Αρχές PCR και υβριδισμού. Ιωσήφ Παπαπαρασκευάς Βιοπαθολόγος, Λέκτορας ΕΚΠΑ Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Αθηνών

Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Αρχές PCR και υβριδισμού. Ιωσήφ Παπαπαρασκευάς Βιοπαθολόγος, Λέκτορας ΕΚΠΑ Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Αθηνών ipapapar@med.uoa."


1 Αρχές PCR και υβριδισμού Ιωσήφ Παπαπαρασκευάς Βιοπαθολόγος, Λέκτορας ΕΚΠΑ Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Αθηνών

2 Ιστορικά στοιχεία Πρώτη αναφορά in vitro ενζυματικής αντίδρασης για την κατασκευή νουκλεοτιδικής αλληλουχίας Kleppe et al, J Mol Biol, 1971 Πρώτη αναλυτική παρουσίαση της τεχνικής της PCR Saiki and Mullis, Science, 1985 Πρώτες άμεσες εφαρμογές της τεχνικής Saiki and Mullis, Science, 1987 Mullis and Faloona, Methods Enzymol, 1987 Mullis, Sci Amer, 1990 Σήμερα η PCR πλέον έχει αυτοματοποιηθεί και εισαχθεί στην καθημερινή ιατρική διαγνωστική πρακτική

3 ομή της παρουσίασης Περιγραφή της τεχνικής της PCR Περιγραφή της ηλεκτροφόρησης του DNA Συζήτηση ορισμένων βασικών παραμέτρων που επηρεάζουν το αποτέλεσμα της αντίδρασης Η επιλογή του DNA στόχου (αναλυτική ευαισθησία) Η επιλογή και επεξεργασία του κλινικού δείγματος (διαγνωστική ευαισθησία) Η αξία του θετικού ή αρνητικού αποτελέσματος (θετική - αρνητική προγνωστική αξία) Η οπτικοποίηση του αποτελέσματος (αναλυτική ευαισθησία) Τα ψευδώς θετικά αποτελέσματα (επιμόλυνση) Τα ψευδώς αρνητικά αποτελέσματα (αναστολή)

4 ιαδικασία της PCR Περιγραφή της τεχνικής της PCR Περιγραφή της ηλεκτροφόρησης των προϊόντων

5 Αναλυτική ευαισθησία της μεθόδου Η αναλυτική ευαισθησία της μεθόδου, δηλ. το όριο της ποσότητας του DNA (ή της ποσότητας των βακτηριακών κυττάρων) που απαιτείται για να είναι θετική η αντίδραση, εξαρτάται από: Αριθμός των σταδίων (ενός σταδίου ή εμφωλεάζουσα) Ύπαρξη και ποσότητα του DNA στόχου στα στελέχη Οπτικοποίηση αποτελέσματος (αγαρόζη, ιχνηθέτης, Real Time)

6 ιάγνωση της φυματίωσης Αναλυτική ευαισθησία μεθόδων Ευαισθησία οξεάντοχης χρώσης: ~ βακτήρια/ml Ευαισθησία καλλιέργειας: βακτήρια/ml Ευαισθησία PCR ποικίλει

7 Αναλυτική ευαισθησία μεθόδου Η επιλογή στόχου με πολλαπλά αντίγραφα M. tuberculosis complex: ~ 5-20 αντίγραφα IS6110 Όμως έως 5% στελεχών M. tuberculosis :0-4αντίγραφα Έως 5% ασθενών με φυματίωση κ/α (+) και PCR (-) Αλλά και στους λοιπούς 95% η αναλυτική ευαισθησία ποικίλει σε μεγάλο βαθμό, ανάλογα με τον αριθμό των αντιγράφων του DNA στόχου στο στέλεχος

8 Αναλυτική ευαισθησία μεθόδου Η μέθοδος ανίχνευσης του αποτελέσματος Συμβατική PCR ενός σταδίου με ανίχνευση των προϊόντων: Οπτικά σε gel αγαρόζης Αύξηση της αναλυτικής ευαισθησίας Οπτικά με υβριδισμό και σημασμένο ιχνηθέτη Φωτομετρικά με ELISA Ραδιομετρικά Συμβατική PCR δύο σταδίων (nested) με ανίχνευση των προϊόντων: Οπτικά σε gel αγαρόζης Οπτικά με υβριδισμό και σημασμένο ιχνηθέτη Φωτομετρικά με ELISA Ραδιομετρικά Real-Time PCR με ανίχνευση των προϊόντων φωτομετρικά (CCD camera) με σημασμένο ιχνηθέτη (TaqMan probe ή molecular beacon)

9 Συμβατική PCR με οπτικοποίηση σε gel αγαρόζης Πρωτόκολλο ενός σταδίου Εκκινητές για το IS6110 Aναλυτική ευαισθησία 180 fg DNA ~ 40 βακτηριακά κύτταρα Ποσοτική Real-Time PCR Πρωτόκολλο ενός σταδίου Εκκινητές και molecular beacon για το IS6110 Aναλυτική ευαισθησία 45 fg DNA ~ 10 βακτηριακά κύτταρα Papaparaskevas et al, J Clin Microbiol, 2008

10 ιάγνωση φυματίωσης Συμβατική μικροβιολογία Οξεάντοχη χρώση Ziehl-Neelsen Χρώση Ροδαμίνης Αουραμίνης Mycobacterium tuberculosis Καλλιέργεια σε Lowenstein-Jensen 24 ημέρες, 36 ο C, 5% CO 2 Αρχείο Εργαστηρίου Μικροβιολογίας ΓΝΑ Λαϊκό

11 Η επιλογή του κλινικού δείγματος Η συσχέτιση μεταξύ της αναλυτικής ευαισθησίας και της διαγνωστικής ευαισθησίας (ικανότητας της αντίδρασης να δίνει θετικό αποτέλεσμα στα θετικά δείγματα) Η κλινική σημαντικότητα του θετικού αποτελέσματος

12 Η πιθανότητα του αρνητικού αποτελέσματος σε δείγματα με χαμηλή συγκέντρωση στόχου Κανόνας του Poison για την ομοιογενή κατανομή του στόχου στο διάλυμα του κλινικού δείγματος P N =C N /Nxe c Σε ένα διάλυμα δείγματος 1 ml (1.000 μl) με χαμηλό αριθμό βακτηριακού φορτίου, η πιθανότητα 100 τυχαία μl του δείγματος να έχουν την ίδια ακριβώς συγκέντρωση στόχου με 100 άλλα τυχαία μl είναι εξαιρετικά μικρή Χαμηλή ευαισθησία και επαναληψιμότητα Greenfield and White, Mayo Foundation, 1993

13 Η πιθανότητα του αρνητικού αποτελέσματος σε δείγματα με χαμηλή συγκέντρωση στόχου Greenfield and White, Mayo Foundation, 1993

14 Βελτιστοποίηση της τεχνικής σε δείγματα με χαμηλή συγκέντρωση στόχου Εμπλουτισμός του δείγματος κατά την διάρκεια της κατεργασίας Φυγοκέντρηση Απομάκρυνση περιττών στοιχείων Κατεργασία μεγαλύτερης ποσότητας δείγματος Λήψη πολλαπλών δειγμάτων

15 Βελτιστοποίηση της τεχνικής σε δείγματα με χαμηλή συγκέντρωση στόχου Αύξηση της ποσότητας του δείγματος για κατεργασία αύξηση της τελικής συγκέντρωσης του ευκαρυωτικού DNA (Αιματηρά πτύελα: 14 μg ευκαρυωτικό DNA/ml πτυέλων) Χρυσή τομή μεταξύ αύξησης της ποσότητας του δείγματος και εξαφάνισης του DNA στόχου μέσα σε τεράστιες ποσότητες ευκαρυωτικού DNA (Αύξηση της πιθανότητας μη ειδικών υβριδισμών απώλεια ευαισθησίας) Greenfield and White, Mayo Foundation, 1993

16 Η επιλογή του κλινικού δείγματος ιάγνωση C. pneumoniae Το κλινικό δείγμα μπορεί να είναι πτύελα, BAL,φαρυγγικό έκπλυμα, κλπ. Το κλινικό δείγμα (ανάλογα με τον τρόπο λήψης) μπορεί να έχει ποικίλου βαθμού φυσιολογική χλωρίδα Ποια είναι η κλινική σημαντικότητα του θετικού αποτελέσματος; Το θετικό αποτέλεσμα της μεθόδου σημαίνει ότι ανευρέθηκε το αίτιο της λοίμωξης;

17 Η επιλογή του κλινικού δείγματος ιάγνωση C. pneumoniae Ποιο είναι το βέλτιστο κλινικό δείγμα? Κατάλληλα κατά Bartlet πτύελα ή βρογχοκυψελιδικό έκπλυμα Συνηθέστερα χρησιμοποιούμενο δείγμα Πτωχό σε ευκαρυωτικά κύτταρα χαμηλότερη ευαισθησία Εξασφαλίζει κλινική σημαντικότητα υψηλότερη ειδικότητα και προγνωστική αξία Φαρυγγικό επίχρισμα ή φαρυγγικό έκπλυμα Σπανιότερα χρησιμοποιούμενο δείγμα Πλούσιο σε ευκαρυωτικά κύτταρα υψηλότερη ευαισθησία εν εξασφαλίζει κλινική σημαντικότητα χαμηλότερη ειδικότητα και προγνωστική αξία

18 Η επιλογή του κλινικού δείγματος ιάγνωση C. pneumoniae Το θετικό δείγμα εξασφαλίζει την διάγνωση? Σε δείγματα κατώτερου αναπνευστικού συνήθως ναι Σε δείγματα ανώτερου αναπνευστικού??? Έως 10% αποικισμός στοματοφάρυγγα από C. pneumoniae, ιδίως σε ΧΑΠ (persistent carriers, chronic infections) SF Dowell et al, Clin Infect Dis, 2001

19 Η επιλογή του κλινικού δείγματος Η PCR διαχωρίζει δυσκολότερα, σε σχέση με την καλλιέργεια, το πραγματικό παθογόνο από την χλωρίδα ή την επιμόλυνση. SF Dowell et al, Clin Infect Dis, 2001

20 Κλινικά δείγματα για PCR Ολικό αίμα ή λευκοκύτταρα (προτιμότερο EDTA από ηπαρίνη) Όταν ο μικροοργανισμός είναι ενδοκυττάριος Ορός ή πλάσμα Όταν ο μικροοργανισμός είναι εξωκυττάριος Πτύελα, ούρα, ΕΝΥ, βιολογικά υγρά Κόπρανα (τα πλέον δύσκολα δείγματα)

21 Μέθοδοι λήψης του DNA Αδρές μέθοδοι καταστροφής του κυττάρου Βρασμός Γυάλινα σφαιρίδια Μέθοδοι διαχωρισμού και εκχύλισης DNA Φαινόλη-Χλωροφόρμιο Χαοτροπικές ενώσεις (γουανιδίνη Μέθοδος Boom) Μαγνητικά σφαιρίδια Στήλες με ηθμό Αυτοματοποίηση

22 Μέθοδοι λήψης του DNA Αδρές μέθοδοι καταστροφής του κυττάρου ιάλυμα από συγκρίματα κυτταροπλάσματος και κυτταρικού τοιχώματος, DNA (διπλόκλωνο, μονόκλωνο και θραύσματα), πρωτεΐνες κλπ. Αδρή, φθηνή μέθοδος, με χαμηλό ποιοτικά αποτέλεσμα Μέθοδοι διαχωρισμού και εκχύλισης DNA Καθαρό DNA που μπορεί να φυλαχθεί για μεγάλο χρονικό διάστημα Πιο ακριβή μέθοδος, με υψηλής ποιότητας παραγόμενο DNA

23 Το ψευδώς θετικό αποτέλεσμα Μη ειδικός υβριδισμός Μη προτυποποιημένο πρωτόκολλο Μέθοδος λήψης του DNA Μεγάλη συγκέντρωση ευκαρυωτικού DNA Θετικό - αμφιλεγόμενο Μη ειδικό Επιμόλυνση με προϊόντα πολλαπλασιασμού Κακή εργαστηριακή πρακτική. Τελικά προϊόντα που βρίσκονται σε μεγάλη συγκέντρωση στο περιβάλλον του εργαστηρίου επιμολύνουν τα αρχικά στάδια εκχύλισης DNA και προετοιμασίας του χημικού μίγματος Ψευδώς θετικό δυνατό σήμα

24 Το ψευδώς θετικό αποτέλεσμα Η εργαστηριακή πρακτική Εξαιρετικά μεγάλη σημασία η σωστή εργονομία και η αυστηρή αλληλουχία των βημάτων της πρακτικής Προετοιμασία του χημικού μίγματος (καθαρό δωμάτιο) Προσθήκη DNA (δωμάτιο προσθήκης DNA) Αντίδραση PCR (δωμάτιο PCR) Ηλεκτροφόρηση προϊόντος PCR (δωμάτιο PCR) Η εκχύλιση του DNA ιδανικά θα πρέπει να γίνεται σε τέταρτο χώρο Η αλληλουχία των βημάτων αυστηρά προς μια κατεύθυνση Συχνή χρήση UV ακτινοβολίας και διαλύματος χλωρίου

25 Η απενεργοποίηση του προϊόντος πολ/σμού Χρήση UNG+dUTP αφορά τη συγκεκριμένη αντίδραση κάθε φορά UV ακτινοβολία ή/και διάλυμα χλωρίου αφορά το περιβάλλον Persing and Chimino, Mayo Foundation, 1993

26 Η απενεργοποίηση του προϊόντος πολ/σμού Χρήση UNG και dutp Αρχή της μεθόδου: χρήση του ενζύμου UNG (uracil-nglycosilase) ένζυμο επισκευής του DNA που υδρολύει τον δεσμό του dutp και αντικαθιστά την ουρακίλη που σποραδικά μπορεί in vivo να ενσωματώνεται στο διπλόκλωνο DNA. Ta νουκλεοτίδια: datp, dctp, dgtp, dttp (A-T, C-G) Συνεχής χρήση dutp αντί για dttp Τα προϊόντα πολ/σμού έχουν νουκλεοτιδική αλληλουχία με dutp Στην αντίδραση της PCR προσθήκη UNG υδρόλυση τμημάτων DNA με dutp (επιμολύνοντα amplicons), αλλά όχι τμημάτων DNA με dttp (DNA στόχος) Μειονέκτημα: Ελάττωση της ευαισθησίας της αντίδρασης Greenfield and White, Mayo Foundation, 1993

27 Το ψευδώς αρνητικό αποτέλεσμα Μικρή συγκέντρωση στόχου, κάτωαπότοόριοτηςαναλυτικής ευαισθησίας Αναστολή της ενζυματικής αντίδρασης

28 Το ψευδώς αρνητικό αποτέλεσμα Αναστολή της αντίδρασης Φυσικές ουσίες Αιμίνη Πολυσακχαρίτες Χημικά αντιδραστήρια Ηπαρίνη, EDTA, SDS Χαοτροπικά μόρια (guanidinium HCl)

29 Το ψευδώς αρνητικό αποτέλεσμα Αναστολή της αντίδρασης Κλινικά δείγματα που πιθανά περιέχουν αναστολείς Αίμα και αιματηρά βιολογικά υγρά Ούρα Πτύελα

30 Το ψευδώς αρνητικό αποτέλεσμα Αναστολή της αντίδρασης Έλεγχος αναστολής Επανάληψη της αντίδρασης του συγκεκριμένου δείγματος μετά από προσθήκη μικρής ποσότητας DNA απότοθετικόcontrol Εάν το αποτέλεσμα εξακολουθεί να είναι αρνητικό, τότε ισχυρή πιθανότητα αναστολής Βασική παράμετρος για την αναστολή η μέθοδος εκχύλισης DNA Στις μεθόδους εκχύλισης του DNA με στήλες με ηθμό ή με μαγνητικά σφαιρίδια, μικρότερη η πιθανότητα. Οι αναστολείς κατακρατούνται από τον ηθμό.

31 Αντί συμπερασμάτων Η PCR και οι άλλες τεχνικές της μοριακής μικροβιολογίας έχουν πλέον καθιερωθεί στο κλινικό εργαστήριο Όμως υπάρχουν όρια στην εφαρμογή τους και κανόνες που πρέπει να γίνονται σεβαστοί εν φαίνεται στο άμεσο μέλλον συμβατικές τεχνικές, όπως η καλλιέργεια και η δοκιμασία ευαισθησίας, να μπορέσουν να αντικατασταθούν πλήρως από μοριακές τεχνικές Το πιθανότερο είναι ότι η συμβατική και η μοριακή μικροβιολογία θα δρουν συμπληρωματικά η μια της άλλης για μεγάλο χρονικό διάστημα ακόμη

32 Ευχαριστώ για την προσοχή σας


ΕΡΜΗΝΕΙΑ ΙΟΛΟΓΙΚΩΝ ΙΑΓΝΩΣΤΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΡΜΗΝΕΙΑ ΙΟΛΟΓΙΚΩΝ ΙΑΓΝΩΣΤΙΚΩΝ ΕΞΕΤΑΣΕΩΝ Dr Α. Μεντής, Ιατρός Βιοπαθολόγος, Κλινικός Μικροβιολόγος ιευθυντής ιαγνωστικού Τμήματος ιευθυντής Εργαστηρίου Ιατρικής Μικροβιολογίας ιευθυντής Εθνικού Εργαστηρίου

Διαβάστε περισσότερα

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία της Δημόσιας Υγείας Α. Βανταράκης Εργαστήριο Υγιεινής, Ιατρική Σχολή,

Διαβάστε περισσότερα

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Chain Reaction (pcr)- Αλυσιδωτή αντίδραση πολυμεράσης.η

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΟ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ. Ιατρική Σχολή Πανεπιστημίου Θεσσαλίας

ΕΡΓΑΣΤΗΡΙΟ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ. Ιατρική Σχολή Πανεπιστημίου Θεσσαλίας ΕΡΓΑΣΤΗΡΙΟ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ Ιατρική Σχολή Πανεπιστημίου Θεσσαλίας Ε. ΠΕΤΕΙΝΑΚΗ Aναπληρώτρια Καθηγήτρια Μικροβιολογίας Διευθύντρια Εργαστηρίου Μικροβιολογίας ΜΙΚΡΟΒΙΟΛΟΓΙΑ φάση της κλινικής ιατρικής Η μικροβιολογία

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Δ. Ιακωβίδης. Πνευμονολόγος Aν. Διευθυντής Μονάδα επεμβατικής Πνευμονολογίας Γ.Π.Ν. «Γ. Παπανικολάου

Δ. Ιακωβίδης. Πνευμονολόγος Aν. Διευθυντής Μονάδα επεμβατικής Πνευμονολογίας Γ.Π.Ν. «Γ. Παπανικολάου Δ. Ιακωβίδης Πνευμονολόγος Aν. Διευθυντής Μονάδα επεμβατικής Πνευμονολογίας Γ.Π.Ν. «Γ. Παπανικολάου Νέα διαγνωστικά μέσα για τη λανθάνουσα φυματίωση Η στοχευμένη δοκιμασία δερματικής φυματινοαντίδρασης

Διαβάστε περισσότερα

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης ΕΙΣΑΓΩΓΗ Σύμφωνα με την ΠΟΥ το 1/3 περίπου του παγκόσμιου πληθυσμού είναι μολυσμένο

Διαβάστε περισσότερα

Εργαστηριακή Διάγνωση της HIV λοίμωξης. Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ

Εργαστηριακή Διάγνωση της HIV λοίμωξης. Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ Εργαστηριακή Διάγνωση της HIV λοίμωξης Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ Διάγνωση της HIV λοίμωξης Από το 1985 και μέχρι σήμερα η διαγνωστική διαδικασία

Διαβάστε περισσότερα

Αρχές Πειραματικής. Έρευνας


Διαβάστε περισσότερα

Βασικές αρχές Ιατρικής Μικροβιολογίας

Βασικές αρχές Ιατρικής Μικροβιολογίας Σελίδες 1 έως 5 ΕΞΕΤΑΣΤΕΑ ΥΛΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ Για τους φοιτητές Β εξαμήνου ΦΑΡΜΑΚΕΥΤΙΚΟΥ ΤΜΗΜΑΤΟΣ Παν/κό έτος 2011-2012 Ύλη αποτελεί η θεματολογία των μαθημάτων (αμφιθεάτρου, εργαστηρίων, φροντιστηρίων)

Διαβάστε περισσότερα

ΠΡΟΔΙΑΓΡΑΦΕΣ ΓΡΗΓΟΡΩΝ ΤΕΣΤ. C. difficile GDH / Toxin A / Toxin B

ΠΡΟΔΙΑΓΡΑΦΕΣ ΓΡΗΓΟΡΩΝ ΤΕΣΤ. C. difficile GDH / Toxin A / Toxin B ΠΡΟΔΙΑΓΡΑΦΕΣ ΓΡΗΓΟΡΩΝ ΤΕΣΤ C. difficile GDH / Toxin A / Toxin B Πλήρες κιτ ανοσοχρωματογραφίας ενός βήματος για την ταυτόχρονη ποιοτική ανίχνευση και διαφοροποίηση των GDH / Toxin A / Toxin B του C. Difficile

Διαβάστε περισσότερα

4 ο Πανελλήνιο Συμπόσιο Φυματίωσης Εταιρεία Μελέτης Πνευμονοπαθειών και Επαγγελματικών Παθήσεων Θώρακος Σάββατο 19 Μαρτίου 2011

4 ο Πανελλήνιο Συμπόσιο Φυματίωσης Εταιρεία Μελέτης Πνευμονοπαθειών και Επαγγελματικών Παθήσεων Θώρακος Σάββατο 19 Μαρτίου 2011 4 ο Πανελλήνιο Συμπόσιο Φυματίωσης Εταιρεία Μελέτης Πνευμονοπαθειών και Επαγγελματικών Παθήσεων Θώρακος Σάββατο 19 Μαρτίου 2011 ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΕΡΕΥΝΗΣΗ ΤΗΣ ΦΥΜΑΤΙΩΣΗΣ ΜΙΚΡΟΒΙΟΛΟΓΙΚΟ ΕΡΓΑΣΤΗΡΙΟ Γ.Ν.Θ «Γ.

Διαβάστε περισσότερα


ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ Η συµβολή της µοριακής ανάλυσης Eλισάβετ Οικονοµάκη Βιολόγος Αιµοπαθολογοανατοµικό Εργαστήριο ΠΓΝΑ > ΜΟΡΙΑΚΕΣ ΜΕΘΟ ΟΙ (Μη µορφολογικές) Αλυσιδωτή Αντίδραση Πολυµεράσης

Διαβάστε περισσότερα

Προϋποθέσεις εφαρμογής των μοριακών τεχνικών

Προϋποθέσεις εφαρμογής των μοριακών τεχνικών Προϋποθέσεις εφαρμογής των μοριακών τεχνικών Α. Μεντής ιαγνωστικό Εργαστήριο Λοιμωδών Νοσημάτων Εθνικό Εργαστήριο Αναφοράς Γρίπης Νοτίου Ελλάδος Εθνικό Εργαστήριο Αναφοράς Ερυθράς/Ιλαράς Ελλάδος, Εθνικό

Διαβάστε περισσότερα


Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp.

Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp. Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp. 5 ο Πανελλήνιο Συνέδριο Ιατρικής Βιοπαθολογίας Η εφαρμογή μοριακών

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΤΕΙΘ Β ΕΞΑΜΗΝΟ Πεδίο Β2-Μοριακή προ- και μετα-γεννητική διάγνωση ασθενειών Συμμετρίες και μοριακή θερμοδυναμική βιομορίων

ΑΤΕΙΘ Β ΕΞΑΜΗΝΟ Πεδίο Β2-Μοριακή προ- και μετα-γεννητική διάγνωση ασθενειών Συμμετρίες και μοριακή θερμοδυναμική βιομορίων ΑΤΕΙΘ Β ΕΞΑΜΗΝΟ 15/10/2015 Πέμπτη ( Ηλεκτρονικά) 16.00 18.00 Πεδίο Β2-Μοριακή προ- και μετα-γεννητική διάγνωση ασθενειών Συμμετρίες και μοριακή θερμοδυναμική βιομορίων Γενική επισκόπηση μεθόδων που χρησιμοποιούνται

Διαβάστε περισσότερα

Reagent Β: n º 1 φιαλίδιο x 5 ml.υγρό αντιδραστήριο, έτοιμο προς χρήση.

Reagent Β: n º 1 φιαλίδιο x 5 ml.υγρό αντιδραστήριο, έτοιμο προς χρήση. -Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ ΠΡΟΟΡΙΖΟΜΕΝΗ ΧΡΗΣΗ Διαγνωστική ανοσονεφελομετρική εξέταση για τον ποσοτικό προσδιορισμό των αντισωμάτων της Ανοσοσφαιρίνης G ( IGG ) σε ανθρώπινο ΕΝΥ με

Διαβάστε περισσότερα


ΒΑΣΙΚΕΣ ΕΝΝΟΙΕΣ ΣΤΗΝ ΕΝΟΡΓΑΝΗ ΑΝΑΛΥΣΗ ΒΑΣΙΚΕΣ ΕΝΝΟΙΕΣ ΣΤΗΝ ΕΝΟΡΓΑΝΗ ΑΝΑΛΥΣΗ Αναλυτική Μέθοδος- Αναλυτικό Πρόβλημα. Ανάλυση, Προσδιορισμός και Μέτρηση. Πρωτόκολλο. Ευαισθησία Μεθόδου. Εκλεκτικότητα. Όριο ανίχνευσης (limit of detection, LOD).

Διαβάστε περισσότερα

Μέθοδοι Ανίχνευσης Αντιγόνων Αντισωμάτων

Μέθοδοι Ανίχνευσης Αντιγόνων Αντισωμάτων Μέθοδοι Ανίχνευσης Αντιγόνων Αντισωμάτων Νεφελομετρία Ανοσοφθορισμός ΝΕΦΕΛΟΜΕΤΡΙΑ Πρόκειται για μέθοδο συγκέντρωσης διάφορων ουσιών στα βιολογικά υγρά κυρίως πρωτεΐνες που αντιδρούν με αντισώματα σχηματίζοντας

Διαβάστε περισσότερα


ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ Μανδηλαρά Γεωργία Βιολόγος PhD, Επιστημονικός Συνεργάτης Εθνική Σχολή Δημόσιας Υγείας Τμήμα Μικροβιολογίας Υδατογενείς λοιμώξεις: χρήση νερού

Διαβάστε περισσότερα

-Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ

-Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ -Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ ΠΡΟΟΡΙΖΟΜΕΝΗ ΧΡΗΣΗ Διαγνωστική ανοσονεφελομετρική εξέταση για τον ποσοτικό προσδιορισμό του Συμπληρώματος C4 ( C4 ) σε ανθρώπινο ορό ή πλάσμα με το σύστημα

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΤΟΥ ΓΕΝΟΥΣ ΤΩΝ ΜΥΚΟΒΑΚΤΗΡΙΔΙΩΝ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΤΟΥ ΓΕΝΟΥΣ ΤΩΝ ΜΥΚΟΒΑΚΤΗΡΙΔΙΩΝ Γένος Μycobacterium (G+C 60-70% DNA) Μέγεθος:0.2-0.6 * 1-10 μm Αερόβιο, μη-κινητό,δεν σχηματίζει σπόρια. Ανθίστανται στον αποχρωματισμό από οξέα-αλκοόλη Θεωρούνται

Διαβάστε περισσότερα



Διαβάστε περισσότερα


Η ΑΝΑΓΚΗ ΓΙΑ ΠΟΣΟΤΙΚΟΠΟΙΗΣΗ ΣΤΗΝ ΕΝΟΡΓΑΝΗ ΑΝΑΛΥΣΗ Η ΑΝΑΓΚΗ ΓΙΑ ΠΟΣΟΤΙΚΟΠΟΙΗΣΗ ΣΤΗΝ ΕΝΟΡΓΑΝΗ ΑΝΑΛΥΣΗ Οι Ενόργανες Μέθοδοι Ανάλυσης είναι σχετικές μέθοδοι και σχεδόν στο σύνολο τους παρέχουν την αριθμητική τιμή μιας φυσικής ή φυσικοχημικής ιδιότητας, η

Διαβάστε περισσότερα

Reagent Β: n º 1 φιαλίδιο x 5 ml.υγρό αντιδραστήριο, έτοιμο προς χρήση.

Reagent Β: n º 1 φιαλίδιο x 5 ml.υγρό αντιδραστήριο, έτοιμο προς χρήση. -Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ ΠΡΟΟΡΙΖΟΜΕΝΗ ΧΡΗΣΗ Διαγνωστική ανοσονεφελομετρική εξέταση για τον ποσοτικό προσδιορισμό Συμπληρώματος ( C3 ) σε ανθρώπινο ορό ή πλάσμα με το σύστημα EasyNeph.

Διαβάστε περισσότερα


ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΕΛΕΥΘΕΡΩΝ ΕΛΑΦΡΩΝ ΑΛΥΣΕΩΝ ΣΤΟΝ ΟΡΟ ΚΑΙ ΣΤΑ ΟΥΡΑ. Χρυσούλα Νικολάου ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΕΛΕΥΘΕΡΩΝ ΕΛΑΦΡΩΝ ΑΛΥΣΕΩΝ ΣΤΟΝ ΟΡΟ ΚΑΙ ΣΤΑ ΟΥΡΑ Χρυσούλα Νικολάου Μονοκλωνικές ελεύθερες ελαφρές αλύσεις Οι μονοκλωνικές ελεύθερες ελαφρές αλύσεις οι οποίες είναι γνωστές ως πρωτεΐνη Bence

Διαβάστε περισσότερα

Κατάλληλη επεξεργασία FNA μαστού σε υγρή μορφή προς μικροσκόπιση

Κατάλληλη επεξεργασία FNA μαστού σε υγρή μορφή προς μικροσκόπιση ΤΕΙ ΑΘΗΝΑΣ ΣΧΟΛΗ ΕΠΑΓΓΕΛΜΑΤΩΝ ΥΓΕΙΑΣ ΚΑΙ ΠΡΟΝΟΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΩΝ ΕΡΓΑΣΗΡΙΩΝ Κατάλληλη επεξεργασία FNA μαστού σε υγρή μορφή προς μικροσκόπιση Εργαστήριο κυτταρολογικό στο ΓΝΑ ΛΑΙΚΟ Ιωάννα Χαραλάμπους Α.Μ

Διαβάστε περισσότερα


ΗΛΕΚΤΡΟΦΟΡΗΣΗ ΠΡΩΤΕΙΝΩΝ ΗΛΕΚΤΡΟΦΟΡΗΣΗ ΠΡΩΤΕΙΝΩΝ Άννα-Μαρία Ψαρρά ΤΒΒ, Παν/μιο Θεσσαλίας Λάρισα 2015 ΗΛΕΚΤΡΟΦΟΡΗΣΗ Αναλυτικός τρόπος διαχωρισμού πρωτεϊνών και άλλων μακρομορίων όπως πρωτεϊνών DNA, RNA Αρχή της μεθόδου Μόρια που

Διαβάστε περισσότερα


ΕΝΟΤΗΤΑ Α ΑΝΑΛΥΤΗΣ ΓΙΑ ΑΝΟΣΟΧΗΜΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΜΕ ΤΗ ΜΕΘΟΔΟ ΤΗΣ ΧΗΜΕΙΟΦΩΤΑΥΓΕΙΑΣ ΕΝΟΤΗΤΑ Α ΑΝΑΛΥΤΗΣ ΓΙΑ ΑΝΟΣΟΧΗΜΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΜΕ ΤΗ ΜΕΘΟΔΟ ΤΗΣ ΧΗΜΕΙΟΦΩΤΑΥΓΕΙΑΣ Τεχνικές προδιαγραφές Αυτόματου Ανοσοχημικού αναλυτή με την μέθοδο της χημειοφωταύγειας 1. Ο Αναλυτής να είναι τυχαίας (random),

Διαβάστε περισσότερα

ΕΡΓΑΣΙΕΣ ΜΕ ΔΙΑΛΥΜΑΤΑ Γραμμομοριακή συγκέντρωση διαλυμάτων

ΕΡΓΑΣΙΕΣ ΜΕ ΔΙΑΛΥΜΑΤΑ Γραμμομοριακή συγκέντρωση διαλυμάτων ΕΡΓΑΣΙΕΣ ΜΕ ΔΙΑΛΥΜΑΤΑ Γραμμομοριακή συγκέντρωση διαλυμάτων Συγκέντρωση διαλύματος: ποσότητα διαλυμένης ουσίας σε καθορισμένη ποσότητα διαλύματος Αραιό διάλυμα: μικρή συγκέντρωση διαλυμένης ουσίας Πυκνό

Διαβάστε περισσότερα

Ορισμός Αναλυτικής Χημείας

Ορισμός Αναλυτικής Χημείας Ορισμός Αναλυτικής Χημείας Αναλυτική Χημεία ορίζεται ως ο επιστημονικός κλάδος, που αναπτύσσει και εφαρμόζει μεθόδους, όργανα και στρατηγικές, για να δώσει πληροφορίες σχετικά με τη σύσταση και φύση υλικών

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Στην τρέχουσα παρουσίαση δεν υφίσταται σύγκρουση συμφερόντων

Στην τρέχουσα παρουσίαση δεν υφίσταται σύγκρουση συμφερόντων Δοκιμασίες κοπράνων Γιώργος Χουλιάρας, Παιδογαστρεντερολόγος, Πανεπιστημιακός Υπότροφος, Υπεύθυνος Ενδοσκοπήσεων & Ιατρείου Ιδιοπαθών Φλεγμονωδών Nοσημάτων του Εντέρου Μονάδα Γαστρεντερολογίας και Διατροφής

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

Προβλήματα σχετιζόμενα με την τυποποίηση αντιγόνων Ι

Προβλήματα σχετιζόμενα με την τυποποίηση αντιγόνων Ι Β Προβλήματα Φαινότυπος Β(Α): ασθενής αντίδραση με αντι-α, έντονη αντίδραση με αντι-β, και ο ορός αντιδρά με ερυθρά Α₁. Ο αντιορός Α περιέχει τον κλώνο ΜΗΟ4? Επίκτητος Β φαινότυπος: έντονη αντίδραση με

Διαβάστε περισσότερα


ΔΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΔΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ Εργαστηριακή αξιολόγηση της αξιοπιστίας του strep testστη διάγνωση και τον καθορισμό της κατάλληλης αντιβιοτικής αγωγής σε ασθενείς με οξεία πυώδη αμυγδαλίτιδα

Διαβάστε περισσότερα

Ενόργανη Ανάλυση Εργαστήριο. Φασματοσκοπία πυρηνικού μαγνητικού συντονισμού Nuclear Magnetic Resonance spectroscopy, NMR. Πέτρος Α.

Ενόργανη Ανάλυση Εργαστήριο. Φασματοσκοπία πυρηνικού μαγνητικού συντονισμού Nuclear Magnetic Resonance spectroscopy, NMR. Πέτρος Α. Ενόργανη Ανάλυση Εργαστήριο Φασματοσκοπία πυρηνικού μαγνητικού συντονισμού Πέτρος Α. Ταραντίλης 1 Βασικές αρχές Που βασίζεται; Στη μέτρηση της απορρόφησης της ακτινοβολίας στην περιοχή των ραδιοσυχνοτήτων

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΚΕΦΑΛΑΙΟ 8 ο...2 I. Εφαρµογές της βιοτεχνολογίας στην ιατρική...2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ...7 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ... ΚΕΦΑΛΑΙΟ 8 ο ΚΕΦΑΛΑΙΟ 8 ο...2 I. Εφαρµογές της βιοτεχνολογίας στην ιατρική...2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ...7 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ...10 1 ΚΕΦΑΛΑΙΟ 8 ο I. Εφαρµογές της βιοτεχνολογίας

Διαβάστε περισσότερα

-Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ

-Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ -Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ ΠΡΟΟΡΙΖΟΜΕΝΗ ΧΡΗΣΗ Διαγνωστική ανοσονεφελομετρική εξέταση για τον ποσοτικό προσδιορισμό της σερουλοπλασμίνης ( CER ) σε ανθρώπινο ορό ή πλάσμα με το σύστημα

Διαβάστε περισσότερα


ΝΕΕΣ MΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΓΙΑ ΤΗΝ ΤΥΠΟΠΟΙΗΣΗ ΤΩΝ ΒΑΚΤΗΡΙΩΝ ΝΕΕΣ MΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΓΙΑ ΤΗΝ ΤΥΠΟΠΟΙΗΣΗ ΤΩΝ ΒΑΚΤΗΡΙΩΝ ΑΠΟΣΤΟΛΟΣ ΒΑΝΤΑΡΑΚΗΣ ΒΙΟΛΟΓΟΣ (M.Sc, Ph.D) Επιδημίες μολυσματικών ασθενειών συχνά οφείλονται σε έκθεση σε μία κοινή πηγή ενός αιτιολογικού παράγοντα.

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΙΣΑΓΩΓΗ ΣΤΗ ΒΙΟΛΟΓΙΑ ΕΙΣΑΓΩΓΗ ΣΤΗ ΒΙΟΛΟΓΙΑ Εξάμηνο Υ/Ε Ώρες Θεωρίας Ώρες Ασκήσης Διδακτικές μονάδες ECTS A Υ 3 3 4 6 Διδάσκουσα Μ. Αλεξίου Χατζάκη, Επίκ. Καθηγήτρια Γεν. Βιολογίας. Aντικειμενικοί στόχοι του μαθήματος Οι στόχοι

Διαβάστε περισσότερα

Εργαστηριακές Δοκιμασίες που πραγματοποιούνται στο Π.Ε.Δ.Υ Κρήτης.

Εργαστηριακές Δοκιμασίες που πραγματοποιούνται στο Π.Ε.Δ.Υ Κρήτης. Εργαστηριακές Δοκιμασίες που πραγματοποιούνται στο Π.Ε.Δ.Υ Κρήτης. Είδος δείγματος Εξεταζόμενη παράμετρος Μέθοδος Πρότυπο Διαπιστευμένη Αρίθμηση μικροοργανισμών ενσωμάτωσης σε στερεό ΕΛΟΤ ΕΝ ISO 6222 καταμέτρηση

Διαβάστε περισσότερα

Έλεγχοι. Τη συγκέντρωση του φαρμάκου σε δείγμα ιστού ή βιολογικού υγρού

Έλεγχοι. Τη συγκέντρωση του φαρμάκου σε δείγμα ιστού ή βιολογικού υγρού Έλεγχοι Τη συγκέντρωση του φαρμάκου σε δείγμα ιστού ή βιολογικού υγρού Το ρυθμό απελευθέρωσης του φαρμάκου από το σκεύασμα Έλεγχο ταυτότητας και καθαρότητας της πρώτης ύλης και των εκδόχων( βάση προδιαγραφών)

Διαβάστε περισσότερα

Άσκηση Φαρμακευτικής Βιοτεχνολογίας

Άσκηση Φαρμακευτικής Βιοτεχνολογίας Άσκηση Φαρμακευτικής Βιοτεχνολογίας Χαρακτηρισμός Φαρμακογενετικών δεικτών με PCR-ARMS Θεωρητικό μέρος 1. Αλυσιδωτή αντίδραση Πολυμεράσης (PCR) Η αλυσιδωτή αντίδραση πολυμεράσης (polymerase chain reaction,

Διαβάστε περισσότερα

ΜΕΘΟΔΟΣ Ανοσονεφελομετρική υπερευαίσθητη μέθοδος ενισχυμένη με latex.

ΜΕΘΟΔΟΣ Ανοσονεφελομετρική υπερευαίσθητη μέθοδος ενισχυμένη με latex. - Ενισχυμένη με latex νεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ ΠΡΟΟΡΙΖΟΜΕΝΗ ΧΡΗΣΗ Διαγνωστική ανοσονεφελομετρική latex εξέταση για τον ποσοτικό προσδιορισμό της C Αντιδρώσας Πρωτεΐνης ( ΗS CRP ) σε ανθρώπινο

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Βιολογία Θετικής Κατεύθυνσης 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία ανασυνδυασμένου DNA Αναπτύχθηκε λόγω της ανακάλυψης: i. Περιοριστικών ενδονουκλεασών ii. Ειδικών φορέων DNA Έδωσε

Διαβάστε περισσότερα

Μικροβιολογία Τροφίμων Ι Εργαστήριο

Μικροβιολογία Τροφίμων Ι Εργαστήριο Μικροβιολογία Τροφίμων Ι Εργαστήριο Ενότητα 10: Μοριακή Βιολογία και Μικροβιολογία Τροφίμων (1/2), 1ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Ευστάθιος Ζ. Πανάγου Πασχαλίτσα

Διαβάστε περισσότερα

artus EBV QS-RGQ Kit Χαρακτηριστικά απόδοσης Μάιος 2012 Sample & Assay Technologies Αναλυτική ευαισθησία πλάσμα

artus EBV QS-RGQ Kit Χαρακτηριστικά απόδοσης Μάιος 2012 Sample & Assay Technologies Αναλυτική ευαισθησία πλάσμα artus EBV QS-RGQ Kit Χαρακτηριστικά απόδοσης artus EBV QS-RGQ Kit, Έκδοση 1, 4501363 Ελέγξτε την διαθεσιμότητα νέων ηλεκτρονικών αναθεωρήσεων επισήμανσης στη διεύθυνση www.qiagen.com/products/artusebvpcrkit.aspx

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

ΙΣΤΟΡΙΚΑ ΠΕΙΡΑΜΑΤΑ ΣΤΗ ΒΙΟΛΟΓΙΑ. Τα πειράματα που οδήγησαν στο συμπέρασμα ότι το DNA είναι το γενετικό υλικό

ΙΣΤΟΡΙΚΑ ΠΕΙΡΑΜΑΤΑ ΣΤΗ ΒΙΟΛΟΓΙΑ. Τα πειράματα που οδήγησαν στο συμπέρασμα ότι το DNA είναι το γενετικό υλικό ΙΣΤΟΡΙΚΑ ΠΕΙΡΑΜΑΤΑ ΣΤΗ ΒΙΟΛΟΓΙΑ Τα πειράματα που οδήγησαν στο συμπέρασμα ότι το DNA είναι το γενετικό υλικό Πείραμα Griffith (1928) o O Griffith ήταν Βρετανός βακτηριολόγος του οποίου το ερευνητικό ενδιαφέρον

Διαβάστε περισσότερα

Σύγχρονη διαγνωστική προσέγγιση των ιώσεων

Σύγχρονη διαγνωστική προσέγγιση των ιώσεων Σύγχρονη διαγνωστική προσέγγιση των ιώσεων Μ. ΓΙΑΝΝΑΚΗ 10 η Ημερίδα Κλινικής Μικροβιολογίας 23/1/2010 Αξιολόγηση για την επιλογή της διαγνωστικής τεχνικής Ευαισθησία Ειδικότητα Θετική και Αρνητική Προγνωστική

Διαβάστε περισσότερα

Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών

Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών Αντιµεταλλαξιγόνο δράση ανίχνευση ουσιών που προστατεύουν το DNA από µεταλλαξιγόνα που προκαλούν µεταλλάξεις

Διαβάστε περισσότερα


ΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΓΝΩΣΕΙΣ ΚΑΙ ΕΞΕΤΑΣΕΙΣ ΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΓΝΩΣΕΙΣ ΚΑΙ ΕΞΕΤΑΣΕΙΣ ΑΝΟΣΟΦΘΟΡΙΣΜΟΣ Εισαγωγή Ο ανοσοφθορισµός είναι η µέθοδος κατά την οποία χρησιµοποιούνται φθορίζοντα αντισώµατα για την ανίχνευση και εντόπιση αντιγόνου ή αντισώµατος

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Άσκηση 3η. Μέθοδοι Διαχωρισμού. Τμήμα ΔΕΑΠΤ - Εργαστήριο Γενικής Χημείας

Άσκηση 3η. Μέθοδοι Διαχωρισμού. Τμήμα ΔΕΑΠΤ - Εργαστήριο Γενικής Χημείας Άσκηση 3η Μέθοδοι Διαχωρισμού 1 2 Θεωρητικό μέρος Χρήση των μεταβολών των φάσεων στην ανάλυση Οι ουσίες λειώνουν και βράζουν σε ορισμένες θερμοκρασίες, αλλάζοντας έτσι μορφή από στερεή σε υγρή ή από υγρή

Διαβάστε περισσότερα

Συχνότητα Human Papilloma Virus (HPV) στη Κύπρο

Συχνότητα Human Papilloma Virus (HPV) στη Κύπρο E M E D N L C SCIENCES BIOMEDICAL E N T E R Kέντρο Μέντελ για Βιοιατρικές Επιστήμες Συχνότητα Human Papilloma Virus (HPV) στη Κύπρο Βασίλειος Τάνος MD PhD www.mendelcenter.org Picture taken from leaflet

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

Εναλλακτικές Μέθοδοι

Εναλλακτικές Μέθοδοι Εναλλακτικές Μέθοδοι Δέσποινα Ν. Περρέα Αναπληρώτρια Καθηγήτρια Ιατρικής Σχολής Πανεπιστημίου Αθηνών Διευθύντρια Εργαστηρίου Πειραματικής Χειρουργικής και Χειρουργικής Ερεύνης «Ν.Σ. Χρηστέας» Ιστορικά

Διαβάστε περισσότερα

Μέθοδοι Μοριακής Βιολογίας με Εφαρμογή στη Βακτηριολογία

Μέθοδοι Μοριακής Βιολογίας με Εφαρμογή στη Βακτηριολογία Μέθοδοι Μοριακής Βιολογίας με Εφαρμογή στη Βακτηριολογία Γενετική Βακτηρίων Κατανόηση μηχανισμών λειτουργίας ευκαρυωτικών κυττάρων Ταξινόμηση βακτηρίων Διάγνωση λοιμωδών νοσημάτων Επιδημιολογική μελέτη

Διαβάστε περισσότερα


ΑΝΤΙΜΙΚΡΟΒΙΑΚΗ ΘΕΡΑΠΕΙΑ ΣΤΙΣ ΛΟΙΜΩΞΕΙΣ ΤΗΣ ΟΡΘΟΠΑΙΔΙΚΗΣ ΑΝΤΙΜΙΚΡΟΒΙΑΚΗ ΘΕΡΑΠΕΙΑ ΣΤΙΣ ΛΟΙΜΩΞΕΙΣ ΤΗΣ ΟΡΘΟΠΑΙΔΙΚΗΣ Ιωάννης Π.Κιουμής Αναπληρωτής Καθηγητής Α.Π.Θ. Για την καλύτερη κατανόηση της δέουσας αντιμικροβιακής θεραπείας στις λοιμώξεις της Ορθοπαιδικής ουσιαστική

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΟ ΟΡΓΑΝΙΚΗΣ ΧΗΜΕΙΑΣ. Άσκηση 2 η : Φασματοφωτομετρία. ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ Γενικό Τμήμα Εργαστήριο Χημείας

ΕΡΓΑΣΤΗΡΙΟ ΟΡΓΑΝΙΚΗΣ ΧΗΜΕΙΑΣ. Άσκηση 2 η : Φασματοφωτομετρία. ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ Γενικό Τμήμα Εργαστήριο Χημείας Άσκηση 2 η : ΑΣΚΗΣΕΙΣ 1. Εκχύλιση - Διήθηση Διαχωρισμός-Απομόνωση 2. Ποσοτικός Προσδιορισμός 3. Ποτενσιομετρία 4. Χρωματογραφία Ηλεκτροχημεία Διαχωρισμός-Απομόνωση 5. Ταυτοποίηση Σακχάρων Χαρακτηριστικές

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Η Κυτταρογενετική στις αιματολογικές κακοήθειες

Η Κυτταρογενετική στις αιματολογικές κακοήθειες Εργαστήριο Υγειοφυσικής & Περιβαλλοντικής Υγείας, ΙΠΤ-Α, Ε.Κ.Ε.Φ.Ε. «Δημόκριτος» Η Κυτταρογενετική στις αιματολογικές κακοήθειες Μανωλά Καλλιόπη, Ph.D Ερευνήτρια Γ Κυτταρογενετική Κλάδος της Γενετικής

Διαβάστε περισσότερα

Μονάδες 6 ΘΕΜΑ Β. ιαθέτουμε υδατικό διάλυμα CH 3 COONa συγκέντρωσης 0,1 Μ ( ιάλυμα 1 ). Β1. Να υπολογίσετε το ph του διαλύματος 1.


Διαβάστε περισσότερα

Αρχές Βιοτεχνολογίας Τροφίμων

Αρχές Βιοτεχνολογίας Τροφίμων Αρχές Βιοτεχνολογίας Τροφίμων Ενότητα 2: Στοιχεία Μικροβιολογίας και Βιοχημείας των Βιομηχανικών Ζυμώσεων(1/5), 2ΔΩ Τμήμα: Επιστήμης και Τεχνολογίας Τροφίμων Διδάσκων: Δρ. Σεραφείμ Παπανικολαου Μαθησιακοί

Διαβάστε περισσότερα


cobas 4800 HPV Test ΓΙΑ IN VITRO ΔΙΑΓΝΩΣΤΙΚΗ ΧΡΗΣΗ. cobas 4800 HPV Test ΓΙΑ IN VITRO ΔΙΑΓΝΩΣΤΙΚΗ ΧΡΗΣΗ. cobas 4800 System Sample Preparation Kit c4800 SMPL PREP 960 Tests P/N: 05235804190 240 Tests P/N: 05235782190 cobas 4800 HPV Amplification/Detection

Διαβάστε περισσότερα


ΑΠΑΙΤΗΣΕΙΣ ΣΧΕΤΙΚΕΣ ΜΕ ΝΕΑΣ ΤΕΧΝΟΛΟΓΙΑΣ ΙΧΝΗΘΕΤΕΣ ΑΠΑΙΤΗΣΕΙΣ ΣΧΕΤΙΚΕΣ ΜΕ ΝΕΑΣ ΤΕΧΝΟΛΟΓΙΑΣ ΙΧΝΗΘΕΤΕΣ Οι απαντήσεις σε όλα τα πεδία οφείλουν να λαμβάνουν υπόψη και να είναι σύμφωνες με τις Ευρωπαϊκές Οδηγίες και τους Ευρωπαϊκούς Κανονισμούς. Για κάθε πεδίο

Διαβάστε περισσότερα

ΕΡΕΥΝΗΤΙΚΗ ΕΡΓΑΣΙΑ. Θεωρία - Πείραμα Μετρήσεις - Σφάλματα

ΕΡΕΥΝΗΤΙΚΗ ΕΡΓΑΣΙΑ. Θεωρία - Πείραμα Μετρήσεις - Σφάλματα ΕΡΕΥΝΗΤΙΚΗ ΕΡΓΑΣΙΑ Θεωρία - Πείραμα Μετρήσεις - Σφάλματα ΟΜΑΔΑ:RADIOACTIVITY Τα μέλη της ομάδας μας: Γιώργος Παπαδόγιαννης Γεράσιμος Κουτσοτόλης Νώντας Καμαρίδης Κωνσταντίνος Πούτος Παναγιώτης Ξανθάκος

Διαβάστε περισσότερα


ΚΕΦΑΛΑΙΟ 14 ΕΙΣΑΓΩΓΗ ΣΤΙΣ ΤΕΧΝΙΚΕΣ ΔΙΑΧΩΡΙΣΜΟΥ ΚΕΦΑΛΑΙΟ 14 ΕΙΣΑΓΩΓΗ ΣΤΙΣ ΤΕΧΝΙΚΕΣ ΔΙΑΧΩΡΙΣΜΟΥ ΓΕΝΙΚΟΤΗΤΕΣ (1) Λίγες οι εκλεκτικές και σπάνιες οι εξειδικευμένες αναλυτικές μέθοδοι Παράδειγμα εξειδικευμένων μεθόδων οι ανοσοχημικές μέθοδοι (χρήση ειδικών

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Διάγνωση λανθάνουσας φυματίωσης. Χαράλαμπος Μόσχος Επιμελητής Α Πνευμονολόγος-Φυματιολογος ΝΝΘΑ Η ΣΩΤΗΡΙΑ

Διάγνωση λανθάνουσας φυματίωσης. Χαράλαμπος Μόσχος Επιμελητής Α Πνευμονολόγος-Φυματιολογος ΝΝΘΑ Η ΣΩΤΗΡΙΑ Διάγνωση λανθάνουσας φυματίωσης 1 Χαράλαμπος Μόσχος Επιμελητής Α Πνευμονολόγος-Φυματιολογος ΝΝΘΑ Η ΣΩΤΗΡΙΑ Τι είναι η λανθανουσα φυματική λοίμωξη (ΛΦ)? 2 Υποκλινική νόσος ΛΦ είναι η παρουσία M. tuberculosis

Διαβάστε περισσότερα

Φύλλο πρωτοκόλλου QIAsymphony SP

Φύλλο πρωτοκόλλου QIAsymphony SP Αύγουστος 2015 Φύλλο πρωτοκόλλου QIAsymphony SP Tissue_LC_200_V7_DSP και Tissue_HC_200_V7_DSP (επικυρωμένο από τον χρήστη για το κιτ QIAsymphony DSP DNA Mini) Το παρόν έγγραφο είναι το Φύλλο πρωτοκόλλου

Διαβάστε περισσότερα

ΠΑΡΟΞΥΣΜΙΚΗ ΝΥΚΤΕΡΙΝΗ ΑΙΜΟΣΦΑΙΡΙΝΟΥΡΙΑ (PNH) Αχιλλέας Θ. Καραμούτσιος Μονάδα Μοριακής Βιολογίας, Αιματολογικό Εργαστήριο ΠΓΝ Ιωαννίνων

ΠΑΡΟΞΥΣΜΙΚΗ ΝΥΚΤΕΡΙΝΗ ΑΙΜΟΣΦΑΙΡΙΝΟΥΡΙΑ (PNH) Αχιλλέας Θ. Καραμούτσιος Μονάδα Μοριακής Βιολογίας, Αιματολογικό Εργαστήριο ΠΓΝ Ιωαννίνων ΠΑΡΟΞΥΣΜΙΚΗ ΝΥΚΤΕΡΙΝΗ ΑΙΜΟΣΦΑΙΡΙΝΟΥΡΙΑ (PNH) Αχιλλέας Θ. Καραμούτσιος Μονάδα Μοριακής Βιολογίας, Αιματολογικό Εργαστήριο ΠΓΝ Ιωαννίνων Ιωάννινα, Σεπτέμβριος 2013 PNH Σπάνια διαταραχή του αρχέγονου αιμοποιητικού

Διαβάστε περισσότερα

Ορισμοί νοσοκομειακών λοιμώξεων

Ορισμοί νοσοκομειακών λοιμώξεων Ορισμοί νοσοκομειακών λοιμώξεων Ιωαννίδου Ελένη Παθολόγος Εξειδικευόμενη Λοιμωξιολογίας Νοσοκομείο Ρεθύμνου Ουρολοιμώξεις Σηψαιμίες Λοιμώξεις συνδεόμενες με αγγειακούς καθετρες Ουρολοιμώξεις UTI-A συμπτωματικ

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ 1 ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ άμεση πρόσβαση στο γενετικό υλικό εφαρμογές στην υγεία, βελτίωση φυτών και ζώων, προστασία

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα


ΕΡΓΑΣΤΗΡΙΟ ΟΡΓΑΝΙΚΗΣ ΧΗΜΕΙΑΣ Υπεύθυνος Εργαστηρίου: Δρ. Πέτρος Α. Ταραντίλης, Λέκτορας Δρ. Χρήστος Παππάς, Λέκτορας (βάσει Ν. 407/80) Δρ. Σοφία Κουλοχέρη, Επιστημονικός συνεργάτης Δρ. Αναστασία Μίχου, Επιστημονικός συνεργάτης Βάση

Διαβάστε περισσότερα

HPV DNA, E6, E7, L1, L2, E2, p16, prb, κυκλίνες, κινάσες, Ki67. Τι από όλα αυτά πρέπει να γνωρίζει ο κλινικός γιατρός; Αλέξανδρος Λαµπρόπουλος

HPV DNA, E6, E7, L1, L2, E2, p16, prb, κυκλίνες, κινάσες, Ki67. Τι από όλα αυτά πρέπει να γνωρίζει ο κλινικός γιατρός; Αλέξανδρος Λαµπρόπουλος HPV DNA, E6, E7, L1, L2, E2, p16, prb, κυκλίνες, κινάσες, Ki67. Τι από όλα αυτά πρέπει να γνωρίζει ο κλινικός γιατρός; Αλέξανδρος Λαµπρόπουλος δεν υπάρχει σύγκρουση συµφερόντων Ø Ποιό HPV τεστ είναι το

Διαβάστε περισσότερα


ΙΖΗΜΑΤΙΝΟΑΝΤΙΔΡΑΣΕΙΣ ΙΖΗΜΑΤΙΝΟΑΝΤΙΔΡΑΣΕΙΣ Ιζηματινο-αντίδραση ονομάζουμε την ένωση ενός διαλυτού αντιγόνου με το ομόλογο αντίσωμα του και το σχηματισμό ιζήματος. Στην πρώτη φάση γίνεται η ταχεία ένωση του αντιγόνου με το αντίσωμα

Διαβάστε περισσότερα

1. Ο ατμοσφαιρικός αέρας, ως αέριο μίγμα, είναι ομογενές. Άρα, είναι διάλυμα.

1. Ο ατμοσφαιρικός αέρας, ως αέριο μίγμα, είναι ομογενές. Άρα, είναι διάλυμα. 2.8 Διαλύματα Υπόδειξη: Στα αριθμητικά προβλήματα, τα πειραματικά μεγέθη που δίνονται με ένα ή δύο σημαντικά ψηφία θεωρούνται ότι πρακτικά έχουν 3 ή 4 σημαντικά ψηφία. 1. Ο ατμοσφαιρικός αέρας, ως αέριο

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση:

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση: ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) : ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Τεκμηριωμένη Ιατρική Evidence-Based Medicine

Τεκμηριωμένη Ιατρική Evidence-Based Medicine Τεκμηριωμένη Ιατρική Evidence-Based Medicine Δημήτριος Γ. Γουλής Επίκουρος καθηγητής Ενδοκρινολογίας Αναπαραγωγής Μονάδα Ενδοκρινολογίας Αναπαραγωγής Α Μαιευτική & Γυναικολογική Κλινική ΑΠΘ Περιστατικό

Διαβάστε περισσότερα

Επίλυση προβλημάτων ασυμβατότητας. Νίκη Βγόντζα

Επίλυση προβλημάτων ασυμβατότητας. Νίκη Βγόντζα Επίλυση προβλημάτων ασυμβατότητας Νίκη Βγόντζα Βασικά στάδια ελέγχου συμβατότητας του αίματος μεταξύ δότη και λήπτη 1.Αίτηση αίματος (παραπεμπτικό) και δείγμα ασθενή 2.Ομάδα ABO,RhD στο δείγμα του ασθενή

Διαβάστε περισσότερα

ΠΡΑΚΤΙΚΟ ΕΠΙΤΡΟΠΗΣ. 2.Μεταπτυχιακό δίπλωµα Ειδίκευσης στη Βιοχηµεία - Συντελεστής βαρύτητας: 15%

ΠΡΑΚΤΙΚΟ ΕΠΙΤΡΟΠΗΣ. 2.Μεταπτυχιακό δίπλωµα Ειδίκευσης στη Βιοχηµεία - Συντελεστής βαρύτητας: 15% ΠΡΑΚΤΙΚΟ ΕΠΙΤΡΟΠΗΣ Στις 29/07/2016, ηµέρα Παρασκευή και ώρα 13:00 συνεκλήθη η Επιτροπή Αξιολόγησης, όπως ορίστηκε µε την µε αρ. πρωτ. 100/2016-3149 της 14/06/2016 απόφαση, αποτελούµενη από τον Διευθυντή

Διαβάστε περισσότερα

ηλικία περιεκτικότητα σε λίπος φύλο

ηλικία περιεκτικότητα σε λίπος φύλο ΥΓΡΑ ΤΟΥ ΣΩΜΑΤΟΣ Το ύδωρ αποτελεί το 60% του βάρους σώματος α) από την ηλικία (νεογνά 75%) β) περιεκτικότητα σε λίπος (ο λιπώδης ιστός έχει μικρή περιεκτικότητα σε ύδωρ) γ) το φύλο ( το ύδωρ είναι λιγότερο

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4. Βασικές αρχές της μοριακής βιολογίας. Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1

ΚΕΦΑΛΑΙΟ 4. Βασικές αρχές της μοριακής βιολογίας. Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1 ΚΕΦΑΛΑΙΟ 4 Βασικές αρχές της μοριακής βιολογίας Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1 ΕΙΚΟΝΑ 4.4 Η μεταφορά της γενετικής πληροφορίας μέσω του DNA. Ακαδημαϊκές Εκδόσεις 2011 Το

Διαβάστε περισσότερα