1 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες. Τασος Οικονόµου

Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "1 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες. Τασος Οικονόµου"


1 1 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες Τασος Οικονόµου

2 Τι θα πούµε 1. Βασική πρωτεινική Βιοχηµεία 2. Πρωτεινες στο κυτταρικό περιβάλλον 3. Απο τις µεµονωµένες πρωτείνες στο πρωτεινωµικό διαδίκτυο 4. Πως µελετάµε πρωτεινες? 5. Πως µελετάµε διαπρωτεινικές επαφές?

3 Τι θα πούµε 1. Βασική πρωτεινική Βιοχηµεία 2. Πρωτεινες στο κυτταρικό περιβάλλον 3. Απο τις µεµονωµένες πρωτείνες στο πρωτεινωµικό διαδίκτυο 4. Πως µελετάµε πρωτεινες? 5. Πως µελετάµε διαπρωτεινικές επαφές?

4 H xηµεία της ζωής είναι χηµεία πολυµερών

5 4 γευσεις βιολογικων µακροµοριων ΑΤΑΞΙΑ ΑΤΟΜΑ Ν, Ο, C, S, P, H... (ΜΙΚΡΟ)ΜΟΡΙΑ Σάκχαρα Λιπαρά οξέα Νουκλεοτίδια Αµινοξέα ΜΑΚΡΟΜΟΡΙΑ Πολυσακχαρίτες Λιπίδια DNA, RNA Πρωτεΐνες ΜΑΚΡΟΜΟΡΙΑΚΑ ΣΥΜΠΛΟΚΑ ΤΑΞΗ (οργάνωση δοµών) µη πληροφοριακά πληροφοριακά

6 Τι δουλειές εκτελούν οι ΠPΩTEINEΣ? 1. Kατάλυση κυτταρικής χηµείας 2. Pύθµιση κυτταρικής χηµείας 3. οµικά στοιχεία κύτταρου

7 οµη αµινοξεων

8 οµή αµινοξέων-οι 22 οµαδες R +σεληνοκυστεινη +πυρολυσινη

9 Πεπτιδικος δεσµος

10 οµή πρωτεινών (πρωτοταγης) NH2-Ala-Leu-Arg-Phe-Gly-Asp-Asp- Glu-Arg-Met etc cooh Πεπτιδικος δεσµος

11 οµή πρωτεινών (δευτεροταγης) α-ελικα/α-ελικα

12 οµή πρωτεινών (δευτεροταγης) β-πτυχωτο φυλλο/β-sheet

13 οµή πρωτεινών (τριτοταγης)

14 οµή πρωτεινών (τεταρτοταγης)

15 Τι θα πούµε 1. Βασική πρωτεινική Βιοχηµεία 2. Πρωτεινες στο κυτταρικό περιβάλλον 3. Απο τις µεµονωµένες πρωτείνες στο πρωτεινωµικό διαδίκτυο 4. Πως µελετάµε πρωτεινες? 5. Πως µελετάµε διαπρωτεινικές επαφές?

16 Tι είναι το κύτταρο? Γιαννης Χηµικοπουλος Xµµµµ. ένα σακκουλάκι µε οργανικά χηµικά

17 Tι είναι το κύτταρο? Γιαννης Χηµικοπουλος Xµµµµ. ένα σακκουλάκι µε οργανικά χηµικά Μαρια Εντροπιδου Xµµµµ. µία εντροπική µηχανή ενέργεια ζωή θερµότητα

18 ΚΥΤΤΑΡΟΠΟΥΛΟΣ Xηµεία - H 2 O - 4 πολυµερή Tι είναι το κύτταρο? DNA RNA Πολυπεπτίδια Πολυσακχαρίτες Σύνθετα Λιπίδια Πόσα? (% dry weight) µονοµερή - διάφορα (στοιχεία, προσθετικές οµάδες κλπ) } 4

19 ΚΥΤΤΑΡΟΠΟΥΛΟΣ Tι είναι το κύτταρο? Kαθορ ισµένη χηµ ικά οντότητα µε ποσοτικά ορ ισµένο περ ιεχόµενο

20 ΚΥΤΤΑΡΟΠΟΥΛΟΣ Tι είναι το κύτταρο? Kαθορ ισµένη χηµ ικά οντότητα µε ποσοτικά ορ ισµένο περ ιεχόµενο Mπαµµµ!!!!! H B ιολογ ία µετατρέπετα ι σε πραγµατική σκληρη επιστηµη

21 Πως δουλεύει το κύτταρο? ηµήτρης Γενετικάκης Xµµµµ....είναι γεµάτο γονίδια...τα γονίδια "δίνουν" πρωτείνες

22 Πως δουλεύει το κύτταρο? ηµήτρης Γενετικάκης Xµµµµ....είναι γεµάτο γονίδια Mάκης Bιοχηµικάκης Xµµµµ....είναι γεµάτο πρωτείνες...τα γονίδια "δίνουν" πρωτείνες...οι πρωτείνες καταλύουν χηµικές αντιδράσεις, ρυθµίζουν και δηµιουργούν δοµές

23 Mycoplasma genitalium 482 γονίδια 440 πρωτείνες + 42 δοµικά RNA

24 M. genitalium Γονίδιο 1 mrna 1 Πολυπεπτίδιο 1 Πρωτο+ δευτεροταγής δοµή Τριτοταγής δοµή-aναδίπλωση Τροποποιήσεις Υποκυτταρική στόχευση Tεταρτοταγής δοµή ενέργεια ζωή θερµότητα

25 θερµότητα M. genitalium Γονίδιο 1 mrna 1 Πολυπεπτίδιο 1 Γονίδιο 2 mrna 2 Πολυπεπτίδιο 2 Γονίδιο 3 mrna 3 Πολυπεπτίδιο 3 Πρωτο+ δευτεροταγής δοµή Τριτοταγής δοµή-aναδίπλωση τροποποιήσεις Υποκυτταρική στόχευση Mοριακή Mηχανή ή Πολυµερικό Eνζυµο Tεταρτοταγής δοµή Tεταρτοταγής δοµή ενέργεια ζωή

26 Mycoplasma genitalium 482 γονίδια 440 πρωτείνες + 42 δοµικά RNA <100 µοριακές Mηχανές π.χ. - µαστίγιο ~50 υποµ. - ριβόσωµα ~50 υποµ. - F1ATPase ~8 υποµ. - DNApol ~10 υποµ. - SecTranslocase ~9

27 Τι θα πούµε 1. Βασική πρωτεινική Βιοχηµεία 2. Πρωτεινες στο κυτταρικό περιβάλλον 3. Απο τις µεµονωµένες πρωτείνες στο πρωτεινωµικό διαδίκτυο 4. Πως µελετάµε πρωτεινες? 5. Πως µελετάµε διαπρωτεινικές επαφές?

28 Λίγες πρωτείνες δρουν κατά µόνας π.χ. Υδρολάσες µικρών µορίων

29 Οι περισσότερες πρωτείνες ζούν σε αλληλεπίδραση µε άλλες π.χ. RNA πολυµεράσες, ριβόσωµα, µοριακές µηχανές

30 Tι είναι το κύτταρο? Molecular Crowding mg/ml πολυπεπτιδια

31 Molecular Crowding Tι είναι το κύτταρο? ενα Interactome

32 Η βιολογική πολυπλοκότητα πατά πάνω στην πρωτεινική πολυπλοκότητα

33 - Σε σχεση µε το γονιδιωµα το πρωτεινωµα ειναι πολυ πιο δυναµικο - Πρωτεινικη πολυπλοκοτητα>>γονιδιακη πολυπλοκοτητα

34 Τι ειναι το κύτταρο?..ένα εργοστάσ ιο δυναµ ικών µορ ιακών µηχανών που αλληλεπ ιδρούν Για να το κατανοήσω πρέπει να αποκτήσω πλήρη γνώση: 1. των ξεχωριστών ~100 µοριακών µηχανών (...το µονοπάτι της φώτισης..) 2. των επιδράσεων µεταξύ των µοριακών µηχανών 3. της κινητικής της δράσης των µοριακών µηχανών.

35 Τι θα πούµε 1. Βασική πρωτεινική Βιοχηµεία 2. Πρωτεινες στο κυτταρικό περιβάλλον 3. Απο τις µεµονωµένες πρωτείνες στο πρωτεινωµικό διαδίκτυο 4. Πως µελετάµε πρωτεινες? 5. Πως µελετάµε διαπρωτεινικές επαφές?

36 Τι θέλω να µάθω µελετώντας πρωτείνες κατά µόνας...6 easy pieces...

37 Τι θέλω να µάθω µελετώντας πρωτείνες κατά µόνας...6 easy pieces οµές σε ατοµική λεπτοµέρεια

38 Τι θέλω να µάθω µελετώντας πρωτείνες κατά µόνας...6 easy pieces οµές σε ατοµική λεπτοµέρεια 2. Πρόσδεση υποστρωµάτων+κατάλυση

39 Τι θέλω να µάθω µελετώντας πρωτείνες κατά µόνας...6 easy pieces οµές σε ατοµική λεπτοµέρεια 2. Πρόσδεση υποστρωµάτων+κατάλυση 3. ιαπρωτεινικές επαφές

40 Τι θέλω να µάθω µελετώντας πρωτείνες κατά µόνας...6 easy pieces οµές σε ατοµική λεπτοµέρεια 2. Πρόσδεση υποστρωµάτων+κατάλυση 3. ιαπρωτεινικές επαφές 4. Κρίσιµα αµινοξέα

41 Τι θέλω να µάθω µελετώντας πρωτείνες κατά µόνας...6 easy pieces οµές σε ατοµική λεπτοµέρεια 2. Πρόσδεση υποστρωµάτων+κατάλυση 3. ιαπρωτεινικές επαφές 4. Κρίσιµα αµινοξέα 5. ευτερογενείς µετατροπές

42 Τι θέλω να µάθω µελετώντας πρωτείνες κατά µόνας...6 easy pieces οµές σε ατοµική λεπτοµέρεια 2. Πρόσδεση υποστρωµάτων+κατάλυση 3. ιαπρωτεινικές επαφές 4. Κρίσιµα αµινοξέα 5. ευτερογενείς µετατροπές 6. Στερεοδιατακτική δυναµική

43 Τι θέλω να µάθω µελετώντας πρωτείνες κατά µόνας...6 easy pieces οµές σε ατοµική λεπτοµέρεια 2. Πρόσδεση υποστρωµάτων+κατάλυση 3. ιαπρωτεινικές επαφές 4. Κρίσιµα αµινοξέα 5. ευτερογενείς µετατροπές 6. Στερεοδιατακτική δυναµική ZEN

44 Εργαλειοθήκη Πρωτεινικης Αναλυσης

45 Εργαλειοθήκη Πρωτεινικης Αναλυσης 1. Ενζυµολογια 2. Κρυσταλλογραφια 3. NMR 4. Μοριακη γενετικη 5. Βιοφυσικες/Φυσικοχηµικες µεθοδοι

46 Bιοφυσικές Mέθοδοι Xαρακτηρισµού µακροµορίων

47 Τι θα πούµε 1. Βασική πρωτεινική Βιοχηµεία 2. Πρωτεινες στο κυτταρικό περιβάλλον 3. Απο τις µεµονωµένες πρωτείνες στο πρωτεινωµικό διαδίκτυο 4. Πως µελετάµε πρωτεινες? 5. Πως µελετάµε διαπρωτεινικές επαφές?

48 Τι θέλω να µάθω µελετώντας πρωτείνες οµαδόν...4 easy pieces Ποιος δεσµεύεται µε ποιόν 2. Που δεσµεύεται ο κάθε εταίρος 3. Βιοφυσική της δέσµευσης 4. Λειτουργικές επιπτώσεις ZEN

49 Εργαλειοθήκη ιαπρωτεινικων Επιδρασεων

50 Ποιός δεσµεύεται µε ποιόν 2 εταίροι Γενετική 1. Yeast 2-hybrid 2. Genetics (extragenic suppressors, multi-copy suppresion, synthetic phenotype) 3. Phage display Βιοχηµεία 1. Co-purification/Co-fractionation/Co-sedimentation/Co-purification 2. Far-western 3. Size-exclusion chromatography 4. Native PAGE 5. Rate zonal centrifugation 6. Chemical cross-linking 7. Protease footprinting 8. Peptide scans 9. Enzymatic assays

51 Yeast 2-hybrid

52 Genetic suppression

53 Dominance

54 Phage Display

55 Ποιός δεσµεύεται µε ποιόν 2 εταίροι Βιοχηµεία 1. Co-purification/Co-fractionation/Co-sedimentation/ Co-purification 2. Far-western 3. Size-exclusion chromatography 4. Native PAGE 5. Rate zonal centrifugation 6. Chemical cross-linking 7. Protease footprinting 8. Peptide scans 9. Enzymatic assays

56 Affinity Chromatography

57 Chemical cross-linking

58 Ποιός δεσµεύεται µε ποιόν 2 εταίροι Βιοφυσική 1. Κρυσταλλογραφία 2. NMR 3. Aναλυτική Υπερφυγοκέντριση- Sedimentation Equilibrium 4. Light Scattering 5. Surface Plasmon Resonance and other biosensors 6. Fluorescence (e.g. FRET) 7. Circular dichroism 8. Isothermal Titration Calorimetry 9. Mass spectrometry

59 Isothermal Titration Calorimetry -Affinity -Stoichiometry -Thermodynamics

60 Μελετη του Interactome

61 Ποιός δεσµεύεται µε ποιόν n εταίροι 1. Yeast 2-hybrid 2. Protein microarrays 3. Multidimensional chromatography 4. Protein tagging+ms

62 Πολυπεπτιδικος διαχωρισµος πολλαπλων διαστασεων

63 ισδιαστατη αποµονωση πολυπεπτιδιων

64 Πολύτιµες πληροφορίες από πρωτεινωµατικη αναλυση - Σχετικές συγκεντρώσεις πολυπεπτιδιων στο κύτταρο - Kινητική έκφρασης - ιαπρωτεινικές επαφές (ταυτόχρονες και εν παραλλήλω) - Mετα-µεταφραστικές τροποιήσεις

BIO408/BIO506 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες. Tάσος Οικονόµου

BIO408/BIO506 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες. Tάσος Οικονόµου BIO408/BIO506 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες Tάσος Οικονόµου Τι θα πούµε 1. Βασική πρωτεινική Βιοχηµεία 2. Πρωτεινες στο κυτταρικό περιβάλλον 3. Απο τις µεµονωµένες πρωτείνες στο

Διαβάστε περισσότερα

BIO111 Μικροβιολογια ιαλεξη 3. Κυτταρικη Χηµεια

BIO111 Μικροβιολογια ιαλεξη 3. Κυτταρικη Χηµεια BIO111 Μικροβιολογια ιαλεξη 3 Κυτταρικη Χηµεια Mικροβιολογία = Bιολογία των µονοκύτταρων οργανισµών και των ιών H µεγάλη σας φίλη Το βακτηριο E.coli 1.000.000X C Γλυκόζη trna αντισωµα ριβοσωµα ATP DNA

Διαβάστε περισσότερα

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i..

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i.. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ «XHMIKH ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ» ΕΙΣΑΓΩΓΗ ΚΑΙ Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Όταν αναφερόμαστε στον όρο «Χημική Σύσταση του Κυττάρου», τί νομίζετε ότι

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα

τα βιβλία των επιτυχιών

τα βιβλία των επιτυχιών Τα βιβλία των Εκδόσεων Πουκαμισάς συμπυκνώνουν την πολύχρονη διδακτική εμπειρία των συγγραφέων μας και αποτελούν το βασικό εκπαιδευτικό υλικό που χρησιμοποιούν οι μαθητές των φροντιστηρίων μας. Μέσα από

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση:

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου Ενότητα 1.1: Χημεία της ζωής Ενότητα 2.1: Μακρομόρια Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: 1. Για ποιο λόγο θεωρείται αναγκαία η σταθερότητα

Διαβάστε περισσότερα

αποτελούν το 96% κ.β Ποικιλία λειτουργιών

αποτελούν το 96% κ.β Ποικιλία λειτουργιών ΧΗΜΙΚΑ ΣΤΟΙΧΕΙΑ ΠΟΥ ΣΥΝΘΕΤΟΥΝ ΤΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ 92 στοιχεία στο φλοιό της Γης 27 απαραίτητα για τη ζωή H, Ο, Ν, C αποτελούν το 96% κ.β S, Ca, P, Cl, K, Na, Mg αποτελούν το 4% κ.β. Fe, I Ιχνοστοιχεία αποτελούν

Διαβάστε περισσότερα

Βιοφυσική. ΦΥΣ 415 Διδάσκων Σ. Σκούρτης (χειμερινό εξάμηνο ) 3 η Διάλεξη

Βιοφυσική. ΦΥΣ 415 Διδάσκων Σ. Σκούρτης (χειμερινό εξάμηνο ) 3 η Διάλεξη Βιοφυσική ΦΥΣ 415 Διδάσκων Σ. Σκούρτης (χειμερινό εξάμηνο 2009-10) 3 η Διάλεξη Από την προηγούμενη διάλεξη: Οι πρωτεΐνες εκτελούν τις περισσότερες βιολογικές λειτουργίες π.χ Ενζυμική κατάλυση (επιτάχυνση

Διαβάστε περισσότερα

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημικά στοιχεία που συνθέτουν τους οργανισμούς Ο C, το H 2, το O 2 και το N 2 είναι τα επικρατέστερα στους οργανισμούς σε ποσοστό 96% κ.β. Γιατί; Συμμετέχουν σε σημαντικό βαθμό στη σύνθεση

Διαβάστε περισσότερα

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία)

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Βιοτεχνολογία Φυτών ΔΠΘ / Τμήμα Αγροτικής Ανάπτυξης ΠΜΣ Αειφορικά Συστήματα Παραγωγής και Περιβάλλον στη Γεωργία Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Αριστοτέλης Χ. Παπαγεωργίου Εργαστήριο

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα


ΔΙΑΚΡΙΣΗ ΣΤΟΙΧΕΙΩΝ ΜΑΚΡΟΘΡΕΠΤΙΚΑ (C, H, N, O) 96% ΜΙΚΡΟΘΡΕΠΤΙΚΑ (πχ. Na, K, P, Ca, Mg) 4% ΙΧΝΟΣΤΟΙΧΕΙΑ (Fe, I) 0,01% ΔΙΑΚΡΙΣΗ ΣΤΟΙΧΕΙΩΝ ΜΑΚΡΟΘΡΕΠΤΙΚΑ (C, H, N, O) 96% ΜΙΚΡΟΘΡΕΠΤΙΚΑ (πχ. Na, K, P, Ca, Mg) 4% ΙΧΝΟΣΤΟΙΧΕΙΑ (Fe, I) 0,01% Ο άνθρακας, το υδρογόνο, το οξυγόνο και το άζωτο συμμετέχουν, σε σημαντικό βαθμό, στη

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Τα χημικά μόρια που οικοδομούν τους οργανισμούς

ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Τα χημικά μόρια που οικοδομούν τους οργανισμούς ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ Τα χημικά μόρια που οικοδομούν τους οργανισμούς Μελέτη φαινομένου της ζωής o Η μελέτη του φαινομένου της ζωής ξεκινά από το μοριακό επίπεδο δηλαδή από τα χημικά μόρια που οικοδομούν

Διαβάστε περισσότερα

Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών

Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών Βασίλης Προμπονάς, PhD Ερευνητικό Εργαστήριο Βιοπληροφορικής Τμήμα Βιολογικών Επιστημών Νέα Παν/πολη, Γραφείο B161 Πανεπιστήμιο Κύπρου Ταχ.Κιβ. 20537 1678,

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΒΙΟΧΗΜΕΙΑ Ι. ΚΕΦΑΛΑΙΟ 2 ο Βιοχημική εξέλιξη


Διαβάστε περισσότερα

οµή και λειτουργία των µεγάλων βιολογικών µορίων

οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων κατηγορίες υδατάνθρακες πρωτεΐνες νουκλεϊνικά οξέα λιπίδια Οι πρωτεΐνες, υδατάνθρακες, νουκλεϊνικά οξέα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΝΟΤΗΤΑ 14: Ο ΦΟΡΕΑΣ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ (DNA) 14.1 ΕΙΣΑΓΩΓΗ 1 ΕΝΟΤΗΤΑ 14: Ο ΦΟΡΕΑΣ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ (DNA) 14.1 ΕΙΣΑΓΩΓΗ Οι δύο πολυνουκλεοτιδικές αλυσίδες του DNA αποτελούνται από νουκλεοτίδια τα οποία ενώνονται με φωσφοδιεστερικούς δεσμούς. Πιο συγκεκριμένα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΙΚΟΝΑ 2.4 ΣΤΑΔΙΑ ΜΕΤΑΦΡΑΣΗΣ σ ε λ ί δ α 1 ΕΙΚΟΝΑ 4.2β ΕΡΩΤΗΣΕΙΣ 1. Να συμπληρώσετε τα κενά πλαίσια της εικόνας με την κατάλληλη λέξη ή φράση 2. Να γράψετε τον προσανατολισμό της μετακίνησης του ριβοσώματος

Διαβάστε περισσότερα

Διδάσκων: Καθηγητής Εμμανουήλ Μ. Παπαμιχαήλ

Διδάσκων: Καθηγητής Εμμανουήλ Μ. Παπαμιχαήλ Τίτλος Μαθήματος: Ενζυμολογία Ενότητα: Εισαγωγή Διδάσκων: Καθηγητής Εμμανουήλ Μ. Παπαμιχαήλ Τμήμα: Χημείας 8 1. EIΣAΓΩΓH Tα ένζυμα είναι οι καταλύτες της ζώσης ύλης. Καταλύουν τις χημικές αντιδράσεις,

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 1 Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται

Διαβάστε περισσότερα


«ΠΡΩΤΕΪΝΕΣ: ΧΗΜΙΚΗ ΔΟΜΗ ΚΑΙ ΒΙΟΛΟΓΙΚΟΣ ΡΟΛΟΣ» «ΠΡΩΤΕΪΝΕΣ: ΧΗΜΙΚΗ ΔΟΜΗ ΚΑΙ ΒΙΟΛΟΓΙΚΟΣ ΡΟΛΟΣ» Τι είναι οι πρωτεΐνες; Από τι αποτελούνται; Ποιος είναι ο βιολογικός του ρόλος; Ας ρίξουμε μία ματιά σε όλα αυτά τα ερωτήματα που μας απασχολούν ΚΕΦΑΛΑΙΟ 1:

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ / Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ / Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1. Οργάνωση της ζωής βιολογικά συστήματα

ΚΕΦΑΛΑΙΟ 1. Οργάνωση της ζωής βιολογικά συστήματα ΚΕΦΑΛΑΙΟ 1 Οργάνωση της ζωής βιολογικά συστήματα 1.1 Τα μόρια της ζωής Καινούριες γνώσεις Ποια μόρια συμμετέχουν στη δομή και στις λειτουργίες των οργανισμών. Ποια είναι η σημασία του νερού για τη ζωή

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ 1. Τοποθετείστε στο διάγραμμα που ακολουθεί, τους όρους: σύνθεση, υδρόλυση, μακρομόριο, μονομερή. Ερμηνεύστε το διάγραμμα. Η -Q-

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 2. Δομή νουκλεϊκών οξέων ΝΟΥΚΛΕΪΚΑ ΟΞΕΑ ΣΥΣΤΑΣΗ ΟΡΓΑΝΙΣΜΩΝ ΣΕ ΟΡΓΑΝΙΚΕΣ ΕΝΩΣΕΙΣ ΜΙΚΡΟΜΟΡΙΑ ΜΑΚΡΟΜΟΡΙΑ 1. Αμινοξέα πρωτεϊνες

Διαβάστε περισσότερα

1.1 Η συζυγής βάση του Η 2 SO 4 είναι α. SO 4 2. β. HSO 4. γ. H 2 SO 3. δ. H 2 S. Μονάδες 5


Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 2 ο 1. Με ποιο μηχανισμό αντιγράφεται το DNA σύμφωνα με τους Watson και Crick; 2. Ένα κύτταρο που περιέχει ένα μόνο χρωμόσωμα τοποθετείται σε θρεπτικό υλικό που περιέχει ραδιενεργό

Διαβάστε περισσότερα

Βιοϋλικά. Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά. Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών

Βιοϋλικά. Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά. Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών Βιοϋλικά Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών Περιεχόμενα ενότητας Πρωτεΐνες Δομή και είδη Λειτουργίες πρωτεϊνών

Διαβάστε περισσότερα

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ Θέµατα ιάλεξης οµή, αριθµός και διαχωρισµός των αµινοξέων Ένωση αµινοξέων µε τον πεπτιδικό δεσµό

Διαβάστε περισσότερα

ΠΡΩΤΕΪΝΕΣ. Φατούρος Ιωάννης Αναπληρωτής Καθηγητής

ΠΡΩΤΕΪΝΕΣ. Φατούρος Ιωάννης Αναπληρωτής Καθηγητής ΠΡΩΤΕΪΝΕΣ Φατούρος Ιωάννης Αναπληρωτής Καθηγητής Θέματα Διάλεξης Δομή, αριθμός και διαχωρισμός των αμινοξέων Ένωση αμινοξέων με τον πεπτιδικό δεσμό για τη δημιουργία πρωτεΐνης Λειτουργίες των πρωτεϊνών

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Μεταγωγή σήματος και βιολογικές μεμβράνες

Μεταγωγή σήματος και βιολογικές μεμβράνες Μεταγωγή σήματος και βιολογικές μεμβράνες ΜΕΜΒΡΑΝΙΚΕΣ ΠΡΩΤΕΪΝΕΣ ΠΡΩΤΕΪΝΕΣ ΒΙΟΛΟΓΙΚΩΝ ΜΕΜΒΡΑΝΩΝ Ορισμός / Μονάδες Δομές (πρωτοταγής κλπ) Ταξινόμηση με βάση τις λειτουργίες Απεικόνιση - Μοντέλα (συρμάτων

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ.

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. ΒΙΟΛΟΓΙΑ Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. Ηλιούπολης Κεφάλαιο 1ο ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Η ΙΕΡΑΡΧΙΑ ΤΩΝ ΒΙΟΜΟΡΙΩΝ ΠΡΟΔΡΟΜΕΣ

Διαβάστε περισσότερα

β. [Η 3 Ο + ] > 10-7 Μ γ. [ΟΗ _ ] < [Η 3 Ο + ]


Διαβάστε περισσότερα

ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ. 1.4 Να μεταφέρετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις σωστά συμπληρωμένες: καταλύτες


Διαβάστε περισσότερα

Εξερευνώντας τα Βιομόρια Ένζυμα: Βασικές Αρχές και Κινητική

Εξερευνώντας τα Βιομόρια Ένζυμα: Βασικές Αρχές και Κινητική Εξερευνώντας τα Βιομόρια Ένζυμα: Βασικές Αρχές και Κινητική Βιοχημεία Βιομορίων Αθήνα 2015 Γενικές Ιδιότητες Ένζυμα : Βιολογικοί Καταλύτες Τα ένζυμα είναι πρωτεϊνικά μόρια Μικρή ομάδα καταλυτικών RNA H

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Φραγκίσκος Κολίσης Καθηγητής Βιοτεχνολογίας, Σχολή Χημικών Μηχανικών ΕΜΠ, Διευθυντής Ινστιτούτου Βιολογικών Ερευνών και Βιοτεχνολογίας, EIE

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο. 1.2 Όξινο είναι το υδατικό διάλυμα του α. ΝaCl. β. ΝΗ 4 Cl. γ. CH 3 COONa. δ. KOH. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΤΕΛΟΣ 1ΗΣ ΑΠΟ 7 ΣΕΛΙ ΕΣ


Διαβάστε περισσότερα

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες ΕΞΕΤΑΣΤΕΑ ΥΛΗ ΕΝΟΤΗΤΑ 2: Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ, 5 9 (απλή αναφορά) 2.2 ΤΟ ΝΕΡΟ ΚΑΙ Η ΒΙΟΛΟΓΙΚΗ ΤΟΥ ΣΗΜΑΣΙΑ, 9 14 (απλή αναφορά), 2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ, σελ. 20 36 Οργανικές Ουσίες

Διαβάστε περισσότερα


ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΕΙΣΑΓΩΓΗ Oι ζωντανοί οργανισμοί αποτελούνται από ένα ή περισσότερα κύτταρα. Χαρακτηρίζονται αντίστοιχα, μονοκύτταροι (μονοκυτταρικοί) και πολυκύτταροι (πολυκυτταρικοί)

Διαβάστε περισσότερα

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους Για να εξασφαλιστεί η σωστή και αρμονική έκφραση των ενζύμων μέσα στο κύτταρο χρειάζεται ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. και Η εναρμόνιση αυτή επιτυγχάνεται με διάφορους τρόπους

Διαβάστε περισσότερα

Μικρά αμινοξέα. Βιοχημεία Ι Β-3

Μικρά αμινοξέα. Βιοχημεία Ι Β-3 Βιοχημεία Ι Β-2 Μικρά αμινοξέα Βιοχημεία Ι Β-3 Aλειφατικά αμινοξέα Βιοχημεία Ι Β-4 Ιμινοξύ Βιοχημεία Ι Β-5 Αρωματικά αμινοξέα Βιοχημεία Ι Β-6 Βιοχημεία Ι Β-7 Η Tyr και η Trp απορροφούν στα 280nm-έτσι μετράται

Διαβάστε περισσότερα


3.2 ΕΝΖΥΜΑ ΒΙΟΛΟΓΙΚΟΙ ΚΑΤΑΛΥΤΕΣ ΠΕΡΙΛΗΨΗ ΣΤΟ 3 Ο ΚΕΦΑΛΑΙΟ: ΜΕΤΑΒΟΛΙΣΜΟΣ ΚΥΡΙΑΚΟΣ Γ. Β1 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Όλοι οι οργανισμοί προκειμένου να επιβιώσουν και να επιτελέσουν τις λειτουργίες τους χρειάζονται ενέργεια. Οι φυτικοί

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογικές Μεμβράνες και Μεταγωγή Σήματος

Βιολογικές Μεμβράνες και Μεταγωγή Σήματος ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Βιολογικές Μεμβράνες και Μεταγωγή Σήματος Πρωτεΐνες Διδάσκουσα: Καθ. Μαρία - Ελένη Ε. Λέκκα Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες

Διαβάστε περισσότερα

πρωτεϊνες νουκλεϊκά οξέα Βιολογικά Μακρομόρια υδατάνθρακες λιπίδια

πρωτεϊνες νουκλεϊκά οξέα Βιολογικά Μακρομόρια υδατάνθρακες λιπίδια πρωτεϊνες νουκλεϊκά οξέα Βιολογικά Μακρομόρια υδατάνθρακες λιπίδια Περιγραφή μαθήματος Επανάληψη σημαντικών εννοιών από την Οργανική Χημεία Χημική σύσταση των κυττάρων Μονοσακχαρίτες Αμινοξέα Νουκλεοτίδια

Διαβάστε περισσότερα

Οι πρωτεΐνες συμμετέχουν σε όλες τις κυτταρικές λειτουργίες

Οι πρωτεΐνες συμμετέχουν σε όλες τις κυτταρικές λειτουργίες Οι πρωτεΐνες συμμετέχουν σε όλες τις κυτταρικές λειτουργίες Γένωμα vs Πρωτέωμα Όλη η αλληλουχία βάσεων στο DNA Τι είναι δυνατόν Συγκεκριμένο Στατικό Οι πρωτεΐνες που κωδικοποιούνται από το γένωμα Τι είναι

Διαβάστε περισσότερα

Βάσεις δομικών δεδομένων βιολογικών μακρομορίων

Βάσεις δομικών δεδομένων βιολογικών μακρομορίων Βάσεις δομικών δεδομένων βιολογικών μακρομορίων Vasilis Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus Εισαγωγή Βασικές αρχές δομής πρωτεϊνών και νουκλεϊκών

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα

ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ. 1.4 Να μεταφέρετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις, σωστά συμπληρωμένες:


Διαβάστε περισσότερα

Εφαρμοσμένη Διατροφική Ιατρική

Εφαρμοσμένη Διατροφική Ιατρική Γλωσσάρι για το Μάθημα της Διατροφικής Ιατρικής Λιπαρά οξέα: περιέχουν μακριές αλυσίδες μορίων που αποτελούν σχεδόν όλο το σύμπλεγμα λιπιδίων τόσο για τα ζωικά όσο και για τα φυτικά λίπη. Αν αποκοπούν

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις


Διαβάστε περισσότερα

Ανακτήθηκε από την ΕΚΠΑΙΔΕΥΤΙΚΗ ΚΛΙΜΑΚΑ http://edu.klimaka.gr ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ


Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα


ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ. Πώς από το DNA φτάνουμε στις πρωτεΐνες ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ Πώς από το DNA φτάνουμε στις πρωτεΐνες Αντιγραφή του DNA o Ο μηχανισμός αντιγραφής του DNA ονομάζεται ημισυντηρητικός διότι κατά την αντιγραφή του

Διαβάστε περισσότερα

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών Διαχείριση ορμονικών μορίων Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών 3 ου Εξαμήνου Δ. Μπουράνης, Σ. Χωριανοπούλου 1 Φυσιολογία Φυτών Διαχείριση ορμονικών

Διαβάστε περισσότερα

Τριαδικό σύστημα του Salthe (1985) επίπεδα σημειωτικών διεργασιών.

Τριαδικό σύστημα του Salthe (1985) επίπεδα σημειωτικών διεργασιών. Τριαδικό σύστημα του Salthe (1985) επίπεδα σημειωτικών διεργασιών. Υψηλότερο επίπεδο-εκλεκτικό σημειωτικό περιβάλλον ή πλαίσιο-όροι ορίου-συνοριακές συνθήκες-εκλεκτικός ρυθμιστικός ρόλος-μακροσημειωτικό

Διαβάστε περισσότερα

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ Ενδεικτική διδακτική προσέγγιση Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ 30 Στο τέλος της διδασκαλίας της ενότητας αυτής ο μαθητής θα πρέπει να έχει: Διαπιστώσει ότι τα χημικά στοιχεία που

Διαβάστε περισσότερα

Γονιδιωματική. G. Patrinos

Γονιδιωματική. G. Patrinos Γονιδιωματική Η μεταγονιδιωματική εποχή... Σημαντικότερα επιτεύγματα POST GENOME ERA Ολοκλήρωση της αποκρυπτογράφησης της αλληλουχίας των γονιδιωμάτων πολλών οργανισμών. Προτύπωση μεθοδολογιών για προσδιορισμό

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Οι James Watson και Francis Crick δίπλα από το μοντέλο της διπλής έλικας του DNA που τους εξασφάλισε το Βραβείο Νόμπελ. 2015 2 Β.

Διαβάστε περισσότερα

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή.

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή. 5ο ΓΕΛ ΧΑΛΑΝΔΡΙΟΥ Μ. ΚΡΥΣΤΑΛΛΙΑ 2/4/2014 Β 2 ΚΕΦΑΛΑΙΟ 3 ΒΙΟΛΟΓΙΑΣ 3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική

Διαβάστε περισσότερα



Διαβάστε περισσότερα

σελ 1 από 8 Τμήμα Τεχνολογίας Τροφίμων ΤΕΙ Αθήνας Εαρινό Εξάμηνο a 2 η Εξέταση στην Βιοχημεία

σελ 1 από 8 Τμήμα Τεχνολογίας Τροφίμων ΤΕΙ Αθήνας Εαρινό Εξάμηνο a 2 η Εξέταση στην Βιοχημεία Τμήμα Τεχνολογίας Τροφίμων ΤΕΙ Αθήνας Εαρινό Εξάμηνο 2006 2007 a 2 η Εξέταση στην Βιοχημεία σελ 1 από 8 Ονοματεπώνυμο : Τυπικό εξάμηνο : Αριθμός Μητρώου : Σε κάθε ερώτηση αντιστοιχούν πέντε απαντήσεις

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ / Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: 1 ΗΜΕΡΟΜΗΝΙΑ: 21 / 09 /2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ / Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: 1 ΗΜΕΡΟΜΗΝΙΑ: 21 / 09 /2014 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Για τις ερωτήσεις Α1 έως και Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής ΚΕΑΛΑΙΟ 5 ιατήρηση και συνέχεια της ζωής 5.2 H ροή της γενετικής πληροφορίας 3 Πώς βρέθηκε η δομή του DNA στο χώρο; Η ανακάλυψη της δομής του DNA πραγματοποιήθηκε το 1953 από τους Watson και Crick. Από

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών Αφού είδαμε πως το DNA αντιγράφεται και μεταγράφεται, τώρα θα εξετάσουμε τη διαδικασία με την παράγονται οι πρωτεϊνες Στην ουσία θα πρέπει να συνδυαστεί ο κώδικας δύο βιβλιοθηκών,

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ: ΒΙΟΛΟΓΙΑ ΟΠ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ & ΧΕΙΜΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 22/10/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία και αρχές Βιοδιάβρωσης Πολυμερές Μονομερές

Βιολογία και αρχές Βιοδιάβρωσης Πολυμερές Μονομερές Βιολογία και αρχές Βιοδιάβρωσης Τα χημικά στοιχεία που συνθέτουν τους οργανισμούς. Στον φλοιό της γης απαντώνται 92 στοιχεία, απαραίτητα για την ζωή είναι τα 27, από τα οποία τα πιο σημαντικά είναι τα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ: Η ΕΠΙΣΤΗΜΗ ΤΩΝ ΖΩΝΤΑΝΩΝ ΟΡΓΑΝΙΣΜΩΝ ΒΙΟΛΟΓΙΑ: Η ΕΠΙΣΤΗΜΗ ΤΩΝ ΖΩΝΤΑΝΩΝ ΟΡΓΑΝΙΣΜΩΝ Παρατήρηση του φυσικού κόσμου και συλλογή πληροφοριών προς επιβίωση Κυνηγοί και συλλέκτες Γεωργοί Κτηνοτρόφοι Γιατροί - Θεραπευτές Τι είναι ζωή; Ποια είναι

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ EIKONA 2.1 Ημισυντηρητικός μηχανισμός αντιγραφής του DNA 1. Να γράψετε τα ένζυμα που (α) προκαλούν ξετύλιγμα των αλυσίδων του αρχικού (μητρικού μορίου) DNA και (β) συνθέτουν τις νέες αλυσίδες του DNA.

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ.

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ. Kυτταρική Bιολογία ΔIAΛEΞΗ 3 (7/3/2012) ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ AΣ ΘYMHΘOYME Στην προηγούμενη διάλεξη μιλήσαμε για τη χημική σύσταση των κυττάρων και για τα βιολογικά πολυμερή που αποτελούν

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4ο Γενετική

ΚΕΦΑΛΑΙΟ 4ο Γενετική ΚΕΦΑΛΑΙΟ 4ο Γενετική Ενότητα 4.1: Κύκλος ζωής του κυττάρου Ενότητα 4.2: Μοριακή γενετική. (Το κεντρικό δόγμα της βιολογίας - Αντιγραφή - Μεταγραφή - Μετάφραση του DNA - Η χρωματίνη και το χρωμόσωμα) Ενότητα

Διαβάστε περισσότερα

δημιουργία βιομορίων που αποτελούνται από πολυάριθμους δομικούς λίθους. Να απαντήσετε στις ερωτήσεις:

δημιουργία βιομορίων που αποτελούνται από πολυάριθμους δομικούς λίθους. Να απαντήσετε στις ερωτήσεις: 1) Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται η χημική αντίδραση Γ και η χημική

Διαβάστε περισσότερα


ΔΟΜΗ ΚΑΙ ΔΡΑΣΗ ΠΡΩΤΕΙΝΩΝ ΔΟΜΗ ΚΑΙ ΔΡΑΣΗ ΠΡΩΤΕΙΝΩΝ ΠPΩTEINEΣ Οι πρωτεΐνες παίζουν σημαντικό ρόλο σε όλες σχεδόν τις βιολογικές διεργασίες. H σημασία τους φαίνεται στις παρακάτω περιπτώσεις: 1. Κατάλυση (πχ. ένζυμα) 2. Μεταφορά

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved Κεφάλαιο 2 1 Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved ΟΡΓΑΝΙΚΗ ΜΟΡΙΑΚΗ ΔΟΜΗ ΤΩΝ ΖΩΝΤΑΝΩΝ ΟΡΓΑΝΙΣΜΩΝ «Οργανική» ένωση αναφέρεται σε ενώσεις του C Συμμετέχουν

Διαβάστε περισσότερα

ΘΕΜΑ: Ορισµός εξεταζοµένων µαθηµάτων στις κατατακτήριες εξετάσεις 2015-2016

ΘΕΜΑ: Ορισµός εξεταζοµένων µαθηµάτων στις κατατακτήριες εξετάσεις 2015-2016 Ε Λ Λ Η Ν Ι Κ Η ΗΜΟΚΡΑΤΙΑ ΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ Θ Ρ Α Κ Η Σ ΠΑΝΕΠΙΣΤΗΜΙΟΥΠΟΛΗ 6 Ο χλµ AΛΕΞ/ΠΟΛΗΣ-ΜΑΚΡΗΣ 68100 ΑΛΕΞΑΝ ΡΟΥΠΟΛΗ Τ Μ Η ΜΑ Ι Α Τ Ρ Ι Κ Η Σ Γ Ρ Α Μ Μ Α Τ Ε Ι Α H E L L E N I C R E P U B L I

Διαβάστε περισσότερα

BIO111 Μικροβιολογια ιαλεξη 7 Κυτταρικη Ρυθµιση

BIO111 Μικροβιολογια ιαλεξη 7 Κυτταρικη Ρυθµιση BIO111 Μικροβιολογια ιαλεξη 7 Κυτταρικη Ρυθµιση Περιεχοµενα 1. Τι σηµαινει ρυθµιζω για την κυτταρικη µηχανη? 1. Η κυτταρικη ρυθµιση ειναι πολυεπιπεδη 2. Επιπεδο Μεταγραφης-Pύθµιση έκφρασης γονιδίων-tο

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 11. Βιοενεργητική & Μεταβολισµός: Μιτοχόνδρια, Χλωροπλάστες & Υπεροξειδιοσώµατα

ΚΕΦΑΛΑΙΟ 11. Βιοενεργητική & Μεταβολισµός: Μιτοχόνδρια, Χλωροπλάστες & Υπεροξειδιοσώµατα ΚΕΦΑΛΑΙΟ 11 Βιοενεργητική & Μεταβολισµός: Μιτοχόνδρια, Χλωροπλάστες & Υπεροξειδιοσώµατα Τα ΥΠΕΡΟΞΕΙΔΙΟΣΩΜΑΤΑ Μέρος Ε ΤΑ ΒΑΣΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΤΩΝ ΥΠΕΡΟΞΕΙΔΙΟΣΩΜΑΤΩΝ - Περιέχουν ένζυµα για ποικίλες µεταβολικές

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Τράπεζα Θεμάτων. Βιολογίας Β Γενικού Ημερήσιου Λυκείου

Τράπεζα Θεμάτων. Βιολογίας Β Γενικού Ημερήσιου Λυκείου 1 Τράπεζα Θεμάτων Βιολογίας Β Γενικού Ημερήσιου Λυκείου Χανιά 2014-2015 2 ΠΕΡΙΕΧΟΜΕΝΑ Κεφάλαιο 1ο 4-21 σελ. Θέμα Β 22-33 σελ. Θέμα Δ Κεφάλαιο 2ο 35-55 σελ. Θέμα Β 56-72 σελ. Θέμα Δ Κεφάλαιο 3ο 74 76 σελ.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα