Expression of Porcine SFRP4 and Its Effect on Differentiation of Preadipocytes via Inhibitor SP600125
|
|
- Καλυψώ Δεσποτόπουλος
- 8 χρόνια πριν
- Προβολές:
Transcript
1 ISSN CN / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology ~ 463 SFRP4 SP * secreted frizzled-related protein 4 SFRP4 Wnt Solexa PCR RT-qPCR SFRP4 JNK SP JNK SFRP4 mrna SFRP4 P < 0 01 SFRP4 SFRP4 SP PPARγ FABP4 ATGL Perilipin P < 0 01 SFRP4 4 SP Q78 Q246 Expression of Porcine SFRP4 and Its Effect on Differentiation of Preadipocytes via Inhibitor SP GUAN Hua ZHENG Jia-Meng CHEN Zong-Zheng SONG Zi-Yi YANG Hao YANG Gong-She * Laboratory of Animal Fat Deposition and Muscle Development College of Animal Science and Technology Northwest A&F University Yangling Shaanxi China Abstract Secreted frizzled-related protein 4 SFRP4 was the regulator of Wnt signaling pathway The expression of SFRP4 in fat tissues of different genotype pigs and in different growth periods were explored by high-throughout sequencing Solexa and real-time quantity PCR RT-qPCR The effect on differentiation of preadipocyte and the expression level of SFRP4 were explored by inhibitor SP in JNK signaling pathway The results showed that expression level of SFRP4 was higher in fat tissues of obese-type than that in the lean-type Expression level of SFRP4 in the porcine fat tissue and adipocyte was influenced by ages and was higher in fat but lower in other tissues SP promoted the adiocytes to differentiate and significantly increased expression levels of PPARγ FABP4 ATGL Perilipin but the SFRP4 expression level was inhibited significantly This research provides a new reference for screen the key genes in adipocyte differentiation Key words secreted frizzled-related protein 4 high-throughput sequencing preadipocyte inhibitor SP differentiation No 2009ZX B * Tel E- mail gsyang999@ hotmail com Received January Accepted March Supported by Genetically Modified Organisms Breeding Major Projects No 2009ZX B * Corresponding author Tel E- mail gsyang999@ hotmail com
2 secreted frizzled- related protein 4 SFRP Rattner SFRP4 1 Wnt 15 Wnt / cm 2 SFRP4 3 4 ~ 9 60 mm 10% 10 DMEM / F % CO 2 1 d 2 d 1 SFRP4 Fzd5 Wnt7a 100% 15 μmol / L Wnt7a JNK SP h 48 h 72 h 11 3 DMSO 3 JNK RNA 12 ~ 13 JNK SFRP Ouchi 16 PBS I SFRP min r / min 5 min SFRP4 adipocyte AD PCR AD SVF RNA RT-qPCR SFRP4 SFRP4 mrna mrna 1 4 Solexa 17 JNK RNA 1 ~ 2 g Oligo dt beads SP JNK RNA mrna cdna 4 JNK SFRP4 Nla III cdna Illumina ~ adapter 2 5 kg 0 5% 0 5 hn 1 Clean Tag Clean tag Clean tag Clean tag Trizol RT TaKaRa RTqPCR DMEM / 1 5 PCR F12 I Gibco DMEM / F12 Hyclone PVDF ECUL Invtrogen SFRP4 anti-goat β-actin p-jnk anti-mouse Santa Cruz JNK SP Sigma stromal vascular fractions SVF adapter1 Mme I 3' 20 3 ' Illumina adapter2 Primer GX1 Primer GX2 PCR 6% TBE PAGE 85 Illumina Clean tag β-actin SFRP4 PPARγ FABP4 ATGL Perilipin RT-qPCR NCBI Table 1
3 5 SFRP4 SP Table 1 Primer sequences and parameters for RT- qpcr amplification of the related genes Gene GenBank accession number Primer sequence 5'-3' Length / bp β-actin AF FP GGACTTCGAGCAGGAGATGG 138 RP AGGAAGGAGGGCTGGAAGAG SFRP4 NM_ FP TGCCAGTGTCCTCACATCCTAC 168 RP GACTGTCCTCTGCTGCTCCTG PPARγ NM_ FP AGGACTACCAAAGTGCCATCAA 142 RP GAGGCTTTATCCCCACAGACAC Perilipin NM_ RP CAGCCAAGGAAGAGTCAGC 107 FR CCTGGAAGGTGTGTTGAGAG FABP4 NM_ RP GAGCACCATAACCTTAGATGG 121 FP AAATTCTGGTAGCCGTGACA ATGL NM_ RP CCTCATTCCACCTGCTCTCC 90 FP GTGATGGTGCTCTTGAGTTCGT - 70 SP DMSO RNA 1 8 cdna SPSS18 0 One-way 1 RT cdna ANOVA SYBR Green I ± Mean ± SE PCR 2 20 μl cdna 1 μl FP RP 1 μl ReaulMasterMix / SYBR solution 9 μl ddh 2 O 20 μl PCR 95 3 min s s s Solexa SFRP4 mrna C t β-actin SFRP4 PPARγ FABP4 Perilipin ATGL PCR Fig 1A CT PCR β-actin 1 6 O PBS 3 4% O min SFRP4 1 7 Western mrna SFRP4 Fig 2A PCR 100 mg 1 ml ml 2 1 SFRP4 SFRP4 SFRP4 mrna Fig 1B min PBS 10 min SFRP4 Solexa 180 SFRP4 mrna SFRP4 PBS μl Fig 2B 2 3 SFRP4 4 PCR r / min 10 min SFRP4 mrna min SFRP4
4 Fig 1 Variation of abundance for SFRP4 in pig fat tissues of different growing phases Two RNA pools of subcutaneous adipose tissue one from 3 days old pigs one from 240 days pigs were used in the expression analysis of SFRP4 All experiments repeated three times Both Solexa sequencing and RT-qPCR analysis revealed that SFRP4 expression level was increased as the age increasing P < 0 01 n = 3 A Expression level of SFRP4 in 3 days old and 240 days old pig fat tissues by Solexa sequencing analysis P < 0 01 n = 3 B Relative expression level of SFRP4 in 3 days old 240 days old pig fat tissues by RT-qPCR P < 0 01 n = 3 Fig 2 Variation of abundance for SFRP4 in different breed pig fat tissues Two RNA pools of subcutaneous adipose tissues one from four 180 days old pigs lean type and one from four 240 days old pigs obese type were used in the expression analysis of SFRP4 All experiments repeated three times Both Solexa sequencing and RT-qPCR analysis revealed that SFRP4 was much higher expressed in obese type porcine fat tissue than in lean type porcine fat tissue P < 0 01 n = 3 A Expression levels of SFRP4 in lean type and obese type porcine fat tissues by Solexa sequencing analysis P < 0 01 n = 3 B Relative expression levels of SFRP4 in lean type and obese type pig fat tissues by RT-qPCR P < 0 01 n = 3 Fig 3A mrna Fig 4C Fig 3B 2 4 SFRP Fig 4D 24 h SFRP4 SFRP4 Fig 4A RT-qPCR Western 80% 0 d 2 d 3 2 d 4 d 6 d 8 d 2 d 0 d 2 d 4 d 6 d 8 d AD Fig 4B 8 d O SVF RT-qPCR SFRP4 mrna
5 5 SFRP4 SP Fig 3 Relative expression levels of SFRP4 in normal pig tissues lean type Collected 180 days various white pig tissues WAT white adipocyte tissue Heart Liver Spleen Lung Kidney S muscle Skeletal muscle and Brain and extracted total RNA and total protein SFRP4 expression levels were determined in different tissues by RT-qPCR and Western blotting and calculated with the 2 - CT method as normalization with β-actin All experiments repeated three times The expression level of SFRP4 is highest in WAT A The mrna expression level of SFRP4 qualified by RT-qPCR n = 3 B Western blot analysized the SFRP4 protein level of various tissues n = 3 Fig 5 Expression of SFRP4 during the pig adipocyte differentiation in vitro Preadipocytes separated from adipose of piglets were directly plated in DMEM / F12 medium differentiated induced and harvested at various time points as indicated extracted total RNA and total protein SFRP4 expression levels were determined by RT-qPCR and - Western blotting and calculated with the 2 CT method as normalization with β-actin All experiments were repeated three times A C RT-qPCR and Western blotting qualified the time course mrna and protein expression levels of SFRP4 Whole cells were harvested at days after inducing differentiation The results indicated that the expression levels of SFRP4 increased gradually reached peak at the 8 days P < 0 05 n = 3 B SFRP4 transcript levels in adipocyte AD and stromal vascular fractions SVF isolated from white adipose tissues of 3 days pig as measured by RT-qPCR analysis and expressed relative to β-actin The SVF mrna expression level of SFRP4 were higher than AD P < 0 05 n = 3 SFRP4 0 d 2 5 JNK Fig 5 A Fig 5C SP JNK SFRP4 mrna SP JNK Fig 5B JNK SFRP4 DMEM / F12 15μmol / L SP600125
6 Fig 4 Morphology observation of porcine primary adipocytes A Adipocytes were cultured in vitro for 24 hours showing stretched fibroblast-like or triangle cell phenotypes B Adipocytes were differentiated in the early stage for 2 days showing small lipid droplet in cytoplasm C Adipocytes were differentiated into mature stage for 8 days Some small lipid droplets fusing into big lipid droplets D Differentiated adipocytes stained by oil red O Lipid droplets were stained red by oil red O 24 h 48 h 72 h 24 h Fig 6A 6D 48 h Fig 6E Fig 6B 72 h Fig 6F Fig 6C SP SFRP4 SP h JNK Fig 6B SFRP4 mrna Fig 7A 7B PPARγ FABP4 Perilipin ATGL mrna 48 h P < 0 01 Fig 7C Fig 6 Morphology observation of porcine primary adipocytes treated with SP Primary cultured porcine preadipocytes were treated with 15 μmol / L SP or DMSO for 72 hours and observed the lipid accumulation by treated with SP or DMSO All experiments were repeated three times The results indicated that SP promote preadipocyte adipogenesis A Treated with DMSO for 24 hours B Treated with DMSO for 48 hours C Treated with DMSO for 72 hours D Treated with SP for 24 hours E Treated with SP for 48 hours F Treated with SP600125for 72 hours JNK mrna SFRP4 SFRP4 3 SFRP4 SFRP4
7 5 SFRP4 SP Fig 7 SP down-regulate SFRP4 mrna levels and promote the porcine preadipocyte differentiation spontaneously Isolated preadipocytes from adipose tissues were directly plated in DMEM / F12 medium when confluenced 100% added 15 μmol / L SP or DMSO control into DMEM / F12 medium and cultured for and 72 hours A Gene expression of SFRP4 was quantified by RT-qPCR and expressed relative to β-actin levels The SFRP4 expression level was decreased significantly as relative to control n = 3 * P < 0 05 * * P < 0 01 B Whole cell extracts were analysized by Western blotting The changes of SFRP4 p-jnk expression were showed in control and SP treated group the SFRP4 and p- JNK protein level were decreased significantly as relative to control C Gene expression of PPARγ FABP4 Perilipin ATGL were quantified by RT-qPCR and expressed relative to β-actin levels The gene expression levels were all increased as relative to control n = 3 * P < 0 05 * * P < 0 01 PCR SFRP4 Yam 20 PCR SFRP4 SFRP4 Northern SFRP4 SFRP4
8 SFRP4 SFRP4 SFRP5 Ouchi 16 II SFRP4 PCR PCR SFRP5 JNK SP Western SFRP4 mrna SFRP5 SFRP4 PPARγ FABP4 SFRP5 ATGL Perilipin SFRP4 JNK SFRP4 SFRP References SFRP4 Wang 30 SFRP4 domain of frizzled receptors J SFRP SFRP4 mrna SFRP4 cancer J Park 31 Suzuki 32 SFRP SFRP4 SFRP2 SFRP4 3T3-L1 SFRP2 33 SFRP SP cancer cells J Cancer Res JNK PCR PPARγ FABP4 ATGL Perilipin mrna JNK PPARγ FABP4 ATGL Perilipin SFRP4 mrna JNK SFRP4 SFRP4 1 Rattner A Hsieh JC Smallwood PM et al A family of secreted proteins contains homology to the cysteine-rich ligand-binding Proc Natl Acad Sci Suzuki H Watkins DN Jair KW et al Epigenetic inactivation of SFRP genes allows constitutive WNT signaling in colorectal Nat Genet Cho HY Choi HJ Sun HJ et al Transgenic mice overexpressing secreted frizzled-related proteins sfrp 4 under the control of serum amyloid P promoter exhibit low bone mass but did not result in disturbed phosphate homeostasis J Bone 4 Stamper B D Park S S Beyer R P et al Differential Expression of Extracellular Matrix-Mediated Pathways in Single- Suture Craniosynostosis J PLoS One e Zhang Y Chen FQ Sun YH et al Effects of DNMT1 silencing on malignant phenotype and methylated gene expression in cervical cancer cells J J Exp Clin Cancer Res Ting AH Suzuki H Cope L et al A requirement for DICER to maintain full promoter CpG island hypermethylation in human 7 Easwaran HP Van Neste L Cope L et al Aberrant silencing of cancer-related genes by CpG hypermethylation occurs independently of their spatial organization in the nucleus J Cancer Res Romaker D Puetz M Teschner S et al Increased expression of secreted frizzled-related protein 4 in polycystic kidneys J J Am Soc Nephrol Jacob F Ukeqjini K Nixdorf S et al Loss of secreted frizzledrelated protein 4 correlates with an aggressive phenotype and
9 5 SFRP4 SP predicts poor outcome in ovarian cancer patients J PLoS One e Moran A Akcan Arikan A Mastragelo MA et al Prevention of trauma and hemorrhagic shock-mediated liver apoptosis by activation of stat3alpha J Int J Clin Exp Med Carmon K S Loose D S Development of a bioassay for detection of Wnt-binding affinities for individual frizzled receptors J Anal Biochem Tominaga S Yamaguchi T Takahashi S et al Negative regulation of adipogenesis from human mesenchymal stem cells by Jun N-terminal kinase J Biochem Biophys Res Commun Fu L Tang T Miao Y et al Stimulation of osteogenic differentiation and inhibition of adipogenic differentiation in bone marrow stromal cells by alendronate via ERK and JNK activation J Bone beta-catenin in human colorectal carcinoma J Cancer Lett J Yang GS Zhang HW Bai L et al Pig A ideal study animal model of obesity and diabeties Huang D Yu B Deng Y et al SFRP4 was overexpressed in J Prog Nat Sci J Qu Chang-Qing Zhang Guo -Hua Chen Fen-Fen et al Primary culture of porcine preadipocyte J J Agric Biotechnol Ouchi N Higuchi A Ohashi K et al Sfrp5 is an antiinflammatory adipokine that modulates metabolic dysfunction in obesity J Science TCTP J Cardiovasc Res J Li 30 Wang S Krinks M Lin K et al Frzb a secreted protein Xin- Jian Yang Hao Cheng Jia et al Expression of porcine expressed in the Spemann organizer binds and inhibits Wnt-8 TCTP and its effect on differentiation of adipocytes J Chin J Biochem Mol Biol Sambrook J Russell DW Molecular Cloning A Laboratory Manual 3rd ed New York Cold Spring Harbor Laboratory Press 1989 J DW 3 M Beijing Science Press PGC-1 SREBP-1c downregulated during differentiation of porcine mesenteric J J Anim Sci J 33 Bennett CN Ross SE Longo KA et al Regulation of Wnt Gao Xiao-Juan Ji Hong Chang Zhi-Guang et al Interaction of PGC-1 and SREBP- 1c during porcine adipocyte differentiation J Chin J Biochem Mol Biol Yam JW Chan KW Ngan ES et al Genomic structure alternative splicing and tissue expression of rfrp / sfrp-4 the rat frizzled related protein gene J Gene White L Suganthini G Friis R et al Expression of secreted frizzled-related protein 4 in the primate placenta J Reprod Biomed Online Constantinou T Baumann F Lacher MD et al SFRP-4 abrogates Wnt-3a-induced beta-catenin and Akt / PKB signalling and reverses a Wnt-3a-imposed inhibition of in vitro mammary differentiation J J Mol Signal Drake JM Friis RR Dharmarajan AM et al The role of sfrp4 a secreted frizzled-related protein in ovulation J Apoptosis Hsieh M Mulders SM Friis RR Expression and localization of secreted frizzled-related protein-4 in the rodent ovary evidence for selective up-regulation in luteinized granulosa cells J Endocrinology Fox S Dharmarajan A WNT signaling in malignant mesothelioma J Front Biosci Feng Han Q Zhao W Bentel J et al Expression of sfrp-4 and colorectal carcinoma J J Cancer Res Clin Oncol Drake J Shearwood AM White J et al Expression of secreted frizzled-related protein 4 SFRP4 in primary serous ovarian tumours J Eur J Gynaecol Oncol Schumann H Holtz J Zerkowski HR et al Expression of secreted frizzled related proteins 3 and 4 in human ventricular myocardium correlates with apoptosis related gene expression J Cell Park JR Jung JW Lee YS et al The roles of Wnt antagonists Dkk1 and SFRP4 during adipogenesis of human adipose tissuederived mesenchymal stem cells J Cell Prolif Suzuki S Sembon S Iwamoto M et al Identification of genes signaling during adipogenesis J Biol Chem Hu E Zhu Y Fredrickson T et al Tissue restricted expression of two human Frzbs in preadipocytes and pancreas J tutive WNT signaling in Biochem Biophys Res Commun
IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2
344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.
Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού
Σχολή Θετικών Επιστημών Τμήμα Βιολογίας Πρόγραμμα Μεταπτυχιακών Σπουδών Κατεύθυνση: Εφαρμοσμένη γενετική και βιοτεχνολογία ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου
Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology
2012 34 2 382-387 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com 212018 105 W 42 2 min 0. 631 TS202. 3 A 1000-2286 2012 02-0382 - 06 Optimizing
TGFp FSH INH INH
(210095) E-mail ( genlinwang@hotmail.com) - -(Strept Avidin-Biotin-Peroxidase Complex SABC), 1 32,, 1 inhibin INH α 32 000 TGFp FSH FSH [1] INHα Sertoli Noguchi 1997 [2] Meunier et al.1988 [3] INH INH
Feedback Regulation of Adipocytokines in Proliferation and Differentiation of Adipocyte
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2011 3 27 3 212 ~ 217 * 100191 2 R589 2 Feedback Regulation of Adipocytokines in Proliferation
High mobility group 1 HMG1
Vol. 29, pp.705 ~ 711, 2001 High mobility group 1 HMG1 13 12 20 anti-neutrophil cytoplasmic antibodies, ANCA ANCA 1982 Davies 1980 1 high mobility group HMG1 HMG2 30 kd high mobility group HMGHMG HMG1
[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,
in vitro αα In Vitro α-glucosidase and α-amylase Inhibitory Effects of Herbal Tea Leaves from Yacon (Smallanthus sonchifolius) 1, 1, 1, 2, 1, 2, 3, 1, 2, 1, 2, 1, 2, 1, 2 1, 2, *, 1 2, 3 Yuto Ueda 1, Shintaro
Distribution of Mercury and Selenium in the Proteins of Porcine Liver and Kidney Under Different Mercury Exposure Level
ISSN 100727626 CN 1123870ΠQ 2003 6 Chinese Journal of Biochemistry and Molecular Biology 19 (3) :377 382, 3,, (, 918 100039), (, 550002) (Sephadex G2100),, ;, ;, 11 kd (MT),,,,,,,,, Q51,X132 Distribution
( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;
28 1 2006 1 RESOURCES SCIENCE Vol. 28 No. 1 Jan. 2006 :1007-7588(2006) 01-0002 - 07 20 1 1 2 (11 100101 ; 21 101149) : 1978 1978 2001 ; 2010 ; ; ; : ; ; 24718kg 1) 1990 26211kg 260kg 1995 2001 238kg( 1)
Antimicrobial Ability of Limonene, a Natural and Active Monoterpene
2010,32 (1) :24 28 http :/ / xuebao. jlau. edu. cn Journal of Jilin Agricultural University E2mail : jlndxb @vip. sina. com Ξ,,,, ΞΞ, 200062 : : 320 mg/ L,; ph 4 9, ; 80, 100,121 : : ; ; : TS20213 : A
ER-Tree (Extended R*-Tree)
1-9825/22/13(4)768-6 22 Journal of Software Vol13, No4 1, 1, 2, 1 1, 1 (, 2327) 2 (, 3127) E-mail xhzhou@ustceducn,,,,,,, 1, TP311 A,,,, Elias s Rivest,Cleary Arya Mount [1] O(2 d ) Arya Mount [1] Friedman,Bentley
GDNF 220YL) 2,52. (glial cell line2de2. 015d 15d rived neurotrophic factor GDNF) 1993 Lin B49 (L15) (FBS) (poly2l2lysin, pll) (laminin, LN) GDNF GDNF
2003123 (6) Basic Medical Sciences and Clinics 625 : 100126325 ( 2003) 0620625205 GDNF 3,,,,, (, 050000) : ( GDNF) (DRGn), MTT 1 g/ L 10 g/ L 50 g/ L 100 g/ L GDNF : GDNF GDNF : ; ; :R32912 :A (glial cell
The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea
2011 48 4 909 914 * 1 2** 2 2 2 2 2*** 1. 110161 2. 100081 026000 3 Calliptamus italicus L. 3 LC 50 LC 90 1. 34 14. 17 mg / L LC 50 LC 90 2. 09 45. 22 mg / L 50 mg / L 14 d 87% 100% 50 mg / L 50% The toxicity
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity Jian-Long Li 1,a, Wei Zhao 1,a, Chen Zhou 1,a, Ya-Xuan
LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing
2003 61 3, 435 439 ACTA CHIMICA SINICA Vol 61, 2003 No 3, 435 439 2 ΞΞ ( 400715), 2, 2, 2, 3/ 2 2,, 2,, Ne w Methods for the Determination of the Inclusion Constant between Procaine Hydrochloride and 2Cyclodextrin
,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78
ISSN 100727626 CN 1123870ΠQ 2002 4 Chinese Journal of Biochemistry and Molecular Biology 18 (2) :245 249 HLA2B2704 3 2) ( 2) 100044) HLA2B2704 286 HLA2B2704 DNA ( HLA2B2704 DNA) PCR F0 F1 RT2PCR HLA2B2704
Αξιοποίηση Φυσικών Αντιοξειδωτικών στην Εκτροφή των Αγροτικών
Ζώων για Παραγωγή Προϊόντων Ποιότητας» 1 Αξιοποίηση Φυσικών Αντιοξειδωτικών στην Εκτροφή των Αγροτικών Ζώων για Παραγωγή Προϊόντων Ποιότητας Γεωπονικό Πανεπιστήμιο Αθηνών Εργαστήριο Ζωοτεχνίας MIS 380231
Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water
31 1 2010 1 ENVIRONMENTAL SCIENCE Vol. 31,No. 1 Jan.,2010, 3, (,, 100084) :,.,, ( Microcystis aeruginosa),3 (A 2 O ) 10 6 ml - 1,> 0139 d - 1. A 2 O222,. TP ( K max ) ( R max ), Monod. :; ; ; ; :X173 :A
BGP TRACP-5b BGP TRACP-5b P 0.05
()2014 10 8 20 Chin J Clinicians(Electronic Edition),October 15,2014,Vol.8,No.20 3615 OP 2011 1 2013 6 120 OP 3 40 37 40 38 40 38 BMD BGP-5b TRACP-5b OP 1 4 L1 4NFTH BMD BGP TRACP-5b P 0.05 OP L1 4 NF
Journal of Ningxia Medical University. Annexin P19 mrna P < AnnexinA2 P19 mrna. AnnexinA2 P19 mrna. PCR 1.
33 6 2011 6 Journal of Ningxia Medical University 511 1674-6309 2011 06-0511 - 04 AnnexinA2 P19 1 2 3 3 3 1. 415700 2. 750004 3. 750004 AnnexinA2 P19 62 IHC RT - PCR Western blot AnnexinA2P19 mrna AnnexinA2
Differential Expression of DNMTs Between Gastric Tissues with and without H. Pylori Infection
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2011 11 27 11 1032 ~ 1038 DNMT 1 2 3 1 1 4 1 * 1 400016 2 400016 3 400016 4 400016 DNA DNA
Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin
2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,
A strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines
1 2 Supplementary information 3 4 A strategy for the identification of combinatorial bioactive compounds contributing to the holistic effect of herbal medicines 5 6 Fang Long 1, Hua Yang 1, Yanmin Xu,
Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang
13 4 2015 7 Chinese Journal of Bioprocess Engineering Vol. 13 No. 4 Jul. 2015 doi 10. 3969 /j. issn. 1672-3678. 2015. 04. 012 1 2 2 2 2 1. 830054 2. 361005 L- 50% IC 50 0. 27 mg /ml K I - K IS 0. 218 0.
Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone
ISSN 100727626 CN 1123870ΠQ 2002 12 Chinese Journal of Biochemistry and Molecular Biology 18 (6) :693 697 cdna, 3, (, 150030) RNA, cdna cdna PCR, 380 bp cdna pmd2182t2verctor 3,,, 96 %, 95 %,, 74 %, 95
,,, (, 100875) 1989 12 25 1990 2 23, - 2-4 ;,,, ; -
25 3 2003 5 RESOURCES SCIENCE Vol. 25 No. 3 May 2003 ( 100875) : 500L - 2-4 - 6-8 - 10 114h - 120h 6h 1989 12 25 1990 2 23-2 - 4 : ; ; - 4 1186cm d - 1 10cm 514d ; : 714 13 317 714 119 317 : ; ; ; :P731
Chin J Osteoporos April 2011 Vol 17 No. 4 Published online www. wanfangdate. com. cn doi / j. issn
312 Published online www. wanfangdate. com. cn doi 10. 3969 / j. issn. 1006-7108. 2011. 04. 007 R681 A 1006-7108 2011 04-0312-05 fat mass lean mass 414 1020 Hologic Delphi A X fat mass lean mass 1 2 Lean
Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil
354 Nippon Shokuhin Kagaku Kogaku Kaishi Vol. /-, No.0, -/.-0* (,**0) 38 * * Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil Tomoko Kawakami, Kyoko Ohashi* and Atsuko Shimada Graduate
8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,
31 2003 8 (FENXI HUAXUE) 8 Chinese Journal of Analytical Chemistry 976 980 22( 82 252 272 )21,82 23,62 3 (, 510631) 22(82 252 272 )21,82 23,62 (BSA), 8Q5SAC BSA 298K, 35 40 6. 1 10 5 LΠmol 8Q5SAC, ph =
Supporting Information
Supporting Information Mitochondria-Targeting Polydopamine Nanocomposites as Chemophotothermal Therapeutics for Cancer Zhuo Wang *,, Yuzhi Chen, Hui Zhang, Yawen Li, Yufan Ma, Jia Huang, Xiaolei Liu, Fang
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology Aβ42 Alzheimer's disease AD insulin degrading enzyme IDE.
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2013 1 29 1 70 ~ 75 PPARγ IDE TNF-α Aβ42 430030 metformin MET MET β- β-amyloid Aβ Alzheimer's
Effects of soothing liver and invigorating spleen recipes of TCM on hepatic inflammatory cytokines of rats with nonalcoholic steatosishepatitis
33 2 Vol. 33 No. 2 2012 4 Journal of Jinan University Medicine Edition Apr. 2012 TNF-α IL-6 IL-1 1 2 1 3 2 2 2 1. 510630 2. 510632 3. 510630 NASH TNF-α 6 IL-6 1 IL-1 NASH NASH 16 HE O ELISA TNF-α IL-6
Effects of Chlorogenic Acid on the Activity of Cultured Osteoblasts in vitro
32 2 Vol 32 No 2 2013 6 Journal of South-Central University for NationalitiesNat Sci Edition Jun 2013 1 1 1 1 1 2* 1 4300742 430074 CGA MC3T3-E1 MTT 11 02 22 05 44 0988 19μmol /L CGA ALP PCR 11 02 ~ 88
Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk
32 3 2011 3 ENVIRONMENTAL SCIENCE Vol 32 No 3 Mar 2011 1 1 1 2 1 100101 2 663000 Panax notoginseng Burk F H Chen 6 9 ~ 242 0 mg kg - 1 48% 2 mg kg - 1 24% 81% 14% 57% 44% 100 mg kg - 1 ADI > > > > FAO
Stress Relaxation Test and Constitutive Equation of Saturated Soft Soil
8 7 011 7 Journal of Highway and Transportation Research and Development Vol. 8 No. 7 Jul. 011 100-068 011 07-0014 - 05 1 1. 0009. 710064 k 0 Merchant 4 Merchant U416. 1 + 6 A Stress Relaxation Test and
Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo
Bull. Earthq. Res. Inst. Univ. Tokyo Vol. 2.,**3 pp.,,3,.* * +, -. +, -. Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Kunihiko Shimazaki *, Tsuyoshi Haraguchi, Takeo Ishibe +, -.
ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ
- - ό ό : Ω ί ό ί ώ.. ά ή ί ός ή ς ύ ί ί ή έ ώ ό. ή ς ά ς ής ό ός ά ς ή έ ός ή ς ί ής ί ς. ό έ ώ - ώ ή ής ή ς- ί ά ά ς ί ς. ά ί ί έ έ ά ύ ή, ό ί ά, ό ό ά έ ά ής ί ύ George Wald ή ί έ ς ί ύ ό ς ί ς ά έ
ACTA CHINESE MEDICINE. diabetic nephropathies DN 24. urine protein quantitation in 24 hours 24hUTP serum creatinine Scr
* TGF-β1 215600 diabetic nephropathies DN 24 urine protein quantitation in 24 hours 24hUTP serum creatinine Scr -β1 transforming growth factor-β1 TGFβ1 STZ DN SD 10 10 10 8 24hUTP Scr HE ELISA TGF-β1 24hUTP
Σχέση µεταξύ της Μεθόδου των ερµατοπτυχών και της Βιοηλεκτρικής Αντίστασης στον Υπολογισµό του Ποσοστού Σωµατικού Λίπους
Ερευνητική Aναζητήσεις στη Φυσική Αγωγή & τον Αθλητισµότόµος 1(3), 244 251 ηµοσιεύτηκε: 2 8 εκεµβρίου 2003 Inquiries in Sport & Physical Education Volume 1(3), 244 251 Released: December 28, 2003 www.hape.gr/emag.asp
Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic
Supporting Information Asymmetric Binary-acid Catalysis with Chiral Phosphoric Acid and MgF 2 : Catalytic Enantioselective Friedel-Crafts Reactions of β,γ- Unsaturated-α-Ketoesters Jian Lv, Xin Li, Long
CPT. Tsuchiya. beta. quantitative RT PCR QIAGEN IGFBP. Fect Transfection Reagent sirna. RT PCR RNA Affymetrix GeneChip Expression Array
7 PTEN p Tsuchiya DNA Hepatocyte nuclear factor beta HNF beta HNFbeta IGFBP GLUT G Pase MODY maturity onset diabetes of the young Tsuchiya HNFbeta HNFbeta HNFbeta sirna CPT HNFbeta HNFbeta TOVG KOC ESMCAS
FENXI HUAXUE Chinese Journal of Analytical Chemistry. Savitzky-Golay. n = SG SG. Savitzky-Golay mmol /L 5700.
38 2010 3 FENXI HUAXUE Chinese Journal of Analytical Chemistry 3 342 ~ 346 DOI 10. 3724 /SP. J. 1096. 2010. 00342 Savitzky-Golay 1 * 1 2 1 3 1 1 510632 2 510632 3 200444 PLS Savitzky-Golay SG 10000 ~ 5300
Electronic Supplementary Information (ESI)
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information (ESI) Cyclopentadienyl iron dicarbonyl (CpFe(CO) 2 ) derivatives
Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
33 2 2011 4 Vol. 33 No. 2 Apr. 2011 1002-8412 2011 02-0096-08 1 1 1 2 3 1. 361005 3. 361004 361005 2. 30 TU746. 3 A Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
Science of Sericulture
Science of Sericulture 2012 38 1 0065-0069 ISSN 0257-4799 CN 32-1115 /S E-mail CYKE@ chinajournal. net. cn 215123 25 0 ~ 24 h GSH GSSG GSH + 2GSSG GSH /GSSG S- GST TPX 23% GR 57% GSH TPX GST GSSG 61% GSH
Supplementary Information
Electronic upplementary Material (EI) for Photochemical & Photobiological ciences. This journal is The Royal ociety of Chemistry and wner ocieties 214 upplementary Information elective and sensitive fluorescence-shift
Survivin sirna. Inhibitory effect of small interference RNA targeting survivin nanospheres on human pancreatic carcinoma BXPC-3 cell growth
Experimental Research Chin J Curr Adv Gen Surg Survivin sirna 253 1 2 1 3 1 1 1 1 266003 266003 : survivin sirna survivin sirna BXPC- 3 : BXPC- 3 BXPC- 3 4 survivin sirna survivin sirna RT- PCR survivin
Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene
2001, 24 (1) : 2529 Journal of Nanjing Agricultural University rolc (, 210095) :, rolc ( Nicotiana tabacum ), GUS, PCR Southern rolc,, rolc : ; ; rolc ; : S572103513 : A : 1000Ο2030 (2001) 01Ο0025Ο05 Study
College of Life Science, Dalian Nationalities University, Dalian , PR China.
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2018 Postsynthetic modification
Cellular Physiology and Biochemistry
Original Paper 2016 The Author(s). 2016 Published The Author(s) by S. Karger AG, Basel Published online: November 25, 2016 www.karger.com/cpb Published by S. Karger AG, Basel 486 www.karger.com/cpb Accepted:
HepG hotmail. com. HepG2 Bid Bcl-2. HepG2 G0 /G1 Bid Bcl-2. HepG2. HepG2
588 HepG2 2 2 53002 E-mail huan_chaos@ hotmail. com 2 3602 HepG2 MTT PI HepG2 Western Blot HepG2 Bid Bcl-2 HepG2 HepG2 G0 /G Bid Bcl-2 Bax Bid Bcl-2 Bax HepG2 HepG2 R 735. 7 A 0253-4304 204-588-05 DOI
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΤΜΗΜΑ ΟΔΟΝΤΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΟΔΟΝΤΙΚΗΣ ΚΑΙ ΑΝΩΤΕΡΑΣ ΠΡΟΣΘΕΤΙΚΗΣ
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΤΜΗΜΑ ΟΔΟΝΤΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΟΔΟΝΤΙΚΗΣ ΚΑΙ ΑΝΩΤΕΡΑΣ ΠΡΟΣΘΕΤΙΚΗΣ ΣΥΓΚΡΙΤΙΚΗ ΜΕΛΕΤΗ ΤΗΣ ΣΥΓΚΡΑΤΗΤΙΚΗΣ ΙΚΑΝΟΤΗΤΑΣ ΟΡΙΣΜΕΝΩΝ ΠΡΟΚΑΤΑΣΚΕΥΑΣΜΕΝΩΝ ΣΥΝΔΕΣΜΩΝ ΑΚΡΙΒΕΙΑΣ
Contents Part I Psychoneuroimmunology and Systems Biology Mechanisms 1 From Psychoneuroimmunology to Personalized, Systems, and Dynamical Medicine
Contents Part I Psychoneuroimmunology and Systems Biology Mechanisms 1 From Psychoneuroimmunology to Personalized, Systems, and Dynamical Medicine... 3 1.1 Psychoneuroimmunology (PNI) and Systems Biology...
ΑΜΦΙΚΟΙΛΙΑΚΗ ΒΗΜΑΤΟΔΟΤΗΣΗ
ΠΑΝΕΛΛΗΝΙΑ ΣΕΜΙΝΑΡΙΑ ΟΜΑΔΩΝ ΕΡΓΑΣΙΑΣ 2015 ΟΜΑΔΑ ΕΡΓΑΣΙΑΣ ΚΑΡΔΙΑΚΗΣ ΑΝΕΠΑΡΚΕΙΑΣ Από τη βασική έρευνα στην κλινική πράξη ΑΜΦΙΚΟΙΛΙΑΚΗ ΒΗΜΑΤΟΔΟΤΗΣΗ Ξυδώνας Σωτήριος, MD, FESC Καρδιολογικό Τµήµα, Γ.Ν.Α. «Ο
ΣΙΣΛΟ ΜΔΛΔΣΗ ΔΠΙΠΔΓΑ ΑΝΣΙΠΟΝΔΚΣΙΝΗ ΣΟΝ ΟΡΟ ΠΑΙΓΙΩΝ ΚΑΙ ΔΦΗΒΩΝ ΜΔ ΠΑΥΤΑΡΚΙΑ. ΤΥΔΣΙΗ ΜΔ ΣΗ ΤΣΑΗ ΣΟΤ ΩΜΑΣΟ ΚΑΙ ΣΗΝ
ΣΙΣΛΟ ΜΔΛΔΣΗ ΔΠΙΠΔΓΑ ΑΝΣΙΠΟΝΔΚΣΙΝΗ ΣΟΝ ΟΡΟ ΠΑΙΓΙΩΝ ΚΑΙ ΔΦΗΒΩΝ ΜΔ ΠΑΥΤΑΡΚΙΑ. ΤΥΔΣΙΗ ΜΔ ΣΗ ΤΣΑΗ ΣΟΤ ΩΜΑΣΟ ΚΑΙ ΣΗΝ ΑΝΣΙΣΑΗ ΣΗΝ ΙΝΟΤΛΙΝΗ. Υπνβάιιεηαη πξνο έγθξηζε ζηνλ Τνκέα Υγείαο ηνπ Παηδηνύ ηνπ Ιαηξηθνύ
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ Πτυχιακή εργασία ΜΕΛΕΤΗ ΠΟΛΥΦΑΙΝΟΛΩΝ ΚΑΙ ΑΝΤΙΟΞΕΙΔΩΤΙΚΗΣ ΙΚΑΝΟΤΗΤΑΣ ΣΟΚΟΛΑΤΑΣ Αναστασία Σιάντωνα Λεμεσός
Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements
5 5 2012 10 Chinese Optics Vol. 5 No. 5 Oct. 2012 1674-2915 2012 05-0525-06 - * 100190-14 - - 14. 51 μm 81. 4 μm - 1. 64 μm / O436. 1 TH703 A doi 10. 3788 /CO. 20120505. 0525 Correction of chromatic aberration
* ** *** *** Jun S HIMADA*, Kyoko O HSUMI**, Kazuhiko O HBA*** and Atsushi M ARUYAMA***
J. Jpn. Soc. Soil Phys. No. +*2, p. +3,2,**2 * ** *** *** Influence Area of Stem Flow on a Soil of Deciduous Forest Floor by Electric Resistivity Survey and the Evaluation of Groundwater Recharge through
Electronic Supplementary Information
Electronic Supplementary Information Unprecedented Carbon-Carbon Bond Cleavage in Nucleophilic Aziridine Ring Opening Reaction, Efficient Ring Transformation of Aziridines to Imidazolidin-4-ones Jin-Yuan
PNS mg kg - 1. Rb 1
94 2 3 3. 53002 2. 53000 3. 543000 86. 2 mg kg -. 8 mg kg - R Rg Rb 3P97 AUC 0 - R Rg Rb R 0. 8 ± 0. 09 vs 0. 6 ± 0. 06 h Rg 2. 03 ± 0. 76 vs. 74 ± 0. 27 h Rb 0. 76 ± 0. 39 vs 0. 74 ± 0. 7 h R 0. 96 ±
Q L -BFGS. Method of Q through full waveform inversion based on L -BFGS algorithm. SUN Hui-qiu HAN Li-guo XU Yang-yang GAO Han ZHOU Yan ZHANG Pan
3 2015 12 GLOBAL GEOLOGY Vol. 3 No. Dec. 2015 100 5589 2015 0 1106 07 L BFGS Q 130026 Q 2D L BFGS Marmousi Q L BFGS P631. 3 A doi 10. 3969 /j. issn. 1005589. 2015. 0. 02 Method of Q through full waveform
Differences in Contents of Neutral Aroma Components and Sensory Evaluation in Air-cured Burley Leaves from Different Curing Barns
2 0 1 0 25 3 1 13-1 1 7 1 2 2 1 1 2 2 1. 450002 2. 635000 6 > > > > > > > > > > > > > > > S572 A 1000-7091 2010 03-0113 - 05 Differences in Contents of Neutral Aroma Components and Sensory Evaluation in
0. 35g kg ~ 2. 0cm 10min. Nar- 15μL 6mm
22 Journal of Ningxia Medical University 34 1 2012 1 1674-6309 2012 01-0022 - 03 1 2 1 3 1. 750004 2. 750004 3. 750004 60 SD 300 ± 20 g 5 S ICH M 2 M 4 M 8 12 Deinsberger S M 2 4 8 - ICH 10min 2 4 8 mg
Η Α ΕΝΟΫΠΟΦΥΣΗ: OI ΓΟΝΑ ΟΤΡΟΠΙΝΕΣ (FSH, LH) ΚΑΙ Η ΠΡΟΛΑΚΤΙΝΗ (PRL)
Η Α ΕΝΟΫΠΟΦΥΣΗ: OI ΓΟΝΑ ΟΤΡΟΠΙΝΕΣ (FSH, LH) ΚΑΙ Η ΠΡΟΛΑΚΤΙΝΗ (PRL) Κωνσταντίνος Καλλαράς Ιατρός Παθολόγος Καθηγητής Φυσιολογίας Εργαστήριο Πειραματικής Φυσιολογίας Ιατρικής Σχολής Α.Π.Θ. FSH:ΜΒ 33000,
Quantum dot sensitized solar cells with efficiency over 12% based on tetraethyl orthosilicate additive in polysulfide electrolyte
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2017 Supplementary Information (SI) Quantum dot sensitized solar cells with
c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No
2008 245 2 1) 1) 2) 3) 4) 1) 1) 1) 1) 1), 2) 1) 2) 3) / 4) 20 3 24 20 8 18 2001 2 2 2004 2 59.0 2002 1 2004 12 3 2 22.1 1 14.0 (CNS), Bacillus c 2 p 0.01 2 1 31.3 41.9 21.4 1 2 80 CNS 2 1 74.3 2 Key words:
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN
BIOTECHNOLOGY BULLETIN 2011 3 α 1 2-300457 PCR Helicobacter pylori HP DNA α 1 2- α 1 2-fucosyltransferase α 1 2-fuct 906 bp pet-22b + pet-fuct BL21 DE3 25 0. 1 mmol /L IPTG 4 h SDS-PAGE 33 kd α 1 2- BL21
2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _
41 Vol.41, No. 01 RARE METAL MATERIALS AND ENGINEERING March 01 Pb O 4 PbO ( 710049) SnO -Sb Pb O 4 Pb O 4 100.5 h 970 h XRF XRD SEM Pb O 4 PbO PbO TG146.1 + A 100-185X(01)0-046-05 [1,] 1 PbO PbO Sn-Sb
Chinese Journal of Biochemistry and Molecular Biology. p38mapk
ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2008 6 24 (6) :537 542 Grx1 HEK293T H 2 O 2 p38mapk 1), 2), 1), 1), 3), 1), 1) 3 ( 1), 150081 ; 2), 150081 ; 3), 161042)
1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.
2 0 1 5 7 Journal of Chinese Institute of Food Science and Technology Vol. 15 No. 7 Jul. 2 0 1 5 1,2 1 1 1 1* ( 1 315211 2 315502) : ( ) : (E-Nose), - : GC-MS, 20.98% 2.5%, 53.15% 11.2%, 0. 51% 71.86%
Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2
Free Radical Initiated Coupling Reaction of Alcohols and Alkynes: not C-O but C-C Bond Formation Zhongquan Liu,* Liang Sun, Jianguo Wang, Jie Han, Yankai Zhao, Bo Zhou Institute of Organic Chemistry, Gannan
HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332
,**1 The Japanese Society for AIDS Research The Journal of AIDS Research +,, +,, +,, + -. / 0 1 +, -. / 0 1 : :,**- +,**. 1..+ - : +** 22 HIV AIDS HIV HIV AIDS : HIV AIDS HIV :HIV AIDS 3 :.1 /-,**1 HIV
Supporting Information
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Supporting Information Crotonols A and B, Two Rare Tigliane Diterpenoid
Hepatic Stellate Cells: Multifunctional mesenchymal cells of the Liver
Nagoya Med. J., 137 Hepatic Stellate Cells: Multifunctional mesenchymal cells of the Liver KAZUO IKEDA Department of Anatomy and Cell Biology, Graduate School of Medical Sciences, Nagoya City University
Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica
35 1 2 0 1 7 1 DOI 10. 13193 /j. issn. 1673-7717. 2017. 01. 035 1 1 1 1 2 1. 150036 2. 150040 D101 DEAE Cellulose 52 Sephacryl S - 300 - - PJP - 1a PJP - 3a 1. 34 10 3 Da 1. 70 10 7 Da - PJP - 3a 4. 56
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΔΙΑΤΡΟΦΙΚΕΣ ΣΥΝΗΘΕΙΕΣ, ΚΟΙΝΩΝΙΚΑ & ΑΝΘΡΩΠΟΜΕΤΡΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΕΛΛΗΝΩΝ ΕΠΑΓΓΕΛΜΑΤΙΩΝ ΠΟΔΟΣΦΑΡΙΣΤΩΝ
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΤΜΗΜΑ ΦΥΣΙΚΗΣ ΑΓΩΓΗΣ & ΑΘΛΗΤΙΣΜΟΥ ΤΟΜΕΑΣ ΙΑΤΡΙΚΗΣ ΤΗΣ ΑΘΛΗΣΗΣ ΜΑΡΙΑΣ Γ.ΓΡΑΜΜΑΤΙΚΟΠΟΥΛΟΥ Πτυχιούχου Διαιτολόγου ΔΙΑΤΡΟΦΙΚΕΣ ΣΥΝΗΘΕΙΕΣ, ΚΟΙΝΩΝΙΚΑ & ΑΝΘΡΩΠΟΜΕΤΡΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ
MSM Men who have Sex with Men HIV -
,**, The Japanese Society for AIDS Research The Journal of AIDS Research HIV,0 + + + + +,,, +, : HIV : +322,*** HIV,0,, :., n,0,,. + 2 2, CD. +3-ml n,, AIDS 3 ARC 3 +* 1. A, MSM Men who have Sex with Men
17 min R A (2009) To probe into the thermal property the mechanism of the thermal decomposition and the prospective
( 31001) (CDZ)CDZCDZ GAMSSCDZCDZ (DSC)CDZCDZ (G) DakinCDZ 1 1 CDZ a =173.9 kj mol min -1 CDZ 17 min A=.69 10 A=1.175 10 17 R97.14A1007-7693(009)1-1019-05 a =17.3 kj mol 1 Mechanism and Kinetics of hermal
Cinnamaldehyde Prevents Endothelial Dysfunction Induced by High Glucose by Activating Nrf2
www.karger.com/cpb 315 Accepted: Wang et al.: March Cinnamaldehyde 11, 2015 Prevents Endothelial Dysfunction 1421-9778/15/0361-0315$39.50/0 Under High Glucose Original Paper This is an Open Access article
Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis
HPLC * 271016 HPLC - DAD DiamonsilC 18 250 mm 4. 6 mm 5 μm - -1% 370 nm 1. 0 ml /min 40 R282. 7 A 1001-1528 2011 01-0001-05 Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus
PCR. Detection of Promoter Hypermethylation of WIF-1 Gene by Nested Methylation Specific Polymerase Chain Reaction in Lung Cancer Patients
13 5 Vol13 No5 5 2009 10 ife Science Research Oct 2009 PCR WIF-1 a, b, a, c, a a*, a 410078 b 410013 c 410011 : WIF-1,, PCR (nsp) WIF-1, PCR (SP), 58 nsp 20 WIF-1, SP 10, WIF-1 (P < 005) 20 WIF-1 ; SP(nSP)
ΙΔΡΥΜΑ. Θεσσαλονίκη, ύλα
ΑΛΕΞΑΝΔΡΕΙΟ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ, ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗΔ ΗΣ ΤΜΗΜΑ ΔΙΑΤΡΟΦΗΣ & ΔΙΑΙΤΟΛΟΓΙΑΣ ΠΑΡΕΜΒΑΤΙΚΟ ΠΡΟΓΡΑΜΜΑ ΔΙΑΤΡΟΦΙΚΗΣ ΑΓΩΓΗΣ ΣΤΟΝ ΔΗΜΟ ΚΑΒΑΛΑΣ Πτυχιακή
ΕΠΙ ΡΑΣΗ ΤΟΥ ΕΥΝΟΥΧΙΣΜΟΥ ΣΕ ΠΑΡΑΓΩΓΙΚΑ ΚΑΙ ΦΥΣΙΟΛΟΓΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΑΡΣΕΝΙΚΩΝ ΟΡΝΙΘΙΩΝ
ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΖΩΙΚΗΣ ΠΑΡΑΓΩΓΗΣ & Υ ΑΤΟΚΑΛΛΙΕΡΓΕΙΩΝ ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΙΚΗΣ & ΕΙ ΙΚΗΣ ΖΩΟΤΕΧΝΙΑΣ Ι ΑΚΤΟΡΙΚΗ ΙΑΤΡΙΒΗ ΕΠΙ ΡΑΣΗ ΤΟΥ ΕΥΝΟΥΧΙΣΜΟΥ ΣΕ ΠΑΡΑΓΩΓΙΚΑ ΚΑΙ ΦΥΣΙΟΛΟΓΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ
Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application
31 5 2011 5 Acta Scientiae Circumstantiae Vol 31 No 5 May 2011 2011 - J 31 5 935-940 Huang Y M Yuan D X Peng Y Z et al 2011 Rapid determination of soluble reactive silicate in seawater by flow injection
Pax8 and Pax2 are specifically required at different steps of Xenopus pronephros development
Pax8 and Pax2 are specifically required at different steps of Xenopus pronephros development Isabelle Buisson, Ronan Le Bouffant, Mélinée Futel, Jean-François Riou, Muriel Umbhauer To cite this version:
TABLE OF CONTENTS Page
TABLE OF CONTENTS Page Acknowledgements... VI Declaration... VII List of abbreviations... VIII 1. INTRODUCTION... 1 2. BASIC PRINCIPLES... 3 2.1. Hereditary Colorectal Cancer... 3 2.1.1. Differential diagnosis...
Discontinuous Hermite Collocation and Diagonally Implicit RK3 for a Brain Tumour Invasion Model
1 Discontinuous Hermite Collocation and Diagonally Implicit RK3 for a Brain Tumour Invasion Model John E. Athanasakis Applied Mathematics & Computers Laboratory Technical University of Crete Chania 73100,
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to facilitate intracellular survival Hongwei Gu 1,2*, Chihao Zhao 1,2*, Tianfu Zhang 1,2*, Hongwei Liang 1,2, Xiao-Ming Wang 1,
ΤΜΗΜΑ ΦΥΣΙΚΩΝ ΠΟΡΩΝ & ΠΕΡΙΒΑΛΛΟΝΤΟΣ
ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙ ΕΥΤΙΚΟ Ι ΡΥΜΑ ΚΡΗΤΗΣ ΠΑΡΑΡΤΗΜΑ ΧΑΝΙΩΝ ΤΜΗΜΑ ΦΥΣΙΚΩΝ ΠΟΡΩΝ & ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΤΟΜΕΑΣ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗΣ ΤΕΧΝΟΛΟΓΙΑΣ ΕΡΓΑΣΤΗΡΙΟ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗΣ ΧΗΜΕΙΑΣ & ΒΙΟΧΗΜΙΚΩΝ ΙΕΡΓΑΣΙΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ
, DYY-8B, ; : Centrifuge 11 R. min
40 Chinese Journal of Otology Vol. 8 No.1 2010 DNA A1555G - ( 030001) 2 12 68 DNA (polymerase chain reaction PCR) DNA A1555G 7 DNA 12S rrna 1555 A G A1555G ; DNA A1555G ; ; ; R764.433 R342.4 A 1672-2922(2010)01-040-06
7KH VHQVLWLYLW\ RI UDGLRWKHUDS\ WR WLVVXH FRPSRVLWLRQ DQG LWV HVWLPDWLRQ XVLQJ QRYHO GXDO HQHUJ\ &7 PHWKRGV Guillaume Landry
Guillaume Landry UUNIVERSITAIRE PERS MAASTRICHT P M 1 ρ 2 60 "Monte Carlo" AND brachytherapy Number of publications 50 40 30 20 10 0 1980 1985 1990 1995 2000 2005 2010 Publication year μ ρ
Supplementary Table 1. Primers used for RT-qPCR analysis of striatal and nigral tissue.
Supplementary Table 1. Primers used for RT-qPCR analysis of striatal and nigral tissue. Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) Dopaminergic Markers TH CTG GCC ATT GAT GTA CTG GA ACA CAC ATG GGA
D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical and experimental study
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical
Electronic Supplementary Information DFT Characterization on the Mechanism of Water Splitting Catalyzed by Single-Ru-substituted Polyoxometalates
Electronic Supplementary Information DFT Characterization on the Mechanism of Water Splitting Catalyzed by Single-Ru-substituted Polyoxometalates Zhong-Ling Lang, Guo-Chun Yang, Na-Na Ma, Shi-Zheng Wen,
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology HBx HBxΔ127
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2011 5 27 5 426 ~ 430 X HBxΔ127 ERK 1 * * 300071 hepatitis B virus HBV X HBx HBx HBxΔ127 1
ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΙΣ «ΚΛΙΝΙΚΕΣ ΚΑΙ ΚΛΙΝΙΚΟΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΤΡΙΚΕΣ ΕΙΔΙΚΟΤΗΤΕΣ»
ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΙΣ «ΚΛΙΝΙΚΕΣ ΚΑΙ ΚΛΙΝΙΚΟΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΤΡΙΚΕΣ ΕΙΔΙΚΟΤΗΤΕΣ» ΑΡΝΗΤΙΚΗ ΡΥΘΜΙΣΗ ΤΗΣ ΜΕΤΑΒΙΒΑΣΗΣ ΤΟΥ ΣΗΜΑΤΟΣ ΤΗΣ
TGF - β1 30% 1. 2 β - catenin Wnt PHC DAB PHC. β - catenin TGF - β1 PHC SPSS α = 0.
33 10 2011 10 Journal of Ningxia Medical University 913 1674-6309 2011 10-0913 - 03 TGF - β1 1 2 1. 750004 2. 750004 TGF - β1 Hepatocellular carcinoma PHC 45 PHC TGF - β1 51. 1% 26. 7% P < 0. 05 TGF -
Congruence Classes of Invertible Matrices of Order 3 over F 2
International Journal of Algebra, Vol. 8, 24, no. 5, 239-246 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/.2988/ija.24.422 Congruence Classes of Invertible Matrices of Order 3 over F 2 Ligong An and
Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic
; +302 ; +313; +320,.
1.,,*+, - +./ +/2 +, -. ; +, - +* cm : Key words: snow-water content, surface soil, snow type, water permeability, water retention +,**. +,,**/.. +30- +302 ; +302 ; +313; +320,. + *+, *2// + -.*, **. **+.,