία 2012 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ
Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού
Σχολή Θετικών Επιστημών Τμήμα Βιολογίας Πρόγραμμα Μεταπτυχιακών Σπουδών Κατεύθυνση: Εφαρμοσμένη γενετική και βιοτεχνολογία ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου
D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical and experimental study
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical
Electronic Supplementary Information
Electronic Supplementary Information Unprecedented Carbon-Carbon Bond Cleavage in Nucleophilic Aziridine Ring Opening Reaction, Efficient Ring Transformation of Aziridines to Imidazolidin-4-ones Jin-Yuan
Supplementary Information for
Supplentary Information for Aggregation induced blue-shifted ission molecular picture from QM/MM study Qunyan Wu, a Tian Zhang, a Qian Peng,* b Dong Wang, a and Zhigang Shuai* a a Key Loratory of Organic
Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer
Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer Naomi Morota Newman M Key Words woman diagnosed with breast cancer, rehabilitation nursing care program, the
Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
33 2 2011 4 Vol. 33 No. 2 Apr. 2011 1002-8412 2011 02-0096-08 1 1 1 2 3 1. 361005 3. 361004 361005 2. 30 TU746. 3 A Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica
35 1 2 0 1 7 1 DOI 10. 13193 /j. issn. 1673-7717. 2017. 01. 035 1 1 1 1 2 1. 150036 2. 150040 D101 DEAE Cellulose 52 Sephacryl S - 300 - - PJP - 1a PJP - 3a 1. 34 10 3 Da 1. 70 10 7 Da - PJP - 3a 4. 56
Πτυχιακή Εργασία Η ΠΟΙΟΤΗΤΑ ΖΩΗΣ ΤΩΝ ΑΣΘΕΝΩΝ ΜΕ ΣΤΗΘΑΓΧΗ
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή Εργασία Η ΠΟΙΟΤΗΤΑ ΖΩΗΣ ΤΩΝ ΑΣΘΕΝΩΝ ΜΕ ΣΤΗΘΑΓΧΗ Νικόλας Χριστοδούλου Λευκωσία, 2012 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ
1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.
2 0 1 5 7 Journal of Chinese Institute of Food Science and Technology Vol. 15 No. 7 Jul. 2 0 1 5 1,2 1 1 1 1* ( 1 315211 2 315502) : ( ) : (E-Nose), - : GC-MS, 20.98% 2.5%, 53.15% 11.2%, 0. 51% 71.86%
Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic
Identification of Fish Species using DNA Method
5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,
2 0 1 2 2 Journal of Shanghai Normal University Natural Sciences Feb. 2 0 1 2 SNAT2. HEK293T Western blot SNAT2 - HA Q 31 A 1000-5137 2012 01-0083-06
4 1 1 Vol 41 No 1 2 0 1 2 2 Journal of Shanghai Normal University Natural Sciences Feb 2 0 1 2 SNAT2 - HA * 200234 SNAT2 - SNAT2 PCR HA SNAT2 C pbk - CMVΔ 1098-1300 - SNAT2 - HA HEK293T Western blot SNAT2
( HN2y Co14 Co8 Co36 Sx (2) 56 (2) ) 16S
16S23S rrna 197 16S23S rrna (, 100050) : 16S23S rrna,, 2, 16S23S rrna,3 3 (ATCC10248 NCPPB 947 NCPPB3580) 1 B. phenazinium (LMG2247) 8 ( HN2y Co14 Co8 Co36 Sx8801 90-3 56 (2) 56 (2) ) 16S 23S rrna,( GenBank)
Το Βιολογικό Ρολόι: Θεµελιώδης Ρυθµιστής της Φυσιολογίας των Οργανισµών
Ιούλιος 2005 Το Βιολογικό Ρολόι: Θεµελιώδης Ρυθµιστής της Φυσιολογίας των Οργανισµών ρ. Α. Προµπονά Εργαστήριο Ρύθµισης της Μεταγραφής από το Βιολογικό Ρολόι Κιρκαδικό Ρολόι Ρυθµοί µε περίοδο ~ 24 ωρών
Nov Journal of Zhengzhou University Engineering Science Vol. 36 No FCM. A doi /j. issn
2015 11 Nov 2015 36 6 Journal of Zhengzhou University Engineering Science Vol 36 No 6 1671-6833 2015 06-0056 - 05 C 1 1 2 2 1 450001 2 461000 C FCM FCM MIA MDC MDC MIA I FCM c FCM m FCM C TP18 A doi 10
Chinese Journal of Biochemistry and Molecular Biology CK2 252
ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2008 9 24 (9) :826 832 CK2 252 1) 3 3, 1),2) 3 3, 1),2) 3, 1) ( 1), 524023 ; 2), 523808) CK2 Π. CK2, pact2 cdna CK2. CK2,
VSC STEADY2STATE MOD EL AND ITS NONL INEAR CONTROL OF VSC2HVDC SYSTEM VSC (1. , ; 2. , )
22 1 2002 1 Vol. 22 No. 1 Jan. 2002 Proceedings of the CSEE ν 2002 Chin. Soc. for Elec. Eng. :025828013 (2002) 0120017206 VSC 1, 1 2, (1., 310027 ; 2., 250061) STEADY2STATE MOD EL AND ITS NONL INEAR CONTROL
Chalkou I. C. [PROJECT] Ανάθεση εργασιών.
Πληροφορική της Υγείας 2014 Chalkou I. C. [PROJECT] Ανάθεση εργασιών. Περιεχόμενα 1. Ομάδα Δ... 3 1.1 Σκιαδά Σαϊσανά Σιδέρη- Γεωργίου... 3 1.2 ΜΗΤΡΟΥ - ΜΠΑΡΑ... 3 1.3 ΜΠΟΧΑΤΖΙΑΡ Α.- ΜΠΟΧΑΤΖΙΑΡ Φ. - ΠΛΕΥΡΙΑ...
C.S. 430 Assignment 6, Sample Solutions
C.S. 430 Assignment 6, Sample Solutions Paul Liu November 15, 2007 Note that these are sample solutions only; in many cases there were many acceptable answers. 1 Reynolds Problem 10.1 1.1 Normal-order
30s 56 60s 72 60s dntp cm s s s 23
31 3 Vol 31 No 3 2012 8 JOURNAL OF OCEANOGRAPHY IN TAIWAN STRAIT Aug 2012 AFLP 1 1 2 1 1 361005 2 361005 dntp Taq Mg 2 + 300 ng DNA 5U PstI 5U MseI 4 h 16 10 50 AFLP AFLP 64 12 AFLP DOI 10 3969 /J ISSN
Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk
32 3 2011 3 ENVIRONMENTAL SCIENCE Vol 32 No 3 Mar 2011 1 1 1 2 1 100101 2 663000 Panax notoginseng Burk F H Chen 6 9 ~ 242 0 mg kg - 1 48% 2 mg kg - 1 24% 81% 14% 57% 44% 100 mg kg - 1 ADI > > > > FAO
P450 CYP4G19. Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody , 518060; 2.
2009 6 9 6 [ ] 1672-3619(2009)06-0591-06 591 P450 CYP4G19 1,2 1,2*,, 2, 2, 2, 2 1, (1., 518060; 2., 518020) P450 CYP4G19, CYP4G19 RT-PCR CYP4G19, T-A, pet-28a, BL21 (DE3),,,, ELISA Western-blot cdna 771bp,
Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo
Bull. Earthq. Res. Inst. Univ. Tokyo Vol. 2.,**3 pp.,,3,.* * +, -. +, -. Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Kunihiko Shimazaki *, Tsuyoshi Haraguchi, Takeo Ishibe +, -.
Gene Expression and Biotoxicological Properties of Recombinant Human Brain Acetylcholinesterase
ISSN 100727626 CN 1123870ΠQ 2002 2 Chinese Journal of Biochemistry and Molecular Biology 18 (1) :44 49 1) 2) 1) 1) 3,,, ( 1), 100850 ; 2) 0, 100039) cdna pcdna3 1, pcdna2 AChE 293, rhache rhache AChE rhache
A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Chinese Journal of Biochemistry and Molecular Biology ERR . I2 (TNNI2) GST2TNNI2, 1. 1
ISSN 100727626 CN 1123870ΠQ 2005 10 Chinese Journal of Biochemistry and Molecular Biology 21 (5) :656 660 I2 ERR 1,,,,, (, 400038) 3 1 ( ERR 1) I2 (TNNI2) TNNI2 ERR 1, GST2TNNI2, 35 S ERR 1, GST,TNNI2
ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ
1 ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΑΝΑΡΤΗΤΕΑ ΣΤΟ ΔΙΑΔΙΚΤΥΟ ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ Ηράκλειο, 04.02.2014 Αρ. πρωτ. 1054 Ο Ειδικός Λογαριασμός του Πανεπιστημίου Κρήτης
Models for Asset Liability Management and Its Application of the Pension Funds Problem in Liaoning Province
005 9 9 :0006788 (005) 0900407, (, 0004) :,,,.,,.,. : ; ;; : F830 : A Models for Asset Liability Management and ts Application of the Pension Funds Problem in Liaoning Province J N Xiu, HUANG Xiaoyuan
Research on explaining porosity in carbonate reservoir by capture cross section method
33 4 2014 12 GLOBAL GEOLOGY Vol. 33 No. 4 Dec. 2014 1004-5589 2014 04-0875 - 05 1 2 1 2 1. 130026 2. 830011 PND SIGMA CATO SIGMA CNL 0. 91 SIGMA CATO P631. 325 A doi 10. 3969 /j. issn. 1004-5589. 2014.
(1) A lecturer at the University College of Applied Sciences in Gaza. Gaza, Palestine, P.O. Box (1514).
1439 2017, 3,29, 1658 7677: 1439 2017,323 299, 3,29, 1 1438 09 06 ; 1438 02 23 : 33,,,,,,,,,,, : The attitudes of lecturers at the University College of Applied Sciences in Gaza (BA - Diploma) towards
Supporting Information. Multigenerational Disruption of Thyroid Endocrine System in Marine Medaka
Supporting Information Multigenerational Disruption of Thyroid Endocrine System in Marine Medaka after A Life-Cycle Exposure to Perfluorobutane Sulfonate (PFBS) Lianguo Chen,, Chenyan Hu #, Mirabelle M.
[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,
in vitro αα In Vitro α-glucosidase and α-amylase Inhibitory Effects of Herbal Tea Leaves from Yacon (Smallanthus sonchifolius) 1, 1, 1, 2, 1, 2, 3, 1, 2, 1, 2, 1, 2, 1, 2 1, 2, *, 1 2, 3 Yuto Ueda 1, Shintaro
Stress Relaxation Test and Constitutive Equation of Saturated Soft Soil
8 7 011 7 Journal of Highway and Transportation Research and Development Vol. 8 No. 7 Jul. 011 100-068 011 07-0014 - 05 1 1. 0009. 710064 k 0 Merchant 4 Merchant U416. 1 + 6 A Stress Relaxation Test and
ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΙΣ «ΚΛΙΝΙΚΕΣ ΚΑΙ ΚΛΙΝΙΚΟΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΤΡΙΚΕΣ ΕΙΔΙΚΟΤΗΤΕΣ»
ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΙΣ «ΚΛΙΝΙΚΕΣ ΚΑΙ ΚΛΙΝΙΚΟΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΤΡΙΚΕΣ ΕΙΔΙΚΟΤΗΤΕΣ» ΑΡΝΗΤΙΚΗ ΡΥΘΜΙΣΗ ΤΗΣ ΜΕΤΑΒΙΒΑΣΗΣ ΤΟΥ ΣΗΜΑΤΟΣ ΤΗΣ
Q L -BFGS. Method of Q through full waveform inversion based on L -BFGS algorithm. SUN Hui-qiu HAN Li-guo XU Yang-yang GAO Han ZHOU Yan ZHANG Pan
3 2015 12 GLOBAL GEOLOGY Vol. 3 No. Dec. 2015 100 5589 2015 0 1106 07 L BFGS Q 130026 Q 2D L BFGS Marmousi Q L BFGS P631. 3 A doi 10. 3969 /j. issn. 1005589. 2015. 0. 02 Method of Q through full waveform
Advance in Nanorealgar Studies
21 5 2009 5 PROGRESS IN CHEMISTRY Vol. 21 No. 5 May, 2009 1 1 2 3 (1. 430074 ; 2. 430074),,, ;,, : O61316 ; R284 : A : 10052281X(2009) 0520934206 Advance in Nanorealgar Studies Ye Xiaochuan 1 Yang Xiangliang
(Vibrio anguillarum) (Cyclina sinensis) *
43 4 Vol.43, No.4 2012 7 OCEANOLOGIA ET LIMNOLOGIA SINICA July, 2012 (Vibrio anguillarum) (Cyclina sinensis) * ( 300387) (GSTs), SMART cdna, σ (CsGSTS) PCR CsGSTS, CsGSTS cdna 793bp, 206, GST-N GST-C GSTs
PCR. Site-directed Mutagenesis of Sumf 1 Gene of Mouse Based on Overlap Extension PCR and Construction of Eukaryotic Expression Vector
13 5 Vol13 No5 9 10 Life Science Research Oct 9 9 PCR Sumf1 *,,,,, 481 : (chromatin immunoprecipitation assay, ChIP) activator protein-2 alpha (AP-2 α) Sumf 1 PCR, AP-2 α Sumf 1, DNA, Sumf 1 103 ~111,
þÿ Ç»¹º ³µÃ ± : Ãż²» Ä Â
Neapolis University HEPHAESTUS Repository School of Economic Sciences and Business http://hephaestus.nup.ac.cy Master Degree Thesis 2015 þÿ Ç»¹º ³µÃ ± : Ãż²» Ä Â þÿãå½±¹ã ¼±Ä¹º  ½ ¼ Ãͽ  þÿ±à ĵ»µÃ¼±Ä¹º
Supporting Information
Supporting Information for AgOTf-catalyzed one-pot reactions of 2-alkynylbenzaldoximes with α,β-unsaturated carbonyl compounds Qiuping Ding 1, Dan Wang 1, Puying Luo* 2, Meiling Liu 1, Shouzhi Pu* 3 and
Supporting Information
Supporting Information Lewis acid catalyzed ring-opening reactions of methylenecyclopropanes with diphenylphosphine oxide in the presence of sulfur or selenium Min Shi,* Min Jiang and Le-Ping Liu State