Θεόδωρος Γ. Κουρέλης Ιατρός Ογκολόγος - Παθολόγος

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Θεόδωρος Γ. Κουρέλης Ιατρός Ογκολόγος - Παθολόγος"

Transcript

1 ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΙΣ ΕΦΑΡΜΟΓΕΣ ΤΩΝ ΒΑΣΙΚΩΝ ΙΑΤΡΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΤΕΥΘΥΝΣΗ: ΠΑΘΟΒΙΟΧΗΜΕΙΑ ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΚΗΣ ΧΗΜΕΙΑΣ ΣΥΝΘΕΣΗ ΠΕΠΤΙΔΙΚΩΝ ΑΝΑΛΟΓΩΝ ΤΗΣ ΧΛΩΡΑΜΦΑΙΝΙΚΟΛΗΣ ΚΑΙ ΜΕΛΕΤΗ ΤΗΣ ΒΙΟΛΟΓΙΚΗΣ ΤΟΥΣ ΔΡΑΣΗΣ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Θεόδωρος Γ. Κουρέλης Ιατρός Ογκολόγος - Παθολόγος ΠΑΤΡΑ 2009

2 Αφιερωμένο στην ιερή μνήμη της μητέρας μου. Aφιερωμένο στη Δήμητρα, που με την αγάπη της και την υπομονή της μου συμπαραστέκεται με στηρίζει και με καθοδηγεί. Αφιερωμένο στην Παναγούλα που με γεμίζει χαρά και με βοηθά να ατενίζω το μέλλον με ευτυχία και αισιοδοξία Αφιερωμένο στον πατέρα μου και στον αδελφό μου για την αγάπη, τη συμπαράστασή τους και την πολύτιμη βοήθειά τους. Αφιερωμένο στον Κώστα και στην Ευαγγελία για την υπομονή, την αγάπη και την συμπαράστασή τους. 2

3 ΕΥΧΑΡΙΣΤΙΕΣ Η εργασία αυτή εκπονήθηκε στο Εργαστήριο Βιολογικής Χημείας της Ιατρικής Σχολής Πανεπιστημίου Πατρών, στα πλαίσια του Προγράμματος Μεταπτυχιακών Σπουδών στις Εφαρμογές των Βασικών Ιατρικών Επιστημών και στην κατεύθυνση της Παθοβιοχημείας, για την απόκτηση του Μεταπτυχιακού Διπλώματος Ειδίκευσης. Θα ήθελα να εκφράσω τις θερμές μου ευχαριστίες στον επιβλέποντα αναπληρωτή καθηγητή κ. Πέτρο Μάμο για την ανάθεση, την επίβλεψη και την πολύτιμη βοήθειά του στην διαδικασία σύνθεσης των πεπτιδικών αναλόγων της χλωραμφαινικόλης. Θέλω επίσης να εκφράσω τις θερμές μου ευχαριστίες στον καθηγητή κ. Δημήτριο Καλπαξή για την παραχώρηση του εργαστηρίου του, για την συνεχή καθοδήγησή του στην μελέτη χημικής κινητικής της βιολογικής δράσης των πεπτιδικών αναλόγων της χλωραμφαινικόλης, για τις συμβουλές του, καθώς και την σημαντική συμβολή του στην συγγραφή και την τελική παρουσίαση του κειμένου. Ιδιαιτέρως θα ήθελα να ευχαριστήσω την μεταπτυχιακή φοιτήτρια κ. Ουρανία Κωστοπούλου για την αμέριστη συμπαράστασή της και την πολύτιμη βοήθειά της στην διεκπεραίωση του πειραματικού μέρους της αναστολής της αντίδρασης πουρομυκίνης. Θεωρώ υποχρέωσή μου, να επισημάνω ότι χωρίς την συμμετοχή της Ράνιας, η ολοκλήρωση της πειραματικής διαδικασίας και συνεπώς και η περάτωση της εν λόγω διατριβής θα ήταν αδύνατη. Θέλω επίσης να εκφράσω τις θερμές ευχαριστίες μου στον καθηγητή κ. Διονύσιο Παπαϊωάννου για τις παρατηρήσεις και τις διορθώσεις του στην τελική μορφή της εργασίας. 3

4 ΠΕΡΙΕΧΟΜΕΝΑ ΕΙΣΑΓΩΓΗ σελ ΔΟΜΗ ΤΟΥ ΡΙΒΟΣΩΜΑΤΟΣ σελ Γενικά χαρακτηριστικά ριβοσωμάτων..σελ Δομή ριβοσωμικών υπομονάδων σελ trnas σελ Πεπτιδυλοτρανσφεράση ( PTase ): Το καταλυτικό κέντρο του ριβοσώματος σελ ΛΕΙΤΟΥΡΓΙΑ ΡΙΒΟΣΩΜΑΤΟΣ Πρωτεϊνική Σύνθεση.σελ Πορεία πρωτεϊνικής σύνθεσης σελ ΑΝΤΙΒΙΟΤΙΚΑ ΚΑΙ ΡΙΒΟΣΩΜΑ σελ Γενικά περί αντιβιοτικών σελ Αντιβιοτικά και ριβόσωμα σελ ΠΟΥΡΟΜΥΚΙΝΗ σελ Μηχανισμός δράσης της πουρομυκίνης σελ Αντίδραση πουρομυκίνης σελ Κινητική ανάλυση της αντίδρασης πουρομυκίνης σελ ΧΛΩΡΑΜΦΑΙΝΙΚΟΛΗ σελ Μηχανισμός δράσης της χλωραμφαινικόλης σελ Συνθετικά ανάλογα χλωραμφαινικόλης... σελ ΕΝΖΥΜΙΚΟΙ ΑΝΑΣΤΟΛΕΙΣ σελ Διάκριση των αναστολέων με βάση τον μηχανισμό δράσης τους σελ Διάκριση των αναστολέων με βάση την κινητική της αναστολής τους σελ. 52 ΣΤΟΧΟΣ ΤΗΣ ΜΕΛΕΤΗΣ σελ. 68 ΥΛΙΚΑ ΚΑΙ ΜΕΘΟΔΟΙ σελ ΧΗΜΙΚΑ ΚΑΙ ΒΙΟΛΟΓΙΚΑ ΥΛΙΚΑ σελ ΣΥΝΘΕΣΗ ΠΕΠΤΙΔΙΚΩΝ ΑΝΑΛΟΓΩΝ ΤΗΣ ΧΛΩΡΑΜΦΑΙΝΙΚΟΛΗΣ σελ Σύνθεση της βήτα αλανίνης-χλωραμφαινικόλης σελ Σύνθεση της τρίτυλο βήτα αλανίνης σελ Σύνθεση της ηλεκτριμιδικής τρίτυλο βήτα αλανίνης σελ Υδρόλυση της χλωραμφαινικόλης σελ Σύνθεση της τρίτυλο βήτα αλανίνης χλωραμφαινικόλης σελ Σύνθεση της βήτα αλανίνης χλωραμφαινικόλης σελ Σύνθεση της φαινυλαλανίνης-φαινυλαλανίνης-χλωραμφαινικόλης σελ ΑΠΟΜΟΝΩΣΗ ΡΙΒΟΣΩΜΑΤΩΝ ΑΠΟ Ε.coli σελ Καλλιέργεια κυττάρων Ε. coli στελέχους Κ12..σελ Παρασκευή κλάσματος σελ Παρασκευή κλάσματος -100.σελ Παρασκευή πλυμμένων ριβοσωμάτων σελ Παρασκευή κλάσματος FWR σελ ΠΑΡΑΣΚΕΥΗ Αc[ 3 Η]Phe-tRNA.σελ Παρασκευή [ 3 Η]Phe-tRNA.σελ Εκχύλιση του [ 3 Η]Phe-tRNA..σελ Απομόνωση του [ 3 Η]Phe-tRNA.σελ Ακετυλίωση του [ 3 Η]Phe-tRNA σελ ΣΧΗΜΑΤΙΣΜΟΣ ΕΝΑΡΚΤΗΡΙΟΥ ΤΡΙΜΕΡΟΥΣ ΣΥΜΠΛΟΚΟΥ C.σελ ΜΕΛΕΤΗ ΣΤΑΘΕΡΟΤΗΤΑΣ ΤΟΥ ΣΥΜΠΛΟΚΟΥ C σελ ANTIΔΡΑΣΗ ΠΟΥΡΟΜΥΚΙΝΗΣ ΚΙΝΗΤΙΚΗ ΤΗΣ ΑΝΤΙΔΡΑΣΗΣ σελ Αντίδραση πουρομυκίνης με το τριμερές σύμπλοκο C.σελ Αναστολή της αντίδρασης πουρομυκίνης από τα ανάλογα της CAM.σελ Προσδιορισμός της σταθεράς αναστολής Κ i.σελ Προσδιορισμός της σταθεράς eq για την αποκατάσταση της steady state σελ

5 ΑΠΟΤΕΛΕΣΜΑΤΑ σελ Παρασκευή ριβοσωμάτων και μεταφραστικών παραγόντων (FWR) σελ Κινητική ανάλυση της αντίδρασης πουρομυκίνης απουσία των αναλόγων σελ Αναστολή σχηματισμού του πεπτιδικού δεσμού παρουσία β-alacam σελ Ανάλυση λογαριθμικών χρονοκαμπυλών για την β-alacam σελ Ανάλυση χρονοδιαγραμμάτων διπλού αντιστρόφου για την β-alacam σελ Ανάλυση αρχικών κλίσεων χρονοδιαγραμμάτων με διαγράμματα διπλού αντιστρόφου για την β-alacam σελ Ανάλυση τελικών κλίσεων με χρονοδιαγραμμάτων με διαγράμματα διπλού αντιστρόφου για την β-alacam σελ Ανάλυση επαναδιαγραμμάτων κλίσης για την β-alacam σελ Συνολικό κινητικό βήμα αναστολής της αντίδρασης από την β-alacam.σελ Υπολογισμός των σταθερών 6 και 7 για την β-alacam με υπολογιστική προσομοίωση.σελ Αναστολή σχηματισμού του πεπτιδικού δεσμού παρουσία PhePheCAM σελ Ανάλυση λογαριθμικών χρονοκαμπυλών για την PhePheCAM σελ Ανάλυση χρονοδιαγραμμάτων διπλού αντιστρόφου για την PhePheCAM σελ Ανάλυση αρχικών κλίσεων χρονοδιαγραμμάτων με διαγράμματα διπλού αντιστρόφου για την PhePheCAM...σελ Ανάλυση τελικών κλίσεων με χρονοδιαγραμμάτων με διαγράμματα διπλού αντιστρόφου για την PhePheCAM σελ Ανάλυση επαναδιαγραμμάτων κλίσης για την PhePheCAM σελ Συνολικό κινητικό βήμα αναστολής της αντίδρασης από την PhePheCAM...σελ Υπολογισμός των σταθερών 6 και 7 για την PhePheCAM με υπολογιστική προσομοίωση σελ. 146 ΣΥΖΗΤΗΣΗ σελ. 149 ΠΕΡΙΛΗΨΗ σελ. 154 ΑBTRACT σελ. 156 ΒΙΒΛΙΟΓΡΑΦΙΑ σελ

6 ΕΙΣΑΓΩΓΗ Το τελευταίο βήμα στην έκφραση των γονιδίων είναι η πρωτεϊνική σύνθεση, μια διαδικασία αρκετά περίπλοκη, στην οποία τον κύριο λόγο παίζει το ριβόσωμα. Tα ριβοσώματα είναι τα εργοστάσια παραγωγής πρωτεϊνών. Τα ριβοσώματα είναι μεγάλα ριβονουκλεο-πρωτεϊνικά σύμπλοκα. Έχουν ειδικές θέσεις που υποδέχονται τα trnas και το mrna, και διαμορφώνουν ειδικές δομικές διατάξεις εξόδου της πεπτιδικής αλυσίδας που συντίθεται. Λειτουργικά, είναι πολυμεράσες που καταλύουν τον πολυμερισμό αμινοξέων σε πρωτεΐνες με βάση το γενετικό κώδικα. Δομικά, παρέχουν την πλατφόρμα πάνω στην οποία το mrna αποκωδικοποιείται και μεταφράζεται σε αντίστοιχη αλληλουχία αμινοξέων με την βοήθεια των άμινο-άκυλο-trnas. Mεταξύ διαφορετικών εξελικτικών ειδών, τα ριβοσώματα εμφανίζουν τόσο ομοιότητες ως προς την οργάνωση και τη λειτουργία τους, όσο και διαφορές ως προς την δομή και το πλήθος των ριβοσωματικών συστατικών τους. Επιπλέον, η λειτουργία της μεταφραστικής μηχανής γίνεται πολυπλοκότερη, όσο ανεβαίνουμε τις εξελικτικές βαθμίδες. Στη συνέχεια ακολουθεί μια πιο αναλυτική εξέταση της δομής και της λειτουργίας του προκαρυωτικού ριβοσώματος και συγκεκριμένα του εντεροβακτηρίου Escherichia coli (E. coli). 6

7 1. ΔΟΜΗ ΡΙΒΟΣΩΜΑΤΟΣ 1.1 Γενικά χαρακτηριστικά ριβοσωμάτων Το βακτηριακό ριβόσωμα έχει μοριακή μάζα 2,6-2,8 ΜDa, διάμετρο Å και συντελεστή καταβύθισης 70. Αποτελείται από δύο άνισες υπομονάδες, την μικρή, 30, και την μεγάλη 50 ριβοσωμική υπομονάδα (Εικ. 1). Αποτελεί το μεγαλύτερο και πιο σύνθετο νουκλεοπρωτεϊνικό σύμπλοκο του κυττάρου. Κάθε υπομονάδα είναι μια ριβονουκλεοπρωτεΐνη το 1/3 της οποίας αποτελείται από πρωτεΐνη (r-proteins) και τα 2/3 από ριβοσωματικό RNA (r-rna) [Moore et al, 1988]. Εικόνα 1. Τρισδιάστατη απεικόνιση του 70 ριβοσωματικού συμπλόκου προκαρυωτικών κυττάρων, όπως έχει προκύψει από κρυσταλλογραφική ανάλυση. 7

8 1.2 Δομή ριβοσωματικών υπομονάδων Η 30 υπομονάδα της E. coli, μάζας 0,8 MDa, συγκροτείται από ένα είδος rrna, το 16 rrna (1542 νουκλεοτίδια) και 21 πρωτεΐνες (1-21). Περιέχει την περιοχή αποκωδικοποίησης του μηνύματος, όπου αλληλεπιδράσεις μεταξύ κωδικονίων του mrna και αντικωδικονίων των trnas προσδιορίζουν την σειρά με την οποία αμινοξέα θα συναρμολογηθούν σε πρωτεΐνη, εξασφαλίζοντας έτσι την πιστότητα της μετάφρασης [Nierhaus et al, 2003]. Από το 1980 μέχρι και σήμερα, και με την χρήση τεχνικών της κρυοηλεκτρονικής μικροσκοπίας (διακριτική ικανότητα > 7 Å) και της κρυσταλλογραφίας ακτίνων Χ (διακριτική ικανότητα > 2,4 Å) έχουν γίνει σημαντικά βήματα, όσον αφορά την ανάλυση και τον λεπτομερή προσδιορισμό της τρισδιάστατης δομής του ριβοσώματος. Ιδιαίτερα η εξέλιξη της κρυο-ηλεκτρονικής μικροσκοπίας, η οποία επιτρέπει την παρατήρηση μορίων σε ενυδατωμένη μορφή, χωρίς συνεπώς να προκαλεί παραμορφώσεις, σε συνδυασμό με την κρυσταλλογραφία ακτίνων Χ, επέτρεψε την τρισδιάστατη απεικόνιση του ριβοσώματος [Fran, 2001]. Στις μελέτες αυτές, η μικρή 30 υπομονάδα παρουσιάζεται με ανθρωπόμορφη μορφή, όπου ξεχωρίζουν η κεφαλή, ο λαιμός, το σώμα, ο ώμος και η πλατφόρμα. Η κεφαλή είναι ενωμένη μέσω του λαιμού με το σώμα. Το σώμα με την σειρά του παρουσιάζει δύο ευμεγέθεις προεξοχές: την ωμοπλάτη και την πλατφόρμα [Fran 1989, Malhotra et al 1998]. Εικόνες κρυο-ηλεκτρονικής μικροσκοπίας υψηλής διακριτικής ικανότητας (Εικ. 2), έδειξαν πιο λεπτομερή δομικά χαρακτηριστικά, όπως το ράμφος και το σπιρούνι που συγκρατούνται αντίστοιχα από την έλικα 33 (h33) και την έλικα 6 (h6) [Gabashvilli et al 1999]. Όσον αφορά το 16 rrna, οι περιοχές της δευτεροταγούς δομής αντιστοιχούν σε διακριτές περιοχές της τριτοταγούς διάταξης, που είναι αυτόνομες δομικά. Το γεγονός αυτό επιτρέπει σχετική ανεξαρτησία κινήσεως των περιοχών αυτών κατά την πρωτεϊνική σύνθεση. Εικόνα 2. Η μικρή υπομονάδα (Α) όπως φαίνεται από την επιφάνεια επαφής των δύο υπομονάδων, (Β) πλαϊνή όψη και (Γ) κυτταροπλασματική πλευρά, όπου Κ: κεφαλή, Σ: σώμα, Ρ: ράμφος, Ω: ωμοπλάτη, ΣΠ: σπιρούνι και Π: πλατφόρμα 8

9 Μελέτες χημικής προστασίας και εξελικτικής συντήρησης είχαν ήδη αποκαλύψει την δευτεροταγή δομή του 16 rrna [Gutell, 1996]. Η δομή αυτή και η αντιστοίχισή της με την τριτοταγή δομή δίνονται στην Εικόνα 3, [Yusupov et al, 2001], όπου διακρίνονται τέσσερις περιοχές (domains), η 5, η κεντρική, η 3 μεγάλη και η 3 μικρή. Εικόνα 3. (Α) Δευτεροταγής και (Β) τριτοταγής δομή του 16 rrna με χρωστική αντιστοίχιση προς τη δευτεροταγή δομή Όπως επιβεβαιώθηκε στη συνέχεια με κρυσταλλογραφικές μελέτες, η δομή του 16 rrna περιέχει πάνω από 50 έλικες [Ramarishnan V. et al 2000], μεταξύ των οποίων παρεμβάλλονται μονές θηλιές (loops). Το κέντρο αποκωδικοποίησης βρίσκεται μεταξύ του άνω τμήματος του σώματος και της κεφαλής της υπομονάδας. Αποτελείται κυρίως από RNA και συγκροτείται εκτός των άλλων στοιχείων, από το άνω τμήμα της έλικας 44 και τα 3 και 5 άκρα του 16 rrna. H 50 υπομονάδα, μάζας 1,5 ΜDa, καταλύει την δημιουργία του πεπτιδικού δεσμού και τον τερματισμό της πρωτεϊνοσύνθεσης. Ταυτόχρονα, προστατεύει την νεοσυντιθέμενη αλυσίδα από πρωτεολυτικές δράσεις και την κατευθύνει στο τούνελ εξόδου. Αποτελείται από δύο είδη rrna, το 23 (2908 νουκλεοτίδια) και το 5, (120 νουκλεοτίδια) καθώς και από 33 πρωτεΐνες (L1-L33). Το 23 rrna διαιρείται από το 5 προς το 3 άκρο σε 6 περιοχές (Ι, II, III, IV, V και VI). Αντίθετα με τις περιοχές του 16 rrna, οι περιοχές του 23 rrna διαπλέκονται ισχυρά μεταξύ τους, με αποτέλεσμα η μεγάλη υπομονάδα να παρουσιάζει μία συμπαγή δομή, το σώμα, με τρείς προεξοχές, την L1 9

10 προεξοχή, την κεντρική προεξοχή (αποτελούμενη από το 5 rrna, από μέρος του 23 rrna, και από τις πρωτεΐνες L5, L18, L25 και L33) καθώς και την προεξοχή L7 / L12 γνωστή και ως μίσχο ή στέλεχος [Yusupov et al, 2001] (Eικ. 4). Εικόνα 4. (Α) Δευτεροταγής δομή του 23 και του 5 rrna (Β) Τρισδιάστατη απεικόνιση της μεγάλης υπομονάδας με χρωματική αντιστοίχιση προς την δευτεροταγή δομή Η ενεργότητα του ριβοσώματος, γνωστή και με το όνομα πεπτίδυλο-τρανσφεράση (PTase) εντοπίζεται στη μεγάλη ριβοσωματική υπομονάδα [Lieberman and Dahlberg, 1995], και συγκεκριμένα στην V περιοχή του 23 rrna και πλησίον αυτής. Ιδιαίτερο χαρακτηριστικό της μεγάλης υπομονάδας είναι το τούνελ, μέσω του οποίου η νεοσυντιθέμενη πολυπεπτιδική αλυσίδα απελευθερώνεται στο κυτταρόπλασμα [Nissen et al, 2000] (Εικ. 5). Το τούνελ εξόδου διασχίζει τη μεγάλη υπομονάδα από την περιοχή της πεπτίδυλο-τρανσφεράσης μέχρι τη βάση της υπομονάδος, δημιουργώντας έναν πόρο μήκους 100 Å και πλάτους 20 Å που φιλοξενεί 30 ως 50 αμινοξέα της αυξανόμενης πολυπεπτιδικής αλυσίδας [Malhotra et al 1998, Nissen et al 2000, Wimberly et al 2000, chluenzen et al 2000, Ban et al 2000, chluenzen et al 2001]. Περαιτέρω μελέτες έδειξαν ότι πρόκειται για ένα σύνθετο σύστημα αγωγών με μία ακόμα έξοδο σε απόσταση 53 Å από την αρχική [Malhotra et al 1998, Fran et al 1995a, Fran et al 1995b]. 10

11 Εικόνα 5. Τομή της μεγάλης ριβοσωματικής υπομονάδας, όπου διακρίνεται το τούνελ εξόδου της νεοσυντιθέμενης πεπτιδικής αλυσίδας Οι ριβοσωματικές πρωτεΐνες δεσμεύονται συνήθως σε εσοχές, μεταξύ των ελίκων, διασυνδέοντας απομακρυσμένες περιοχές της πρωτοταγούς δομής του 23 rrna. Φαίνεται να απουσιάζουν από τη διφασική επιφάνεια των δύο υπομονάδων, και πιο συγκεκριμένα, από περιοχές όπου δεσμεύονται το mrna και τα trnas, καθώς και από την περιοχή όπου εδράζεται το κέντρο της πεπτίδυλοτρανσφεράσης. Οι περισσότερες πρωτεΐνες, και στις δύο υπομονάδες, χαρακτηρίζονται από σφαιρικές δομές, οι οποίες εντοπίζονται κυρίως στην περιφέρεια των υπομονάδων. Πολλές εξ αυτών εκτείνονται με μακριές ουρές (tails) που φτάνουν βαθιά μέσα στον πυρήνα της δομής αλληλεπιδρώντας με το rrna. Οι ουρές αυτές είναι προεκτάσεις πλούσιες σε βασικά αμινοξέα που φτάνουν βαθιά στον πυρήνα του rrna. Τέτοιες πρωτεΐνες είναι οι 2, 6, 9, 11, 12, 14, 16, 17 της μικρής υπομονάδας, καθώς και οι L2, L3, L4, L15, L18, L19, L22, L24 της μεγάλης υπομονάδας [pillmann et al 1977, Nissen et al 2000]. Πρόσφατες κρυσταλλογραφικές μελέτες, στο αρχαίο Haloarcula marismortui, αποκάλυψαν ότι το ενεργό κέντρο της πεπτίδυλο-τρανσφεράσης απαρτίζεται αποκλειστικά από RNA, με ελάχιστη απόσταση προσέγγισης πρωτεϊνών τα 18,4 Å [Ban et al 2000, Nissen et al 2000] (Εικ. 6). 11

12 Εικόνα 6. (Α) Πρωτεΐνες που προσεγγίζουν το ενεργό κέντρο της πεπτίδυλο-τρανσφεράσης (Β) Το καταλυτικό κέντρο χωρίς το rrna. Οι εικόνες έχουν προκύψει από κρυσταλλογραφική ανάλυση του αρχαίου H. marismortui [Nissen et al 2000]. Όμως, στα ριβοσώματα του βακτηρίου Ε. coli, η αμινοτελική ουρά της πρωτεΐνης L27 προσεγγίζει το καταλυτικό κέντρο σε απόσταση που επιτρέπει την ανάπτυξη δεσμών υδρογόνου με συστατικά του καταλυτικού κέντρου [Maguire et al, 2005]. Το γεγονός αυτό απετέλεσε την βάση υποθέσεων για πιθανή συμμετοχή της L27 στο μηχανισμό κατάλυσης, αλλά οι υποθέσεις αυτές δεν έχουν γίνει ευρέως αποδεκτές από την επιστημονική κοινότητα [imonovic and teitz, 2009]. Ο ρόλος των ριβοσωματικών πρωτεϊνών φαίνεται να είναι η σύνδεση διαφορετικών νουκλεϊνικών περιοχών και η εμπλοκή τους σε κάποιες ριβοσωματικές λειτουργίες [Nissen et al, 2005] (Εικ. 7). 12

13 Eικόνα 7. Θέσεις ριβοσωματικών πρωτεϊνών και λειτουργίες τους, στην μικρή 30 (A) και στην μεγάλη 50 (Β) υπομονάδα Τα κύρια είδη αλληλεπιδράσεων που σταθεροποιούν την τριτοταγή δομή του rrna είναι α) γέφυρες μεταξύ φωσφορικών ομάδων του rrna, που διαμεσολαβούνται από ιόντα Mg +2 και πολυαμίνες, β) αλληλεπιδράσεις RNA RNA, οι οποίες περιλαμβάνουν την δημιουργία ζευγών βάσεων μεταξύ νουκλεοτιδίων ή την δημιουργία Α minor motifs, γ) αλληλεπιδράσεις RNA πρωτεϊνών οι οποίες συμβαίνουν κυρίως μέσω του σακχαροφωσφορικού σκελετού του RNA και των θετικών ομάδων των πρωτεϊνών [Laursen et al, 2005]. Οι δύο υπομονάδες ενωμένες σχηματίζουν το 70 ριβόσωμα. Συνδέονται μεταξύ τους με 12 γέφυρες που απαρτίζονται είτε από rrna των δύο υπομονάδων, είτε από rrna της μίας υπομονάδας και πρωτεΐνες της άλλης, είτε αποκλειστικά από πρωτεΐνες [Yusupov et al, 2001]. Έχει βρεθεί ένας 13

14 αριθμός σημείων επαφής μεταξύ της μικρής και μεγάλης υπομονάδας, γνωστές ως γέφυρες διασύνδεσης υπομονάδων [pahn et al, 2001] (Εικ. 8). Εικόνα 8. Γέφυρες διασύνδεσης των ριβοσωμικών υπομονάδων Οι γέφυρες αυτές, 12 σε αριθμό, παίζουν σημαντικό ρόλο στη σωστή λειτουργική επικοινωνία των υπομονάδων μεταξύ τους, δηλαδή στην συνεργασία μεταξύ των υπομονάδων για την διεκπεραίωση της μετατόπισης των υποστρωμάτων, καθώς και την μεταφορά σημάτων μεταξύ του κέντρου αποκωδικοποίησης της μικρής υπομονάδας και του κέντρου της πεπτίδυλο-τρανσφεράσης της μεγάλης υπομονάδας [Wilson and Nierhaus, 2003]. O χώρος μεταξύ των υπομονάδων καλύπτεται από τα trnas, των οποίων τα αντικωδικόνια σχηματίζουν ζεύγη με τα κωδικόνια του mrna, ενώ τα 3 άκρα τους, τα οποία φέρουν την νεοσυντιθέμενη πεπτιδική αλυσίδα ή το νέο αμινοξύ, εκτείνονται στο καταλυτικό κέντρο της 50 υπομονάδας. Το ριβόσωμα σχηματίζει τρείς θέσεις για τα trnas: την Ρ-θέση, όπου δεσμεύεται το πεπτίδυλο-trna ή το αποακυλιωμένο trna μετά το σχηματισμό του πεπτιδικού δεσμού, την Α-θέση, όπου δεσμεύεται το νεοεισερχόμενο άμινο-άκυλο-trna ή το πεπτίδυλο-trna μετά το σχηματισμό του πεπτιδικού δεσμού, καθώς και την Ε-θέση, που είναι ειδική για το αποακυλιωμένο trna πριν την έξοδό του από το ριβόσωμα. Πρόσφατες κρυσταλλογραφικές μελέτες αποκάλυψαν την τοπογραφία των θέσεων αυτών στο ριβόσωμα. Η Α-θέση εντοπίζεται κοντά στο μίσχο L7 / L12, η P-θέση στο διάκενο μεταξύ του λαιμού της μικρής υπομονάδας και της βάσης της κεντρικής προεξοχής της 50 υπομονάδας, ενώ η Ε-θέση κοντά στην προεξοχή της L1 [Agrawal et al 1996, tar et al 1997, Cate et al 1999] (Εικ. 9). 14

15 Εικόνα 9. Οι θέσεις δέσμευσης Α ( πράσινο ), Ρ ( μπλε ) και Ε ( πορτοκαλί ) των trnas ( A ) στη μικρή και ( Β ) στη μεγάλη υπομονάδα 15

16 1.3 trnas Η μετάφραση του mrna σε πρωτεΐνη εξαρτάται από μόρια προσαρμογής που αναγνωρίζουν και συνδέονται τόσο με τα κωδικόνια όσο και με τα αμινοξέα. Αυτοί οι κρίκοι μεταξύ του mrna και των πρωτεϊνών είναι τα μεταφορικά RNAs (transfer RNAs, trnas). άθε μόριο trna έχει μήκος 76 νουκλεοτιδίων. Διπλώνεται σε μια τρισδιάστατη δομή σχηματίζοντας ζεύγη βάσεων ανάμεσα σε διαφορετικές περιοχές του, με αποτέλεσμα να δημιουργούνται δίκλωνες περιοχές, και θηλιές που του αποδίδουν χαρακτηριστική δομή σχήματος L. Στα άκρα της δομής L εντοπίζονται δύο περιοχές αζευγάρωτων νουκλεοτιδίων. Η μία περιοχή αζευγάρωτων νουκλεοτιδίων σχηματίζει το αντικωδικόνιο, την ομάδα δηλαδή των τριών νουκλεοτιδίων που θα ζευγαρώσουν με τα νουκλεοτίδια του συμπληρωματικού κωδικονίου του mrna. Το άκρο του trna που φέρει το αντικωδικόνιο αλληλεπιδρά με την περιοχή αποκωδικοποίησης της μικρής υπομονάδας, ενώ το υπόλοιπο αλληλεπιδρά με τη μεγάλη υπομονάδα. H άλλη περιοχή αζευγάρωτων νουκλεοτιδίων, βρίσκεται στο 3 άκρο του μορίου με αλληλουχία βάσεων CCA, όπου δεσμεύεται το αμινοξύ ή η πεπτίδυλο-αλυσίδα. Τα CCA 3 άκρα των trnas εκτείνονται ως το καταλυτικό κέντρο. Το 3 άκρο του trna σχηματίζει δεσμούς υδρογόνου με βάσεις του 23 rrna, προκειμένου να εγκατασταθεί στην Α ή Ρ θέση του καταλυτικού κέντρου και να προσανατολίσει την πεπτίδυλο- και αμινοξική ομάδα καταλλήλως για την δημιουργία του πεπτιδικού δεσμού [Nierhaus et al, 2002].Η παγκοσμίως συντηρημένη τριτοταγής δομή των trnas φαίνεται στην Εικόνα 10. Εικόνα 10. Τριτοταγής δομή των trnas. Διακρίνονται οι περιοχές που αλληλεπιδρούν με τη μικρή υπομονάδα (μπλε χρώμα) και με τη μεγάλη υπομονάδα (κόκκινο χρώμα) [chaefrer et al, 2002] 16

17 Κατά την μετάφραση, τα trnas κινούνται διαδοχικά σε κάθε μία από τις ριβοσωμικές θέσεις δέσμευσης υποστρωμάτων. Ξεκινώντας από την Α περνούν στην Ρ και πριν φύγουν από το ριβόσωμα στην Ε. Εξαίρεση αποτελεί το εναρκτήριο trna, το οποίο δεσμεύεται απευθείας στην Ρ θέση. Τα trnas αλληλεπιδρούν με το ριβόσωμα. Αυτές οι αλληλεπιδράσεις, όχι μόνο σταθεροποιούν το trna στις θέσεις Α, Ρ και Ε, αλλά εμπλέκονται απευθείας και σε λειτουργικές διαδικασίες, όπως η αποκωδικοποίηση, η διατήρηση του σωστού μεταφραστικού πλαισίου ανάγνωσης, η μετακίνηση των trnas μέσα στο ριβόσωμα, καθώς και η κατάλυση της δημιουργίας του πεπτιδικού δεσμού. Το ριβόσωμα χρησιμοποιεί συντηρημένα χαρακτηριστικά των trnas, προκειμένου να τα αναγνωρίσει και να τα δεσμεύσει. Έτσι σχηματίζει επαφές και με άλλες περιοχές των trnas εκτός από το βρόγχο του αντικωδικονίου. Τέτοιες περιοχές είναι, το στέλεχος D που αλληλεπιδρά με την πλατφόρμα της μικρής υπομονάδας και με το σώμα της μεγάλης υπομονάδας. 17

18 1.4 Πεπτίδυλο-τρανσφεράση (PTase): το καταλυτικό κέντρο του ριβοσώματος Το καταλυτικό κέντρο του ριβοσώματος δημιουργείται από τις διασυνδέσεις πέντε ελίκων της περιοχής V του 23 rrna, των ελίκων 69 και 70 της περιοχής IV, και ενός μικρού τμήματος της περιοχής ΙΙ. Εντοπίζεται κάτω από την κεντρική προεξοχή της υπομονάδας [Lieberman et al 1995, Yusupov et al 2001]. Ο ακριβής τρόπος δράσης της πεπτίδυλο-τρανσφεράσης, όσον αφορά την κατάλυση δημιουργίας πεπτιδικού δεσμού, δεν είναι γνωστός. Κρυσταλλογραφικά δεδομένα δείχνουν πως δεν υπάρχουν πρωτεϊνικά συστατικά σε απόσταση μικρότερη των 18 Å από το κέντρο της PTase. Έχει βρεθεί πως τα CCA άκρα των P και A θέσεων trna δεσμεύονται και τoποθετούνται στις θέσεις αυτές αποκλειστικά από το 23 rrna [Nissen P. et al 2000, Moore et al 2003]. Τα C74 και C75 των πεπτίδυλο-trnas στην Ρ θέση δημιουργούν ζεύγη βάσεων με κατάλοιπα G της έλικας 80 της V περιοχής, και αντίστοιχα, τα άμινο-άκυλο-cca της Α θέσης έχουν το C75 δεσμευμένο με το νουκλεοτίδιο G2553 της ακραίας θηλιάς της έλικας 92. Περαιτέρω σταθεροποίηση των trnas στις θέσεις αυτές γίνεται μέσω A-minor αλληλεπιδράσεων της Α76 βάσης ( Εικ. 11 ).. Εικόνα 11. Αλληλεπιδράσεις των trnas με βάσεις της Ρ και A θέσης της μεγάλης υπομονάδας [Nierhaus et al 2003] Η αντίδραση της πεπτίδυλο-τρανσφεράσης λαμβάνει χώρα, όταν στην θέση Ρ βρίσκεται ένα πεπτίδυλο-trna (p-trna) και στην θέση A ένα άμινο-άκυλο-trna (aa-trna). Η α-αμινομάδα του αα-trna προσβάλλει την καρβοξυλομάδα του πεπτίδυλο-trna, δημιουργώντας ένα τετραεδρικό ενδιάμεσο, το οποίο οδηγεί σε πεπτιδικό δεσμό. Μελέτες δείχνουν πως υπάρχουν δύο ομάδες του rrna κοντά στην θέση αντίδρασης, που μπορούν να δημιουργήσουν δεσμούς υδρογόνου με την υπό επίθεση αμινομάδα : α) η 2 ΟΗ του Α76 του trna στην P θέση και β) η 2 ΟΗ του Α2451. Αυτοί οι 18

19 δεσμοί υδρογόνου πιθανώς βοηθούν στην αποπρωτονίωση ή την σωστή τοποθέτηση της α-αμινομάδας για την νουκλεοφιλική επίθεση [Nissen et al 2000, Moore et al 2003, Nierhaus et al 2003]. 19

20 2. ΛΕΙΤΟΥΡΓΙΑ ΤΟΥ ΡΙΒΟΣΩΜΑΤΟΣ Πρωτεϊνική σύνθεση Η μετάφραση του αγγελιοφόρου RNA (mrna) σε πρωτεΐνη από τα ριβοσώματα είναι μία πολύπλοκη και πολύ σημαντική φάση της γονιδιακής έκφρασης. Η κατάλυση του πεπτιδικού δεσμού είναι από τους πιο βασικούς βιοχημικούς μηχανισμούς στη φύση και πραγματοποείται μέσω της ενζυμικής δραστηριότητας των ριβοσωμάτων. Η μετάφραση του mrna σε πρωτεΐνη λαμβάνει χώρα με μεγάλη ταχύτητα. In vivo, το προκαρυωτικό ριβόσωμα ενσωματώνει αμινοξέα ανά δευτερόλεπτο στην αναπτυσσόμενη πολυπεπτιδική αλυσίδα, ενώ η ακρίβεια της διαδικασίας διατηρείται υψηλή, με ένα λάθος στα αμινοξέα που ενσωματώνονται [Bremer and Dennis 1996]. 2.1 Πορεία πρωτεϊνικής σύνθεσης Οι πρωτεΐνες συντίθενται με κατεύθυνση από το άμινο- προς το καρβόξυ- τελικό άκρο, με την διαδοχική προσθήκη αμινοξέων στο καρβόξυ- άκρο της αναπτυσσόμενης αλυσίδας. Για τη διαδικασία απαιτούνται ενεργοποιημένα πρόδρομα μόρια, τα άμινο-άκυλο-trnas (aa-trnas), στα οποία η καρβοξυλική ομάδα ενός αμινοξέος εστεροποιείται με την 2 ή 3 υδροξυλομάδα της ριβόζης της ακραίας αδενοσίνης του 3 CCA άκρου του trna. Η αντίδραση ενεργοποίησης απαιτεί ΑΤΡ και καταλύεται από ειδικές συνθετάσες των άμινο-άκυλο-trnas. Για κάθε ένα από τα 20 αμινοξέα υπάρχει η αντίστοιχη συνθετάση, η οποία αναγνωρίζει αφ ενός το αμινοξύ, και αφετέρου όλα τα trnas που αποκωδικοποιούν αυτό το αμινοξύ. H πρωτεϊνική σύνθεση, από απόψεως μηχανισμού διακρίνεται σε τέσσερα στάδια: i) το στάδιο έναρξης, ii) το στάδιο επιμήκυνσης, iii) το στάδιο τερματισμού και iv) το στάδιο ανακύκλωσης. i) Στάδιο έναρξης Το στάδιο της έναρξης της πρωτεϊνοσύνθεσης περιλαμβάνει την δημιουργία του 70 εναρκτήριου συμπλόκου. Το σύμπλοκο αποτελείται από τις δύο ριβοσωμικές υπομονάδες, το mrna δεσμευμένο στην 30 υπομονάδα, έτσι ώστε το εναρκτήριο κωδικόνιο AUG να βρίσκεται στην P θέση και το αμέσως επόμενο κωδικόνιο στην Α θέση, και το εναρκτήριο trna (fmet-trna fmet ) στην Ρ θέση του ριβοσώματος [Gualerzi et al 1977, Pon et al 1984, Zucer & Hershey 1986, Gualerzi et al 1990, Tomsic et al 2000, Gualerzi et al 2000, Yusupova et al 2001]. Απαραίτητοι για το στάδιο έναρξης είναι οι παράγοντες έναρξης IF1, IF2 και IF3 [Hartz et al 1990, La Teana et al 1995, Dahlquist et al 2000, Carter et al 2001]. Για τη σύνθεση λειτουργικών πολυπεπτιδίων απαραίτητο είναι να γίνει η έναρξη στο σωστό κωδικόνιο του mrna. H θέση έναρξης στο προκαρυωτικό mrna επιλέγεται μέσω σχηματισμού ζευγών βάσεων τύπου Watson-Cric με την hine-dalgarno αλληλουχία του ριβοσωματικού RNA. Η περιοχή αυτή του mrna ονομάζεται αντί-hine-dalgarno 20

21 αλληλουχία και βρίσκεται ανοδικά του κωδικονίου έναρξης. Αποτελείται από τρείς ως εννέα βάσεις που δημιουργούν ζεύγη με κάποιες ή όλες τις βάσεις 1534 ως 1542 (ΑCCUCCUUA) του 3 άκρου του 16 rrna. Η αλληλεπίδραση αυτή φέρνει κοντά τη μικρή υπομονάδα με το κωδικόνιο έναρξης του mrna. Η δέσμευση του mrna στην 30 διευκολύνεται από τον IF3 [McCutcheon et al 1999, Carter et al 2000, Dallas and Noller 2001]. Το mrna παραμένει ενωμένο με την αλληλουχία κατά το σχηματισμό του πρώτου πεπτιδικού δεσμού [Huttenhofer and Noller 1994]. Εκτός από το 3 - άκρο του 16 rrna, στην πρόσδεση του mrna στο ριβόσωμα εμπλέκονται και οι πρωτεΐνες 1 και 21. Στη συνέχεια το εναρκτήριο fmet-trna προσδένεται στην 30 υπομονάδα, και σχηματίζει ζεύγη βάσεων με το κωδικόνιο έναρξης AUG. Η πρόσδεση αυτή προάγεται από το σύμπλοκο IF2 GTP. Ο IF2 είναι ο μόνος από τους παράγοντες που αναγνωρίζει και δεσμεύει το εναρκτήριο fmet-trna. Συνεπώς οι πολυπεπτιδικές αλυσίδες ξεκινούν πάντα με μεθειονίνη. Ο IF2 στην ενεργοποιημένη του μορφή είναι συμπλοκοποιημένος με GTP και έχει ενεργότητα GTPάσης (GTPase). Η θέση δέσμευσης του fmettrna βρίσκεται στο καρβόξυ-τελικό άκρο του παράγοντα, ενώ οι θέσεις δέσμευσης με το ριβόσωμα και το GTP εντοπίζονται στην κεντρική του περιοχή [purio et al 2000]. Ο παράγοντας IF3 σταθεροποιεί την πρόσδεση του fmet-trna IF2 στην 30 υπομονάδα. Ο IF3 σε συνεργασία με τον IF2 διαδραματίζει σημαντικό ρόλο στην πιστότητα της έναρξης, αναγνωρίζοντας ειδικά δομικά χαρακτηριστικά του εναρκτήριου trna (G-C ζεύγη που βρίσκονται στο αντικωδικό του άκρο) [Maitra et al 1982, Binley et al 1990, ussman et al 1996, Mangroo and RajBhandary 1995]. Επιπλέον, δεσμευόμενος στην 30 υπομονάδα εμποδίζει το σχηματισμό του 70 ριβοσώματος, οδηγώντας την ισορροπία σχηματισμού του 70 συμπλόκου προς την πλευρά των υπομονάδων [Moazed et al, 1995]. Με αυτόν τον τρόπο εξασφαλίζει ελεύθερες υπομονάδες διαθέσιμες για νέα έναρξη της μετάφρασης. Οι λειτουργίες του IF3 συμβαδίζουν με την τοπογραφία του στο ριβόσωμα [McCutcheon et al 1999] (Εικ. 12). Εικόνα 12. Απεικόνιση της 30 υπομονάδας (κίτρινο χρώμα), όπου παρουσιάζονται οι σχετικές θέσεις των IF3 (μωβ χρώμα) και του trna δεσμευμένου στην Ρ-θέση (πράσινο χρώμα) 21

22 Όσον αφορά τον IF1, πρόσφατα κρυσταλλογραφικά δεδομένα αποκάλυψαν ότι ο IF1 εντοπίζεται στην περιοχή του λαιμού της 30 και μάλιστα καλύπτει την Α-θέση προσδενόμενος στη μικρή υπομονάδα μεταξύ της έλικας 44 (h44), του βρόγχου 530 και της πρωτεΐνης 12. Από τη θέση αυτή εκτείνεται στην έλικα 44 προκαλώντας αλλαγή θέσης στις Α1492 και Α1493, οι οποίες με τη σειρά τους προκαλούν μετακίνηση των βάσεων C1412 και Α1413. Οι μετακινήσεις αυτές επάγουν μία αλυσίδα αλλαγών διαμόρφωσης στην έλικα 44, που περιλαμβάνουν στροφή της κεφαλής, ώμου και πλατφόρμας [Carter et al 2001, La Teana et al 2001]. Η h44 συμμετέχει σε τρείς γέφυρες διασύνδεσης με την 50 υπομονάδα [Yusupov et al 2001]. Φαίνεται ότι εκτεταμένες αλλαγές διαμόρφωσης στην 30 λόγω της πρόσδεσης του IF1 στην Α-θέση διευκολύνουν τη σύζευξη της μικρής υπομονάδας με την 50, επάγοντας έτσι το σχηματισμό του 70 συμπλόκου [Carter et al 2001]. Επικαλύπτοντας την Α-θέση, ο IF1 εμποδίζει τη δέσμευση του fmet-trna στη θέση αυτή κατά τη διαδικασία της έναρξης της πρωτεϊνοσύνθεσης [Moazed et al 1995, Carter et al 2001]. Οι αλληλεπιδράσεις του IF1 με την 30 υπομονάδα, όπως έχουν προκύψει από κρυσταλλογραφικά δεδομένα, αναλύονται στην ακόλουθη εικόνα ( Εικ. 13 ). Εικόνα 13. Αλληλεπίδραση του IF1 με τη μικρή υπομονάδα (Α) Η θέση πρόσδεσης του IF1, όπου διακρίνονται, ο IF1 ( μωβ χρώμα ), η έλικα 44 ( γαλάζιο χρώμα ), ο βρόγχος 530 ( πράσινο χρώμα ) και η 12 ( κίτρινο χρώμα ). (Β) Άποψη της 30 ( γκρι χρώμα ) από την επιφάνεια επαφής των υπομονάδων, όπου Κ= κεφαλή, Σ= σώμα, Λ= λαιμός, Π= πλατφόρμα και Ω=ώμος της 30. Tα χρώματα των δομών αντιστοιχούν στα χρώματα του Α. (Γ) Άποψη όπως η Β, όπου παρουσιάζονται τα trnas, στην Α-θέση ( μπλε χρώμα ), Ρ-θέση ( καφέ χρώμα ) και Ε-θέση ( κίτρινο χρώμα ). Σύγκριση των εικόνων Α και Β δείχνει ότι η θέση του ΙF1 καλύπτει τη θέση δέσμευσης του trna της Α-θέσης [Carter et al 2001] Το εναρκτήριο ριβοσωματικό σύμπλοκο fmet-trna mrna 30 υπομονάδα συζεύγνυται με μία ελεύθερη 50 υπομονάδα, το GTP του IF2 υδρολύεται και οι παράγοντες ενάρξεως απομακρύνονται 22

23 από το ριβόσωμα. Έτσι σχηματίζεται το εναρκτήριο ριβοσωματικό σύμπλοκο 70 ριβόσωμα mrna fmet-trna. Όταν ολοκληρωθεί η διαδικασία έναρξης, το fmet-trna βρίσκεται δεσμευμένο στην θέση Ρ, ενώ η θέση Α είναι κενή [Maitra et al 1982, everini et al 1991]. ii) Στάδιο επιμήκυνσης. Στο στάδιο της επιμήκυνσης, πραγματοποιούνται τρείς βιοχημικές διεργασίες: 1) Πρόσδεση του νεοεισερχόμενου άμινο-άκυλο-trna στην Α-θέση, 2) Σχηματισμός πεπτιδικού δεσμού, και 3) Μετατόπιση των trnas. Στα βακτήρια, στο στάδιο επιμήκυνσης εμπλέκονται δύο παράγοντες επιμήκυνσης, ο EF-Tu και ο EF-G. 1. Πρόσδεση του νεοεισερχόμενου άμινο-άκυλο-trna στην Α-θέση Η επιμήκυνση του νεοσυντιθέμενου πεπτιδίου ξεκινάει, όταν ένα άμινο-άκυλο-trna (aatrna) προσδεθεί στην Α-θέση με τη μορφή του τριμερούς συμπλόκου aa-trna EF-Tu GTP. Στη θέση αυτή, το αντικωδικόνιο του aa-trna πρέπει να αλληλεπιδράσει με το αντίστοιχο κωδικόνιο του mrna. Αν για την πρόσδεση του σωστού τριμερούς συμπλόκου στην Α-θέση απαιτούνταν η αναγνώριση ολόκληρου του συμπλόκου, τότε θα είχαμε μια πολλή αργή διαδικασία προκειμένου να είναι ακριβής. Αντιθέτως, γνωρίζουμε ότι η πρωτεϊνική σύνθεση είναι μια γρήγορη (ένα ριβόσωμα ενσωματώνει αμινοξέα ανά δευτερόλεπτο) και ακριβής διαδικασία (μία λάθος ενσωμάτωση στις 3000). Αυτό επιτυγχάνεται με τη διεκπεραίωση της πρόσδεσης στην Α-θέση σε δύο στάδια, α) στο στάδιο αποκωδικοποίησης, όπου από τα συνολικά aa-trnas (41 στην E.coli), αποκλείονται τα aa-trnas με την εντελώς μη-συμπληρωματική αλληλουχία (περίπου 90% των συνολικών), ενώ παραμένουν τα συμπληρωματικά κατά τις δύο πρώτες βάσεις, και β) στο στάδιο τελικής εγκατάστασης στην Α-θέση, όπου πραγματοποιείται η τελική επιλογή του πλήρως συμπληρωματικού aa-trna. Ειδικότερα, στο στάδιο αποκωδικοποίησης αλληλεπιδρούν μόνο η περιοχή κωδικονίου-αντικωδικονίου και όχι ο EF-Tu GTP. Φαίνεται ότι γίνεται στερεοχημική αναγνώριση της μικρής αύλακας της διπλής έλικας που σχηματίζεται από το ζευγάρωμα των βάσεων μεταξύ του κωδικονίου του mrna και του αντικωδικονίου του trna. Στην παρακάτω εικόνα διακρίνεται η θέση αλληλεπίδρασης του τριμερούς συμπλόκου με την περιοχή αποκωδικοποίησης ( Εικ. 14 ).. 23

24 Εικόνα 14. (Α) Ο παράγοντας EF-Tu σε σύμπλοκο με το aa-trna και GTP. (B) Η θέση του τριμερούς συμπλόκου σε σχέση με τις Α, Ρ και Ε θέσεις του ριβοσώματος Γ) Λεπτομερής άποψη του συμπλόκου, όπου dc=περιοχή αποκωδικοποίησης, RL=περιοχή σαρκίνης-ρισίνης και GAC=κέντρο GTPάσης [Valle et al 2002] Σύμφωνα με μελέτες κρυσταλλογραφικής ανάλυσης του ριβοσώματος, η περιοχή αποκωδικοποίησης εντοπίζεται στη μικρή υπομονάδα γύρω από την Α-θέση και περιλαμβάνει τις έλικες 44 και 34 και το βρόγχο 530 του 16 rrna [Cate et al 1999, Yusupov et al 2001]. Πρωταρχικό ρόλο στο στάδιο αυτό έχουν δύο συντηρημένες και απαραίτητες για τη βιωσιμότητα της E.coli βάσεις, οι Α1492 και Α1493 της h44. Mε την πρόσδεση του mrna και του υποψήφιου trna, οι Α1492 και Α1493 στρέφονται προς την περιοχή αποκωδικοποίησης, όπως φαίνεται στην Εικόνα

25 Εικόνα 15. Κέντρο αποκωδικοποίησης (Α) απουσία και (Β) παρουσία mrna ( μπλε χρώμα ) και trna ( κίτρινο χρώμα ) στην Α-θέση. Στη δεξιά απεικόνιση, οι Α1492 και Α1493 ( κόκκινο χρώμα ) στρέφονται προς την περιοχή αποκωδικοποίησης [Ogle et al, 2001] Η βάση Α1493 αναγνωρίζει τη μικρή αύλακα του πρώτου ζευγαριού κωδικονίου-αντικωδικονίου, σχηματίζοντας από ένα δεσμό υδρογόνου με το mrna και το trna αντίστοιχα. Η βάση Α1492 σε συνεργασία με την επίσης συντηρημένη G530 σχηματίζουν από ένα δεσμό υδρογόνου με το mrna και το trna, ελέγχοντας το δεύτερο ζεύγος κωδικονίου-αντικωδικονίου. Ταυτόχρονα, σχηματίζονται δεσμοί υδρογόνου μεταξύ της Α1492 και της συντηρημένης C518, καθώς και της υψηλά συντηρημένης σερίνης 46 (E.coli) της πρωτεΐνης 12. Η τρίτη βάση του κωδικονίου σχηματίζει δεσμό υδρογόνου με την G530, αφήνοντας σχετικά ελεύθερη την τρίτη θέση του αντικωδικονίου για «wobble» αλληλεπιδράσεις [Ogle et al, 2001]. Η αρχική αυτή πρόσδεση του συμπληρωματικού trna προκαλεί προσέγγιση της κεφαλής και του ώμου της μικρής υπομονάδας, που σταθεροποιούν το trna στην Α-θέση. Ταυτόχρονα, αυτές οι αλλαγές σηματοδοτούν αλλαγές διαμόρφωσης στον EF-Tu, που τελικά πυροδοτούν την υδρόλυση του GTP και απελευθέρωση του παράγοντα. Μετά την απελευθέρωση του EF-Tu, το 3 άκρο του aa-trna που φέρει το αμινοξύ κινείται και εισέρχεται στο καταλυτικό κέντρο της πεπτίδυλο-τρανσφεράσης. Η κίνηση αυτή περιλαμβάνει περιστροφή γύρω από το στέλεχος του αντικωδικονίου. Στο στάδιο αυτό, δηλαδή μετά την υδρόλυση του GTP, αλλά πριν από το σχηματισμό πεπτιδικού δεσμού, πραγματοποιείται ο τελικός έλεγχος για την εγκατάσταση του aa-trna στην Α-θέση. Η πιθανότητα να απορριφθεί ένα συγγενές aa-trna στο στάδιο αυτό είναι ιδιαίτερα αυξημένη, επειδή το στάδιο αυτό είναι βραδύ για τα συγγενή aa-trna, αλλά ταχύ για τα πλήρως συμπληρωματικά [Pape et al 1992, Ogle et al 2001, Rodnina and Wintermeyer 2001]. Στο τέλος αυτού του σταδίου το εναρκτήριο trna βρίσκεται στην Ρ-θέση και το aa-trna στην Α-θέση. Συνεπώς, το ριβόσωμα είναι έτοιμο για το σχηματισμό πεπτιδικού δεσμού. 25

26 2. Σχηματισμός πεπτιδικού δεσμού ή αντίδραση πεπτίδυλο-τρανσφεράσης Κατά το σχηματισμό του πεπτιδικού δεσμού η α-αμινομάδα του προσδεδεμένου στην Α-θέση aa-trna προσβάλλει την καρβονυλομάδα του εστερικού δεσμού που συνδέει τη νεοσυντιθέμενη πεπτιδική αλυσίδα με το trna της Ρ-θέσης (Εικ. 16Α). Το αποτέλεσμα είναι ο σχηματισμός ενός τετραεδρικού ενδιαμέσου που οδηγεί στο σχηματισμό πεπτιδικού δεσμού (Εικ. 16Β, 16Γ). Τελικά το aa-trna γίνεται πεπτίδυλο-trna επιμηκυσμένο κατά ένα αμινοξύ, ενώ το πρώην πεπτίδυλο-trna αποακυλιώνεται (εικόνα 16Δ). Εικόνα 16. Στάδια σχηματισμού του πεπτιδικού δεσμού Ο σχηματισμός του πεπτιδικού δεσμού πραγματοποιείται στο κέντρο της πεπτίδυλο-τρανσφεράσης. Βασικά ερωτήματα στην έρευνα του ριβοσώματος είναι, αν ο σχηματισμός πεπτιδικού δεσμού καταλύεται από πρωτεΐνες ή από RNA, καθώς και αν το ριβόσωμα αποτελεί απλώς το υπόβαθρο για τη σωστή στερεοχημική τοποθέτηση των αντιδρώντων ή διαδραματίζει πιο σύνθετη λειτουργία με κάποιο συστατικό του να συμμετέχει άμεσα στο μηχανισμό της κατάλυσης. Την απάντηση στο πρώτο ερώτημα έδωσε η κρυσταλλογραφία, που έδειξε ότι το καταλυτικό κέντρο του ριβοσώματος της Η. marismortui αποτελείται αποκλειστικά από RNA [Nissen et al, 2000]. Έτσι, θεωρήθηκε ότι το ριβόσωμα είναι ριβοένζυμο [Nissen et al 2000, Ban et al 2000]. Όσον αφορά το δεύτερο ερώτημα, 26

27 παλαιότερες βιοχημικές μελέτες [Bruice and Benovic 1963] είχαν δείξει ότι αμινοξέα προσροφημένα σε στερεό υπόστρωμα μπορούν να προσβάλλουν συν-προσροφημένα εστεροποιημένα κατάλοιπα αμινοξέων, με ρυθμό ανάλογο με τον in vivo ρυθμό βιοσύνθεσης πεπτιδικού δεσμού. Στη συνέχεια, κρυσταλλογραφικά δεδομένα αποκάλυψαν ότι πράγματι τα CCA 3 άκρα των trnas είναι στενά προσδεδεμένα στην Α και Ρ-θέση του ριβοσώματος και μάλιστα, τοποθετούνται σε απόσταση 1,7Å [Yusupov et al 2001]. Φαίνεται λοιπόν, ότι η ικανότητα του ριβοσώματος για σύνθεση πεπτιδικού δεσμού οφείλεται καταρχήν, στην ικανότητά του να δεσμεύει σε κατάλληλη διαμόρφωση και απόσταση τα δύο υποστρώματα. Όμως είναι πιθανό το ριβόσωμα να αυξάνει περαιτέρω το ρυθμό σχηματισμού του πεπτιδικού δεσμού, μέσω χημικής κατάλυσης. Προκειμένου να διερευνηθεί η δεύτερη υπόθεση, χρησιμοποιήθηκαν δομές οι οποίες μιμούνται το ενδιάμεσο κατά το σχηματισμό του πεπτιδικού δεσμού. Αρχικές κρυσταλλογραφικές μελέτες έδειξαν ότι η A2451 της περιοχής V είναι η βάση που τοποθετείται πιο κοντά στο ενδιάμεσο του πεπτιδικού δεσμού [Nissen et al 2000, Muth et al 2000] (Εικ. 17). Εικόνα 17. Το Ν3 της Α2451 βρίσκεται σε τέτοια απόσταση, ώστε να μπορεί να σχηματίσει δεσμό υδρογόνου με την αμινομάδα ( attacing amino ) του trna της Α-θέσης. Τα κρυσταλλογραφικά δεδομένα ελήφθησαν χρησιμοποιώντας μεταβατικά ανάλογα της σύνθεσης του πεπτιδικού δεσμού Δεδομένου ότι η Α2451 είναι ισχυρά συντηρημένη, οι υποκαταστάσεις της από άλλα νουκλεοτίδια είναι θανατηφόρες και το pa του Ν3 της αδενίνης εμφανίζει παραδόξως υψηλή τιμή (pa 7), υποστηρίχθηκε αρχικά η υπόθεση ότι το Ν3 της Α2451 συμμετέχει ως βάση, αφαιρώντας πρωτόνιο από την α-αμινομάδα και σταθεροποιώντας με δεσμό υδρογόνου το ενδιάμεσο κατά το σχηματισμό του πεπτιδικού δεσμού, με μηχανισμό κατάλυσης παρόμοιο με εκείνο των σερινοπρωτεασών [Muth et al 2000, Berg et al 2001] ( Εικ. 18 ). 27

28 Εικόνα 18. Μηχανισμός σχηματισμού του πεπτιδικού δεσμού Στη συνέχεια, in vitro κινητικές μελέτες έδειξαν ότι μετάλλαξη της Α2451 σε U οδηγεί σε μείωση πάνω από 100 φορές του ρυθμού σχηματισμού πεπτιδικού δεσμού, ενώ χάνεται και η εξάρτηση από το ph, συνηγορώντας με το ρόλο της Α2451 ως δέκτη πρωτονίων [atunin et al, 2002]. Νεότερες, όμως, μελέτες αμφισβητούν τον καταλυτικό ρόλο που αποδόθηκε στην Α2451. Συγκεκριμένα, αποκαλύφθηκε ότι ο βασικός χαρακτήρας του Ν3 της Α2451 αναιρείται σε φυσιολογικό ιοντικό περιβάλλον [Bayfield et al, 2001]. Επίσης, πρόσφατες κρυσταλλογραφικές μελέτες ριβοσωματικών συμπλόκων που περιείχαν δομικά ανάλογα υποστρωμάτων πιο φυσιολογικά από εκείνα των αρχικών μελετών, αποκάλυψαν ότι ο προσανατολισμός της Α2451 είναι στην πραγματικότητα αντίθετος εκείνου που είχε αρχικά βρεθεί [Hansen et al, 2002]. Λαμβάνοντας υπ όψιν ότι η χημική κατάλυση αυξάνει σε μικρό μόνο βαθμό το ρυθμό σχηματισμού του πεπτιδικού δεσμού [atunin et al 2002], φαίνεται ότι κυρίαρχο ρόλο στο σχηματισμό του πεπτιδικού δεσμού διαδραματίζει η ακριβής στερεοχημική τοποθέτηση των αντιδρώντων στο ριβόσωμα, ενώ μικρότερη συμμετοχή έχει η καταλυτική δραστικότητα των συστατικών του. Σε επιβεβαίωση της άποψης αυτής, πρόσφατες μελέτες συνηγορούν ότι η κατάλυση του πεπτιδικού δεσμού πραγματοποιείται μέσω ενός συνδυασμού τριών μηχανισμών : εντροπικής παγίδευσης των υποστρωμάτων, οξεο-βασικής κατάλυσης και 28

29 ηλεκτροστατικής σταθεροποίησης του τετραεδρικού ενδιαμέσου μέσω ενός μορίου ύδατος [imonović and teitz, 2009]. 3. Μετατόπιση των trnas Μετά το σχηματισμό του πεπτιδικού δεσμού, ο παράγοντας EF-G συμπλοκοποιημένος με GTP δεσμεύεται στο ριβόσωμα, πυροδοτώντας τη μετατόπιση του πεπτίδυλο-trna από την Α-θέση στην Ρ-θέση, τη μετατόπιση του αποακυλιωμένου trna από την Ρ στην Ε θέση και τη μετακίνηση του mrna κατά ένα κωδικόνιο (10-15 Å). Στη μετατόπιση αυτή πειθαρχεί όλο το μόριο των trnas, τόσο η περιοχή που φέρει το αντικωδικόνιο, που σε λάθος μετατόπισή του θα χανόταν το αναγνωστικό πλαίσιο, όσο και η περιοχή που φέρει το αμινοξύ, ώστε να μην μετακινηθεί από το καταλυτικό κέντρο και να παρεμποδισθεί συνεπώς ο περαιτέρω σχηματισμός του πεπτιδικού δεσμού. Κατά τη μετατόπιση το GTP υδρολύεται. Έτσι, ο παράγοντας απελευθερώνεται από το ριβόσωμα μετά το τέλος της μετατόπισης με τη μορφή EF-G GDP. Οι παράγοντες EF-G και EF-Tu προσδένονται σε αλληλοεπικαλυπτόμενες θέσεις, στη βάση του μίσχου L7 / L12 [Agrawal et al 1998, tar et al 2000, Fran and Agrawal 2000]. Μάλιστα, τμήμα του EF-G καλύπτει την Α-θέση, εμποδίζοντας έτσι παλινδρόμηση του πεπτίδυλο-trna στη θέση αυτή κατά τη διάρκεια της μετατόπισης [Nierhaus, 1996]. Μετατόπιση μπορεί να συμβεί και in vitro απουσία του παράγοντα, με χαμηλότερο όμως ρυθμό [chilling-bartezo et al, 1992]. Έτσι, ο μηχανισμός της μετατόπισης αναζητήθηκε σε αλλαγή διαμόρφωσης του ριβοσώματος per se. Σύμφωνα με πρόσφατα δεδομένα της κρυο-ηλεκτρονικής μικροσκοπίας και κρυσταλλογραφίας παρατηρείται στροφή της μικρής υπομονάδας σε σχέση με τη μεγάλη πριν τη μετατόπιση και επιστροφή στην αρχική θέση μετά την μετατόπιση και απελευθέρωση του παράγοντα. Τα δεδομένα της κρυο-ηλεκτρονικής κρυσταλλογραφίας και ανάλυσης ακτίνων Χ υποστηρίζουν μηχανισμό μετατόπισης δύο σταδίων. Στο πρώτο στάδιο η πρόσδεση του παράγοντα επάγει στροφή της μικρής υπομονάδας (ratchet motion). Η στροφή προκαλεί με τη σειρά της αλλαγές διαμόρφωσης και στις δύο υπομονάδες, με κύρια συνέπεια τη διεύρυνση του καναλιού διόδου του mrna, ώστε αυτό να μπορεί να μετακινηθεί κατά τη μετατόπιση. Στο δεύτερο στάδιο η υδρόλυση του GTP επάγει την επαναφορά της μικρής υπομονάδας στην αρχική θέση, μετατόπιση των trnas από τις Α-Ρ στις Ρ-Ε θέσεις και απελευθέρωση του παράγοντα από το ριβόσωμα [Fran et al, 2000]. Όσον αφορά τα μοντέλα που περιγράφουν τον κύκλο της επιμήκυνσης, δύο είναι τα επικρατέστερα: το μοντέλο των υβριδικών θέσεων και το «α-ε» αλλοστερικό μοντέλο. Σύμφωνα με το πρώτο μοντέλο, τα trnas κατά τη μετατόπισή τους καταλαμβάνουν υβριδικές ( Α / Ρ, Ρ / Ε ) ή αμιγείς θέσεις ( Α / Α, Ρ / Ρ, Ε ), όπως φαίνεται στην εικόνα 19 [Moazed and Noller 1989]. 29

30 Εικόνα 19. Mοντέλο υβριδικών θέσεων (ως Α / Ρ ονομάζεται η πρόσδεση του trna στην Α-θέση της μικρής υπομονάδας και στην Ρ-θέση της μεγάλης) Η αρχική επιλογή του aa-trna γίνεται σε μία υβριδική θέση αναγνώρισης Α / Τ, όπου Τ η θέση πρόσδεσης του τριμερούς συμπλόκου EF-Tu GTP aa-trna στη μεγάλη υπομονάδα. Αμέσως μετά το σχηματισμό του πεπτιδικού δεσμού, το τμήμα των trnas που είναι δεσμευμένο στη μεγάλη υπομονάδα προχωρά στην επόμενη θέση δέσμευσης, ενώ η θέση του στη μικρή υπομονάδα δεν αλλάζει. Το τμήμα του πεπτίδυλο-trna στην 50 μετακινείται από την Α στην Ρ θέση και το αποακυλιωμένο trna από την Ρ στην Ε. Έτσι, το πεπτίδυλο-trna τοποθετείται στην υβριδική θέση Α / Ρ, όπου η αντικωδική περιοχή βρίσκεται ακόμη στην Α-θέση, ενώ το αποακυλιωμένο trna τοποθετείται στην Ρ / Ε υβριδική θέση [Moazed and Noller, 1989]. Σύμφωνα με το δεύτερο μοντέλο τα trnas δεσμεύονται σε μια κινητή δομή του ριβοσώματος, η οποία μετακινείται κατά τη μετατόπιση κρατώντας τα δύο trnas στο ίδιο ριβοσωματικό περιβάλλον. Η κινητή αυτή δομή περιλαμβάνει δύο περιοχές δέσμευσης, την «α» και την «ε» [Nierhaus, 1996] (Eικ. 20). 30

31 Εικόνα 20. Αλλοστερικό μοντέλο «α-ε» Όταν, ένα μόριο trna καταλαμβάνει την «α» θέση μπορεί να βρίσκεται στην Α-θέση πριν τη μετατόπιση και στην Ρ μετά τη μετατόπιση. Ομοίως, trna δεσμευμένο στην «ε» θέση μπορεί να βρίσκεται στις Ρ και Ε θέσεις, πριν και μετά τη μετατόπιση αντίστοιχα. Έτσι, η κίνηση των trnas γίνεται ταυτόχρονα και συντονισμένα και στις δύο υπομονάδες και όχι ανεξάρτητα, όπως προκύπτει από το πρώτο μοντέλο. Η λειτουργικότητα των Α και Ε θέσεων χαρακτηρίζεται από ετερότροπο αλλοστερισμό. Δηλαδή, η συγγένεια της Ε θέσης για υπόστρωμα μειώνεται σημαντικά όταν η Α θέση είναι δεσμευμένη και αντιστρόφως. Έτσι, όταν το aa-trna προσδένεται στην Α-θέση, το κινητό τμήμα «α-ε» μετακινείται από τις Ρ-Ε στις Α-Ρ θέσεις, αφήνοντας την Ε θέση χωρίς ικανότητα δέσμευσης [Nierhaus, 1990]. Μετά την εγκατάσταση του συμπληρωματικού trna στην Α-θέση, το κινητό τμήμα επιστρέφει από την Ρ-Ε στην Α-Ρ θέση. Βιοχημικά [Rheinberger et al 1981, Geigenmuller and Nierhaus 1990] και κρυσταλλογραφικά δεδομένα [Dabrowsi et al 1996, Polace et al 2000, Fran and Agrawal 2000] συνηγορούν υπέρ του δεύτερου μοντέλου. Πρόσφατες, όμως, κινητικές μελέτες υποστηρίζουν το υβριδικό μοντέλο [harma et al, 2004]. iii) Στάδιο τερματισμού. Η προσθήκη αμινοξέων στη νεοσυντιθέμενη πεπτιδική αλυσίδα σταματά, όταν εμφανίζεται κωδικόνιο τερματισμού στην Α-θέση του ριβοσώματος. Η διαδικασία του τερματισμού ξεκινά, όταν ένα κωδικόνιο λήξης (stop κωδικόνιο) βρεθεί στην Α θέση. Στα βακτήρια, η αναγνώριση του stop κωδικονίου εμπλέκει τους παράγοντες RF1 και RF2. Και οι δύο παράγοντες αναγνωρίζουν το UAA κωδικόνιο λήξης, ενώ ο RF1 αναγνωρίζει επιπλέον το UAG, ενώ ο RF2 αναγνωρίζει επιπλέον το UGA 31

32 [ isselev & Bucingham, 2000]. Η διαδικασία τερματισμού της πρωτεϊνικής σύνθεσης μπορεί να διαχωριστεί σε δύο διαδοχικά στάδια: 1) την απελευθέρωση της νεοσυντιθέμενης πεπτιδικής αλυσίδας και 2) την απελευθέρωση του συμπλόκου τερματισμού. 1) Η απελευθέρωση της νεοσυντιθέμενης πεπτιδικής αλυσίδας Οι RFs αλληλεπιδρούν τόσο με την περιοχή αποκωδικοποίησης της μικρής υπομονάδας, όσο και με το ενεργό κέντρο της πεπτίδυλο-τρανσφεράσης. Στην πρώτη περίπτωση οι RFs αναγνωρίζουν το κωδικόνιο τερματισμού στην Α-θέση του ριβοσώματος. Πιο ειδικά, ένα τριπεπτίδιο προς το αμινοτελικό τους άκρο είναι υπεύθυνο για αυτή τη λειτουργία, όπου το πρώτο και τρίτο αμινοξύ του αναγνωρίζουν την δεύτερη και τρίτη βάση του κωδικονίου. Το τριπεπτίδιο αλληλεπιδρά στην Α-θέση με την περιοχή αποκωδικοποίησης με ανάλογο τρόπο με αυτόν του trna και του παράγοντα ΙF1 [Ito et al 2000, Naamura and Ehrenberg 2000, Ogle et al 2001, carlett et al 2003]. Όσον αφορά την αλληλεπίδραση των RFs με την πεπτίδυλο-τρανσφεράση, ένα υψηλά συντηρημένο GGQ μοτίβο εμπλέκεται στην υδρόλυση της πεπτιδικής αλυσίδας, προσανατολίζοντας ένα μόριο Η 2 Ο πλησίον του εστερικού δεσμού που συγκρατεί την πεπτιδική αλυσίδα στο trna [Moffat et al 1993, Dincbas- Renqvist et al 2000, Wilson et al 2000, Vestergaard et al 2001]. Το μοτίβο αυτό εντοπίζεται κρυσταλλογραφικά στο καταλυτικό κέντρο του ριβοσώματος, κάνοντας επαφή με το CCA-άκρο του trna της Ρ-θέσης [Wilson et al 2000, laholz et al 2003, Rawat et al 2003] (Eικ. 21). Εικόνα 21. (Α) Ο παράγοντας RF2 (πορτοκαλί χρώμα) αλληλεπιδρά με την περιοχή αποκωδικοποίησης (έλικα 44) και το mrna. (B) To GGQ μοτίβο (κίτρινο χρώμα) του RF2 εκτείνεται στο καταλυτικό κέντρο κοντά στο CCA-άκρο του trna της Ρ-θέσης Αν οι RFs διαδραματίζουν άμεσο ή έμμεσο ρόλο στην υδρόλυση του εστερικού δεσμού στους προκαρυωτικούς οργανισμούς, δεν έχει ξεκαθαριστεί. Αν και το μοτίβο GGQ είναι υψηλά και παγκοσμίως συντηρημένο, μεταλλάξεις σε αυτό δεν οδηγούν σε πλήρη απώλεια της ικανότητας υδρόλυσης [eit-nebi et al 2001, Vestergaard et al 2001]. Από κρυσταλλογραφικά δεδομένα μπορεί 32

33 να προταθεί ότι οι RFs αλληλεπιδρούν αρχικά με το κέντρο αποκωδικοποίησης. Αν δεν συναντήσουν κωδικόνιο τερματισμού, απομακρύνονται από το ριβόσωμα. Όμως, αν συναντήσουν κωδικόνιο τερματισμού, τότε επάγεται αλλαγή διαμόρφωσής τους ώστε να αποκτήσουν μια πιο εκτεταμένη μορφή, επιτρέποντας στην GGQ περιοχή να προσεγγίσει το καταλυτικό κέντρο, όπου προσδένεται ισχυρά [Rawat et al 2003, carlett et al 2003]. 2) Η απελευθέρωση του συμπλόκου τερματισμού Ένας τρίτος παράγοντας τερματισμού, ο RRF GTP, προάγει, ύστερα από υδρόλυση του GTP, απελευθέρωση των RF1 / 2 από το ριβόσωμα. Μετά τη λήξη του πρώτου σταδίου του τερματισμού, παραμένει στην Α-θέση του ριβοσώματος ο RRF και στην P-θέση το αποακυλιωμένο trna. iv) Η ανακύκλωση των ριβοσωματικών υπομονάδων για τον επόμενο κύκλο πρωτεϊνικής σύνθεσης. Ακολουθεί διαχωρισμός των υπομονάδων, απελευθέρωση του mrna και των trnas και ανακύκλωσή τους μέσω των παραγόντων RRF, EF-G και IF3 [Hirashima and aji 1970, Hirashima and aji 1972, Zaviolov et al 2001, iel et al 2003]. Προκειμένου να μπεί το ριβόσωμα σε επόμενο κύκλο πρωτεϊνοσύνθεσης, απαραίτητη προϋπόθεση αποτελεί η απελευθέρωση του RRF, του mrna, του αποακυλιωμένου trna, καθώς και ο διαχωρισμός του 70 ριβοσώματος στις υπομονάδες. Στη διαδικασία αυτή συμμετέχουν δύο παράγοντες, ο EF-G και ο ΙF-3 [Hirashima and aji 1970, Hirashima and aji 1972, iel et al 2003]. O ακριβής μηχανισμός αυτού του τελευταίου σταδίου δεν έχει διευκρινιστεί. Δύο μοντέλα έχουν προταθεί. Σύμφωνα με το πρώτο μοντέλο, ο RRF μαζί με τον EF-G διαχωρίζουν το ριβόσωμα στις υπομονάδες, ενώ η αποδέσμευση του mrna και του αποακυλιωμένου trna γίνεται από τον παράγοντα έναρξης IF3. Το μοντέλο αυτό προσδίδει στους EF-G και IF3 νέους ρόλους [arimi et al, 1999]. Στο δεύτερο μοντέλο, ο RRF προσδένεται στην Α-θέση του ριβοσώματος και στη συνέχεια αναλαμβάνει ο EF-G GTP να μετατοπίσει τον RRF και το αποακυλιωμένο trna από τις Α και Ρ θέσεις, στις Ρ και Ε, αντίστοιχα. Εφόσον σταθερή πρόσδεση του trna στην Ε-θέση δεν υφίσταται χωρίς σταθερή αλληλεπίδραση κωδικονίου-αντικωδικονίου στην Ρ-θέση, το trna απελευθερώνεται και τελικά όλο το σύμπλοκο διαχωρίζεται στα συστατικά του [Rheinberger et al 1981, chilling- Bartezo et al 1992, Pavlov et al 1997, iel et al 2003]. Στο προκαρυωτικό κύτταρο το ριβόσωμα μπορεί να μην αποδεσμευθεί από το mrna, αλλά κινείται στο πολυκιστρονικό mrna αναζητώντας καινούργια θέση έναρξης. 33

34 3. ΑΝΤΙΒΙΟΤΙΚΑ ΚΑΙ ΡΙΒΟΣΩΜΑ 3.1 Γενικά περί αντιβιοτικών Τα αντιβιοτικά είναι χαμηλού μοριακού βάρους (< 3000 D) μεταβολικά προϊόντα μικροοργανισμών, τα οποία αναστέλλουν (ή και νεκρώνουν), σε χαμηλές συγκεντρώσεις (< 200 μg/ml), την ανάπτυξη άλλων μικροοργανισμών [pahn and Prescott, 1996]. Σήμερα, στον ορισμό περιλαμβάνονται και συνθετικές ενώσεις οι οποίες έχουν τοξική δράση έναντι μικροοργανισμών, ιών και ευκαρυωτικών κυττάρων [Τsui et al., 2004]. To πρώτο αντιβιοτικό, η βενζυλική πενικιλλίνη, ανακαλύφθηκε το Η δράση της έναντι του παθογόνου οργανισμού taphylococcus aureus περιορίσθηκε σύντομα (2 χρόνια μετά την εμπορική της διάθεση) μετά την εφαρμογή της, λόγω της ταχείας ανάπτυξης ανθεκτικότητας του παθογόνου έναντι σε αυτό. Παρόμοια φαινόμενα παρατηρήθηκαν και με άλλα αντιβιοτικά που ανακαλύφθηκαν τις επόμενες δεκαετίες. Οι επιστήμονες συνειδητοποίησαν πως τα παθογόνα βακτήρια έχουν την ικανότητα να αναπτύσσουν, σε σύντομο χρόνο και υπό κατάλληλες συνθήκες έκθεσης, πολλαπλούς τρόπους ανθεκτικότητας έναντι των αντιβιοτικών. Οι μηχανισμοί αντίστασης των βακτηρίων έναντι των αντιβιοτικών που στοχεύουν τον μηχανισμό της πρωτεϊνικής σύνθεσης διακρίνονται σε τρείς κατηγορίες: α) με χημική τροποποίηση ή μετάλλαξη της θέσης δέσμευσης του αντιβιοτικού στο ριβόσωμα [Lambert, 2005], β) με μείωση της ενδοκυττάριας συγκέντρωσης του αντιβιοτικού μέσω ειδικών αντλιών εξόδου (efflux pumps), oι οποίες οδηγούν σε απέκκριση του αντιβιοτικού από το κύτταρο [Ross et al. 1990, Acermann and Rodloff 2003, umara and chweizer 2005] και γ) με απενεργοποίηση του αντιβιοτικού μέσω παραγωγής ενζύμων αδρανοποίησής του από τα ίδια τα κύτταρα [Wright, 2005]. Aνάλογα με τον μηχανισμό δράσης τους, έναντι των βακτηρίων, τα αντιβιοτικά διακρίνονται σε αυτά που παρεμποδίζουν: α) την σύνθεση του DNA π.χ. φθοριοκινολόνες [Maxwell, 1997], β) την σύνθεση του RNA π.χ. ριφαμπικίνη, γ) την σύνθεση του κυτταρικού τοιχώματος π.χ. β- και μόνο λακτάμες [pratt and Cromie, 1988], δ) την λειτουργία της κυτταρικής μεμβράνης π.χ. γραμμισιδίνη, και ε) την βακτηριακή πρωτεϊνική σύνθεση [Βrisson-Noel et al. 1988, Walsh 2000]. Στην εικόνα 22 απεικονίζονται οι στόχοι των αντιβιοτικών στο προκαρυωτικό κύτταρο [Walsh, 2000]. 34

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα

Από τα δεδομένα της πρωτοδιάταξης σε συνδυασμό με τα δεδομένα που λαμβάνονται από ανοσοχημικές

Από τα δεδομένα της πρωτοδιάταξης σε συνδυασμό με τα δεδομένα που λαμβάνονται από ανοσοχημικές Εν αντιθέσει με αυτά που έχουν βρεθεί για τους προκαρυωτικούς οργανισμούς, για τους ευκαρυωτικούς υπάρχουν διαθέσιμες μόνο λίγες ακολουθίες ριβοσωμικών πρωτεϊνών. Από τα δεδομένα της πρωτοδιάταξης σε συνδυασμό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

Μετάφραση του mrna. mrna Translation. Βιοσύνθεση πρωτεϊνών Πολυμερισμός αμινοξέων. Γενικά χαρακτηριστικά

Μετάφραση του mrna. mrna Translation. Βιοσύνθεση πρωτεϊνών Πολυμερισμός αμινοξέων. Γενικά χαρακτηριστικά Μετάφραση του mrna mrna Translation Βιοσύνθεση πρωτεϊνών Πολυμερισμός αμινοξέων 1 Γενικά χαρακτηριστικά A. Μετάφραση της αλληλουχίας νουκλεοτιδίων του mrna σε αλληλουχία αμινοξέων- Γενικές έννοιες 1. Γενετικός

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

Μετάφραση του mrna. mrna Translation. Βιοσύνθεση πρωτεϊνών Πολυμερισμός αμινοξέων. Γενικά χαρακτηριστικά

Μετάφραση του mrna. mrna Translation. Βιοσύνθεση πρωτεϊνών Πολυμερισμός αμινοξέων. Γενικά χαρακτηριστικά Μετάφραση του mrna mrna Translation Βιοσύνθεση πρωτεϊνών Πολυμερισμός αμινοξέων 1 Γενικά χαρακτηριστικά A. Μετάφραση της αλληλουχίας νουκλεοτιδίων του mrna σε αλληλουχία αμινοξέων- Γενικές έννοιες 1. Γενετικός

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΔΕΥΤΕΡΟ ΣΚΑΛΟΠΑΤΙ ΤΗΣ ΡΟΗΣ ΠΛΗΡΟΦΟΡΙΩΝ - ΣΥΝΘΕΣΗ ΠΡΩΤΕΪΝΩΝ

ΔΕΥΤΕΡΟ ΣΚΑΛΟΠΑΤΙ ΤΗΣ ΡΟΗΣ ΠΛΗΡΟΦΟΡΙΩΝ - ΣΥΝΘΕΣΗ ΠΡΩΤΕΪΝΩΝ ΔΕΥΤΕΡΟ ΣΚΑΛΟΠΑΤΙ ΤΗΣ ΡΟΗΣ ΠΛΗΡΟΦΟΡΙΩΝ - ΣΥΝΘΕΣΗ ΠΡΩΤΕΪΝΩΝ Ιωάννης Π. Τρουγκάκος Τομέας Βιολογίας Κυττάρου & Βιοφυσικής Τμήμα Βιολογίας, Παν/μιο Αθηνών 6.1. Πρωτεϊνοσύνθεση Ένας μηχανισμός αποκωδικοποίησης

Διαβάστε περισσότερα

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ φ φ Ccarbonyl n Ccarbonyl n N Cα n Ccarbonyl n-1 Cα n N φ Ccarbonyl n-1 ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ ψ φ ψ Ccarbonyl n N (Ca

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

Η κυτταρική µετατόπιση των πρωτεϊνών

Η κυτταρική µετατόπιση των πρωτεϊνών 9-1 Κεφάλαιο 9 Η κυτταρική µετατόπιση των πρωτεϊνών Εισαγωγή Στο κύτταρο η έκφραση των πρωτεϊνών γίνεται από µόνο ένα τύπο ριβοσώµατος (εκτός των µιτοχονδριακών και των χλωροπλαστικών που µοιάζουν µε αυτά

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα

regulatory mechanisms). stringency).

regulatory mechanisms). stringency). ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ Αποτελεί µια άλλη περίπτωση ρύθµισης των γονιδίωνκαιδιακρίνεται: 1) Στην αυτόνοµη καταστολή και 2) Στηναυτόνοµηεπαγωγή. ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ 1) Αυτόνοµη καταστολή: Η µεταβολική πορεία καταλήγει

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

Από το γονίδιο στην πρωτεΐνη

Από το γονίδιο στην πρωτεΐνη Κεφάλαιο 17 Από το γονίδιο στην πρωτεΐνη Original Slides by Erin Barley Kathleen Fitzpatrick Γρηγόρης Παπαγρηγορίου 1 Η ροή της γενετικής πληροφορίας Η πληροφορία που περιέχεται στα γονίδια έχει την μορφή

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)]

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] Μεταβίβαση γενετικής πληροφορίας Η Γενετική πληροφορία βρίσκεται στο DNA (Λεία) (Αδρά) Αντικείμενα του μαθήματος Διαιώνιση/ Εξέλιξη της πληροφορίας

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ο µέγιστος αριθµός διαφορετικών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α A1. α Α2. γ Α3. α Α4. α Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Τα πολυπεπτίδια

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΧΕΙΡΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ : - ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΘΕΜΑ A Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ B Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Από. Από. κατά την πορεία της μεταγραφής. την αποδοτικότητα της Μεταμεταγραφικής ωρίμανσης. Από

Από. Από. κατά την πορεία της μεταγραφής. την αποδοτικότητα της Μεταμεταγραφικής ωρίμανσης. Από Τα επίπεδα του mrna πού είναι διαθέσιμα για την μετάφραση προσδιορίζονται Από την ταχύτητα σύνθεσης του μηνύματος κατά την πορεία της μεταγραφής Από την αποδοτικότητα της Μεταμεταγραφικής ωρίμανσης Από

Διαβάστε περισσότερα

οµή και Αναδίπλωση πρωτεϊνών

οµή και Αναδίπλωση πρωτεϊνών οµή και Αναδίπλωση πρωτεϊνών Νηφόρου Κατερίνα Μεταδιδακτορική Ερευνήτρια, Οµάδα Μοριακής Καρκινογένεσης, Εργ/ριο Ιστολογίας-Εµβρυολογίας, Ιατρική Σχολή Αθηνών Σηµασία των πρωτεϊνών Ενζυµική κατάλυση Μεταφορά

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

Το κεντρικό δόγμα (The central dogma)

Το κεντρικό δόγμα (The central dogma) Οι βασικές μοριακές γενετικές διαδικασίες Αντιγραφή Μεταγραφή Μετάφραση ΠΡΩΤΕΪΝΗ Το κεντρικό δόγμα (The central dogma) Σύσταση νουκλεοτιδίων του DNA και του RNA Α 5 -άκρο Θυμίνη (Θ) Β 5 άκρο Αδενίνη (Α)

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΜΑΤΑ 1.Πώς οι κινητικές παράμετροι Κ m και K cat χρησιμεύουν για να συγκριθεί η ανακύκλωση διαφορετικών

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. 1. β 2. β 3. γ 4. β Β. Ζύμωση: Διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες Υβριδοποίηση:

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Θέματα 1. Ποια είναι η δομή και τα βασικά χαρακτηριστικά των λιπαρών οξέων 2. Πώς απομακρύνονται

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Οι οργανισμοί εξασφαλίζουν ενέργεια, για τις διάφορες λειτουργίες τους, διασπώντας θρεπτικές ουσίες που περιέχονται στην τροφή τους. Όμως οι φωτοσυνθετικοί

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ Θέµατα ιάλεξης οµή, αριθµός και διαχωρισµός των αµινοξέων Ένωση αµινοξέων µε τον πεπτιδικό δεσµό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. β 2. γ 3. α 4. γ 5. δ ΘΕΜΑ 2ο 1. Σχολικό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Μοριακή Αναγνώριση. 5.1. Εισαγωγή. 5.2. Σταθερές σύνδεσης και αποχωρισµού. [A][B] k d = ----------- [AB] [ΑΒ] k i = ---------- [Α][Β] Κεφάλαιο

Μοριακή Αναγνώριση. 5.1. Εισαγωγή. 5.2. Σταθερές σύνδεσης και αποχωρισµού. [A][B] k d = ----------- [AB] [ΑΒ] k i = ---------- [Α][Β] Κεφάλαιο Κεφάλαιο 5-1 5 Μοριακή Αναγνώριση 5.1. Εισαγωγή Ένα από τα σηµαντικότερα χαρακτηριστικά των ζωντανών οργανισµών είναι ότι τα µακροµόρια που περιέχουν κάνουν πολύ εξειδικευµένες αλληλεπιδράσεις µε άλλα

Διαβάστε περισσότερα

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι σ αυτόν. Β2. Σελίδα 133

Διαβάστε περισσότερα