Αρχές PCR και υβριδισμού. Ιωσήφ Παπαπαρασκευάς Βιοπαθολόγος, Λέκτορας ΕΚΠΑ Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Αθηνών

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Αρχές PCR και υβριδισμού. Ιωσήφ Παπαπαρασκευάς Βιοπαθολόγος, Λέκτορας ΕΚΠΑ Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Αθηνών ipapapar@med.uoa."

Transcript

1 Αρχές PCR και υβριδισμού Ιωσήφ Παπαπαρασκευάς Βιοπαθολόγος, Λέκτορας ΕΚΠΑ Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Αθηνών

2 Ιστορικά στοιχεία Πρώτη αναφορά in vitro ενζυματικής αντίδρασης για την κατασκευή νουκλεοτιδικής αλληλουχίας Kleppe et al, J Mol Biol, 1971 Πρώτη αναλυτική παρουσίαση της τεχνικής της PCR Saiki and Mullis, Science, 1985 Πρώτες άμεσες εφαρμογές της τεχνικής Saiki and Mullis, Science, 1987 Mullis and Faloona, Methods Enzymol, 1987 Mullis, Sci Amer, 1990 Σήμερα η PCR πλέον έχει αυτοματοποιηθεί και εισαχθεί στην καθημερινή ιατρική διαγνωστική πρακτική

3 ομή της παρουσίασης Περιγραφή της τεχνικής της PCR Περιγραφή της ηλεκτροφόρησης του DNA Συζήτηση ορισμένων βασικών παραμέτρων που επηρεάζουν το αποτέλεσμα της αντίδρασης Η επιλογή του DNA στόχου (αναλυτική ευαισθησία) Η επιλογή και επεξεργασία του κλινικού δείγματος (διαγνωστική ευαισθησία) Η αξία του θετικού ή αρνητικού αποτελέσματος (θετική - αρνητική προγνωστική αξία) Η οπτικοποίηση του αποτελέσματος (αναλυτική ευαισθησία) Τα ψευδώς θετικά αποτελέσματα (επιμόλυνση) Τα ψευδώς αρνητικά αποτελέσματα (αναστολή)

4 ιαδικασία της PCR Περιγραφή της τεχνικής της PCR Περιγραφή της ηλεκτροφόρησης των προϊόντων

5 Αναλυτική ευαισθησία της μεθόδου Η αναλυτική ευαισθησία της μεθόδου, δηλ. το όριο της ποσότητας του DNA (ή της ποσότητας των βακτηριακών κυττάρων) που απαιτείται για να είναι θετική η αντίδραση, εξαρτάται από: Αριθμός των σταδίων (ενός σταδίου ή εμφωλεάζουσα) Ύπαρξη και ποσότητα του DNA στόχου στα στελέχη Οπτικοποίηση αποτελέσματος (αγαρόζη, ιχνηθέτης, Real Time)

6 ιάγνωση της φυματίωσης Αναλυτική ευαισθησία μεθόδων Ευαισθησία οξεάντοχης χρώσης: ~ βακτήρια/ml Ευαισθησία καλλιέργειας: βακτήρια/ml Ευαισθησία PCR ποικίλει

7 Αναλυτική ευαισθησία μεθόδου Η επιλογή στόχου με πολλαπλά αντίγραφα M. tuberculosis complex: ~ 5-20 αντίγραφα IS6110 Όμως έως 5% στελεχών M. tuberculosis :0-4αντίγραφα Έως 5% ασθενών με φυματίωση κ/α (+) και PCR (-) Αλλά και στους λοιπούς 95% η αναλυτική ευαισθησία ποικίλει σε μεγάλο βαθμό, ανάλογα με τον αριθμό των αντιγράφων του DNA στόχου στο στέλεχος

8 Αναλυτική ευαισθησία μεθόδου Η μέθοδος ανίχνευσης του αποτελέσματος Συμβατική PCR ενός σταδίου με ανίχνευση των προϊόντων: Οπτικά σε gel αγαρόζης Αύξηση της αναλυτικής ευαισθησίας Οπτικά με υβριδισμό και σημασμένο ιχνηθέτη Φωτομετρικά με ELISA Ραδιομετρικά Συμβατική PCR δύο σταδίων (nested) με ανίχνευση των προϊόντων: Οπτικά σε gel αγαρόζης Οπτικά με υβριδισμό και σημασμένο ιχνηθέτη Φωτομετρικά με ELISA Ραδιομετρικά Real-Time PCR με ανίχνευση των προϊόντων φωτομετρικά (CCD camera) με σημασμένο ιχνηθέτη (TaqMan probe ή molecular beacon)

9 Συμβατική PCR με οπτικοποίηση σε gel αγαρόζης Πρωτόκολλο ενός σταδίου Εκκινητές για το IS6110 Aναλυτική ευαισθησία 180 fg DNA ~ 40 βακτηριακά κύτταρα Ποσοτική Real-Time PCR Πρωτόκολλο ενός σταδίου Εκκινητές και molecular beacon για το IS6110 Aναλυτική ευαισθησία 45 fg DNA ~ 10 βακτηριακά κύτταρα Papaparaskevas et al, J Clin Microbiol, 2008

10 ιάγνωση φυματίωσης Συμβατική μικροβιολογία Οξεάντοχη χρώση Ziehl-Neelsen Χρώση Ροδαμίνης Αουραμίνης Mycobacterium tuberculosis Καλλιέργεια σε Lowenstein-Jensen 24 ημέρες, 36 ο C, 5% CO 2 Αρχείο Εργαστηρίου Μικροβιολογίας ΓΝΑ Λαϊκό

11 Η επιλογή του κλινικού δείγματος Η συσχέτιση μεταξύ της αναλυτικής ευαισθησίας και της διαγνωστικής ευαισθησίας (ικανότητας της αντίδρασης να δίνει θετικό αποτέλεσμα στα θετικά δείγματα) Η κλινική σημαντικότητα του θετικού αποτελέσματος

12 Η πιθανότητα του αρνητικού αποτελέσματος σε δείγματα με χαμηλή συγκέντρωση στόχου Κανόνας του Poison για την ομοιογενή κατανομή του στόχου στο διάλυμα του κλινικού δείγματος P N =C N /Nxe c Σε ένα διάλυμα δείγματος 1 ml (1.000 μl) με χαμηλό αριθμό βακτηριακού φορτίου, η πιθανότητα 100 τυχαία μl του δείγματος να έχουν την ίδια ακριβώς συγκέντρωση στόχου με 100 άλλα τυχαία μl είναι εξαιρετικά μικρή Χαμηλή ευαισθησία και επαναληψιμότητα Greenfield and White, Mayo Foundation, 1993

13 Η πιθανότητα του αρνητικού αποτελέσματος σε δείγματα με χαμηλή συγκέντρωση στόχου Greenfield and White, Mayo Foundation, 1993

14 Βελτιστοποίηση της τεχνικής σε δείγματα με χαμηλή συγκέντρωση στόχου Εμπλουτισμός του δείγματος κατά την διάρκεια της κατεργασίας Φυγοκέντρηση Απομάκρυνση περιττών στοιχείων Κατεργασία μεγαλύτερης ποσότητας δείγματος Λήψη πολλαπλών δειγμάτων

15 Βελτιστοποίηση της τεχνικής σε δείγματα με χαμηλή συγκέντρωση στόχου Αύξηση της ποσότητας του δείγματος για κατεργασία αύξηση της τελικής συγκέντρωσης του ευκαρυωτικού DNA (Αιματηρά πτύελα: 14 μg ευκαρυωτικό DNA/ml πτυέλων) Χρυσή τομή μεταξύ αύξησης της ποσότητας του δείγματος και εξαφάνισης του DNA στόχου μέσα σε τεράστιες ποσότητες ευκαρυωτικού DNA (Αύξηση της πιθανότητας μη ειδικών υβριδισμών απώλεια ευαισθησίας) Greenfield and White, Mayo Foundation, 1993

16 Η επιλογή του κλινικού δείγματος ιάγνωση C. pneumoniae Το κλινικό δείγμα μπορεί να είναι πτύελα, BAL,φαρυγγικό έκπλυμα, κλπ. Το κλινικό δείγμα (ανάλογα με τον τρόπο λήψης) μπορεί να έχει ποικίλου βαθμού φυσιολογική χλωρίδα Ποια είναι η κλινική σημαντικότητα του θετικού αποτελέσματος; Το θετικό αποτέλεσμα της μεθόδου σημαίνει ότι ανευρέθηκε το αίτιο της λοίμωξης;

17 Η επιλογή του κλινικού δείγματος ιάγνωση C. pneumoniae Ποιο είναι το βέλτιστο κλινικό δείγμα? Κατάλληλα κατά Bartlet πτύελα ή βρογχοκυψελιδικό έκπλυμα Συνηθέστερα χρησιμοποιούμενο δείγμα Πτωχό σε ευκαρυωτικά κύτταρα χαμηλότερη ευαισθησία Εξασφαλίζει κλινική σημαντικότητα υψηλότερη ειδικότητα και προγνωστική αξία Φαρυγγικό επίχρισμα ή φαρυγγικό έκπλυμα Σπανιότερα χρησιμοποιούμενο δείγμα Πλούσιο σε ευκαρυωτικά κύτταρα υψηλότερη ευαισθησία εν εξασφαλίζει κλινική σημαντικότητα χαμηλότερη ειδικότητα και προγνωστική αξία

18 Η επιλογή του κλινικού δείγματος ιάγνωση C. pneumoniae Το θετικό δείγμα εξασφαλίζει την διάγνωση? Σε δείγματα κατώτερου αναπνευστικού συνήθως ναι Σε δείγματα ανώτερου αναπνευστικού??? Έως 10% αποικισμός στοματοφάρυγγα από C. pneumoniae, ιδίως σε ΧΑΠ (persistent carriers, chronic infections) SF Dowell et al, Clin Infect Dis, 2001

19 Η επιλογή του κλινικού δείγματος Η PCR διαχωρίζει δυσκολότερα, σε σχέση με την καλλιέργεια, το πραγματικό παθογόνο από την χλωρίδα ή την επιμόλυνση. SF Dowell et al, Clin Infect Dis, 2001

20 Κλινικά δείγματα για PCR Ολικό αίμα ή λευκοκύτταρα (προτιμότερο EDTA από ηπαρίνη) Όταν ο μικροοργανισμός είναι ενδοκυττάριος Ορός ή πλάσμα Όταν ο μικροοργανισμός είναι εξωκυττάριος Πτύελα, ούρα, ΕΝΥ, βιολογικά υγρά Κόπρανα (τα πλέον δύσκολα δείγματα)

21 Μέθοδοι λήψης του DNA Αδρές μέθοδοι καταστροφής του κυττάρου Βρασμός Γυάλινα σφαιρίδια Μέθοδοι διαχωρισμού και εκχύλισης DNA Φαινόλη-Χλωροφόρμιο Χαοτροπικές ενώσεις (γουανιδίνη Μέθοδος Boom) Μαγνητικά σφαιρίδια Στήλες με ηθμό Αυτοματοποίηση

22 Μέθοδοι λήψης του DNA Αδρές μέθοδοι καταστροφής του κυττάρου ιάλυμα από συγκρίματα κυτταροπλάσματος και κυτταρικού τοιχώματος, DNA (διπλόκλωνο, μονόκλωνο και θραύσματα), πρωτεΐνες κλπ. Αδρή, φθηνή μέθοδος, με χαμηλό ποιοτικά αποτέλεσμα Μέθοδοι διαχωρισμού και εκχύλισης DNA Καθαρό DNA που μπορεί να φυλαχθεί για μεγάλο χρονικό διάστημα Πιο ακριβή μέθοδος, με υψηλής ποιότητας παραγόμενο DNA

23 Το ψευδώς θετικό αποτέλεσμα Μη ειδικός υβριδισμός Μη προτυποποιημένο πρωτόκολλο Μέθοδος λήψης του DNA Μεγάλη συγκέντρωση ευκαρυωτικού DNA Θετικό - αμφιλεγόμενο Μη ειδικό Επιμόλυνση με προϊόντα πολλαπλασιασμού Κακή εργαστηριακή πρακτική. Τελικά προϊόντα που βρίσκονται σε μεγάλη συγκέντρωση στο περιβάλλον του εργαστηρίου επιμολύνουν τα αρχικά στάδια εκχύλισης DNA και προετοιμασίας του χημικού μίγματος Ψευδώς θετικό δυνατό σήμα

24 Το ψευδώς θετικό αποτέλεσμα Η εργαστηριακή πρακτική Εξαιρετικά μεγάλη σημασία η σωστή εργονομία και η αυστηρή αλληλουχία των βημάτων της πρακτικής Προετοιμασία του χημικού μίγματος (καθαρό δωμάτιο) Προσθήκη DNA (δωμάτιο προσθήκης DNA) Αντίδραση PCR (δωμάτιο PCR) Ηλεκτροφόρηση προϊόντος PCR (δωμάτιο PCR) Η εκχύλιση του DNA ιδανικά θα πρέπει να γίνεται σε τέταρτο χώρο Η αλληλουχία των βημάτων αυστηρά προς μια κατεύθυνση Συχνή χρήση UV ακτινοβολίας και διαλύματος χλωρίου

25 Η απενεργοποίηση του προϊόντος πολ/σμού Χρήση UNG+dUTP αφορά τη συγκεκριμένη αντίδραση κάθε φορά UV ακτινοβολία ή/και διάλυμα χλωρίου αφορά το περιβάλλον Persing and Chimino, Mayo Foundation, 1993

26 Η απενεργοποίηση του προϊόντος πολ/σμού Χρήση UNG και dutp Αρχή της μεθόδου: χρήση του ενζύμου UNG (uracil-nglycosilase) ένζυμο επισκευής του DNA που υδρολύει τον δεσμό του dutp και αντικαθιστά την ουρακίλη που σποραδικά μπορεί in vivo να ενσωματώνεται στο διπλόκλωνο DNA. Ta νουκλεοτίδια: datp, dctp, dgtp, dttp (A-T, C-G) Συνεχής χρήση dutp αντί για dttp Τα προϊόντα πολ/σμού έχουν νουκλεοτιδική αλληλουχία με dutp Στην αντίδραση της PCR προσθήκη UNG υδρόλυση τμημάτων DNA με dutp (επιμολύνοντα amplicons), αλλά όχι τμημάτων DNA με dttp (DNA στόχος) Μειονέκτημα: Ελάττωση της ευαισθησίας της αντίδρασης Greenfield and White, Mayo Foundation, 1993

27 Το ψευδώς αρνητικό αποτέλεσμα Μικρή συγκέντρωση στόχου, κάτωαπότοόριοτηςαναλυτικής ευαισθησίας Αναστολή της ενζυματικής αντίδρασης

28 Το ψευδώς αρνητικό αποτέλεσμα Αναστολή της αντίδρασης Φυσικές ουσίες Αιμίνη Πολυσακχαρίτες Χημικά αντιδραστήρια Ηπαρίνη, EDTA, SDS Χαοτροπικά μόρια (guanidinium HCl)

29 Το ψευδώς αρνητικό αποτέλεσμα Αναστολή της αντίδρασης Κλινικά δείγματα που πιθανά περιέχουν αναστολείς Αίμα και αιματηρά βιολογικά υγρά Ούρα Πτύελα

30 Το ψευδώς αρνητικό αποτέλεσμα Αναστολή της αντίδρασης Έλεγχος αναστολής Επανάληψη της αντίδρασης του συγκεκριμένου δείγματος μετά από προσθήκη μικρής ποσότητας DNA απότοθετικόcontrol Εάν το αποτέλεσμα εξακολουθεί να είναι αρνητικό, τότε ισχυρή πιθανότητα αναστολής Βασική παράμετρος για την αναστολή η μέθοδος εκχύλισης DNA Στις μεθόδους εκχύλισης του DNA με στήλες με ηθμό ή με μαγνητικά σφαιρίδια, μικρότερη η πιθανότητα. Οι αναστολείς κατακρατούνται από τον ηθμό.

31 Αντί συμπερασμάτων Η PCR και οι άλλες τεχνικές της μοριακής μικροβιολογίας έχουν πλέον καθιερωθεί στο κλινικό εργαστήριο Όμως υπάρχουν όρια στην εφαρμογή τους και κανόνες που πρέπει να γίνονται σεβαστοί εν φαίνεται στο άμεσο μέλλον συμβατικές τεχνικές, όπως η καλλιέργεια και η δοκιμασία ευαισθησίας, να μπορέσουν να αντικατασταθούν πλήρως από μοριακές τεχνικές Το πιθανότερο είναι ότι η συμβατική και η μοριακή μικροβιολογία θα δρουν συμπληρωματικά η μια της άλλης για μεγάλο χρονικό διάστημα ακόμη

32 Ευχαριστώ για την προσοχή σας

ΕΡΜΗΝΕΙΑ ΙΟΛΟΓΙΚΩΝ ΙΑΓΝΩΣΤΙΚΩΝ ΕΞΕΤΑΣΕΩΝ

ΕΡΜΗΝΕΙΑ ΙΟΛΟΓΙΚΩΝ ΙΑΓΝΩΣΤΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΡΜΗΝΕΙΑ ΙΟΛΟΓΙΚΩΝ ΙΑΓΝΩΣΤΙΚΩΝ ΕΞΕΤΑΣΕΩΝ Dr Α. Μεντής, Ιατρός Βιοπαθολόγος, Κλινικός Μικροβιολόγος ιευθυντής ιαγνωστικού Τμήματος ιευθυντής Εργαστηρίου Ιατρικής Μικροβιολογίας ιευθυντής Εθνικού Εργαστηρίου

Διαβάστε περισσότερα

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία της Δημόσιας Υγείας Α. Βανταράκης Εργαστήριο Υγιεινής, Ιατρική Σχολή,

Διαβάστε περισσότερα

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Chain Reaction (pcr)- Αλυσιδωτή αντίδραση πολυμεράσης.η

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

ΤΟ ΕΡΓΑΣΤΗΡΙΟ ΚΛΙΝΙΚΗΣ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ ΣΤΟΝ ΕΛΕΓΧΟ ΤΩΝ ΝΟΣΟΚΟΜΕΙΑΚΩΝ ΛΟΙΜΩΞΕΩΝ

ΤΟ ΕΡΓΑΣΤΗΡΙΟ ΚΛΙΝΙΚΗΣ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ ΣΤΟΝ ΕΛΕΓΧΟ ΤΩΝ ΝΟΣΟΚΟΜΕΙΑΚΩΝ ΛΟΙΜΩΞΕΩΝ 1η ΕΠΙΣΤΗΜΟΝΙΚΗ ΔΙΗΜΕΡΙΔΑ «ΕΛΕΓΧΟΣ ΤΩΝ ΝΟΣΟΚΟΜΕΙΑΚΩΝ ΛΟΙΜΩΞΕΩΝ ΕΦΑΡΜΟΓΕΣ ΣΤΗ ΚΑΘΗΜΕΡΙΝΗ ΠΡΑΞΗ ΔΥΝΑΤΟΤΗΤΕΣ ΠΡΟΟΠΤΙΚΕΣ» ΛΑΜΙΑ 21 22 22 ΟΚΤΩΒΡΙΟΥ 2005 ΤΟ ΕΡΓΑΣΤΗΡΙΟ ΚΛΙΝΙΚΗΣ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ ΣΤΟΝ ΕΛΕΓΧΟ ΤΩΝ

Διαβάστε περισσότερα

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης ΕΙΣΑΓΩΓΗ Σύμφωνα με την ΠΟΥ το 1/3 περίπου του παγκόσμιου πληθυσμού είναι μολυσμένο

Διαβάστε περισσότερα

ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR)

ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR) ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR) Α. ΘΕΩΡΗΤΙΚΟ ΜΕΡΟΣ Σταμάτης Κουσίσης, Δημοσθένης Κίζης, Δήμητρα Χούχουλα Βασική αρχή της Αλυσιδωτής Αντίδρασης της Πολυμεράσης

Διαβάστε περισσότερα

Δ. Ιακωβίδης. Πνευμονολόγος Aν. Διευθυντής Μονάδα επεμβατικής Πνευμονολογίας Γ.Π.Ν. «Γ. Παπανικολάου

Δ. Ιακωβίδης. Πνευμονολόγος Aν. Διευθυντής Μονάδα επεμβατικής Πνευμονολογίας Γ.Π.Ν. «Γ. Παπανικολάου Δ. Ιακωβίδης Πνευμονολόγος Aν. Διευθυντής Μονάδα επεμβατικής Πνευμονολογίας Γ.Π.Ν. «Γ. Παπανικολάου Νέα διαγνωστικά μέσα για τη λανθάνουσα φυματίωση Η στοχευμένη δοκιμασία δερματικής φυματινοαντίδρασης

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

Εργαστηριακή Διάγνωση της HIV λοίμωξης. Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ

Εργαστηριακή Διάγνωση της HIV λοίμωξης. Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ Εργαστηριακή Διάγνωση της HIV λοίμωξης Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ Διάγνωση της HIV λοίμωξης Από το 1985 και μέχρι σήμερα η διαγνωστική διαδικασία

Διαβάστε περισσότερα

4 ο Πανελλήνιο Συμπόσιο Φυματίωσης Εταιρεία Μελέτης Πνευμονοπαθειών και Επαγγελματικών Παθήσεων Θώρακος Σάββατο 19 Μαρτίου 2011

4 ο Πανελλήνιο Συμπόσιο Φυματίωσης Εταιρεία Μελέτης Πνευμονοπαθειών και Επαγγελματικών Παθήσεων Θώρακος Σάββατο 19 Μαρτίου 2011 4 ο Πανελλήνιο Συμπόσιο Φυματίωσης Εταιρεία Μελέτης Πνευμονοπαθειών και Επαγγελματικών Παθήσεων Θώρακος Σάββατο 19 Μαρτίου 2011 ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΕΡΕΥΝΗΣΗ ΤΗΣ ΦΥΜΑΤΙΩΣΗΣ ΜΙΚΡΟΒΙΟΛΟΓΙΚΟ ΕΡΓΑΣΤΗΡΙΟ Γ.Ν.Θ «Γ.

Διαβάστε περισσότερα

ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ

ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ Η συµβολή της µοριακής ανάλυσης Eλισάβετ Οικονοµάκη Βιολόγος Αιµοπαθολογοανατοµικό Εργαστήριο ΠΓΝΑ > ΜΟΡΙΑΚΕΣ ΜΕΘΟ ΟΙ (Μη µορφολογικές) Αλυσιδωτή Αντίδραση Πολυµεράσης

Διαβάστε περισσότερα

ΠΡΟΔΙΑΓΡΑΦΕΣ ΓΡΗΓΟΡΩΝ ΤΕΣΤ. C. difficile GDH / Toxin A / Toxin B

ΠΡΟΔΙΑΓΡΑΦΕΣ ΓΡΗΓΟΡΩΝ ΤΕΣΤ. C. difficile GDH / Toxin A / Toxin B ΠΡΟΔΙΑΓΡΑΦΕΣ ΓΡΗΓΟΡΩΝ ΤΕΣΤ C. difficile GDH / Toxin A / Toxin B Πλήρες κιτ ανοσοχρωματογραφίας ενός βήματος για την ταυτόχρονη ποιοτική ανίχνευση και διαφοροποίηση των GDH / Toxin A / Toxin B του C. Difficile

Διαβάστε περισσότερα

Αρχές Πειραματικής. Έρευνας

Αρχές Πειραματικής. Έρευνας ΕΛΑΧΙΣΤΑ ΕΠΕΜΒΑΤΙΚΗ ΧΕΙΡΟΥΡΓΙΚΗ, ΡΟΜΠΟΤΙΚΗ ΧΕΙΡΟΥΡΓΙΚΗ ΚΑΙ ΤΗΛΕΧΕΙΡΟΥΡΓΙΚΗ Αρχές Πειραματικής Χειρουργικής και Χειρουργικής Έρευνας ΕΡΓΑΣΤΗΡΙΟ ΠΕΙΡΑΜΑΤΙΚΗΣ ΧΕΙΡΟΥΡΓΙΚΗΣ ΚΑΙ ΧΕΙΡΟΥΡΓΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΠΕΙΡΑΜΑΤΙΚΗΣ

Διαβάστε περισσότερα

ΒΑΣΙΚΕΣ ΕΝΝΟΙΕΣ ΣΤΗΝ ΕΝΟΡΓΑΝΗ ΑΝΑΛΥΣΗ

ΒΑΣΙΚΕΣ ΕΝΝΟΙΕΣ ΣΤΗΝ ΕΝΟΡΓΑΝΗ ΑΝΑΛΥΣΗ ΒΑΣΙΚΕΣ ΕΝΝΟΙΕΣ ΣΤΗΝ ΕΝΟΡΓΑΝΗ ΑΝΑΛΥΣΗ Αναλυτική Μέθοδος- Αναλυτικό Πρόβλημα. Ανάλυση, Προσδιορισμός και Μέτρηση. Πρωτόκολλο. Ευαισθησία Μεθόδου. Εκλεκτικότητα. Όριο ανίχνευσης (limit of detection, LOD).

Διαβάστε περισσότερα

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp.

Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp. Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp. 5 ο Πανελλήνιο Συνέδριο Ιατρικής Βιοπαθολογίας Η εφαρμογή μοριακών

Διαβάστε περισσότερα

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ Μανδηλαρά Γεωργία Βιολόγος PhD, Επιστημονικός Συνεργάτης Εθνική Σχολή Δημόσιας Υγείας Τμήμα Μικροβιολογίας Υδατογενείς λοιμώξεις: χρήση νερού

Διαβάστε περισσότερα

Προϋποθέσεις εφαρμογής των μοριακών τεχνικών

Προϋποθέσεις εφαρμογής των μοριακών τεχνικών Προϋποθέσεις εφαρμογής των μοριακών τεχνικών Α. Μεντής ιαγνωστικό Εργαστήριο Λοιμωδών Νοσημάτων Εθνικό Εργαστήριο Αναφοράς Γρίπης Νοτίου Ελλάδος Εθνικό Εργαστήριο Αναφοράς Ερυθράς/Ιλαράς Ελλάδος, Εθνικό

Διαβάστε περισσότερα

ΝΕΟΤΕΡΕΣ ΜΕΘΟΔΟΙ ΔΙΑΓΝΩΣΗΣ ΛΟΙΜΩΞΕΩΝ

ΝΕΟΤΕΡΕΣ ΜΕΘΟΔΟΙ ΔΙΑΓΝΩΣΗΣ ΛΟΙΜΩΞΕΩΝ ΝΕΟΤΕΡΕΣ ΜΕΘΟΔΟΙ ΔΙΑΓΝΩΣΗΣ ΛΟΙΜΩΞΕΩΝ Ο ΡΟΛΟΣ ΤΟΥ ΚΛΙΝΙΚΟΥ ΜΙΚΡΟΒΙΟΛΟΓΙΚΟΥ ΕΡΓΑΣΤΗΡΙΟΥ ΕΙΝΑΙ Η ΔΙΑΓΝΩΣΗ ΤΟΥ ΑΙΤΙΟΛΟΓΙΚΟΥ ΠΑΡΑΓΟΝΤΑ ΤΗΣ ΛΟΙΜΩΞΗΣ ΤΕΛΟΣ ΤΗΣ ΕΜΠΕΙΡΙΚΗΣ ΘΕΡΑΠΕΙΑΣ ΔΙΑΓΝΩΣΗ ΤΗΣ ΒΑΚΤΗΡΙΑΚΗΣ ΛΟΙΜΩΞΗΣ

Διαβάστε περισσότερα

Η ΑΝΑΓΚΗ ΓΙΑ ΠΟΣΟΤΙΚΟΠΟΙΗΣΗ ΣΤΗΝ ΕΝΟΡΓΑΝΗ ΑΝΑΛΥΣΗ

Η ΑΝΑΓΚΗ ΓΙΑ ΠΟΣΟΤΙΚΟΠΟΙΗΣΗ ΣΤΗΝ ΕΝΟΡΓΑΝΗ ΑΝΑΛΥΣΗ Η ΑΝΑΓΚΗ ΓΙΑ ΠΟΣΟΤΙΚΟΠΟΙΗΣΗ ΣΤΗΝ ΕΝΟΡΓΑΝΗ ΑΝΑΛΥΣΗ Οι Ενόργανες Μέθοδοι Ανάλυσης είναι σχετικές μέθοδοι και σχεδόν στο σύνολο τους παρέχουν την αριθμητική τιμή μιας φυσικής ή φυσικοχημικής ιδιότητας, η

Διαβάστε περισσότερα

ΜΟΡΙΑΚΗ ΑΝΙΧΝΕΥΣΗ ΚΑΙ ΔΙΕΡΕΥΝΗΣΗ ΤΗΣ ΜΙΚΡΟΒΙΑΚΗΣ ΑΝΤΟΧΗΣ

ΜΟΡΙΑΚΗ ΑΝΙΧΝΕΥΣΗ ΚΑΙ ΔΙΕΡΕΥΝΗΣΗ ΤΗΣ ΜΙΚΡΟΒΙΑΚΗΣ ΑΝΤΟΧΗΣ ΗΜΕΡΙΔΑ ΕΦΑΡΜΟΣΜΕΝΗΣ ΚΛΙΝΙΚΗΣ ΚΑΙ ΔΙΑΓΝΩΣΤΙΚΗΣ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ 24 ΙΑΝΟΥΑΡΙΟΥ 2009 ΜΟΡΙΑΚΗ ΑΝΙΧΝΕΥΣΗ ΚΑΙ ΔΙΕΡΕΥΝΗΣΗ ΤΗΣ ΜΙΚΡΟΒΙΑΚΗΣ ΑΝΤΟΧΗΣ Ε. ΠΕΤΕΙΝΑΚΗ ΕΡΓΑΣΤΗΡΙΟ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ ΙΑΤΡΙΚΗΣ ΣΧΟΛΗΣ ΠΑΝΕΠΙΣΤΗΜΙΟΥ

Διαβάστε περισσότερα

ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΕΛΕΥΘΕΡΩΝ ΕΛΑΦΡΩΝ ΑΛΥΣΕΩΝ ΣΤΟΝ ΟΡΟ ΚΑΙ ΣΤΑ ΟΥΡΑ. Χρυσούλα Νικολάου

ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΕΛΕΥΘΕΡΩΝ ΕΛΑΦΡΩΝ ΑΛΥΣΕΩΝ ΣΤΟΝ ΟΡΟ ΚΑΙ ΣΤΑ ΟΥΡΑ. Χρυσούλα Νικολάου ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΕΛΕΥΘΕΡΩΝ ΕΛΑΦΡΩΝ ΑΛΥΣΕΩΝ ΣΤΟΝ ΟΡΟ ΚΑΙ ΣΤΑ ΟΥΡΑ Χρυσούλα Νικολάου Μονοκλωνικές ελεύθερες ελαφρές αλύσεις Οι μονοκλωνικές ελεύθερες ελαφρές αλύσεις οι οποίες είναι γνωστές ως πρωτεΐνη Bence

Διαβάστε περισσότερα

ΟΙ ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΣΤΗΝ ΙΑΤΡΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Eφη. Πετεινάκη

ΟΙ ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΣΤΗΝ ΙΑΤΡΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Eφη. Πετεινάκη ΟΙ ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΣΤΗΝ ΙΑΤΡΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Eφη Πετεινάκη ΠΡΟΒΛΗΜΑΤΑ ΡΟΥΤΙΝΑΣ ΕΝΟΣ ΚΛΙΝΙΚΟΥ ΜΙΚΡΟΒΙΟΛΟΓΙΚΟΥ ΕΡΓΑΣΤΗΡΙΟΥ ταυτοποίηση κάποιων βακτηρίων ο έλεγχος ευαισθησίας διάγνωση λοιμώξεων από μικροοργανισμούς

Διαβάστε περισσότερα

ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΤΟΥ ΓΕΝΟΥΣ ΤΩΝ ΜΥΚΟΒΑΚΤΗΡΙΔΙΩΝ

ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΤΟΥ ΓΕΝΟΥΣ ΤΩΝ ΜΥΚΟΒΑΚΤΗΡΙΔΙΩΝ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΤΟΥ ΓΕΝΟΥΣ ΤΩΝ ΜΥΚΟΒΑΚΤΗΡΙΔΙΩΝ Γένος Μycobacterium (G+C 60-70% DNA) Μέγεθος:0.2-0.6 * 1-10 μm Αερόβιο, μη-κινητό,δεν σχηματίζει σπόρια. Ανθίστανται στον αποχρωματισμό από οξέα-αλκοόλη Θεωρούνται

Διαβάστε περισσότερα

Ορισμός Αναλυτικής Χημείας

Ορισμός Αναλυτικής Χημείας Ορισμός Αναλυτικής Χημείας Αναλυτική Χημεία ορίζεται ως ο επιστημονικός κλάδος, που αναπτύσσει και εφαρμόζει μεθόδους, όργανα και στρατηγικές, για να δώσει πληροφορίες σχετικά με τη σύσταση και φύση υλικών

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΕΙΣΑΓΩΓΗ ΣΤΗ ΒΙΟΛΟΓΙΑ

ΕΙΣΑΓΩΓΗ ΣΤΗ ΒΙΟΛΟΓΙΑ ΕΙΣΑΓΩΓΗ ΣΤΗ ΒΙΟΛΟΓΙΑ Εξάμηνο Υ/Ε Ώρες Θεωρίας Ώρες Ασκήσης Διδακτικές μονάδες ECTS A Υ 3 3 4 6 Διδάσκουσα Μ. Αλεξίου Χατζάκη, Επίκ. Καθηγήτρια Γεν. Βιολογίας. Aντικειμενικοί στόχοι του μαθήματος Οι στόχοι

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

Κατάλληλη επεξεργασία FNA μαστού σε υγρή μορφή προς μικροσκόπιση

Κατάλληλη επεξεργασία FNA μαστού σε υγρή μορφή προς μικροσκόπιση ΤΕΙ ΑΘΗΝΑΣ ΣΧΟΛΗ ΕΠΑΓΓΕΛΜΑΤΩΝ ΥΓΕΙΑΣ ΚΑΙ ΠΡΟΝΟΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΩΝ ΕΡΓΑΣΗΡΙΩΝ Κατάλληλη επεξεργασία FNA μαστού σε υγρή μορφή προς μικροσκόπιση Εργαστήριο κυτταρολογικό στο ΓΝΑ ΛΑΙΚΟ Ιωάννα Χαραλάμπους Α.Μ

Διαβάστε περισσότερα

ΕΡΓΑΣΙΕΣ ΜΕ ΔΙΑΛΥΜΑΤΑ Γραμμομοριακή συγκέντρωση διαλυμάτων

ΕΡΓΑΣΙΕΣ ΜΕ ΔΙΑΛΥΜΑΤΑ Γραμμομοριακή συγκέντρωση διαλυμάτων ΕΡΓΑΣΙΕΣ ΜΕ ΔΙΑΛΥΜΑΤΑ Γραμμομοριακή συγκέντρωση διαλυμάτων Συγκέντρωση διαλύματος: ποσότητα διαλυμένης ουσίας σε καθορισμένη ποσότητα διαλύματος Αραιό διάλυμα: μικρή συγκέντρωση διαλυμένης ουσίας Πυκνό

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

Έλεγχοι. Τη συγκέντρωση του φαρμάκου σε δείγμα ιστού ή βιολογικού υγρού

Έλεγχοι. Τη συγκέντρωση του φαρμάκου σε δείγμα ιστού ή βιολογικού υγρού Έλεγχοι Τη συγκέντρωση του φαρμάκου σε δείγμα ιστού ή βιολογικού υγρού Το ρυθμό απελευθέρωσης του φαρμάκου από το σκεύασμα Έλεγχο ταυτότητας και καθαρότητας της πρώτης ύλης και των εκδόχων( βάση προδιαγραφών)

Διαβάστε περισσότερα

ΕΝΟΤΗΤΑ Α ΑΝΑΛΥΤΗΣ ΓΙΑ ΑΝΟΣΟΧΗΜΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΜΕ ΤΗ ΜΕΘΟΔΟ ΤΗΣ ΧΗΜΕΙΟΦΩΤΑΥΓΕΙΑΣ

ΕΝΟΤΗΤΑ Α ΑΝΑΛΥΤΗΣ ΓΙΑ ΑΝΟΣΟΧΗΜΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΜΕ ΤΗ ΜΕΘΟΔΟ ΤΗΣ ΧΗΜΕΙΟΦΩΤΑΥΓΕΙΑΣ ΕΝΟΤΗΤΑ Α ΑΝΑΛΥΤΗΣ ΓΙΑ ΑΝΟΣΟΧΗΜΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΜΕ ΤΗ ΜΕΘΟΔΟ ΤΗΣ ΧΗΜΕΙΟΦΩΤΑΥΓΕΙΑΣ Τεχνικές προδιαγραφές Αυτόματου Ανοσοχημικού αναλυτή με την μέθοδο της χημειοφωταύγειας 1. Ο Αναλυτής να είναι τυχαίας (random),

Διαβάστε περισσότερα

Εργαστηριακές Δοκιμασίες που πραγματοποιούνται στο Π.Ε.Δ.Υ Κρήτης.

Εργαστηριακές Δοκιμασίες που πραγματοποιούνται στο Π.Ε.Δ.Υ Κρήτης. Εργαστηριακές Δοκιμασίες που πραγματοποιούνται στο Π.Ε.Δ.Υ Κρήτης. Είδος δείγματος Εξεταζόμενη παράμετρος Μέθοδος Πρότυπο Διαπιστευμένη Αρίθμηση μικροοργανισμών ενσωμάτωσης σε στερεό ΕΛΟΤ ΕΝ ISO 6222 καταμέτρηση

Διαβάστε περισσότερα

ΔΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ

ΔΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΔΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ Εργαστηριακή αξιολόγηση της αξιοπιστίας του strep testστη διάγνωση και τον καθορισμό της κατάλληλης αντιβιοτικής αγωγής σε ασθενείς με οξεία πυώδη αμυγδαλίτιδα

Διαβάστε περισσότερα

Προβλήματα σχετιζόμενα με την τυποποίηση αντιγόνων Ι

Προβλήματα σχετιζόμενα με την τυποποίηση αντιγόνων Ι Β Προβλήματα Φαινότυπος Β(Α): ασθενής αντίδραση με αντι-α, έντονη αντίδραση με αντι-β, και ο ορός αντιδρά με ερυθρά Α₁. Ο αντιορός Α περιέχει τον κλώνο ΜΗΟ4? Επίκτητος Β φαινότυπος: έντονη αντίδραση με

Διαβάστε περισσότερα

Στην τρέχουσα παρουσίαση δεν υφίσταται σύγκρουση συμφερόντων

Στην τρέχουσα παρουσίαση δεν υφίσταται σύγκρουση συμφερόντων Δοκιμασίες κοπράνων Γιώργος Χουλιάρας, Παιδογαστρεντερολόγος, Πανεπιστημιακός Υπότροφος, Υπεύθυνος Ενδοσκοπήσεων & Ιατρείου Ιδιοπαθών Φλεγμονωδών Nοσημάτων του Εντέρου Μονάδα Γαστρεντερολογίας και Διατροφής

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

ΑΛΕΞΑΝΔΡΕΙΟ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗΣ ΤΜΗΜΑ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ

ΑΛΕΞΑΝΔΡΕΙΟ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗΣ ΤΜΗΜΑ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΑΛΕΞΑΝΔΡΕΙΟ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗΣ ΤΜΗΜΑ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΚΑΤΕΥΘΥΝΣΗ: ΖΩΪΚΗΣ ΠΑΡΑΓΩΓΗΣ Η ΤΕΧΝΙΚΗ ΤΗΣ PCR ΣΤΗ

Διαβάστε περισσότερα

Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών

Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών Αντιµεταλλαξιγόνο δράση ανίχνευση ουσιών που προστατεύουν το DNA από µεταλλαξιγόνα που προκαλούν µεταλλάξεις

Διαβάστε περισσότερα

Συχνότητα Human Papilloma Virus (HPV) στη Κύπρο

Συχνότητα Human Papilloma Virus (HPV) στη Κύπρο E M E D N L C SCIENCES BIOMEDICAL E N T E R Kέντρο Μέντελ για Βιοιατρικές Επιστήμες Συχνότητα Human Papilloma Virus (HPV) στη Κύπρο Βασίλειος Τάνος MD PhD www.mendelcenter.org Picture taken from leaflet

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΚΑΙ ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ. ΕΡΓΑΣΤΗΡΙΑΚΗ ΙΕΡΕΥΝΗΣΗ ΚΡΟΥΣΜΑΤΩΝ ΥΠΟΠΤΩΝ ΓΙΑ ΓΡΙΠΗ ΠΤΗΝΩΝ εκέµβριος 2005

ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΚΑΙ ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ. ΕΡΓΑΣΤΗΡΙΑΚΗ ΙΕΡΕΥΝΗΣΗ ΚΡΟΥΣΜΑΤΩΝ ΥΠΟΠΤΩΝ ΓΙΑ ΓΡΙΠΗ ΠΤΗΝΩΝ εκέµβριος 2005 ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΚΑΙ ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ ΕΡΓΑΣΤΗΡΙΑΚΗ ΙΕΡΕΥΝΗΣΗ ΚΡΟΥΣΜΑΤΩΝ ΥΠΟΠΤΩΝ ΓΙΑ ΓΡΙΠΗ ΠΤΗΝΩΝ εκέµβριος 2005 Για ασθενείς που διερευνώνται για γρίπη των πτηνών, η έγκαιρη επιβεβαίωση µε εργαστηριακές

Διαβάστε περισσότερα

ΑΠΑΙΤΗΣΕΙΣ ΣΧΕΤΙΚΕΣ ΜΕ ΝΕΑΣ ΤΕΧΝΟΛΟΓΙΑΣ ΙΧΝΗΘΕΤΕΣ

ΑΠΑΙΤΗΣΕΙΣ ΣΧΕΤΙΚΕΣ ΜΕ ΝΕΑΣ ΤΕΧΝΟΛΟΓΙΑΣ ΙΧΝΗΘΕΤΕΣ ΑΠΑΙΤΗΣΕΙΣ ΣΧΕΤΙΚΕΣ ΜΕ ΝΕΑΣ ΤΕΧΝΟΛΟΓΙΑΣ ΙΧΝΗΘΕΤΕΣ Οι απαντήσεις σε όλα τα πεδία οφείλουν να λαμβάνουν υπόψη και να είναι σύμφωνες με τις Ευρωπαϊκές Οδηγίες και τους Ευρωπαϊκούς Κανονισμούς. Για κάθε πεδίο

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

Εναλλακτικές Μέθοδοι

Εναλλακτικές Μέθοδοι Εναλλακτικές Μέθοδοι Δέσποινα Ν. Περρέα Αναπληρώτρια Καθηγήτρια Ιατρικής Σχολής Πανεπιστημίου Αθηνών Διευθύντρια Εργαστηρίου Πειραματικής Χειρουργικής και Χειρουργικής Ερεύνης «Ν.Σ. Χρηστέας» Ιστορικά

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΟ ΟΡΓΑΝΙΚΗΣ ΧΗΜΕΙΑΣ

ΕΡΓΑΣΤΗΡΙΟ ΟΡΓΑΝΙΚΗΣ ΧΗΜΕΙΑΣ Υπεύθυνος Εργαστηρίου: Δρ. Πέτρος Α. Ταραντίλης, Λέκτορας Δρ. Χρήστος Παππάς, Λέκτορας (βάσει Ν. 407/80) Δρ. Σοφία Κουλοχέρη, Επιστημονικός συνεργάτης Δρ. Αναστασία Μίχου, Επιστημονικός συνεργάτης Βάση

Διαβάστε περισσότερα

ΕΘΝΙΚΟ ΚΕΝΤΡΟ ΑΝΑΦΟΡΑΣ ΜΗΝΙΓΓΙΤΙΔΑΣ ΠΑΡΕΧΟΜΕΝΕΣ ΥΠΗΡΕΣΙΕΣ ΚΑΙ ΟΔΗΓΙΕΣ ΑΠΟΣΤΟΛΗΣ ΔΕΙΓΜΑΤΩΝ

ΕΘΝΙΚΟ ΚΕΝΤΡΟ ΑΝΑΦΟΡΑΣ ΜΗΝΙΓΓΙΤΙΔΑΣ ΠΑΡΕΧΟΜΕΝΕΣ ΥΠΗΡΕΣΙΕΣ ΚΑΙ ΟΔΗΓΙΕΣ ΑΠΟΣΤΟΛΗΣ ΔΕΙΓΜΑΤΩΝ ΕΘΝΙΚΗ ΣΧΟΛΗ ΔΗΜΟΣΙΑΣ ΥΓΕΙΑΣ ΤΟΜΕΑΣ ΔΗΜΟΣΙΑΣ ΥΓΕΙΑΣ ΕΘΝΙΚΟ ΚΕΝΤΡΟ ΑΝΑΦΟΡΑΣ ΜΗΝΙΓΓΙΤΙΔΑΣ ΠΑΡΕΧΟΜΕΝΕΣ ΥΠΗΡΕΣΙΕΣ ΚΑΙ ΟΔΗΓΙΕΣ ΑΠΟΣΤΟΛΗΣ ΔΕΙΓΜΑΤΩΝ ΕΠΙΣΤΗΜΟΝΙΚΟΙ ΥΠΕΥΘΥΝΟΙ ΚΑΘ. ΤΖ. ΚΟΥΡΕΑ ΚΡΕΜΑΣΤΙΝΟΥ Δρ. ΤΖΩΡΤΖΙΝΑ

Διαβάστε περισσότερα

Σύγχρονη διαγνωστική προσέγγιση των ιώσεων

Σύγχρονη διαγνωστική προσέγγιση των ιώσεων Σύγχρονη διαγνωστική προσέγγιση των ιώσεων Μ. ΓΙΑΝΝΑΚΗ 10 η Ημερίδα Κλινικής Μικροβιολογίας 23/1/2010 Αξιολόγηση για την επιλογή της διαγνωστικής τεχνικής Ευαισθησία Ειδικότητα Θετική και Αρνητική Προγνωστική

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΟ ΟΡΓΑΝΙΚΗΣ ΧΗΜΕΙΑΣ. Άσκηση 2 η : Φασματοφωτομετρία. ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ Γενικό Τμήμα Εργαστήριο Χημείας

ΕΡΓΑΣΤΗΡΙΟ ΟΡΓΑΝΙΚΗΣ ΧΗΜΕΙΑΣ. Άσκηση 2 η : Φασματοφωτομετρία. ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ Γενικό Τμήμα Εργαστήριο Χημείας Άσκηση 2 η : ΑΣΚΗΣΕΙΣ 1. Εκχύλιση - Διήθηση Διαχωρισμός-Απομόνωση 2. Ποσοτικός Προσδιορισμός 3. Ποτενσιομετρία 4. Χρωματογραφία Ηλεκτροχημεία Διαχωρισμός-Απομόνωση 5. Ταυτοποίηση Σακχάρων Χαρακτηριστικές

Διαβάστε περισσότερα

Μονάδες 6 ΘΕΜΑ Β. ιαθέτουμε υδατικό διάλυμα CH 3 COONa συγκέντρωσης 0,1 Μ ( ιάλυμα 1 ). Β1. Να υπολογίσετε το ph του διαλύματος 1.

Μονάδες 6 ΘΕΜΑ Β. ιαθέτουμε υδατικό διάλυμα CH 3 COONa συγκέντρωσης 0,1 Μ ( ιάλυμα 1 ). Β1. Να υπολογίσετε το ph του διαλύματος 1. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 21 ΜΑΪΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΟΛΟ

Διαβάστε περισσότερα

Η Κυτταρογενετική στις αιματολογικές κακοήθειες

Η Κυτταρογενετική στις αιματολογικές κακοήθειες Εργαστήριο Υγειοφυσικής & Περιβαλλοντικής Υγείας, ΙΠΤ-Α, Ε.Κ.Ε.Φ.Ε. «Δημόκριτος» Η Κυτταρογενετική στις αιματολογικές κακοήθειες Μανωλά Καλλιόπη, Ph.D Ερευνήτρια Γ Κυτταρογενετική Κλάδος της Γενετικής

Διαβάστε περισσότερα

ΧΡΩΜΑΤΟΓΡΑΦΙΚΕΣ ΜΕΘΟΔΟΙ ΔΙΑΧΩΡΙΣΜΟΥ. ΑΝΝΑ-ΜΑΡΙΑ ΨΑΡΡΑ Τμήμα Βιοχημείας κ Βιοτεχνολογίας

ΧΡΩΜΑΤΟΓΡΑΦΙΚΕΣ ΜΕΘΟΔΟΙ ΔΙΑΧΩΡΙΣΜΟΥ. ΑΝΝΑ-ΜΑΡΙΑ ΨΑΡΡΑ Τμήμα Βιοχημείας κ Βιοτεχνολογίας ΧΡΩΜΑΤΟΓΡΑΦΙΚΕΣ ΜΕΘΟΔΟΙ ΔΙΑΧΩΡΙΣΜΟΥ ΑΝΝΑ-ΜΑΡΙΑ ΨΑΡΡΑ Τμήμα Βιοχημείας κ Βιοτεχνολογίας ΑΝΝΑ-ΜΑΡΙΑ ΨΑΡΡΑ 1 ΣΥΣΤΗΜΑ ΧΡΩΜΑΤΟΓΡΑΦΙΑΣ Αντλία Στήλη Υγρό Έκλουσης Συλλέκτης κλασμάτων ΧΡΩΜΑΤΟΓΡΑΦΙΚΕΣ ΜΕΘΟΔΟΙ ΔΙΑΧΩΡΙΣΜΟΥ

Διαβάστε περισσότερα

Αρχές Βιοτεχνολογίας Τροφίμων

Αρχές Βιοτεχνολογίας Τροφίμων Αρχές Βιοτεχνολογίας Τροφίμων Ενότητα 2: Στοιχεία Μικροβιολογίας και Βιοχημείας των Βιομηχανικών Ζυμώσεων(1/5), 2ΔΩ Τμήμα: Επιστήμης και Τεχνολογίας Τροφίμων Διδάσκων: Δρ. Σεραφείμ Παπανικολαου Μαθησιακοί

Διαβάστε περισσότερα

ηλικία περιεκτικότητα σε λίπος φύλο

ηλικία περιεκτικότητα σε λίπος φύλο ΥΓΡΑ ΤΟΥ ΣΩΜΑΤΟΣ Το ύδωρ αποτελεί το 60% του βάρους σώματος α) από την ηλικία (νεογνά 75%) β) περιεκτικότητα σε λίπος (ο λιπώδης ιστός έχει μικρή περιεκτικότητα σε ύδωρ) γ) το φύλο ( το ύδωρ είναι λιγότερο

Διαβάστε περισσότερα

Διάγνωση λανθάνουσας φυματίωσης. Χαράλαμπος Μόσχος Επιμελητής Α Πνευμονολόγος-Φυματιολογος ΝΝΘΑ Η ΣΩΤΗΡΙΑ

Διάγνωση λανθάνουσας φυματίωσης. Χαράλαμπος Μόσχος Επιμελητής Α Πνευμονολόγος-Φυματιολογος ΝΝΘΑ Η ΣΩΤΗΡΙΑ Διάγνωση λανθάνουσας φυματίωσης 1 Χαράλαμπος Μόσχος Επιμελητής Α Πνευμονολόγος-Φυματιολογος ΝΝΘΑ Η ΣΩΤΗΡΙΑ Τι είναι η λανθανουσα φυματική λοίμωξη (ΛΦ)? 2 Υποκλινική νόσος ΛΦ είναι η παρουσία M. tuberculosis

Διαβάστε περισσότερα

ΦΥΣΙΚΗ ΧΗΜΕΙΑ ΙΙΙ ΤΜΗΜΑ ΧΗΜΕΙΑΣ ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ: ΕΠΙΔΡΑΣΗ ΘΕΡΜΟΚΡΑΣΙΑΣ ΣΤΗ ΣΤΑΘΕΡΑ ΤΑΧΥΤΗΤΑΣ ΑΝΤΙΔΡΑΣΗΣ

ΦΥΣΙΚΗ ΧΗΜΕΙΑ ΙΙΙ ΤΜΗΜΑ ΧΗΜΕΙΑΣ ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ: ΕΠΙΔΡΑΣΗ ΘΕΡΜΟΚΡΑΣΙΑΣ ΣΤΗ ΣΤΑΘΕΡΑ ΤΑΧΥΤΗΤΑΣ ΑΝΤΙΔΡΑΣΗΣ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΧΗΜΕΙΑΣ ΕΡΓΑΣΤΗΡΙΟ ΦΥΣΙΚΟΧΗΜΕΙΑΣ Γραφείο 211 Επίκουρος Καθηγητής: Δ. Τσιπλακίδης Τηλ.: 2310 997766 e mail: dtsiplak@chem.auth.gr url:

Διαβάστε περισσότερα

ΜΕΘΟΔΟΣ ΑΝΙΧΝΕΥΣΗΣ, ΤΑΥΤΟΠΟΙΗΣΗΣ ΚΑΙ ΑΝΤΙΒΙΟΓΡΑΜΜΑΤΟΣ ΟΥΡΟΓΕΝΝΗΤΙΚΩΝ ΜΥΚΟΠΛΑΣΜΑΤΩΝ.

ΜΕΘΟΔΟΣ ΑΝΙΧΝΕΥΣΗΣ, ΤΑΥΤΟΠΟΙΗΣΗΣ ΚΑΙ ΑΝΤΙΒΙΟΓΡΑΜΜΑΤΟΣ ΟΥΡΟΓΕΝΝΗΤΙΚΩΝ ΜΥΚΟΠΛΑΣΜΑΤΩΝ. Παρασκευή Λίντα ΜΕΘΟΔΟΣ ΑΝΙΧΝΕΥΣΗΣ, ΤΑΥΤΟΠΟΙΗΣΗΣ ΚΑΙ ΑΝΤΙΒΙΟΓΡΑΜΜΑΤΟΣ ΟΥΡΟΓΕΝΝΗΤΙΚΩΝ ΜΥΚΟΠΛΑΣΜΑΤΩΝ. Η διαδικασία χρησιμοποιείται για ταυτοποίηση και διαφορική τιτλοποίηση των δύο ειδών των ουρογεννητικών

Διαβάστε περισσότερα

Το κεντρικό δόγμα (The central dogma)

Το κεντρικό δόγμα (The central dogma) Οι βασικές μοριακές γενετικές διαδικασίες Αντιγραφή Μεταγραφή Μετάφραση ΠΡΩΤΕΪΝΗ Το κεντρικό δόγμα (The central dogma) Σύσταση νουκλεοτιδίων του DNA και του RNA Α 5 -άκρο Θυμίνη (Θ) Β 5 άκρο Αδενίνη (Α)

Διαβάστε περισσότερα

ΜΑΘΗΜΑ: Τεχνολογία Μετρήσεων ΙΙ

ΜΑΘΗΜΑ: Τεχνολογία Μετρήσεων ΙΙ ΜΑΘΗΜΑ: Τεχνολογία Μετρήσεων ΙΙ ΔΙΔΑΣΚΩΝ: Αν. Καθ. Δρ Μαρία Α. Γούλα ΤΜΗΜΑ: Μηχανικών Περιβάλλοντος & Μηχανικών Αντιρρύπανσης 1 Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες χρήσης Creative

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. β 2. γ 3. α 4. γ 5. δ ΘΕΜΑ 2ο 1. Σχολικό

Διαβάστε περισσότερα

ΕΡΕΥΝΗΤΙΚΗ ΕΡΓΑΣΙΑ. Θεωρία - Πείραμα Μετρήσεις - Σφάλματα

ΕΡΕΥΝΗΤΙΚΗ ΕΡΓΑΣΙΑ. Θεωρία - Πείραμα Μετρήσεις - Σφάλματα ΕΡΕΥΝΗΤΙΚΗ ΕΡΓΑΣΙΑ Θεωρία - Πείραμα Μετρήσεις - Σφάλματα ΟΜΑΔΑ:RADIOACTIVITY Τα μέλη της ομάδας μας: Γιώργος Παπαδόγιαννης Γεράσιμος Κουτσοτόλης Νώντας Καμαρίδης Κωνσταντίνος Πούτος Παναγιώτης Ξανθάκος

Διαβάστε περισσότερα

Ορισμοί νοσοκομειακών λοιμώξεων

Ορισμοί νοσοκομειακών λοιμώξεων Ορισμοί νοσοκομειακών λοιμώξεων Ιωαννίδου Ελένη Παθολόγος Εξειδικευόμενη Λοιμωξιολογίας Νοσοκομείο Ρεθύμνου Ουρολοιμώξεις Σηψαιμίες Λοιμώξεις συνδεόμενες με αγγειακούς καθετρες Ουρολοιμώξεις UTI-A συμπτωματικ

Διαβάστε περισσότερα

HPV DNA, E6, E7, L1, L2, E2, p16, prb, κυκλίνες, κινάσες, Ki67. Τι από όλα αυτά πρέπει να γνωρίζει ο κλινικός γιατρός; Αλέξανδρος Λαµπρόπουλος

HPV DNA, E6, E7, L1, L2, E2, p16, prb, κυκλίνες, κινάσες, Ki67. Τι από όλα αυτά πρέπει να γνωρίζει ο κλινικός γιατρός; Αλέξανδρος Λαµπρόπουλος HPV DNA, E6, E7, L1, L2, E2, p16, prb, κυκλίνες, κινάσες, Ki67. Τι από όλα αυτά πρέπει να γνωρίζει ο κλινικός γιατρός; Αλέξανδρος Λαµπρόπουλος δεν υπάρχει σύγκρουση συµφερόντων Ø Ποιό HPV τεστ είναι το

Διαβάστε περισσότερα

Για χρήση στην παρασκευή και απομόνωση λευκοκυττάρων απευθείας από ολικό αίμα ΕΝΘΕΤΟ ΣΥΣΚΕΥΑΣΙΑΣ. Για In Vitro διαγνωστική χρήση PI-TT.

Για χρήση στην παρασκευή και απομόνωση λευκοκυττάρων απευθείας από ολικό αίμα ΕΝΘΕΤΟ ΣΥΣΚΕΥΑΣΙΑΣ. Για In Vitro διαγνωστική χρήση PI-TT. Για χρήση στην παρασκευή και απομόνωση λευκοκυττάρων απευθείας από ολικό αίμα ΕΝΘΕΤΟ ΣΥΣΚΕΥΑΣΙΑΣ Για In Vitro διαγνωστική χρήση PI-TT.610-GR-V5 Εκπαιδευτικές πληροφορίες Ενδεικνυόμενη Χρήση Το αντιδραστήριο

Διαβάστε περισσότερα

15PROC003177823 2015-10-16. Fax: 213 204 1838 E-mail: karetou@0304.syzefxis.gov.gr

15PROC003177823 2015-10-16. Fax: 213 204 1838 E-mail: karetou@0304.syzefxis.gov.gr ΕΛΛΗΝΙΚΗ ΗΜΟΚΡΑΤΙΑ 1 Η ΥΠΕ ΑΤΤΙΚΗΣ Γ.Ν.Α «Ο ΕΥΑΓΓΕΛΙΣΜΟΣ- ΟΦΘΑΛΜΙΑΤΡΕΙΟ ΑΘΗΝΩΝ- ΠΟΛΥΚΛΙΝΙΚΗ» Ν.Π.. ΥΠΗΡΕΣΙΑ: ΙΟΙΚΗΤΙΚΗ ΥΠΟ /ΝΣΗ: ΟΙΚΟΝΟΜΙΚΟΥ ΤΜΗΜΑ: ΟΙΚΟΝΟΜΙΚΟ ΓΡΑΦΕΙΟ: ΠΡΟΜΗΘΕΙΩΝ Πληροφορίες:. Καρέτου

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

Ανάλυση µε έγχυση του δείγµατος σε συνεχή ροή (Flow Injection Analysis, FIA)

Ανάλυση µε έγχυση του δείγµατος σε συνεχή ροή (Flow Injection Analysis, FIA) Ανάλυση µε έγχυση του δείγµατος σε συνεχή ροή (Flow Injection Analysis, FIA) H ιστορική εξέλιξη των αυτόµατων µεθόδων ανάλυσης Κλασική ανάλυση Ασυνεχής αυτόµατη ανάλυση Ανάλυση συνεχούς ροής? Τα πλεονεκτήµατα

Διαβάστε περισσότερα

Κεφάλαιο 1: Εισαγωγή. Κεφάλαιο 2: Η Βιολογία των Ιών

Κεφάλαιο 1: Εισαγωγή. Κεφάλαιο 2: Η Βιολογία των Ιών Κεφάλαιο 1: Εισαγωγή 1.1 Μικροοργανισμοί, Μικροβιολογία και Μικροβιολόγοι... 19 1.1.1 Μικροοργανισμοί... 19 1.1.2 Μικροβιολογία... 20 1.1.3 Μικροβιολόγοι... 21 1.2 Σύντομη Ιστορική Εξέλιξη της Μικροβιολογίας...

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Επίλυση προβλημάτων ασυμβατότητας. Νίκη Βγόντζα

Επίλυση προβλημάτων ασυμβατότητας. Νίκη Βγόντζα Επίλυση προβλημάτων ασυμβατότητας Νίκη Βγόντζα Βασικά στάδια ελέγχου συμβατότητας του αίματος μεταξύ δότη και λήπτη 1.Αίτηση αίματος (παραπεμπτικό) και δείγμα ασθενή 2.Ομάδα ABO,RhD στο δείγμα του ασθενή

Διαβάστε περισσότερα

Τεχνολογία του ανασυνδυασμένου DNA

Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία του ανασυνδυασμένου DNA Ε Ι Σ Α Γ Ω Γ Η Φώτης Καρβέλης Ιστορική αναδρομή Ανακάλυψη του DNA Μελέτη αντιγραφής Απομόνωση ενζύμων Μελέτη της δράσης τους Αποκάλυψη των περιοριστικών ενδονουκλεασών

Διαβάστε περισσότερα

ΣΥΧΝΟΤΗΤΑ ΑΠΟΜΟΝΩΣΗΣ ΜΙΚΡΟΟΡΓΑΝΙΣΜΩΝ ΑΠΟ ΧΕΙΡΟΥΡΓΙΚΑ ΤΡΑΥΜΑΤΑ ΑΣΘΕΝΩΝ ΤΡΙΤΟΒΑΘΜΙΟΥ ΝΟΣΟΚΟΜΕΙΟΥ ΚΑΤΑ ΤΗΝ ΤΡΙΕΤΙΑ 2007 2009

ΣΥΧΝΟΤΗΤΑ ΑΠΟΜΟΝΩΣΗΣ ΜΙΚΡΟΟΡΓΑΝΙΣΜΩΝ ΑΠΟ ΧΕΙΡΟΥΡΓΙΚΑ ΤΡΑΥΜΑΤΑ ΑΣΘΕΝΩΝ ΤΡΙΤΟΒΑΘΜΙΟΥ ΝΟΣΟΚΟΜΕΙΟΥ ΚΑΤΑ ΤΗΝ ΤΡΙΕΤΙΑ 2007 2009 ΜΙΚΡΟΟΡΓΑΝΙΣΜΩΝ ΑΠΟ ΑΣΘΕΝΩΝ ΤΡΙΤΟΒΑΘΜΙΟΥ ΤΡΙΕΤΙΑ 2007 2009 1 Μικροβιολογικό Τμήμα, Γ.Ν. Νίκαιας-Πειραιά «Άγιος Παντελεήμων», 2 Ά Χειρουργική Κλινική, Γ. Ν. Νίκαιας-Πειραιά «Άγιος Παντελεήμων» Εισαγωγή

Διαβάστε περισσότερα

3/12/2014 ΑΜΙΣΟΥΛΠΡΙΔΗ " ΜΕΘΟΔΟΛΟΓΙΑ ΑΝΙΧΝΕΥΣΗΣ ΝΕΥΡΟΛΗΠΤΙΚΩΝ (ΑΜΙΣΟΥΛΠΡΙΔΗ)ΣΕ ΑΙΜΑ ΚΑΙ ΟΥΡΑ ΜΕ ΤΗ ΜΕΘΟΔΟ GC/MS " AΜΙΣΟΥΛΠΡΙΔΗ-ΜΗΧΑΝΙΣΜΟΣ ΔΡΑΣΗΣ

3/12/2014 ΑΜΙΣΟΥΛΠΡΙΔΗ  ΜΕΘΟΔΟΛΟΓΙΑ ΑΝΙΧΝΕΥΣΗΣ ΝΕΥΡΟΛΗΠΤΙΚΩΝ (ΑΜΙΣΟΥΛΠΡΙΔΗ)ΣΕ ΑΙΜΑ ΚΑΙ ΟΥΡΑ ΜΕ ΤΗ ΜΕΘΟΔΟ GC/MS  AΜΙΣΟΥΛΠΡΙΔΗ-ΜΗΧΑΝΙΣΜΟΣ ΔΡΑΣΗΣ ΔΗΜΟΚΡIΤΕΙΟ ΠΑΝΕΠΙΣΤHΜΙΟ ΘΡAΚΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ Μεταπτυχιακό Πρόγραμμα Σπουδών «Κλινική Φαρμακολογία και Θεραπευτική» " ΜΕΘΟΔΟΛΟΓΙΑ ΑΝΙΧΝΕΥΣΗΣ ΝΕΥΡΟΛΗΠΤΙΚΩΝ (ΑΜΙΣΟΥΛΠΡΙΔΗ)ΣΕ ΑΙΜΑ ΚΑΙ ΟΥΡΑ ΜΕ ΤΗ ΜΕΘΟΔΟ GC/MS

Διαβάστε περισσότερα

Εισαγωγή στη διαγνωστική έρευνα

Εισαγωγή στη διαγνωστική έρευνα DEPARTMENT OF HYGIENE AND EPIDEMIOLOGY Εισαγωγή στη διαγνωστική έρευνα Κώστας Τσιλίδης, ktsilidi@cc.uoi.gr http://users.uoi.gr/ktsilidi/teaching Ιωαννίδης: κεφάλαιο 3 Ahlbom: κεφάλαιο 3, 4 Guyatt: κεφάλαιο

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΕΡΕΥΝΗΤΙΚΕΣ ΕΦΑΡΜΟΓΕΣ ΤΗΣ ΚΥΤΤΑΡΟΜΕΤΡΙΑΣ ΡΟΗΣ

ΕΡΕΥΝΗΤΙΚΕΣ ΕΦΑΡΜΟΓΕΣ ΤΗΣ ΚΥΤΤΑΡΟΜΕΤΡΙΑΣ ΡΟΗΣ ΕΡΕΥΝΗΤΙΚΕΣ ΕΦΑΡΜΟΓΕΣ ΤΗΣ ΚΥΤΤΑΡΟΜΕΤΡΙΑΣ ΡΟΗΣ Σπυριδούλα Βασιλείου Βιολόγος, PhD Αιματολογική Κλινική-Μονάδα Μεταμόσχευσης Μυελού Οστών, Γ.Ν.Α. Κυτταρομετρία Ροής (ΚΡ): απαραίτητο εργαλείο

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΟ ΣΠΕΡΜΑΤΟΛΟΓΙΑΣ Γ. ΛΥΜΠΕΡΟΠΟΥΛΟΣ

ΕΡΓΑΣΤΗΡΙΟ ΣΠΕΡΜΑΤΟΛΟΓΙΑΣ Γ. ΛΥΜΠΕΡΟΠΟΥΛΟΣ ΕΡΓΑΣΤΗΡΙΟ ΣΠΕΡΜΑΤΟΛΟΓΙΑΣ Γ. ΛΥΜΠΕΡΟΠΟΥΛΟΣ Εφαρμογή σύγχρονων μεθόδων διάγνωσης των προβλημάτων στον τομέα της ανδρικής γονιμότητας Λεωφ. Κηφισίας 46 115 26 Αθήνα (2ος όροφος) Τηλ: 210 6452 172, 210 6400

Διαβάστε περισσότερα

Εργαλεία & Υλικά Διαλύματα Χρωστικές

Εργαλεία & Υλικά Διαλύματα Χρωστικές Ενότητα Ροή γενετικής πληροφορίας Φύλλο εργασίας 2 Απομόνωση νουκλεϊκών οξέων από φυτικά κύτταρα Βιολογία Γ Γυμνασίου Ονοματεπώνυμο Τμήμα Ημερομηνία. Τα νουκλεϊκά οξέα, όπως και οι πρωτεΐνες, είναι μακρομοριακές

Διαβάστε περισσότερα

ΠΑΡΑΣΙΤΑ ΝΕΑ ΔΕΔΟΜΕΝΑ. Ν. Βακάλης Εθνική Σχολή Δημόσιας Υγείας

ΠΑΡΑΣΙΤΑ ΝΕΑ ΔΕΔΟΜΕΝΑ. Ν. Βακάλης Εθνική Σχολή Δημόσιας Υγείας ΠΑΡΑΣΙΤΑ ΝΕΑ ΔΕΔΟΜΕΝΑ Ν. Βακάλης Εθνική Σχολή Δημόσιας Υγείας ΕΞΕΛΙΞΗ ΜΕΘΟΔΟΛΟΓΙΑΣ ΣΧΕΣΗ ΝΕΩΝ ΜΕΘΟΔΩΝ ΜΕ ΤΗ ΣΥΜΒΑΤΙΚΗ ΔΙΑΓΝΩΣΤΙΚΗ ΤΙ ΧΡΕΙΑΖΕΤΑΙ ΝΑ ΓΙΝΕΙ ΘΕΜΑΤΑ ΠΟΥ ΑΠΑΣΧΟΛΟΥΝ ΜΕΘΟΔΟΛΟΓΙΑ Συμβατική Παρασιτολογική

Διαβάστε περισσότερα

BIO111 Μικροβιολογια ιαλεξη 8 Κυτταρικη ιαιρεση

BIO111 Μικροβιολογια ιαλεξη 8 Κυτταρικη ιαιρεση BIO111 Μικροβιολογια ιαλεξη 8 Κυτταρικη ιαιρεση Τα χαρακτηριστικα της Ζωης Τα χαρακτηριστικα της Ζωης Περιεχοµενα 1. Πως κληρονοµείται η πληροφορία-aναδιπλασιασµός χρωµοσωµικού και πλασµιδιακού DNA. 2.

Διαβάστε περισσότερα

Πρόγραμμα εξειδίκευσης στη λοιμωξιολογία στη Γʹ Παιδιατρική Κλινική ΑΠΘ

Πρόγραμμα εξειδίκευσης στη λοιμωξιολογία στη Γʹ Παιδιατρική Κλινική ΑΠΘ 1 Πρόγραμμα εξειδίκευσης στη λοιμωξιολογία στη Γʹ Παιδιατρική Κλινική ΑΠΘ Υπεύθυνοι για την εκπαίδευση των εξειδικευομένων είναι οι: Εμμανουήλ Ροηλίδης, Καθηγητής Παιδιατρικής Λοιμωξιολογίας Χαράλαμπος

Διαβάστε περισσότερα

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: ΘΕΜΑ 1o 1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α. µόνο στο καθαρό νερό β. σε οποιοδήποτε υδατικό διάλυµα γ. µόνο σε

Διαβάστε περισσότερα

ΚΡΙΤΗΡΙΑ ΛΟΙΜΩΞΗΣ ΧΕΙΡΟΥΡΓΙΚΟΥ ΠΕΔΙΟΥ (SSI) ΠΝΕΥΜΟΝΙΑΣ (PN) Ρουμπελάκη Μαρία Νοσηλεύτρια PhD,καθηγήτρια ΤΕΙ Ηρακλείου

ΚΡΙΤΗΡΙΑ ΛΟΙΜΩΞΗΣ ΧΕΙΡΟΥΡΓΙΚΟΥ ΠΕΔΙΟΥ (SSI) ΠΝΕΥΜΟΝΙΑΣ (PN) Ρουμπελάκη Μαρία Νοσηλεύτρια PhD,καθηγήτρια ΤΕΙ Ηρακλείου ΚΡΙΤΗΡΙΑ ΛΟΙΜΩΞΗΣ ΧΕΙΡΟΥΡΓΙΚΟΥ ΠΕΔΙΟΥ (SSI) ΠΝΕΥΜΟΝΙΑΣ (PN) Ρουμπελάκη Μαρία Νοσηλεύτρια PhD,καθηγήτρια ΤΕΙ Ηρακλείου ΛΟΙΜΩΞΗ ΧΕΙΡΟΥΡΓΙΚΟΥ ΠΕΔΙΟΥ (SSI) Επιπολής (SSI S) Εν τω βάθει (SSI D) Οργάνου/Χώρου

Διαβάστε περισσότερα

ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ. 1.4. Να συμπληρώσετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις:

ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ. 1.4. Να συμπληρώσετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 30 ΜΑΪΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΟΛΟ ΣΕΛΙ

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 21/09/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Για το γονιδίωμα της γάτας

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ 2 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1 ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 23 ΜΑΪΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ

Διαβάστε περισσότερα

β. [Η 3 Ο + ] > 10-7 Μ γ. [ΟΗ _ ] < [Η 3 Ο + ]

β. [Η 3 Ο + ] > 10-7 Μ γ. [ΟΗ _ ] < [Η 3 Ο + ] ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ

Διαβάστε περισσότερα

ΣΥΛΛΟΓΗ ΜΕΤΑΦΟΡΑ ΚΑΤΑΛΛΗΛΟΤΗΤΑ ΒΙΟΛΟΓΙΚΩΝ ΔΕΙΓΜΑΤΩΝ ΓΙΑ ΑΝΑΕΡΟΒΙΑ ΚΑΛΛΙΕΡΓΕΙΑ

ΣΥΛΛΟΓΗ ΜΕΤΑΦΟΡΑ ΚΑΤΑΛΛΗΛΟΤΗΤΑ ΒΙΟΛΟΓΙΚΩΝ ΔΕΙΓΜΑΤΩΝ ΓΙΑ ΑΝΑΕΡΟΒΙΑ ΚΑΛΛΙΕΡΓΕΙΑ ΣΥΛΛΟΓΗ ΜΕΤΑΦΟΡΑ ΚΑΤΑΛΛΗΛΟΤΗΤΑ ΒΙΟΛΟΓΙΚΩΝ ΔΕΙΓΜΑΤΩΝ ΓΙΑ ΑΝΑΕΡΟΒΙΑ ΚΑΛΛΙΕΡΓΕΙΑ Π. ΓΙΑΝΝΟΠΟΥΛΟΥ ΒΙΟΠΑΘΟΛΟΓΟΣ Γ.Ν.Ε. «ΘΡΙΑΣΙΟ» ΑΝΑΕΡΟΒΙΑ ΚΑΛΛΙΕΡΓΕΙΑ Ειδικές ατμοσφαιρικές συνθήκες Ειδικά υλικά λήψης, μεταφοράς,

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΥ ΓΕΝΙΚΥ ΛΥΚΕΙΥ ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΥ 2013 ΕΞΕΤΑΖΜΕΝ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ-ΒΙΧΗΜΕΙΑ ΤΕΧΝΛΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΣ ΤΕΧΝΛΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΛ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

Δημήτριος Κουτσούρης, Καθηγητής ΕΜΠ Ηλιοπούλου Δήμητρα, Δρ. Βιοϊατρικής Τεχνολογίας, Ηλεκτρολόγος Μηχ. και Μηχ. Υπολογιστών, ΕΜΠ

Δημήτριος Κουτσούρης, Καθηγητής ΕΜΠ Ηλιοπούλου Δήμητρα, Δρ. Βιοϊατρικής Τεχνολογίας, Ηλεκτρολόγος Μηχ. και Μηχ. Υπολογιστών, ΕΜΠ Ο ΡΟΛΟΣ ΤΗΣ ΒΙΟΪΑΤΡΙΚΗΣ ΤΕΧΝΟΛΟΓΙΑΣ ΣΤΗΝ ΕΞΑΤΟΜΙΚΕΥΜΕΝΗ ΔΙΑΧΕΙΡΙΣΗ ΓΥΝΑΙΚΩΝ ΜΕ ΠΑΘΟΛΟΓΙΚΟ ΤΕΣΤ ΠΑΠΑΝΙΚΟΛΑΟΥ Δημήτριος Κουτσούρης, Καθηγητής ΕΜΠ Ηλιοπούλου Δήμητρα, Δρ. Βιοϊατρικής Τεχνολογίας, Ηλεκτρολόγος

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΧΕΙΡΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

ΤΟ ΕΡΓΑΣΤΗΡΙΟ ΚΛΙΝΙΚΗΣ ΒΙΟΧΗΜΕΙΑΣ στη σύγχρονη κλινικο-εργαστηριακή πράξη

ΤΟ ΕΡΓΑΣΤΗΡΙΟ ΚΛΙΝΙΚΗΣ ΒΙΟΧΗΜΕΙΑΣ στη σύγχρονη κλινικο-εργαστηριακή πράξη ΤΟ ΕΡΓΑΣΤΗΡΙΟ ΚΛΙΝΙΚΗΣ ΒΙΟΧΗΜΕΙΑΣ στη σύγχρονη κλινικο-εργαστηριακή πράξη ΜΑΡΙΑΝΝΑ Α. ΝΤΑΛΑΜΑΓΚΑ, ΜD, MSc, MPH, PhD ΙΑΤΡΟΣ ΒΙΟΠΑΘΟΛΟΓΟΣ ΕΠ. ΚΑΘΗΓΗΤΡΙΑ ΚΛΙΝΙΚΗΣ ΒΙΟΧΗΜΕΙΑΣ ΙΑΤΡΙΚΗΣ ΣΧΟΛΗΣ ΠΑΝΕΠΙΣΤΗΜΙΟΥ

Διαβάστε περισσότερα

ΑΠΕΙΚΟΝΙΣΗΣ ΤΩΝ ΟΓΚΩΝ

ΑΠΕΙΚΟΝΙΣΗΣ ΤΩΝ ΟΓΚΩΝ 2. ΜΕΤΑΒΟΛΙΚΟ ΜΟΝΤΕΛΟ ΑΠΕΙΚΟΝΙΣΗΣ ΤΩΝ ΟΓΚΩΝ Οι όγκοι χαρακτηρίζονται από πολλαπλές αλλαγές του μεταβολισμού. Η χαρακτηριστική μεταβολική λειτουργία μπορεί να μετρηθεί in vivo με τη βοήθεια ενός ραδιοσημασμένου

Διαβάστε περισσότερα

MYCOBACTERIUM INTRACELLULARE CULTURE IDENTIFICATION TEST (ΕΞΕΤΑΣΗ ΤΑΥΤΟΠΟΙΗΣΗΣ MYCOBACTERIUM INTRACELLULARE ΑΠΟ ΚΑΛΛΙΕΡΓΕΙΑ) (biomérieux ref.

MYCOBACTERIUM INTRACELLULARE CULTURE IDENTIFICATION TEST (ΕΞΕΤΑΣΗ ΤΑΥΤΟΠΟΙΗΣΗΣ MYCOBACTERIUM INTRACELLULARE ΑΠΟ ΚΑΛΛΙΕΡΓΕΙΑ) (biomérieux ref. MYCOBACTERIUM INTRACELLULARE CULTURE IDENTIFICATION TEST (ΕΞΕΤΑΣΗ ΤΑΥΤΟΠΟΙΗΣΗΣ MYCOBACTERIUM INTRACELLULARE ΑΠΟ ΚΑΛΛΙΕΡΓΕΙΑ) (biomérieux ref. 39004 / Gen-Probe Cat. No. 102840/2840) Page 1 of 9 MYCOBACTERIUM

Διαβάστε περισσότερα

ΠΡΟΣΚΛΗΣΗ ΕΝΔΙΑΦΕΡΟΝΤΟΣ KAI ΚΑΤΑΘΕΣΗΣ ΠΡΟΣΦΟΡΩΝ ΓΙΑ ΤΗΝ ΠΡΟΜΗΘΕΙΑ ΑΝΑΛΩΣΙΜΩΝ: «Προμήθεια αναλωσίμων εργαστηρίου»

ΠΡΟΣΚΛΗΣΗ ΕΝΔΙΑΦΕΡΟΝΤΟΣ KAI ΚΑΤΑΘΕΣΗΣ ΠΡΟΣΦΟΡΩΝ ΓΙΑ ΤΗΝ ΠΡΟΜΗΘΕΙΑ ΑΝΑΛΩΣΙΜΩΝ: «Προμήθεια αναλωσίμων εργαστηρίου» ΕΘΝΙΚΟ ΚΕΝΤΡΟ ΕΡΕΥΝΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΑΝΑΠΤΥΞΗΣ (Ε.Κ.Ε.Τ.Α.) ΙΝΣΤΙΤΟΥΤΟ ΕΡΕΥΝΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΘΕΣΣΑΛΙΑΣ (ΙΕΤΕΘ) Τομέας Κινησιολογίας Δημητριάδος 95& Π. Μελά 3ος όροφος Τ.Κ. 38333 Βόλος ΠΡΟΣΚΛΗΣΗ ΕΝΔΙΑΦΕΡΟΝΤΟΣ

Διαβάστε περισσότερα

ΠΙΝΑΚΑΣ : "ΠΡΟΤΕΙΝΟΜΕΝΟ ΒΙΟΛΟΓΙΚΟ ΕΙΓΜΑ ΑΝΑ ΕΞΕΤΑΣΗ"

ΠΙΝΑΚΑΣ : ΠΡΟΤΕΙΝΟΜΕΝΟ ΒΙΟΛΟΓΙΚΟ ΕΙΓΜΑ ΑΝΑ ΕΞΕΤΑΣΗ ΠΙΝΑΚΑΣ : "ΠΡΟΤΕΙΝΟΜΕΝΟ ΒΙΟΛΟΓΙΚΟ ΕΙΓΜΑ ΑΝΑ ΕΞΕΤΑΣΗ" Παθογόνο/Συντομογραφία Μέθοδος 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Parecho-ιοί RNA Αδενοϊοί DNA Αδενοϊοί IgG Αδενοϊοί

Διαβάστε περισσότερα