1 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες. Τασος Οικονόµου

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "1 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες. Τασος Οικονόµου"

Transcript

1 1 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες Τασος Οικονόµου

2 Τι θα πούµε 1. Βασική πρωτεινική Βιοχηµεία 2. Πρωτεινες στο κυτταρικό περιβάλλον 3. Απο τις µεµονωµένες πρωτείνες στο πρωτεινωµικό διαδίκτυο 4. Πως µελετάµε πρωτεινες? 5. Πως µελετάµε διαπρωτεινικές επαφές?

3 Τι θα πούµε 1. Βασική πρωτεινική Βιοχηµεία 2. Πρωτεινες στο κυτταρικό περιβάλλον 3. Απο τις µεµονωµένες πρωτείνες στο πρωτεινωµικό διαδίκτυο 4. Πως µελετάµε πρωτεινες? 5. Πως µελετάµε διαπρωτεινικές επαφές?

4 H xηµεία της ζωής είναι χηµεία πολυµερών

5 4 γευσεις βιολογικων µακροµοριων ΑΤΑΞΙΑ ΑΤΟΜΑ Ν, Ο, C, S, P, H... (ΜΙΚΡΟ)ΜΟΡΙΑ Σάκχαρα Λιπαρά οξέα Νουκλεοτίδια Αµινοξέα ΜΑΚΡΟΜΟΡΙΑ Πολυσακχαρίτες Λιπίδια DNA, RNA Πρωτεΐνες ΜΑΚΡΟΜΟΡΙΑΚΑ ΣΥΜΠΛΟΚΑ ΤΑΞΗ (οργάνωση δοµών) µη πληροφοριακά πληροφοριακά

6 Τι δουλειές εκτελούν οι ΠPΩTEINEΣ? 1. Kατάλυση κυτταρικής χηµείας 2. Pύθµιση κυτταρικής χηµείας 3. οµικά στοιχεία κύτταρου

7 οµη αµινοξεων

8 οµή αµινοξέων-οι 22 οµαδες R +σεληνοκυστεινη +πυρολυσινη

9 Πεπτιδικος δεσµος

10 οµή πρωτεινών (πρωτοταγης) NH2-Ala-Leu-Arg-Phe-Gly-Asp-Asp- Glu-Arg-Met etc cooh Πεπτιδικος δεσµος

11 οµή πρωτεινών (δευτεροταγης) α-ελικα/α-ελικα

12 οµή πρωτεινών (δευτεροταγης) β-πτυχωτο φυλλο/β-sheet

13 οµή πρωτεινών (τριτοταγης)

14 οµή πρωτεινών (τεταρτοταγης)

15 Τι θα πούµε 1. Βασική πρωτεινική Βιοχηµεία 2. Πρωτεινες στο κυτταρικό περιβάλλον 3. Απο τις µεµονωµένες πρωτείνες στο πρωτεινωµικό διαδίκτυο 4. Πως µελετάµε πρωτεινες? 5. Πως µελετάµε διαπρωτεινικές επαφές?

16 Tι είναι το κύτταρο? Γιαννης Χηµικοπουλος Xµµµµ. ένα σακκουλάκι µε οργανικά χηµικά

17 Tι είναι το κύτταρο? Γιαννης Χηµικοπουλος Xµµµµ. ένα σακκουλάκι µε οργανικά χηµικά Μαρια Εντροπιδου Xµµµµ. µία εντροπική µηχανή ενέργεια ζωή θερµότητα

18 ΚΥΤΤΑΡΟΠΟΥΛΟΣ Xηµεία - H 2 O - 4 πολυµερή Tι είναι το κύτταρο? DNA RNA Πολυπεπτίδια Πολυσακχαρίτες Σύνθετα Λιπίδια Πόσα? (% dry weight) µονοµερή - διάφορα (στοιχεία, προσθετικές οµάδες κλπ) } 4

19 ΚΥΤΤΑΡΟΠΟΥΛΟΣ Tι είναι το κύτταρο? Kαθορ ισµένη χηµ ικά οντότητα µε ποσοτικά ορ ισµένο περ ιεχόµενο

20 ΚΥΤΤΑΡΟΠΟΥΛΟΣ Tι είναι το κύτταρο? Kαθορ ισµένη χηµ ικά οντότητα µε ποσοτικά ορ ισµένο περ ιεχόµενο Mπαµµµ!!!!! H B ιολογ ία µετατρέπετα ι σε πραγµατική σκληρη επιστηµη

21 Πως δουλεύει το κύτταρο? ηµήτρης Γενετικάκης Xµµµµ....είναι γεµάτο γονίδια...τα γονίδια "δίνουν" πρωτείνες

22 Πως δουλεύει το κύτταρο? ηµήτρης Γενετικάκης Xµµµµ....είναι γεµάτο γονίδια Mάκης Bιοχηµικάκης Xµµµµ....είναι γεµάτο πρωτείνες...τα γονίδια "δίνουν" πρωτείνες...οι πρωτείνες καταλύουν χηµικές αντιδράσεις, ρυθµίζουν και δηµιουργούν δοµές

23 Mycoplasma genitalium 482 γονίδια 440 πρωτείνες + 42 δοµικά RNA

24 M. genitalium Γονίδιο 1 mrna 1 Πολυπεπτίδιο 1 Πρωτο+ δευτεροταγής δοµή Τριτοταγής δοµή-aναδίπλωση Τροποποιήσεις Υποκυτταρική στόχευση Tεταρτοταγής δοµή ενέργεια ζωή θερµότητα

25 θερµότητα M. genitalium Γονίδιο 1 mrna 1 Πολυπεπτίδιο 1 Γονίδιο 2 mrna 2 Πολυπεπτίδιο 2 Γονίδιο 3 mrna 3 Πολυπεπτίδιο 3 Πρωτο+ δευτεροταγής δοµή Τριτοταγής δοµή-aναδίπλωση τροποποιήσεις Υποκυτταρική στόχευση Mοριακή Mηχανή ή Πολυµερικό Eνζυµο Tεταρτοταγής δοµή Tεταρτοταγής δοµή ενέργεια ζωή

26 Mycoplasma genitalium 482 γονίδια 440 πρωτείνες + 42 δοµικά RNA <100 µοριακές Mηχανές π.χ. - µαστίγιο ~50 υποµ. - ριβόσωµα ~50 υποµ. - F1ATPase ~8 υποµ. - DNApol ~10 υποµ. - SecTranslocase ~9

27 Τι θα πούµε 1. Βασική πρωτεινική Βιοχηµεία 2. Πρωτεινες στο κυτταρικό περιβάλλον 3. Απο τις µεµονωµένες πρωτείνες στο πρωτεινωµικό διαδίκτυο 4. Πως µελετάµε πρωτεινες? 5. Πως µελετάµε διαπρωτεινικές επαφές?

28 Λίγες πρωτείνες δρουν κατά µόνας π.χ. Υδρολάσες µικρών µορίων

29 Οι περισσότερες πρωτείνες ζούν σε αλληλεπίδραση µε άλλες π.χ. RNA πολυµεράσες, ριβόσωµα, µοριακές µηχανές

30 Tι είναι το κύτταρο? Molecular Crowding mg/ml πολυπεπτιδια

31 Molecular Crowding Tι είναι το κύτταρο? ενα Interactome

32 Η βιολογική πολυπλοκότητα πατά πάνω στην πρωτεινική πολυπλοκότητα

33 - Σε σχεση µε το γονιδιωµα το πρωτεινωµα ειναι πολυ πιο δυναµικο - Πρωτεινικη πολυπλοκοτητα>>γονιδιακη πολυπλοκοτητα

34 Τι ειναι το κύτταρο?..ένα εργοστάσ ιο δυναµ ικών µορ ιακών µηχανών που αλληλεπ ιδρούν Για να το κατανοήσω πρέπει να αποκτήσω πλήρη γνώση: 1. των ξεχωριστών ~100 µοριακών µηχανών (...το µονοπάτι της φώτισης..) 2. των επιδράσεων µεταξύ των µοριακών µηχανών 3. της κινητικής της δράσης των µοριακών µηχανών.

35 Τι θα πούµε 1. Βασική πρωτεινική Βιοχηµεία 2. Πρωτεινες στο κυτταρικό περιβάλλον 3. Απο τις µεµονωµένες πρωτείνες στο πρωτεινωµικό διαδίκτυο 4. Πως µελετάµε πρωτεινες? 5. Πως µελετάµε διαπρωτεινικές επαφές?

36 Τι θέλω να µάθω µελετώντας πρωτείνες κατά µόνας...6 easy pieces...

37 Τι θέλω να µάθω µελετώντας πρωτείνες κατά µόνας...6 easy pieces οµές σε ατοµική λεπτοµέρεια

38 Τι θέλω να µάθω µελετώντας πρωτείνες κατά µόνας...6 easy pieces οµές σε ατοµική λεπτοµέρεια 2. Πρόσδεση υποστρωµάτων+κατάλυση

39 Τι θέλω να µάθω µελετώντας πρωτείνες κατά µόνας...6 easy pieces οµές σε ατοµική λεπτοµέρεια 2. Πρόσδεση υποστρωµάτων+κατάλυση 3. ιαπρωτεινικές επαφές

40 Τι θέλω να µάθω µελετώντας πρωτείνες κατά µόνας...6 easy pieces οµές σε ατοµική λεπτοµέρεια 2. Πρόσδεση υποστρωµάτων+κατάλυση 3. ιαπρωτεινικές επαφές 4. Κρίσιµα αµινοξέα

41 Τι θέλω να µάθω µελετώντας πρωτείνες κατά µόνας...6 easy pieces οµές σε ατοµική λεπτοµέρεια 2. Πρόσδεση υποστρωµάτων+κατάλυση 3. ιαπρωτεινικές επαφές 4. Κρίσιµα αµινοξέα 5. ευτερογενείς µετατροπές

42 Τι θέλω να µάθω µελετώντας πρωτείνες κατά µόνας...6 easy pieces οµές σε ατοµική λεπτοµέρεια 2. Πρόσδεση υποστρωµάτων+κατάλυση 3. ιαπρωτεινικές επαφές 4. Κρίσιµα αµινοξέα 5. ευτερογενείς µετατροπές 6. Στερεοδιατακτική δυναµική

43 Τι θέλω να µάθω µελετώντας πρωτείνες κατά µόνας...6 easy pieces οµές σε ατοµική λεπτοµέρεια 2. Πρόσδεση υποστρωµάτων+κατάλυση 3. ιαπρωτεινικές επαφές 4. Κρίσιµα αµινοξέα 5. ευτερογενείς µετατροπές 6. Στερεοδιατακτική δυναµική ZEN

44 Εργαλειοθήκη Πρωτεινικης Αναλυσης

45 Εργαλειοθήκη Πρωτεινικης Αναλυσης 1. Ενζυµολογια 2. Κρυσταλλογραφια 3. NMR 4. Μοριακη γενετικη 5. Βιοφυσικες/Φυσικοχηµικες µεθοδοι

46 Bιοφυσικές Mέθοδοι Xαρακτηρισµού µακροµορίων

47 Τι θα πούµε 1. Βασική πρωτεινική Βιοχηµεία 2. Πρωτεινες στο κυτταρικό περιβάλλον 3. Απο τις µεµονωµένες πρωτείνες στο πρωτεινωµικό διαδίκτυο 4. Πως µελετάµε πρωτεινες? 5. Πως µελετάµε διαπρωτεινικές επαφές?

48 Τι θέλω να µάθω µελετώντας πρωτείνες οµαδόν...4 easy pieces Ποιος δεσµεύεται µε ποιόν 2. Που δεσµεύεται ο κάθε εταίρος 3. Βιοφυσική της δέσµευσης 4. Λειτουργικές επιπτώσεις ZEN

49 Εργαλειοθήκη ιαπρωτεινικων Επιδρασεων

50 Ποιός δεσµεύεται µε ποιόν 2 εταίροι Γενετική 1. Yeast 2-hybrid 2. Genetics (extragenic suppressors, multi-copy suppresion, synthetic phenotype) 3. Phage display Βιοχηµεία 1. Co-purification/Co-fractionation/Co-sedimentation/Co-purification 2. Far-western 3. Size-exclusion chromatography 4. Native PAGE 5. Rate zonal centrifugation 6. Chemical cross-linking 7. Protease footprinting 8. Peptide scans 9. Enzymatic assays

51 Yeast 2-hybrid

52 Genetic suppression

53 Dominance

54 Phage Display

55 Ποιός δεσµεύεται µε ποιόν 2 εταίροι Βιοχηµεία 1. Co-purification/Co-fractionation/Co-sedimentation/ Co-purification 2. Far-western 3. Size-exclusion chromatography 4. Native PAGE 5. Rate zonal centrifugation 6. Chemical cross-linking 7. Protease footprinting 8. Peptide scans 9. Enzymatic assays

56 Affinity Chromatography

57 Chemical cross-linking

58 Ποιός δεσµεύεται µε ποιόν 2 εταίροι Βιοφυσική 1. Κρυσταλλογραφία 2. NMR 3. Aναλυτική Υπερφυγοκέντριση- Sedimentation Equilibrium 4. Light Scattering 5. Surface Plasmon Resonance and other biosensors 6. Fluorescence (e.g. FRET) 7. Circular dichroism 8. Isothermal Titration Calorimetry 9. Mass spectrometry

59 Isothermal Titration Calorimetry -Affinity -Stoichiometry -Thermodynamics

60 Μελετη του Interactome

61 Ποιός δεσµεύεται µε ποιόν n εταίροι 1. Yeast 2-hybrid 2. Protein microarrays 3. Multidimensional chromatography 4. Protein tagging+ms

62 Πολυπεπτιδικος διαχωρισµος πολλαπλων διαστασεων

63 ισδιαστατη αποµονωση πολυπεπτιδιων

64 Πολύτιµες πληροφορίες από πρωτεινωµατικη αναλυση - Σχετικές συγκεντρώσεις πολυπεπτιδιων στο κύτταρο - Kινητική έκφρασης - ιαπρωτεινικές επαφές (ταυτόχρονες και εν παραλλήλω) - Mετα-µεταφραστικές τροποιήσεις

BIO408/BIO506 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες. Tάσος Οικονόµου

BIO408/BIO506 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες. Tάσος Οικονόµου BIO408/BIO506 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες Tάσος Οικονόµου Τι θα πούµε 1. Βασική πρωτεινική Βιοχηµεία 2. Πρωτεινες στο κυτταρικό περιβάλλον 3. Απο τις µεµονωµένες πρωτείνες στο

Διαβάστε περισσότερα

BIO111 Μικροβιολογια ιαλεξη 3. Κυτταρικη Χηµεια

BIO111 Μικροβιολογια ιαλεξη 3. Κυτταρικη Χηµεια BIO111 Μικροβιολογια ιαλεξη 3 Κυτταρικη Χηµεια Mικροβιολογία = Bιολογία των µονοκύτταρων οργανισµών και των ιών H µεγάλη σας φίλη Το βακτηριο E.coli 1.000.000X C Γλυκόζη trna αντισωµα ριβοσωµα ATP DNA

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών

Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών Βασίλης Προμπονάς, PhD Ερευνητικό Εργαστήριο Βιοπληροφορικής Τμήμα Βιολογικών Επιστημών Νέα Παν/πολη, Γραφείο B161 Πανεπιστήμιο Κύπρου Ταχ.Κιβ. 20537 1678,

Διαβάστε περισσότερα

οµή και λειτουργία των µεγάλων βιολογικών µορίων

οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων κατηγορίες υδατάνθρακες πρωτεΐνες νουκλεϊνικά οξέα λιπίδια Οι πρωτεΐνες, υδατάνθρακες, νουκλεϊνικά οξέα

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 1 Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα

1.1 Η συζυγής βάση του Η 2 SO 4 είναι α. SO 4 2. β. HSO 4. γ. H 2 SO 3. δ. H 2 S. Μονάδες 5

1.1 Η συζυγής βάση του Η 2 SO 4 είναι α. SO 4 2. β. HSO 4. γ. H 2 SO 3. δ. H 2 S. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 7 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 2. Δομή νουκλεϊκών οξέων ΝΟΥΚΛΕΪΚΑ ΟΞΕΑ ΣΥΣΤΑΣΗ ΟΡΓΑΝΙΣΜΩΝ ΣΕ ΟΡΓΑΝΙΚΕΣ ΕΝΩΣΕΙΣ ΜΙΚΡΟΜΟΡΙΑ ΜΑΚΡΟΜΟΡΙΑ 1. Αμινοξέα πρωτεϊνες

Διαβάστε περισσότερα

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ Θέµατα ιάλεξης οµή, αριθµός και διαχωρισµός των αµινοξέων Ένωση αµινοξέων µε τον πεπτιδικό δεσµό

Διαβάστε περισσότερα

Βιοϋλικά. Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά. Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών

Βιοϋλικά. Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά. Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών Βιοϋλικά Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών Περιεχόμενα ενότητας Πρωτεΐνες Δομή και είδη Λειτουργίες πρωτεϊνών

Διαβάστε περισσότερα

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Φραγκίσκος Κολίσης Καθηγητής Βιοτεχνολογίας, Σχολή Χημικών Μηχανικών ΕΜΠ, Διευθυντής Ινστιτούτου Βιολογικών Ερευνών και Βιοτεχνολογίας, EIE

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα

Διαβάστε περισσότερα

β. [Η 3 Ο + ] > 10-7 Μ γ. [ΟΗ _ ] < [Η 3 Ο + ]

β. [Η 3 Ο + ] > 10-7 Μ γ. [ΟΗ _ ] < [Η 3 Ο + ] ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Εξερευνώντας τα Βιομόρια Ένζυμα: Βασικές Αρχές και Κινητική

Εξερευνώντας τα Βιομόρια Ένζυμα: Βασικές Αρχές και Κινητική Εξερευνώντας τα Βιομόρια Ένζυμα: Βασικές Αρχές και Κινητική Βιοχημεία Βιομορίων Αθήνα 2015 Γενικές Ιδιότητες Ένζυμα : Βιολογικοί Καταλύτες Τα ένζυμα είναι πρωτεϊνικά μόρια Μικρή ομάδα καταλυτικών RNA H

Διαβάστε περισσότερα

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες ΕΞΕΤΑΣΤΕΑ ΥΛΗ ΕΝΟΤΗΤΑ 2: Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ, 5 9 (απλή αναφορά) 2.2 ΤΟ ΝΕΡΟ ΚΑΙ Η ΒΙΟΛΟΓΙΚΗ ΤΟΥ ΣΗΜΑΣΙΑ, 9 14 (απλή αναφορά), 2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ, σελ. 20 36 Οργανικές Ουσίες

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα

Βάσεις δομικών δεδομένων βιολογικών μακρομορίων

Βάσεις δομικών δεδομένων βιολογικών μακρομορίων Βάσεις δομικών δεδομένων βιολογικών μακρομορίων Vasilis Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus Εισαγωγή Βασικές αρχές δομής πρωτεϊνών και νουκλεϊκών

Διαβάστε περισσότερα

Ανακτήθηκε από την ΕΚΠΑΙΔΕΥΤΙΚΗ ΚΛΙΜΑΚΑ http://edu.klimaka.gr ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ

Ανακτήθηκε από την ΕΚΠΑΙΔΕΥΤΙΚΗ ΚΛΙΜΑΚΑ http://edu.klimaka.gr ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 10 ΙΟΥΛΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών Διαχείριση ορμονικών μορίων Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών 3 ου Εξαμήνου Δ. Μπουράνης, Σ. Χωριανοπούλου 1 Φυσιολογία Φυτών Διαχείριση ορμονικών

Διαβάστε περισσότερα

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ Ενδεικτική διδακτική προσέγγιση Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ 30 Στο τέλος της διδασκαλίας της ενότητας αυτής ο μαθητής θα πρέπει να έχει: Διαπιστώσει ότι τα χημικά στοιχεία που

Διαβάστε περισσότερα

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή.

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή. 5ο ΓΕΛ ΧΑΛΑΝΔΡΙΟΥ Μ. ΚΡΥΣΤΑΛΛΙΑ 2/4/2014 Β 2 ΚΕΦΑΛΑΙΟ 3 ΒΙΟΛΟΓΙΑΣ 3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ Θέμα: ΜΕΤΟΥΣΙΩΣΗ ΠΡΩΤΕΪΝΩΝ (άσκηση 7 του εργαστηριακού οδηγού) Μέσος χρόνος πειράματος: 45 λεπτά Α. ΑΝΑΛΩΣΙΜΑ Εργαλεία

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

Βιολογία και αρχές Βιοδιάβρωσης Πολυμερές Μονομερές

Βιολογία και αρχές Βιοδιάβρωσης Πολυμερές Μονομερές Βιολογία και αρχές Βιοδιάβρωσης Τα χημικά στοιχεία που συνθέτουν τους οργανισμούς. Στον φλοιό της γης απαντώνται 92 στοιχεία, απαραίτητα για την ζωή είναι τα 27, από τα οποία τα πιο σημαντικά είναι τα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΕ ANIMATIONS ΚΑΙ ΣΧΕΔΙΑΓΡΑΜΜΑΤΑ Παν. Πάλλα - ΕΚΦΕ Ν. ΣΜΥΡΝΗΣ 1 ΜΙΑ ΕΙΚΟΝΑ ΧΙΛΙΕΣ ΛΕΞΕΙΣ Η παρουσίαση ακολουθεί τη σειρά των περιεχομένων του βιβλίου Βιολογίας

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ.

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ. Kυτταρική Bιολογία ΔIAΛEΞΗ 3 (7/3/2012) ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ AΣ ΘYMHΘOYME Στην προηγούμενη διάλεξη μιλήσαμε για τη χημική σύσταση των κυττάρων και για τα βιολογικά πολυμερή που αποτελούν

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved Κεφάλαιο 2 1 Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved ΟΡΓΑΝΙΚΗ ΜΟΡΙΑΚΗ ΔΟΜΗ ΤΩΝ ΖΩΝΤΑΝΩΝ ΟΡΓΑΝΙΣΜΩΝ «Οργανική» ένωση αναφέρεται σε ενώσεις του C Συμμετέχουν

Διαβάστε περισσότερα

ΘΕΜΑ: Ορισµός εξεταζοµένων µαθηµάτων στις κατατακτήριες εξετάσεις 2015-2016

ΘΕΜΑ: Ορισµός εξεταζοµένων µαθηµάτων στις κατατακτήριες εξετάσεις 2015-2016 Ε Λ Λ Η Ν Ι Κ Η ΗΜΟΚΡΑΤΙΑ ΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ Θ Ρ Α Κ Η Σ ΠΑΝΕΠΙΣΤΗΜΙΟΥΠΟΛΗ 6 Ο χλµ AΛΕΞ/ΠΟΛΗΣ-ΜΑΚΡΗΣ 68100 ΑΛΕΞΑΝ ΡΟΥΠΟΛΗ Τ Μ Η ΜΑ Ι Α Τ Ρ Ι Κ Η Σ Γ Ρ Α Μ Μ Α Τ Ε Ι Α H E L L E N I C R E P U B L I

Διαβάστε περισσότερα

Τράπεζα Θεμάτων. Βιολογίας Β Γενικού Ημερήσιου Λυκείου

Τράπεζα Θεμάτων. Βιολογίας Β Γενικού Ημερήσιου Λυκείου 1 Τράπεζα Θεμάτων Βιολογίας Β Γενικού Ημερήσιου Λυκείου Χανιά 2014-2015 2 ΠΕΡΙΕΧΟΜΕΝΑ Κεφάλαιο 1ο 4-21 σελ. Θέμα Β 22-33 σελ. Θέμα Δ Κεφάλαιο 2ο 35-55 σελ. Θέμα Β 56-72 σελ. Θέμα Δ Κεφάλαιο 3ο 74 76 σελ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

BIO111 Μικροβιολογια ιαλεξη 7 Κυτταρικη Ρυθµιση

BIO111 Μικροβιολογια ιαλεξη 7 Κυτταρικη Ρυθµιση BIO111 Μικροβιολογια ιαλεξη 7 Κυτταρικη Ρυθµιση Περιεχοµενα 1. Τι σηµαινει ρυθµιζω για την κυτταρικη µηχανη? 1. Η κυτταρικη ρυθµιση ειναι πολυεπιπεδη 2. Επιπεδο Μεταγραφης-Pύθµιση έκφρασης γονιδίων-tο

Διαβάστε περισσότερα

ΤΟ ΚΥΤΤΑΡΟ ΠΥΡΗΝΑ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ

ΤΟ ΚΥΤΤΑΡΟ ΠΥΡΗΝΑ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ ΤΟ ΚΥΤΤΑΡΟ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΠΥΡΗΝΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΑΝΟΡΓΑΝΕΣ και ΟΡΓΑΝΙΚΕΣ ενώσεις ΑΝΟΡΓΑΝΕΣ C, O, N, H, P, S, Cl,, J, Fe, Cu Άλατα των παραπάνω

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ 2 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1 ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 23 ΜΑΪΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ

Διαβάστε περισσότερα

3 ο Κ Ε Φ Α Λ Α Ι Ο ΠΡΩΤΕΪΝΕΣ Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ

3 ο Κ Ε Φ Α Λ Α Ι Ο ΠΡΩΤΕΪΝΕΣ Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ 3 ο Κ Ε Φ Α Λ Α Ι Ο ΠΡΩΤΕΪΝΕΣ Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ Ερωτήσεις πολλαπλής επιλογής Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15

ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 Θέμα 2ο 2ο ΓΕΛ Χαλανδρίου Βιολογία Β Λυκείου Περιεχόμενα ΘΕΜΑ 14306... 2 ΘΕΜΑ 14351... 2 ΘΕΜΑ 14360... 3 ΘΕΜΑ 14363... 3 ΘΕΜΑ 14364... 4 ΘΕΜΑ 14366... 5 ΘΕΜΑ 14367... 5 ΘΕΜΑ 14369...

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

ΑΝΑΚΟΙΝΩΣΗ. Η κατάταξη γίνεται με εξετάσεις στα παρακάτω μαθήματα: Οι επιτυχόντες κατατάσσονται στα παρακάτω εξάμηνα ανά Κατηγορία πτυχιούχων

ΑΝΑΚΟΙΝΩΣΗ. Η κατάταξη γίνεται με εξετάσεις στα παρακάτω μαθήματα: Οι επιτυχόντες κατατάσσονται στα παρακάτω εξάμηνα ανά Κατηγορία πτυχιούχων ΑΝΑΚΟΙΝΩΣΗ Από το Τμήμα Ιατρικής ανακοινώνεται ότι για το ακαδημαϊκό έτος 2014-2015 στο Τμήμα Ιατρικής κατατάσσονται : Οι πτυχιούχου Πανεπιστημίου, Τ.Ε.Ι. ή ισοτίμων προς αυτά, Α.ΣΠΑΙ.Τ.Ε., της Ελλάδος

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΣΣΑΛΟΝΙΚΗ ΣΧΟΛΙΚΟ ΕΤΟΣ 2012-2013 Σελίδα 2 από 35 Ενότητα πρώτη Η χημεία της ζωής Ενότητα πρώτη Η χημεία της ζωής Α. Σύντομη παρουσίαση της θεωρίας Χαρακτηριστικά

Διαβάστε περισσότερα

Τεχνολογία του ανασυνδυασμένου DNA

Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία του ανασυνδυασμένου DNA Ε Ι Σ Α Γ Ω Γ Η Φώτης Καρβέλης Ιστορική αναδρομή Ανακάλυψη του DNA Μελέτη αντιγραφής Απομόνωση ενζύμων Μελέτη της δράσης τους Αποκάλυψη των περιοριστικών ενδονουκλεασών

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΓΗ_Β_ΒΙΟ_0_14364 Β5 (ΚΕΦ. 2, 4) ΘΕΜΑ Β: ΚΕΦΑΛΑΙΟ 4 ΙΙ. Τα μιτοχόνδρια ανήκουν σε μια ευρύτερη κατηγορία οργανιδίων που μετατρέπουν την ενέργεια που προσλαμβάνουν τα κύτταρα σε αξιοποιήσιμη μορφή. α) Να

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ

ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ-ΒΙΟΛ. ΜΑΚΡΟΜΟΡΙΑ 1 ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ 2010 2 ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ-ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ-ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Βιολογία είναι η επιστήμη

Διαβάστε περισσότερα

οµή και Αναδίπλωση πρωτεϊνών

οµή και Αναδίπλωση πρωτεϊνών οµή και Αναδίπλωση πρωτεϊνών Νηφόρου Κατερίνα Μεταδιδακτορική Ερευνήτρια, Οµάδα Μοριακής Καρκινογένεσης, Εργ/ριο Ιστολογίας-Εµβρυολογίας, Ιατρική Σχολή Αθηνών Σηµασία των πρωτεϊνών Ενζυµική κατάλυση Μεταφορά

Διαβάστε περισσότερα

Μονάδες 6 ΘΕΜΑ Β. ιαθέτουμε υδατικό διάλυμα CH 3 COONa συγκέντρωσης 0,1 Μ ( ιάλυμα 1 ). Β1. Να υπολογίσετε το ph του διαλύματος 1.

Μονάδες 6 ΘΕΜΑ Β. ιαθέτουμε υδατικό διάλυμα CH 3 COONa συγκέντρωσης 0,1 Μ ( ιάλυμα 1 ). Β1. Να υπολογίσετε το ph του διαλύματος 1. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 21 ΜΑΪΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΟΛΟ

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών Χηµική Μεταβίβαση Σήµατος Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών 1 Η Επικοινωνία στα Ζωϊκά Κύτταρα 1. Δίκτυα εξωκυτταρικών και ενδοκυτταρικών

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ Η τροφή αποτελείται και από ουσίες μεγάλου μοριακού βάρους (πρωτεΐνες, υδατάνθρακες, λιπίδια, νουκλεϊνικά οξέα). Οι ουσίες αυτές διασπώνται (πέψη) σε απλούστερες (αμινοξέα, απλά σάκχαρα,

Διαβάστε περισσότερα

2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. Οι οργανικές ουσίες είναι εξαιρετικά χρήσιμες για όλους τους ζωντανούς οργανισμούς για τρεις κύριους λόγους:

2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. Οι οργανικές ουσίες είναι εξαιρετικά χρήσιμες για όλους τους ζωντανούς οργανισμούς για τρεις κύριους λόγους: 2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ Οι οργανικές ουσίες είναι εξαιρετικά χρήσιμες για όλους τους ζωντανούς οργανισμούς για τρεις κύριους λόγους: (α) Αποτελούν βασικά δομικά συστατικά του σώματος (β) Εξυπηρετούν ενεργειακές

Διαβάστε περισσότερα

Τ.Ε.Ι. ΚΑΒΑΛΑΣ ΣΧΟΛΗ ΣΔΟ ΤΜΗΜΑ ΔΙΑΧΕΙΡΙΣΗ ΠΛΗΡΟΦΟΡΙΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΘΕΜΑ: «ΠΡΟΣΟΜΟΙΩΣΗ ΓΕΝΕΤΙΚΩΝ ΔΙΚΤΥΩΝ ΜΕ ΤΗ ΧΡΗΣΗ ΕΞΕΛΙΚΤΙΚΩΝ ΜΗΧΑΝΩΝ»

Τ.Ε.Ι. ΚΑΒΑΛΑΣ ΣΧΟΛΗ ΣΔΟ ΤΜΗΜΑ ΔΙΑΧΕΙΡΙΣΗ ΠΛΗΡΟΦΟΡΙΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΘΕΜΑ: «ΠΡΟΣΟΜΟΙΩΣΗ ΓΕΝΕΤΙΚΩΝ ΔΙΚΤΥΩΝ ΜΕ ΤΗ ΧΡΗΣΗ ΕΞΕΛΙΚΤΙΚΩΝ ΜΗΧΑΝΩΝ» Τ.Ε.Ι. ΚΑΒΑΛΑΣ ΣΧΟΛΗ ΣΔΟ ΤΜΗΜΑ ΔΙΑΧΕΙΡΙΣΗ ΠΛΗΡΟΦΟΡΙΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΘΕΜΑ: «ΠΡΟΣΟΜΟΙΩΣΗ ΓΕΝΕΤΙΚΩΝ ΔΙΚΤΥΩΝ ΜΕ ΤΗ ΧΡΗΣΗ ΕΞΕΛΙΚΤΙΚΩΝ ΜΗΧΑΝΩΝ» ΣΥΝΤΑΚΤΡΙΑ/ΕΚΦΩΝΗΤΡΙΑ ΟΙΚΟΝΟΜΙΔΟΥ ΕΥΓΕΝΙΑ ΥΠΕΥΘΥΝΟΣ ΚΑΘΗΓΗΤΗΣ

Διαβάστε περισσότερα

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Απαντήσεις στις ερωτήσεις: Πρόλογος Το βιβλίο αυτό γράφτηκε για να βοηθήσει το μαθητή της Γ Γυμνασίου στην κατανόηση των θεμελιωδών γνώσεων της Βιολογίας

Διαβάστε περισσότερα

ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ. ΘΕΜΑ : «Μελέτη της υπολογιστικής πολυπλοκότητας μοντελοποίησης των Γενετικών Δικτύων με τη χρήση Κυψελιδωτών Αυτομάτων»

ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ. ΘΕΜΑ : «Μελέτη της υπολογιστικής πολυπλοκότητας μοντελοποίησης των Γενετικών Δικτύων με τη χρήση Κυψελιδωτών Αυτομάτων» ΤΕΙ ΚΑΒΑΛΑΣ ΣΧΟΛΗ ΣΔΟ ΤΜΗΜΑ ΔΙΑΧΕΙΡΙΣΗΣ ΠΛΗΡΟΦΟΡΙΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΘΕΜΑ : «Μελέτη της υπολογιστικής πολυπλοκότητας μοντελοποίησης των Γενετικών Δικτύων με τη χρήση Κυψελιδωτών Αυτομάτων» ΥΠΕΥΘΥΝΟΣ ΚΑΘΗΓΗΤΗΣ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr Παρουσιάσεις μαθήματος http://users.auth.gr/~palexios/

Διαβάστε περισσότερα

regulatory mechanisms). stringency).

regulatory mechanisms). stringency). ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ Αποτελεί µια άλλη περίπτωση ρύθµισης των γονιδίωνκαιδιακρίνεται: 1) Στην αυτόνοµη καταστολή και 2) Στηναυτόνοµηεπαγωγή. ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ 1) Αυτόνοµη καταστολή: Η µεταβολική πορεία καταλήγει

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

Πανεπιστημιο Κυπρου. Τμημα Βιολογικων Επιστημων

Πανεπιστημιο Κυπρου. Τμημα Βιολογικων Επιστημων Πανεπιστημιο Κυπρου Τμημα Βιολογικων Επιστημων Σημειωσεις μαθηματος ΒΙΟ101 Ιωάννης Κυρμιτζόγλου Αν. Καθ. Λεόντιος Κωστρίκης Λευκωσια, 2007-2008 Ε Ι Σ Α Γ Ω Γ Η Σ Τ Ι Σ Σ Υ Γ Χ Ρ Ο Ν Ε Σ Β Ι Ο Λ Ο Γ Ι Κ

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Θέματα 1. Ποια είναι η δομή και τα βασικά χαρακτηριστικά των λιπαρών οξέων 2. Πώς απομακρύνονται

Διαβάστε περισσότερα

Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις:

Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: ΘΕΜΑ Β: Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται η χημική αντίδραση Γ και

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΜΕΡΟΣ Α' ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΕΞΕΤΑΣΕΙΣ ΓΙΑ ΤΑ ΑΝΩΤΕΡΑ ΚΑΙ ΑΝΩΤΑΤΑ ΕΚΠΑΙΔΕΥΤΙΚΑ ΙΔΡΥΜΑΤΑ Μάθημα: ΒΙΟΛΟΓΙΑ Ημερομηνία και ώρα

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β Γενικού. Ημερήσιου Λυκείου. Ομαδοποιημένα ανά κεφάλαιο. (σχολικό έτος 2014-2015)

Τράπεζα Θεμάτων Βιολογίας Β Γενικού. Ημερήσιου Λυκείου. Ομαδοποιημένα ανά κεφάλαιο. (σχολικό έτος 2014-2015) Τράπεζα Θεμάτων Βιολογίας Β Γενικού Ημερήσιου Λυκείου Ομαδοποιημένα ανά κεφάλαιο (σχολικό έτος 2014-2015) Ιωαννίδης Θωμάς Βιολόγος 11 ου ΓΕΛ Ηρακλείου 1 ΠΕΡΙΕΧΟΜΕΝΑ Εξεταστέα Ύλη 2014-15.. σελ.3 1 ο Κεφάλαιο..σελ.

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α A1. α Α2. γ Α3. α Α4. α Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Τα πολυπεπτίδια

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Επειδή στο σχολικό βιβλίο Βιολογία Β Γενικού Λυκείου Γενικής παιδείας πρόσφατα προστέθηκαν ερωτήσεις και άλλαξε η αρίθμηση των προϋπαρχουσών ασκήσεων,

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση:

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΧΡΙΣΤΙΝΑ ΠΕΡΔΙΟΥ ΒΙΟΛΟΓΟΣ (MSc) 1 ΠΕΡΙΕΧΟΜΕΝΑ ΕΝΟΤΗΤΑ ΣΕΛΙΔΑ Ενότητα 2 : Χημεία της ζωής 4 Ενότητα 3: Ενέργεια και οργανισμοί 13 Ενότητα 4: κυτταρική

Διαβάστε περισσότερα

Η κυτταρική µετατόπιση των πρωτεϊνών

Η κυτταρική µετατόπιση των πρωτεϊνών 9-1 Κεφάλαιο 9 Η κυτταρική µετατόπιση των πρωτεϊνών Εισαγωγή Στο κύτταρο η έκφραση των πρωτεϊνών γίνεται από µόνο ένα τύπο ριβοσώµατος (εκτός των µιτοχονδριακών και των χλωροπλαστικών που µοιάζουν µε αυτά

Διαβάστε περισσότερα

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ φ φ Ccarbonyl n Ccarbonyl n N Cα n Ccarbonyl n-1 Cα n N φ Ccarbonyl n-1 ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ ψ φ ψ Ccarbonyl n N (Ca

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

Για εισαγωγή στο Τμήμα Ιατρικής

Για εισαγωγή στο Τμήμα Ιατρικής Τμήμα Ιατρικής Της Σχολής Επιστημών Υγείας Του Α.Π.Θ. Οδηγός Κατατακτηρίων Εξετάσεων Για εισαγωγή στο Τμήμα Ιατρικής Ακαδημαϊκού έτους 2015-2016 1 Γενικές Οδηγίες Σύμφωνα με το Νόμο 4218/2013 και την Υπουργική

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

Αρχές Βιοτεχνολογίας Τροφίμων

Αρχές Βιοτεχνολογίας Τροφίμων Αρχές Βιοτεχνολογίας Τροφίμων Ενότητα 3: Εφαρμογές Βιομηχανικής Βιοτεχνολογίας(1/3), 2ΔΩ Τμήμα: Επιστήμης και Τεχνολογίας Τροφίμων Διδάσκων: Δρ. Σεραφείμ Παπανικολαου Μαθησιακοί Στόχοι Βιοτεχνολογικά Προϊόντα

Διαβάστε περισσότερα

Μοριακή Αναγνώριση. 5.1. Εισαγωγή. 5.2. Σταθερές σύνδεσης και αποχωρισµού. [A][B] k d = ----------- [AB] [ΑΒ] k i = ---------- [Α][Β] Κεφάλαιο

Μοριακή Αναγνώριση. 5.1. Εισαγωγή. 5.2. Σταθερές σύνδεσης και αποχωρισµού. [A][B] k d = ----------- [AB] [ΑΒ] k i = ---------- [Α][Β] Κεφάλαιο Κεφάλαιο 5-1 5 Μοριακή Αναγνώριση 5.1. Εισαγωγή Ένα από τα σηµαντικότερα χαρακτηριστικά των ζωντανών οργανισµών είναι ότι τα µακροµόρια που περιέχουν κάνουν πολύ εξειδικευµένες αλληλεπιδράσεις µε άλλα

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: ΘΕΜΑ 1o 1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α. µόνο στο καθαρό νερό β. σε οποιοδήποτε υδατικό διάλυµα γ. µόνο σε

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ο µέγιστος αριθµός διαφορετικών

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

1.2. Να γράψετε στο τετράδιό σας την παρακάτω πρόταση. Από τα παρακάτω ζεύγη ουσιών ρυθµιστικό διάλυµα είναι το α. HF / NaF.

1.2. Να γράψετε στο τετράδιό σας την παρακάτω πρόταση. Από τα παρακάτω ζεύγη ουσιών ρυθµιστικό διάλυµα είναι το α. HF / NaF. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 10 ΙΟΥΝΙΟΥ 2002 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ

Διαβάστε περισσότερα

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο 1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α.

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ÊÏÑÕÖÇ ΕΚΦΩΝΗΣΕΙΣ

Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ÊÏÑÕÖÇ ΕΚΦΩΝΗΣΕΙΣ 1 Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΘΕΜΑ 1 ο ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΕΚΦΩΝΗΣΕΙΣ Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα