Αρχές PCR και υβριδισμού. Ιωσήφ Παπαπαρασκευάς Βιοπαθολόγος, Λέκτορας ΕΚΠΑ Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Αθηνών

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Αρχές PCR και υβριδισμού. Ιωσήφ Παπαπαρασκευάς Βιοπαθολόγος, Λέκτορας ΕΚΠΑ Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Αθηνών ipapapar@med.uoa."

Transcript

1 Αρχές PCR και υβριδισμού Ιωσήφ Παπαπαρασκευάς Βιοπαθολόγος, Λέκτορας ΕΚΠΑ Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Αθηνών

2 Ιστορικά στοιχεία Πρώτη αναφορά in vitro ενζυματικής αντίδρασης για την κατασκευή νουκλεοτιδικής αλληλουχίας Kleppe et al, J Mol Biol, 1971 Πρώτη αναλυτική παρουσίαση της τεχνικής της PCR Saiki and Mullis, Science, 1985 Πρώτες άμεσες εφαρμογές της τεχνικής Saiki and Mullis, Science, 1987 Mullis and Faloona, Methods Enzymol, 1987 Mullis, Sci Amer, 1990 Σήμερα η PCR πλέον έχει αυτοματοποιηθεί και εισαχθεί στην καθημερινή ιατρική διαγνωστική πρακτική

3 ομή της παρουσίασης Περιγραφή της τεχνικής της PCR Περιγραφή της ηλεκτροφόρησης του DNA Συζήτηση ορισμένων βασικών παραμέτρων που επηρεάζουν το αποτέλεσμα της αντίδρασης Η επιλογή του DNA στόχου (αναλυτική ευαισθησία) Η επιλογή και επεξεργασία του κλινικού δείγματος (διαγνωστική ευαισθησία) Η αξία του θετικού ή αρνητικού αποτελέσματος (θετική - αρνητική προγνωστική αξία) Η οπτικοποίηση του αποτελέσματος (αναλυτική ευαισθησία) Τα ψευδώς θετικά αποτελέσματα (επιμόλυνση) Τα ψευδώς αρνητικά αποτελέσματα (αναστολή)

4 ιαδικασία της PCR Περιγραφή της τεχνικής της PCR Περιγραφή της ηλεκτροφόρησης των προϊόντων

5 Αναλυτική ευαισθησία της μεθόδου Η αναλυτική ευαισθησία της μεθόδου, δηλ. το όριο της ποσότητας του DNA (ή της ποσότητας των βακτηριακών κυττάρων) που απαιτείται για να είναι θετική η αντίδραση, εξαρτάται από: Αριθμός των σταδίων (ενός σταδίου ή εμφωλεάζουσα) Ύπαρξη και ποσότητα του DNA στόχου στα στελέχη Οπτικοποίηση αποτελέσματος (αγαρόζη, ιχνηθέτης, Real Time)

6 ιάγνωση της φυματίωσης Αναλυτική ευαισθησία μεθόδων Ευαισθησία οξεάντοχης χρώσης: ~ βακτήρια/ml Ευαισθησία καλλιέργειας: βακτήρια/ml Ευαισθησία PCR ποικίλει

7 Αναλυτική ευαισθησία μεθόδου Η επιλογή στόχου με πολλαπλά αντίγραφα M. tuberculosis complex: ~ 5-20 αντίγραφα IS6110 Όμως έως 5% στελεχών M. tuberculosis :0-4αντίγραφα Έως 5% ασθενών με φυματίωση κ/α (+) και PCR (-) Αλλά και στους λοιπούς 95% η αναλυτική ευαισθησία ποικίλει σε μεγάλο βαθμό, ανάλογα με τον αριθμό των αντιγράφων του DNA στόχου στο στέλεχος

8 Αναλυτική ευαισθησία μεθόδου Η μέθοδος ανίχνευσης του αποτελέσματος Συμβατική PCR ενός σταδίου με ανίχνευση των προϊόντων: Οπτικά σε gel αγαρόζης Αύξηση της αναλυτικής ευαισθησίας Οπτικά με υβριδισμό και σημασμένο ιχνηθέτη Φωτομετρικά με ELISA Ραδιομετρικά Συμβατική PCR δύο σταδίων (nested) με ανίχνευση των προϊόντων: Οπτικά σε gel αγαρόζης Οπτικά με υβριδισμό και σημασμένο ιχνηθέτη Φωτομετρικά με ELISA Ραδιομετρικά Real-Time PCR με ανίχνευση των προϊόντων φωτομετρικά (CCD camera) με σημασμένο ιχνηθέτη (TaqMan probe ή molecular beacon)

9 Συμβατική PCR με οπτικοποίηση σε gel αγαρόζης Πρωτόκολλο ενός σταδίου Εκκινητές για το IS6110 Aναλυτική ευαισθησία 180 fg DNA ~ 40 βακτηριακά κύτταρα Ποσοτική Real-Time PCR Πρωτόκολλο ενός σταδίου Εκκινητές και molecular beacon για το IS6110 Aναλυτική ευαισθησία 45 fg DNA ~ 10 βακτηριακά κύτταρα Papaparaskevas et al, J Clin Microbiol, 2008

10 ιάγνωση φυματίωσης Συμβατική μικροβιολογία Οξεάντοχη χρώση Ziehl-Neelsen Χρώση Ροδαμίνης Αουραμίνης Mycobacterium tuberculosis Καλλιέργεια σε Lowenstein-Jensen 24 ημέρες, 36 ο C, 5% CO 2 Αρχείο Εργαστηρίου Μικροβιολογίας ΓΝΑ Λαϊκό

11 Η επιλογή του κλινικού δείγματος Η συσχέτιση μεταξύ της αναλυτικής ευαισθησίας και της διαγνωστικής ευαισθησίας (ικανότητας της αντίδρασης να δίνει θετικό αποτέλεσμα στα θετικά δείγματα) Η κλινική σημαντικότητα του θετικού αποτελέσματος

12 Η πιθανότητα του αρνητικού αποτελέσματος σε δείγματα με χαμηλή συγκέντρωση στόχου Κανόνας του Poison για την ομοιογενή κατανομή του στόχου στο διάλυμα του κλινικού δείγματος P N =C N /Nxe c Σε ένα διάλυμα δείγματος 1 ml (1.000 μl) με χαμηλό αριθμό βακτηριακού φορτίου, η πιθανότητα 100 τυχαία μl του δείγματος να έχουν την ίδια ακριβώς συγκέντρωση στόχου με 100 άλλα τυχαία μl είναι εξαιρετικά μικρή Χαμηλή ευαισθησία και επαναληψιμότητα Greenfield and White, Mayo Foundation, 1993

13 Η πιθανότητα του αρνητικού αποτελέσματος σε δείγματα με χαμηλή συγκέντρωση στόχου Greenfield and White, Mayo Foundation, 1993

14 Βελτιστοποίηση της τεχνικής σε δείγματα με χαμηλή συγκέντρωση στόχου Εμπλουτισμός του δείγματος κατά την διάρκεια της κατεργασίας Φυγοκέντρηση Απομάκρυνση περιττών στοιχείων Κατεργασία μεγαλύτερης ποσότητας δείγματος Λήψη πολλαπλών δειγμάτων

15 Βελτιστοποίηση της τεχνικής σε δείγματα με χαμηλή συγκέντρωση στόχου Αύξηση της ποσότητας του δείγματος για κατεργασία αύξηση της τελικής συγκέντρωσης του ευκαρυωτικού DNA (Αιματηρά πτύελα: 14 μg ευκαρυωτικό DNA/ml πτυέλων) Χρυσή τομή μεταξύ αύξησης της ποσότητας του δείγματος και εξαφάνισης του DNA στόχου μέσα σε τεράστιες ποσότητες ευκαρυωτικού DNA (Αύξηση της πιθανότητας μη ειδικών υβριδισμών απώλεια ευαισθησίας) Greenfield and White, Mayo Foundation, 1993

16 Η επιλογή του κλινικού δείγματος ιάγνωση C. pneumoniae Το κλινικό δείγμα μπορεί να είναι πτύελα, BAL,φαρυγγικό έκπλυμα, κλπ. Το κλινικό δείγμα (ανάλογα με τον τρόπο λήψης) μπορεί να έχει ποικίλου βαθμού φυσιολογική χλωρίδα Ποια είναι η κλινική σημαντικότητα του θετικού αποτελέσματος; Το θετικό αποτέλεσμα της μεθόδου σημαίνει ότι ανευρέθηκε το αίτιο της λοίμωξης;

17 Η επιλογή του κλινικού δείγματος ιάγνωση C. pneumoniae Ποιο είναι το βέλτιστο κλινικό δείγμα? Κατάλληλα κατά Bartlet πτύελα ή βρογχοκυψελιδικό έκπλυμα Συνηθέστερα χρησιμοποιούμενο δείγμα Πτωχό σε ευκαρυωτικά κύτταρα χαμηλότερη ευαισθησία Εξασφαλίζει κλινική σημαντικότητα υψηλότερη ειδικότητα και προγνωστική αξία Φαρυγγικό επίχρισμα ή φαρυγγικό έκπλυμα Σπανιότερα χρησιμοποιούμενο δείγμα Πλούσιο σε ευκαρυωτικά κύτταρα υψηλότερη ευαισθησία εν εξασφαλίζει κλινική σημαντικότητα χαμηλότερη ειδικότητα και προγνωστική αξία

18 Η επιλογή του κλινικού δείγματος ιάγνωση C. pneumoniae Το θετικό δείγμα εξασφαλίζει την διάγνωση? Σε δείγματα κατώτερου αναπνευστικού συνήθως ναι Σε δείγματα ανώτερου αναπνευστικού??? Έως 10% αποικισμός στοματοφάρυγγα από C. pneumoniae, ιδίως σε ΧΑΠ (persistent carriers, chronic infections) SF Dowell et al, Clin Infect Dis, 2001

19 Η επιλογή του κλινικού δείγματος Η PCR διαχωρίζει δυσκολότερα, σε σχέση με την καλλιέργεια, το πραγματικό παθογόνο από την χλωρίδα ή την επιμόλυνση. SF Dowell et al, Clin Infect Dis, 2001

20 Κλινικά δείγματα για PCR Ολικό αίμα ή λευκοκύτταρα (προτιμότερο EDTA από ηπαρίνη) Όταν ο μικροοργανισμός είναι ενδοκυττάριος Ορός ή πλάσμα Όταν ο μικροοργανισμός είναι εξωκυττάριος Πτύελα, ούρα, ΕΝΥ, βιολογικά υγρά Κόπρανα (τα πλέον δύσκολα δείγματα)

21 Μέθοδοι λήψης του DNA Αδρές μέθοδοι καταστροφής του κυττάρου Βρασμός Γυάλινα σφαιρίδια Μέθοδοι διαχωρισμού και εκχύλισης DNA Φαινόλη-Χλωροφόρμιο Χαοτροπικές ενώσεις (γουανιδίνη Μέθοδος Boom) Μαγνητικά σφαιρίδια Στήλες με ηθμό Αυτοματοποίηση

22 Μέθοδοι λήψης του DNA Αδρές μέθοδοι καταστροφής του κυττάρου ιάλυμα από συγκρίματα κυτταροπλάσματος και κυτταρικού τοιχώματος, DNA (διπλόκλωνο, μονόκλωνο και θραύσματα), πρωτεΐνες κλπ. Αδρή, φθηνή μέθοδος, με χαμηλό ποιοτικά αποτέλεσμα Μέθοδοι διαχωρισμού και εκχύλισης DNA Καθαρό DNA που μπορεί να φυλαχθεί για μεγάλο χρονικό διάστημα Πιο ακριβή μέθοδος, με υψηλής ποιότητας παραγόμενο DNA

23 Το ψευδώς θετικό αποτέλεσμα Μη ειδικός υβριδισμός Μη προτυποποιημένο πρωτόκολλο Μέθοδος λήψης του DNA Μεγάλη συγκέντρωση ευκαρυωτικού DNA Θετικό - αμφιλεγόμενο Μη ειδικό Επιμόλυνση με προϊόντα πολλαπλασιασμού Κακή εργαστηριακή πρακτική. Τελικά προϊόντα που βρίσκονται σε μεγάλη συγκέντρωση στο περιβάλλον του εργαστηρίου επιμολύνουν τα αρχικά στάδια εκχύλισης DNA και προετοιμασίας του χημικού μίγματος Ψευδώς θετικό δυνατό σήμα

24 Το ψευδώς θετικό αποτέλεσμα Η εργαστηριακή πρακτική Εξαιρετικά μεγάλη σημασία η σωστή εργονομία και η αυστηρή αλληλουχία των βημάτων της πρακτικής Προετοιμασία του χημικού μίγματος (καθαρό δωμάτιο) Προσθήκη DNA (δωμάτιο προσθήκης DNA) Αντίδραση PCR (δωμάτιο PCR) Ηλεκτροφόρηση προϊόντος PCR (δωμάτιο PCR) Η εκχύλιση του DNA ιδανικά θα πρέπει να γίνεται σε τέταρτο χώρο Η αλληλουχία των βημάτων αυστηρά προς μια κατεύθυνση Συχνή χρήση UV ακτινοβολίας και διαλύματος χλωρίου

25 Η απενεργοποίηση του προϊόντος πολ/σμού Χρήση UNG+dUTP αφορά τη συγκεκριμένη αντίδραση κάθε φορά UV ακτινοβολία ή/και διάλυμα χλωρίου αφορά το περιβάλλον Persing and Chimino, Mayo Foundation, 1993

26 Η απενεργοποίηση του προϊόντος πολ/σμού Χρήση UNG και dutp Αρχή της μεθόδου: χρήση του ενζύμου UNG (uracil-nglycosilase) ένζυμο επισκευής του DNA που υδρολύει τον δεσμό του dutp και αντικαθιστά την ουρακίλη που σποραδικά μπορεί in vivo να ενσωματώνεται στο διπλόκλωνο DNA. Ta νουκλεοτίδια: datp, dctp, dgtp, dttp (A-T, C-G) Συνεχής χρήση dutp αντί για dttp Τα προϊόντα πολ/σμού έχουν νουκλεοτιδική αλληλουχία με dutp Στην αντίδραση της PCR προσθήκη UNG υδρόλυση τμημάτων DNA με dutp (επιμολύνοντα amplicons), αλλά όχι τμημάτων DNA με dttp (DNA στόχος) Μειονέκτημα: Ελάττωση της ευαισθησίας της αντίδρασης Greenfield and White, Mayo Foundation, 1993

27 Το ψευδώς αρνητικό αποτέλεσμα Μικρή συγκέντρωση στόχου, κάτωαπότοόριοτηςαναλυτικής ευαισθησίας Αναστολή της ενζυματικής αντίδρασης

28 Το ψευδώς αρνητικό αποτέλεσμα Αναστολή της αντίδρασης Φυσικές ουσίες Αιμίνη Πολυσακχαρίτες Χημικά αντιδραστήρια Ηπαρίνη, EDTA, SDS Χαοτροπικά μόρια (guanidinium HCl)

29 Το ψευδώς αρνητικό αποτέλεσμα Αναστολή της αντίδρασης Κλινικά δείγματα που πιθανά περιέχουν αναστολείς Αίμα και αιματηρά βιολογικά υγρά Ούρα Πτύελα

30 Το ψευδώς αρνητικό αποτέλεσμα Αναστολή της αντίδρασης Έλεγχος αναστολής Επανάληψη της αντίδρασης του συγκεκριμένου δείγματος μετά από προσθήκη μικρής ποσότητας DNA απότοθετικόcontrol Εάν το αποτέλεσμα εξακολουθεί να είναι αρνητικό, τότε ισχυρή πιθανότητα αναστολής Βασική παράμετρος για την αναστολή η μέθοδος εκχύλισης DNA Στις μεθόδους εκχύλισης του DNA με στήλες με ηθμό ή με μαγνητικά σφαιρίδια, μικρότερη η πιθανότητα. Οι αναστολείς κατακρατούνται από τον ηθμό.

31 Αντί συμπερασμάτων Η PCR και οι άλλες τεχνικές της μοριακής μικροβιολογίας έχουν πλέον καθιερωθεί στο κλινικό εργαστήριο Όμως υπάρχουν όρια στην εφαρμογή τους και κανόνες που πρέπει να γίνονται σεβαστοί εν φαίνεται στο άμεσο μέλλον συμβατικές τεχνικές, όπως η καλλιέργεια και η δοκιμασία ευαισθησίας, να μπορέσουν να αντικατασταθούν πλήρως από μοριακές τεχνικές Το πιθανότερο είναι ότι η συμβατική και η μοριακή μικροβιολογία θα δρουν συμπληρωματικά η μια της άλλης για μεγάλο χρονικό διάστημα ακόμη

32 Ευχαριστώ για την προσοχή σας

ΕΡΜΗΝΕΙΑ ΙΟΛΟΓΙΚΩΝ ΙΑΓΝΩΣΤΙΚΩΝ ΕΞΕΤΑΣΕΩΝ

ΕΡΜΗΝΕΙΑ ΙΟΛΟΓΙΚΩΝ ΙΑΓΝΩΣΤΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΡΜΗΝΕΙΑ ΙΟΛΟΓΙΚΩΝ ΙΑΓΝΩΣΤΙΚΩΝ ΕΞΕΤΑΣΕΩΝ Dr Α. Μεντής, Ιατρός Βιοπαθολόγος, Κλινικός Μικροβιολόγος ιευθυντής ιαγνωστικού Τμήματος ιευθυντής Εργαστηρίου Ιατρικής Μικροβιολογίας ιευθυντής Εθνικού Εργαστηρίου

Διαβάστε περισσότερα

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία της Δημόσιας Υγείας Α. Βανταράκης Εργαστήριο Υγιεινής, Ιατρική Σχολή,

Διαβάστε περισσότερα

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Chain Reaction (pcr)- Αλυσιδωτή αντίδραση πολυμεράσης.η

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΟ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ. Ιατρική Σχολή Πανεπιστημίου Θεσσαλίας

ΕΡΓΑΣΤΗΡΙΟ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ. Ιατρική Σχολή Πανεπιστημίου Θεσσαλίας ΕΡΓΑΣΤΗΡΙΟ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ Ιατρική Σχολή Πανεπιστημίου Θεσσαλίας Ε. ΠΕΤΕΙΝΑΚΗ Aναπληρώτρια Καθηγήτρια Μικροβιολογίας Διευθύντρια Εργαστηρίου Μικροβιολογίας ΜΙΚΡΟΒΙΟΛΟΓΙΑ φάση της κλινικής ιατρικής Η μικροβιολογία

Διαβάστε περισσότερα

ΤΟ ΕΡΓΑΣΤΗΡΙΟ ΚΛΙΝΙΚΗΣ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ ΣΤΟΝ ΕΛΕΓΧΟ ΤΩΝ ΝΟΣΟΚΟΜΕΙΑΚΩΝ ΛΟΙΜΩΞΕΩΝ

ΤΟ ΕΡΓΑΣΤΗΡΙΟ ΚΛΙΝΙΚΗΣ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ ΣΤΟΝ ΕΛΕΓΧΟ ΤΩΝ ΝΟΣΟΚΟΜΕΙΑΚΩΝ ΛΟΙΜΩΞΕΩΝ 1η ΕΠΙΣΤΗΜΟΝΙΚΗ ΔΙΗΜΕΡΙΔΑ «ΕΛΕΓΧΟΣ ΤΩΝ ΝΟΣΟΚΟΜΕΙΑΚΩΝ ΛΟΙΜΩΞΕΩΝ ΕΦΑΡΜΟΓΕΣ ΣΤΗ ΚΑΘΗΜΕΡΙΝΗ ΠΡΑΞΗ ΔΥΝΑΤΟΤΗΤΕΣ ΠΡΟΟΠΤΙΚΕΣ» ΛΑΜΙΑ 21 22 22 ΟΚΤΩΒΡΙΟΥ 2005 ΤΟ ΕΡΓΑΣΤΗΡΙΟ ΚΛΙΝΙΚΗΣ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ ΣΤΟΝ ΕΛΕΓΧΟ ΤΩΝ

Διαβάστε περισσότερα

Από την Ανόσόηλεκτρόφό ρηση στην Ανόσόκαθη λωση και Ανοσοαφαίρεση-Τριχοειδούς Ηλεκτροφόρησης

Από την Ανόσόηλεκτρόφό ρηση στην Ανόσόκαθη λωση και Ανοσοαφαίρεση-Τριχοειδούς Ηλεκτροφόρησης Από την Ανόσόηλεκτρόφό ρηση στην Ανόσόκαθη λωση και Ανοσοαφαίρεση-Τριχοειδούς Ηλεκτροφόρησης (immunosubtraction capillary electrophoresis (IS-CE)) Xρήστος Ντίνας Βιοχημικός-Κλινικός Χημικός Υπεύθυνος Εργαστηρίου

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

Δ. Ιακωβίδης. Πνευμονολόγος Aν. Διευθυντής Μονάδα επεμβατικής Πνευμονολογίας Γ.Π.Ν. «Γ. Παπανικολάου

Δ. Ιακωβίδης. Πνευμονολόγος Aν. Διευθυντής Μονάδα επεμβατικής Πνευμονολογίας Γ.Π.Ν. «Γ. Παπανικολάου Δ. Ιακωβίδης Πνευμονολόγος Aν. Διευθυντής Μονάδα επεμβατικής Πνευμονολογίας Γ.Π.Ν. «Γ. Παπανικολάου Νέα διαγνωστικά μέσα για τη λανθάνουσα φυματίωση Η στοχευμένη δοκιμασία δερματικής φυματινοαντίδρασης

Διαβάστε περισσότερα

ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR)

ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR) ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR) Α. ΘΕΩΡΗΤΙΚΟ ΜΕΡΟΣ Σταμάτης Κουσίσης, Δημοσθένης Κίζης, Δήμητρα Χούχουλα Βασική αρχή της Αλυσιδωτής Αντίδρασης της Πολυμεράσης

Διαβάστε περισσότερα

PCR Εφαρμογές-2. RACE Site directed mutagenesis

PCR Εφαρμογές-2. RACE Site directed mutagenesis PCR Εφαρμογές-2 RACE Site directed mutagenesis Σκοπός της αντίδρασης PCR (Polymerase Chain Reaction) είναι το να φτιάξει ένα μεγάλο αριθμό αντιγράφων. BHMATA 1. ΑΠΟΔΙΑΤΑΞΗ 2. ΥΒΡΙΔΙΣΜΟΣ 3. ΕΠΙΜΗΚΥΝΣΗ Επειδή

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της...

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... Γενετική Μηχανική o Περιλαμβάνει όλες τις τεχνικές με τις οποίες μπορούμε να επεμβαίνουμε στο γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης ΕΙΣΑΓΩΓΗ Σύμφωνα με την ΠΟΥ το 1/3 περίπου του παγκόσμιου πληθυσμού είναι μολυσμένο

Διαβάστε περισσότερα

Εργαστηριακή Διάγνωση της HIV λοίμωξης. Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ

Εργαστηριακή Διάγνωση της HIV λοίμωξης. Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ Εργαστηριακή Διάγνωση της HIV λοίμωξης Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ Διάγνωση της HIV λοίμωξης Από το 1985 και μέχρι σήμερα η διαγνωστική διαδικασία

Διαβάστε περισσότερα

Αρχές Πειραματικής. Έρευνας

Αρχές Πειραματικής. Έρευνας ΕΛΑΧΙΣΤΑ ΕΠΕΜΒΑΤΙΚΗ ΧΕΙΡΟΥΡΓΙΚΗ, ΡΟΜΠΟΤΙΚΗ ΧΕΙΡΟΥΡΓΙΚΗ ΚΑΙ ΤΗΛΕΧΕΙΡΟΥΡΓΙΚΗ Αρχές Πειραματικής Χειρουργικής και Χειρουργικής Έρευνας ΕΡΓΑΣΤΗΡΙΟ ΠΕΙΡΑΜΑΤΙΚΗΣ ΧΕΙΡΟΥΡΓΙΚΗΣ ΚΑΙ ΧΕΙΡΟΥΡΓΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΠΕΙΡΑΜΑΤΙΚΗΣ

Διαβάστε περισσότερα

Βασικές αρχές Ιατρικής Μικροβιολογίας

Βασικές αρχές Ιατρικής Μικροβιολογίας Σελίδες 1 έως 5 ΕΞΕΤΑΣΤΕΑ ΥΛΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ Για τους φοιτητές Β εξαμήνου ΦΑΡΜΑΚΕΥΤΙΚΟΥ ΤΜΗΜΑΤΟΣ Παν/κό έτος 2011-2012 Ύλη αποτελεί η θεματολογία των μαθημάτων (αμφιθεάτρου, εργαστηρίων, φροντιστηρίων)

Διαβάστε περισσότερα

ΠΡΟΔΙΑΓΡΑΦΕΣ ΓΡΗΓΟΡΩΝ ΤΕΣΤ. C. difficile GDH / Toxin A / Toxin B

ΠΡΟΔΙΑΓΡΑΦΕΣ ΓΡΗΓΟΡΩΝ ΤΕΣΤ. C. difficile GDH / Toxin A / Toxin B ΠΡΟΔΙΑΓΡΑΦΕΣ ΓΡΗΓΟΡΩΝ ΤΕΣΤ C. difficile GDH / Toxin A / Toxin B Πλήρες κιτ ανοσοχρωματογραφίας ενός βήματος για την ταυτόχρονη ποιοτική ανίχνευση και διαφοροποίηση των GDH / Toxin A / Toxin B του C. Difficile

Διαβάστε περισσότερα

ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ

ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ Η συµβολή της µοριακής ανάλυσης Eλισάβετ Οικονοµάκη Βιολόγος Αιµοπαθολογοανατοµικό Εργαστήριο ΠΓΝΑ > ΜΟΡΙΑΚΕΣ ΜΕΘΟ ΟΙ (Μη µορφολογικές) Αλυσιδωτή Αντίδραση Πολυµεράσης

Διαβάστε περισσότερα

ΔΙΑΓΝΩΣΤΙΚΈΣ ΔΟΚΙΜΑΣΊΕΣ

ΔΙΑΓΝΩΣΤΙΚΈΣ ΔΟΚΙΜΑΣΊΕΣ ΔΙΑΓΝΩΣΤΙΚΈΣ ΔΟΚΙΜΑΣΊΕΣ Εμμανουήλ Σμυρνάκης Λέκτορας Πρωτοβάθμιας Φροντίδας Υγείας Ιατρικής Σχολής ΑΠΘ smyrnak@auth.gr Θέματα Διαγνωστικές Δοκιμασίες Μέτρα Εγκυρότητας Ευαισθησία Ειδικότητα Θετική και

Διαβάστε περισσότερα

Προϋποθέσεις εφαρμογής των μοριακών τεχνικών

Προϋποθέσεις εφαρμογής των μοριακών τεχνικών Προϋποθέσεις εφαρμογής των μοριακών τεχνικών Α. Μεντής ιαγνωστικό Εργαστήριο Λοιμωδών Νοσημάτων Εθνικό Εργαστήριο Αναφοράς Γρίπης Νοτίου Ελλάδος Εθνικό Εργαστήριο Αναφοράς Ερυθράς/Ιλαράς Ελλάδος, Εθνικό

Διαβάστε περισσότερα

Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp.

Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp. Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp. 5 ο Πανελλήνιο Συνέδριο Ιατρικής Βιοπαθολογίας Η εφαρμογή μοριακών

Διαβάστε περισσότερα

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

Reagent Β: n º 1 φιαλίδιο x 5 ml.υγρό αντιδραστήριο, έτοιμο προς χρήση.

Reagent Β: n º 1 φιαλίδιο x 5 ml.υγρό αντιδραστήριο, έτοιμο προς χρήση. -Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ ΠΡΟΟΡΙΖΟΜΕΝΗ ΧΡΗΣΗ Διαγνωστική ανοσονεφελομετρική εξέταση για τον ποσοτικό προσδιορισμό των αντισωμάτων της Ανοσοσφαιρίνης G ( IGG ) σε ανθρώπινο ΕΝΥ με

Διαβάστε περισσότερα

ΑΤΕΙΘ Β ΕΞΑΜΗΝΟ Πεδίο Β2-Μοριακή προ- και μετα-γεννητική διάγνωση ασθενειών Συμμετρίες και μοριακή θερμοδυναμική βιομορίων

ΑΤΕΙΘ Β ΕΞΑΜΗΝΟ Πεδίο Β2-Μοριακή προ- και μετα-γεννητική διάγνωση ασθενειών Συμμετρίες και μοριακή θερμοδυναμική βιομορίων ΑΤΕΙΘ Β ΕΞΑΜΗΝΟ 15/10/2015 Πέμπτη ( Ηλεκτρονικά) 16.00 18.00 Πεδίο Β2-Μοριακή προ- και μετα-γεννητική διάγνωση ασθενειών Συμμετρίες και μοριακή θερμοδυναμική βιομορίων Γενική επισκόπηση μεθόδων που χρησιμοποιούνται

Διαβάστε περισσότερα

4 ο Πανελλήνιο Συμπόσιο Φυματίωσης Εταιρεία Μελέτης Πνευμονοπαθειών και Επαγγελματικών Παθήσεων Θώρακος Σάββατο 19 Μαρτίου 2011

4 ο Πανελλήνιο Συμπόσιο Φυματίωσης Εταιρεία Μελέτης Πνευμονοπαθειών και Επαγγελματικών Παθήσεων Θώρακος Σάββατο 19 Μαρτίου 2011 4 ο Πανελλήνιο Συμπόσιο Φυματίωσης Εταιρεία Μελέτης Πνευμονοπαθειών και Επαγγελματικών Παθήσεων Θώρακος Σάββατο 19 Μαρτίου 2011 ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΕΡΕΥΝΗΣΗ ΤΗΣ ΦΥΜΑΤΙΩΣΗΣ ΜΙΚΡΟΒΙΟΛΟΓΙΚΟ ΕΡΓΑΣΤΗΡΙΟ Γ.Ν.Θ «Γ.

Διαβάστε περισσότερα

ΒΑΣΙΚΕΣ ΕΝΝΟΙΕΣ ΣΤΗΝ ΕΝΟΡΓΑΝΗ ΑΝΑΛΥΣΗ

ΒΑΣΙΚΕΣ ΕΝΝΟΙΕΣ ΣΤΗΝ ΕΝΟΡΓΑΝΗ ΑΝΑΛΥΣΗ ΒΑΣΙΚΕΣ ΕΝΝΟΙΕΣ ΣΤΗΝ ΕΝΟΡΓΑΝΗ ΑΝΑΛΥΣΗ Αναλυτική Μέθοδος- Αναλυτικό Πρόβλημα. Ανάλυση, Προσδιορισμός και Μέτρηση. Πρωτόκολλο. Ευαισθησία Μεθόδου. Εκλεκτικότητα. Όριο ανίχνευσης (limit of detection, LOD).

Διαβάστε περισσότερα

Μέθοδοι Ανίχνευσης Αντιγόνων Αντισωμάτων

Μέθοδοι Ανίχνευσης Αντιγόνων Αντισωμάτων Μέθοδοι Ανίχνευσης Αντιγόνων Αντισωμάτων Νεφελομετρία Ανοσοφθορισμός ΝΕΦΕΛΟΜΕΤΡΙΑ Πρόκειται για μέθοδο συγκέντρωσης διάφορων ουσιών στα βιολογικά υγρά κυρίως πρωτεΐνες που αντιδρούν με αντισώματα σχηματίζοντας

Διαβάστε περισσότερα

ΣΥΣΧΕΤΙΣΗ ΓΕΝΕΤΙΚΩΝ ΠΟΛΥΜΟΡΦΙΣΜΩΝ ΣΤΟ ΓΟΝΙ Ι0 MYD88 ΜΕ ΤΗΝ ΑΝΑΠΤΥΞΗ ΦΥΜΑΤΙΩΣΗΣ

ΣΥΣΧΕΤΙΣΗ ΓΕΝΕΤΙΚΩΝ ΠΟΛΥΜΟΡΦΙΣΜΩΝ ΣΤΟ ΓΟΝΙ Ι0 MYD88 ΜΕ ΤΗΝ ΑΝΑΠΤΥΞΗ ΦΥΜΑΤΙΩΣΗΣ ΣΥΣΧΕΤΙΣΗ ΓΕΝΕΤΙΚΩΝ ΠΟΛΥΜΟΡΦΙΣΜΩΝ ΣΤΟ ΓΟΝΙ Ι MYD88 ΜΕ ΤΗΝ ΑΝΑΠΤΥΞΗ ΦΥΜΑΤΙΩΣΗΣ Φωτεινή Μάλλη 1, Ειρήνη Γερογιάννη 1 Καλλιόπη Αγγέλου 1, Βίκυ Μολλάκη 2, Φωτεινή Μπαρδάκα 1, Κωνσταντίνος Ι. Γουργουλιάνης

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ)

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» Department of Biochemistry

Διαβάστε περισσότερα

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ Μανδηλαρά Γεωργία Βιολόγος PhD, Επιστημονικός Συνεργάτης Εθνική Σχολή Δημόσιας Υγείας Τμήμα Μικροβιολογίας Υδατογενείς λοιμώξεις: χρήση νερού

Διαβάστε περισσότερα

-Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ

-Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ -Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ ΠΡΟΟΡΙΖΟΜΕΝΗ ΧΡΗΣΗ Διαγνωστική ανοσονεφελομετρική εξέταση για τον ποσοτικό προσδιορισμό του Συμπληρώματος C4 ( C4 ) σε ανθρώπινο ορό ή πλάσμα με το σύστημα

Διαβάστε περισσότερα

Δομή και λειτουργία προκαρυωτικού κυττάρου

Δομή και λειτουργία προκαρυωτικού κυττάρου Δομή και λειτουργία προκαρυωτικού κυττάρου Ιωσήφ Παπαπαρασκευάς Βιοπαθολόγος, Επ. Καθηγητής ΕΚΠΑ Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή ipapapar@med.uoa.gr Γιατί πρέπει να γνωρίζουμε την δομή και τη

Διαβάστε περισσότερα

Σύντομη Περιγραφή Συνολικής Προόδου Φυσικού Αντικειμένου από την έναρξη του έργου μέχρι τις 30/06/2015

Σύντομη Περιγραφή Συνολικής Προόδου Φυσικού Αντικειμένου από την έναρξη του έργου μέχρι τις 30/06/2015 Σύντομη Περιγραφή Συνολικής Προόδου Φυσικού Αντικειμένου από την έναρξη του έργου μέχρι τις 30/06/2015 Δ1: Συντονισμός του έργου. Προκηρύξεις και επιλογή εξωτερικών επιστημονικών συνεργατών. Ολοκλήρωση

Διαβάστε περισσότερα

ΜΟΡΙΑΚΗ ΑΝΙΧΝΕΥΣΗ ΚΑΙ ΔΙΕΡΕΥΝΗΣΗ ΤΗΣ ΜΙΚΡΟΒΙΑΚΗΣ ΑΝΤΟΧΗΣ

ΜΟΡΙΑΚΗ ΑΝΙΧΝΕΥΣΗ ΚΑΙ ΔΙΕΡΕΥΝΗΣΗ ΤΗΣ ΜΙΚΡΟΒΙΑΚΗΣ ΑΝΤΟΧΗΣ ΗΜΕΡΙΔΑ ΕΦΑΡΜΟΣΜΕΝΗΣ ΚΛΙΝΙΚΗΣ ΚΑΙ ΔΙΑΓΝΩΣΤΙΚΗΣ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ 24 ΙΑΝΟΥΑΡΙΟΥ 2009 ΜΟΡΙΑΚΗ ΑΝΙΧΝΕΥΣΗ ΚΑΙ ΔΙΕΡΕΥΝΗΣΗ ΤΗΣ ΜΙΚΡΟΒΙΑΚΗΣ ΑΝΤΟΧΗΣ Ε. ΠΕΤΕΙΝΑΚΗ ΕΡΓΑΣΤΗΡΙΟ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ ΙΑΤΡΙΚΗΣ ΣΧΟΛΗΣ ΠΑΝΕΠΙΣΤΗΜΙΟΥ

Διαβάστε περισσότερα

- Ενισχυμένη με latex νεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ

- Ενισχυμένη με latex νεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ - Ενισχυμένη με latex νεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ ΠΡΟΟΡΙΖΟΜΕΝΗ ΧΡΗΣΗ Διαγνωστική ανοσονεφελομετρική latex εξέταση για τον ποσοτικό προσδιορισμό της β-2 Μικροσφαιρίνης (Uβ2M) σε ανθρώπινα

Διαβάστε περισσότερα

ΝΕΟΤΕΡΕΣ ΜΕΘΟΔΟΙ ΔΙΑΓΝΩΣΗΣ ΛΟΙΜΩΞΕΩΝ

ΝΕΟΤΕΡΕΣ ΜΕΘΟΔΟΙ ΔΙΑΓΝΩΣΗΣ ΛΟΙΜΩΞΕΩΝ ΝΕΟΤΕΡΕΣ ΜΕΘΟΔΟΙ ΔΙΑΓΝΩΣΗΣ ΛΟΙΜΩΞΕΩΝ Ο ΡΟΛΟΣ ΤΟΥ ΚΛΙΝΙΚΟΥ ΜΙΚΡΟΒΙΟΛΟΓΙΚΟΥ ΕΡΓΑΣΤΗΡΙΟΥ ΕΙΝΑΙ Η ΔΙΑΓΝΩΣΗ ΤΟΥ ΑΙΤΙΟΛΟΓΙΚΟΥ ΠΑΡΑΓΟΝΤΑ ΤΗΣ ΛΟΙΜΩΞΗΣ ΤΕΛΟΣ ΤΗΣ ΕΜΠΕΙΡΙΚΗΣ ΘΕΡΑΠΕΙΑΣ ΔΙΑΓΝΩΣΗ ΤΗΣ ΒΑΚΤΗΡΙΑΚΗΣ ΛΟΙΜΩΞΗΣ

Διαβάστε περισσότερα

Η ΑΝΑΓΚΗ ΓΙΑ ΠΟΣΟΤΙΚΟΠΟΙΗΣΗ ΣΤΗΝ ΕΝΟΡΓΑΝΗ ΑΝΑΛΥΣΗ

Η ΑΝΑΓΚΗ ΓΙΑ ΠΟΣΟΤΙΚΟΠΟΙΗΣΗ ΣΤΗΝ ΕΝΟΡΓΑΝΗ ΑΝΑΛΥΣΗ Η ΑΝΑΓΚΗ ΓΙΑ ΠΟΣΟΤΙΚΟΠΟΙΗΣΗ ΣΤΗΝ ΕΝΟΡΓΑΝΗ ΑΝΑΛΥΣΗ Οι Ενόργανες Μέθοδοι Ανάλυσης είναι σχετικές μέθοδοι και σχεδόν στο σύνολο τους παρέχουν την αριθμητική τιμή μιας φυσικής ή φυσικοχημικής ιδιότητας, η

Διαβάστε περισσότερα

-Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ

-Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ -Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ ΠΡΟΟΡΙΖΟΜΕΝΗ ΧΡΗΣΗ Διαγνωστική ανοσονεφελομετρική εξέταση για τον ποσοτικό προσδιορισμό απτοσφαιρίνης ( HPT ) σε ανθρώπινο ορό ή πλάσμα με το σύστημα EasyNeph.

Διαβάστε περισσότερα

ΟΙ ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΣΤΗΝ ΙΑΤΡΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Eφη. Πετεινάκη

ΟΙ ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΣΤΗΝ ΙΑΤΡΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Eφη. Πετεινάκη ΟΙ ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΣΤΗΝ ΙΑΤΡΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Eφη Πετεινάκη ΠΡΟΒΛΗΜΑΤΑ ΡΟΥΤΙΝΑΣ ΕΝΟΣ ΚΛΙΝΙΚΟΥ ΜΙΚΡΟΒΙΟΛΟΓΙΚΟΥ ΕΡΓΑΣΤΗΡΙΟΥ ταυτοποίηση κάποιων βακτηρίων ο έλεγχος ευαισθησίας διάγνωση λοιμώξεων από μικροοργανισμούς

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ)

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΤΜΗΜΑ

Διαβάστε περισσότερα

-Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ

-Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ -Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ ΠΡΟΟΡΙΖΟΜΕΝΗ ΧΡΗΣΗ Διαγνωστική ανοσονεφελομετρική εξέταση για τον ποσοτικό προσδιορισμό της α1 απολιποπρωτεΐνης ( APA ) σε ανθρώπινο ορό ή πλάσμα με το σύστημα

Διαβάστε περισσότερα

ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΕΛΕΥΘΕΡΩΝ ΕΛΑΦΡΩΝ ΑΛΥΣΕΩΝ ΣΤΟΝ ΟΡΟ ΚΑΙ ΣΤΑ ΟΥΡΑ. Χρυσούλα Νικολάου

ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΕΛΕΥΘΕΡΩΝ ΕΛΑΦΡΩΝ ΑΛΥΣΕΩΝ ΣΤΟΝ ΟΡΟ ΚΑΙ ΣΤΑ ΟΥΡΑ. Χρυσούλα Νικολάου ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΕΛΕΥΘΕΡΩΝ ΕΛΑΦΡΩΝ ΑΛΥΣΕΩΝ ΣΤΟΝ ΟΡΟ ΚΑΙ ΣΤΑ ΟΥΡΑ Χρυσούλα Νικολάου Μονοκλωνικές ελεύθερες ελαφρές αλύσεις Οι μονοκλωνικές ελεύθερες ελαφρές αλύσεις οι οποίες είναι γνωστές ως πρωτεΐνη Bence

Διαβάστε περισσότερα

Μικροβιολογία Τροφίμων Ι Εργαστήριο

Μικροβιολογία Τροφίμων Ι Εργαστήριο Μικροβιολογία Τροφίμων Ι Εργαστήριο Ενότητα 10: Μοριακή Βιολογία και Μικροβιολογία Τροφίμων (2/2), 2ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Ευστάθιος Ζ. Πανάγου Πασχαλίτσα

Διαβάστε περισσότερα

-Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ

-Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ -Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ ΠΡΟΟΡΙΖΟΜΕΝΗ ΧΡΗΣΗ Διαγνωστική ανοσονεφελομετρική εξέταση για τον ποσοτικό προσδιορισμό των λ-ελαφρών Αλυσίδων της Ανοσοσφαιρίνης ( Ελεύθερες και Δεσμευμένες)

Διαβάστε περισσότερα

ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΤΟΥ ΓΕΝΟΥΣ ΤΩΝ ΜΥΚΟΒΑΚΤΗΡΙΔΙΩΝ

ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΤΟΥ ΓΕΝΟΥΣ ΤΩΝ ΜΥΚΟΒΑΚΤΗΡΙΔΙΩΝ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΤΟΥ ΓΕΝΟΥΣ ΤΩΝ ΜΥΚΟΒΑΚΤΗΡΙΔΙΩΝ Γένος Μycobacterium (G+C 60-70% DNA) Μέγεθος:0.2-0.6 * 1-10 μm Αερόβιο, μη-κινητό,δεν σχηματίζει σπόρια. Ανθίστανται στον αποχρωματισμό από οξέα-αλκοόλη Θεωρούνται

Διαβάστε περισσότερα

Κατάλληλη επεξεργασία FNA μαστού σε υγρή μορφή προς μικροσκόπιση

Κατάλληλη επεξεργασία FNA μαστού σε υγρή μορφή προς μικροσκόπιση ΤΕΙ ΑΘΗΝΑΣ ΣΧΟΛΗ ΕΠΑΓΓΕΛΜΑΤΩΝ ΥΓΕΙΑΣ ΚΑΙ ΠΡΟΝΟΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΩΝ ΕΡΓΑΣΗΡΙΩΝ Κατάλληλη επεξεργασία FNA μαστού σε υγρή μορφή προς μικροσκόπιση Εργαστήριο κυτταρολογικό στο ΓΝΑ ΛΑΙΚΟ Ιωάννα Χαραλάμπους Α.Μ

Διαβάστε περισσότερα

ΗΛΕΚΤΡΟΦΟΡΗΣΗ ΠΡΩΤΕΙΝΩΝ

ΗΛΕΚΤΡΟΦΟΡΗΣΗ ΠΡΩΤΕΙΝΩΝ ΗΛΕΚΤΡΟΦΟΡΗΣΗ ΠΡΩΤΕΙΝΩΝ Άννα-Μαρία Ψαρρά ΤΒΒ, Παν/μιο Θεσσαλίας Λάρισα 2015 ΗΛΕΚΤΡΟΦΟΡΗΣΗ Αναλυτικός τρόπος διαχωρισμού πρωτεϊνών και άλλων μακρομορίων όπως πρωτεϊνών DNA, RNA Αρχή της μεθόδου Μόρια που

Διαβάστε περισσότερα

- Ανοσονεφελομετρική μέθοδος

- Ανοσονεφελομετρική μέθοδος - Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ ΠΡΟΟΡΙΖΟΜΕΝΗ ΧΡΗΣΗ Διαγνωστική ανοσονεφελομετρική εξέταση για τον ποιοτικό προσδιορισμό της α-1 Αντιθρυψίνης ( ΑΑΤ ) σε ανθρώπινο ορό ή πλάσμα με το σύστημα

Διαβάστε περισσότερα

Reagent Β: n º 1 φιαλίδιο x 5 ml.υγρό αντιδραστήριο, έτοιμο προς χρήση.

Reagent Β: n º 1 φιαλίδιο x 5 ml.υγρό αντιδραστήριο, έτοιμο προς χρήση. -Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ ΠΡΟΟΡΙΖΟΜΕΝΗ ΧΡΗΣΗ Διαγνωστική ανοσονεφελομετρική εξέταση για τον ποσοτικό προσδιορισμό Συμπληρώματος ( C3 ) σε ανθρώπινο ορό ή πλάσμα με το σύστημα EasyNeph.

Διαβάστε περισσότερα

-Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ

-Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ -Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ ΠΡΟΟΡΙΖΟΜΕΝΗ ΧΡΗΣΗ Διαγνωστική ανοσονεφελομετρική εξέταση για τον ποσοτικό προσδιορισμό της α-1 Όξινης Γλυκοπρωτεΐνης ( AGP ) σε ανθρώπινο ορό ή πλάσμα με

Διαβάστε περισσότερα

ΕΝΟΤΗΤΑ Α ΑΝΑΛΥΤΗΣ ΓΙΑ ΑΝΟΣΟΧΗΜΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΜΕ ΤΗ ΜΕΘΟΔΟ ΤΗΣ ΧΗΜΕΙΟΦΩΤΑΥΓΕΙΑΣ

ΕΝΟΤΗΤΑ Α ΑΝΑΛΥΤΗΣ ΓΙΑ ΑΝΟΣΟΧΗΜΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΜΕ ΤΗ ΜΕΘΟΔΟ ΤΗΣ ΧΗΜΕΙΟΦΩΤΑΥΓΕΙΑΣ ΕΝΟΤΗΤΑ Α ΑΝΑΛΥΤΗΣ ΓΙΑ ΑΝΟΣΟΧΗΜΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΜΕ ΤΗ ΜΕΘΟΔΟ ΤΗΣ ΧΗΜΕΙΟΦΩΤΑΥΓΕΙΑΣ Τεχνικές προδιαγραφές Αυτόματου Ανοσοχημικού αναλυτή με την μέθοδο της χημειοφωταύγειας 1. Ο Αναλυτής να είναι τυχαίας (random),

Διαβάστε περισσότερα

ΕΡΓΑΣΙΕΣ ΜΕ ΔΙΑΛΥΜΑΤΑ Γραμμομοριακή συγκέντρωση διαλυμάτων

ΕΡΓΑΣΙΕΣ ΜΕ ΔΙΑΛΥΜΑΤΑ Γραμμομοριακή συγκέντρωση διαλυμάτων ΕΡΓΑΣΙΕΣ ΜΕ ΔΙΑΛΥΜΑΤΑ Γραμμομοριακή συγκέντρωση διαλυμάτων Συγκέντρωση διαλύματος: ποσότητα διαλυμένης ουσίας σε καθορισμένη ποσότητα διαλύματος Αραιό διάλυμα: μικρή συγκέντρωση διαλυμένης ουσίας Πυκνό

Διαβάστε περισσότερα

Ορισμός Αναλυτικής Χημείας

Ορισμός Αναλυτικής Χημείας Ορισμός Αναλυτικής Χημείας Αναλυτική Χημεία ορίζεται ως ο επιστημονικός κλάδος, που αναπτύσσει και εφαρμόζει μεθόδους, όργανα και στρατηγικές, για να δώσει πληροφορίες σχετικά με τη σύσταση και φύση υλικών

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Στην τρέχουσα παρουσίαση δεν υφίσταται σύγκρουση συμφερόντων

Στην τρέχουσα παρουσίαση δεν υφίσταται σύγκρουση συμφερόντων Δοκιμασίες κοπράνων Γιώργος Χουλιάρας, Παιδογαστρεντερολόγος, Πανεπιστημιακός Υπότροφος, Υπεύθυνος Ενδοσκοπήσεων & Ιατρείου Ιδιοπαθών Φλεγμονωδών Nοσημάτων του Εντέρου Μονάδα Γαστρεντερολογίας και Διατροφής

Διαβάστε περισσότερα

Φύλλο πρωτοκόλλου QIAsymphony SP

Φύλλο πρωτοκόλλου QIAsymphony SP Φεβρουάριος 2017 Φύλλο πρωτοκόλλου QIAsymphony SP circdna_2000_dsp_v1 and circdna_4000_dsp_v1 Το παρόν έγγραφο είναι το φύλλο πρωτοκόλλου QIAsymphony circdna_2000_dsp_v1 και circdna_4000_dsp_v1, έκδοση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

Ενόργανη Ανάλυση Εργαστήριο. Φασματοσκοπία πυρηνικού μαγνητικού συντονισμού Nuclear Magnetic Resonance spectroscopy, NMR. Πέτρος Α.

Ενόργανη Ανάλυση Εργαστήριο. Φασματοσκοπία πυρηνικού μαγνητικού συντονισμού Nuclear Magnetic Resonance spectroscopy, NMR. Πέτρος Α. Ενόργανη Ανάλυση Εργαστήριο Φασματοσκοπία πυρηνικού μαγνητικού συντονισμού Πέτρος Α. Ταραντίλης 1 Βασικές αρχές Που βασίζεται; Στη μέτρηση της απορρόφησης της ακτινοβολίας στην περιοχή των ραδιοσυχνοτήτων

Διαβάστε περισσότερα

ΔΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ

ΔΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΔΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ Εργαστηριακή αξιολόγηση της αξιοπιστίας του strep testστη διάγνωση και τον καθορισμό της κατάλληλης αντιβιοτικής αγωγής σε ασθενείς με οξεία πυώδη αμυγδαλίτιδα

Διαβάστε περισσότερα

Προβλήματα σχετιζόμενα με την τυποποίηση αντιγόνων Ι

Προβλήματα σχετιζόμενα με την τυποποίηση αντιγόνων Ι Β Προβλήματα Φαινότυπος Β(Α): ασθενής αντίδραση με αντι-α, έντονη αντίδραση με αντι-β, και ο ορός αντιδρά με ερυθρά Α₁. Ο αντιορός Α περιέχει τον κλώνο ΜΗΟ4? Επίκτητος Β φαινότυπος: έντονη αντίδραση με

Διαβάστε περισσότερα

-Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ

-Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ -Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ ΠΡΟΟΡΙΖΟΜΕΝΗ ΧΡΗΣΗ Διαγνωστική ανοσονεφελομετρική εξέταση για τον ποσοτικό προσδιορισμό της σερουλοπλασμίνης ( CER ) σε ανθρώπινο ορό ή πλάσμα με το σύστημα

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΗ ΠΡΟΣΕΓΓΙΣΗ ΣΕ ΑΣΘΕΝΗ ΜΕ ΠΙΘΑΝΗ ΜΟΝΟΚΛΩΝΙΚΗ ΓΑΜΜΑΣΦΑΙΡΙΝΟΠΑΘΕΙΑ. Φ.ΠΑΛΗΟΓΙΑΝΝΗ Καθηγήτρια Μικροβιολογίας-Ανοσολογίας Λοιμώξεων

ΕΡΓΑΣΤΗΡΙΑΚΗ ΠΡΟΣΕΓΓΙΣΗ ΣΕ ΑΣΘΕΝΗ ΜΕ ΠΙΘΑΝΗ ΜΟΝΟΚΛΩΝΙΚΗ ΓΑΜΜΑΣΦΑΙΡΙΝΟΠΑΘΕΙΑ. Φ.ΠΑΛΗΟΓΙΑΝΝΗ Καθηγήτρια Μικροβιολογίας-Ανοσολογίας Λοιμώξεων ΕΡΓΑΣΤΗΡΙΑΚΗ ΠΡΟΣΕΓΓΙΣΗ ΣΕ ΑΣΘΕΝΗ ΜΕ ΠΙΘΑΝΗ ΜΟΝΟΚΛΩΝΙΚΗ ΓΑΜΜΑΣΦΑΙΡΙΝΟΠΑΘΕΙΑ Φ.ΠΑΛΗΟΓΙΑΝΝΗ Καθηγήτρια Μικροβιολογίας-Ανοσολογίας Λοιμώξεων Multiple Myeloma 18% (185) Amyloidosis (AL) 10% (106) Lymphoma

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 8 ο...2 I. Εφαρµογές της βιοτεχνολογίας στην ιατρική...2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ...7 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ...

ΚΕΦΑΛΑΙΟ 8 ο...2 I. Εφαρµογές της βιοτεχνολογίας στην ιατρική...2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ...7 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ... ΚΕΦΑΛΑΙΟ 8 ο ΚΕΦΑΛΑΙΟ 8 ο...2 I. Εφαρµογές της βιοτεχνολογίας στην ιατρική...2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ...7 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ...10 1 ΚΕΦΑΛΑΙΟ 8 ο I. Εφαρµογές της βιοτεχνολογίας

Διαβάστε περισσότερα

ΒΙΟΤΡΟΜΟΚΡΑΤΙΑ ΜΕ ΛΟΙΜΩΔΕΙΣ

ΒΙΟΤΡΟΜΟΚΡΑΤΙΑ ΜΕ ΛΟΙΜΩΔΕΙΣ ΒΙΟΤΡΟΜΟΚΡΑΤΙΑ ΜΕ ΛΟΙΜΩΔΕΙΣ ΠΑΡΑΓΟΝΤΕΣ ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΕΡΕΥΝΗΣΗ Βασιλική Γεννηματά Αν. Καθηγήτρια Μικροβιολογίας, Ιατρική Σχολή ΕΚΠΑ ΒΙΟΤΡΟΜΟΚΡΑΤΙΚH ΕΠIΘΕΣΗ Ορισμός CDC: Σκόπιμη απελευθέρωση Iών, βακτηρίων,

Διαβάστε περισσότερα

ΝΕΕΣ MΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΓΙΑ ΤΗΝ ΤΥΠΟΠΟΙΗΣΗ ΤΩΝ ΒΑΚΤΗΡΙΩΝ

ΝΕΕΣ MΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΓΙΑ ΤΗΝ ΤΥΠΟΠΟΙΗΣΗ ΤΩΝ ΒΑΚΤΗΡΙΩΝ ΝΕΕΣ MΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΓΙΑ ΤΗΝ ΤΥΠΟΠΟΙΗΣΗ ΤΩΝ ΒΑΚΤΗΡΙΩΝ ΑΠΟΣΤΟΛΟΣ ΒΑΝΤΑΡΑΚΗΣ ΒΙΟΛΟΓΟΣ (M.Sc, Ph.D) Επιδημίες μολυσματικών ασθενειών συχνά οφείλονται σε έκθεση σε μία κοινή πηγή ενός αιτιολογικού παράγοντα.

Διαβάστε περισσότερα

Δομή και χημεία Νουκλεοτιδίων και Νουκλεϊκών οξέων DNA/RNA

Δομή και χημεία Νουκλεοτιδίων και Νουκλεϊκών οξέων DNA/RNA Δομή και χημεία Νουκλεοτιδίων και Νουκλεϊκών οξέων DNA/RNA Χρήστος Κρούπης, MSc, PhD Επίκουρος Καθηγητής Κλινικής Βιοχημείας Ιατρική Σχολή Πανεπιστημίου Αθηνών Αττικόν Πανεπιστημιακό Νοσοκομείο Lehninger

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 4 ΙΟΥΝΙΟΥ 2014 ΕΚΦΩΝΗΣΕΙΣ ÓÕÃ ÑÏÍÏ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 4 ΙΟΥΝΙΟΥ 2014 ΕΚΦΩΝΗΣΕΙΣ ÓÕÃ ÑÏÍÏ Θέµα Α ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 4 ΙΟΥΝΙΟΥ 2014 ΕΚΦΩΝΗΣΕΙΣ Στις προτάσεις Α1 και Α2 να γράψετε στο τετράδιό σας τον αριθµό της πρότασης και, δίπλα,

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΚΑΙ ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ. ΕΡΓΑΣΤΗΡΙΑΚΗ ΙΕΡΕΥΝΗΣΗ ΚΡΟΥΣΜΑΤΩΝ ΥΠΟΠΤΩΝ ΓΙΑ ΓΡΙΠΗ ΠΤΗΝΩΝ εκέµβριος 2005

ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΚΑΙ ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ. ΕΡΓΑΣΤΗΡΙΑΚΗ ΙΕΡΕΥΝΗΣΗ ΚΡΟΥΣΜΑΤΩΝ ΥΠΟΠΤΩΝ ΓΙΑ ΓΡΙΠΗ ΠΤΗΝΩΝ εκέµβριος 2005 ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΚΑΙ ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ ΕΡΓΑΣΤΗΡΙΑΚΗ ΙΕΡΕΥΝΗΣΗ ΚΡΟΥΣΜΑΤΩΝ ΥΠΟΠΤΩΝ ΓΙΑ ΓΡΙΠΗ ΠΤΗΝΩΝ εκέµβριος 2005 Για ασθενείς που διερευνώνται για γρίπη των πτηνών, η έγκαιρη επιβεβαίωση µε εργαστηριακές

Διαβάστε περισσότερα

ΕΙΣΑΓΩΓΗ ΣΤΗ ΒΙΟΛΟΓΙΑ

ΕΙΣΑΓΩΓΗ ΣΤΗ ΒΙΟΛΟΓΙΑ ΕΙΣΑΓΩΓΗ ΣΤΗ ΒΙΟΛΟΓΙΑ Εξάμηνο Υ/Ε Ώρες Θεωρίας Ώρες Ασκήσης Διδακτικές μονάδες ECTS A Υ 3 3 4 6 Διδάσκουσα Μ. Αλεξίου Χατζάκη, Επίκ. Καθηγήτρια Γεν. Βιολογίας. Aντικειμενικοί στόχοι του μαθήματος Οι στόχοι

Διαβάστε περισσότερα

Εργαστηριακές Δοκιμασίες που πραγματοποιούνται στο Π.Ε.Δ.Υ Κρήτης.

Εργαστηριακές Δοκιμασίες που πραγματοποιούνται στο Π.Ε.Δ.Υ Κρήτης. Εργαστηριακές Δοκιμασίες που πραγματοποιούνται στο Π.Ε.Δ.Υ Κρήτης. Είδος δείγματος Εξεταζόμενη παράμετρος Μέθοδος Πρότυπο Διαπιστευμένη Αρίθμηση μικροοργανισμών ενσωμάτωσης σε στερεό ΕΛΟΤ ΕΝ ISO 6222 καταμέτρηση

Διαβάστε περισσότερα

Έλεγχοι. Τη συγκέντρωση του φαρμάκου σε δείγμα ιστού ή βιολογικού υγρού

Έλεγχοι. Τη συγκέντρωση του φαρμάκου σε δείγμα ιστού ή βιολογικού υγρού Έλεγχοι Τη συγκέντρωση του φαρμάκου σε δείγμα ιστού ή βιολογικού υγρού Το ρυθμό απελευθέρωσης του φαρμάκου από το σκεύασμα Έλεγχο ταυτότητας και καθαρότητας της πρώτης ύλης και των εκδόχων( βάση προδιαγραφών)

Διαβάστε περισσότερα

- Ενισχυμένη με latex νεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ

- Ενισχυμένη με latex νεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ - Ενισχυμένη με latex νεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ ΠΡΟΟΡΙΖΟΜΕΝΗ ΧΡΗΣΗ Διαγνωστική ανοσονεφελομετρική latex εξέταση για τον ποσοτικό προσδιορισμό των Ρευματοειδών Παραγόντων ( RF ) σε ανθρώπινο

Διαβάστε περισσότερα

ΜΕΘΟΔΟΣ Ανοσονεφελομετρική υπερευαίσθητη μέθοδος ενισχυμένη με latex.

ΜΕΘΟΔΟΣ Ανοσονεφελομετρική υπερευαίσθητη μέθοδος ενισχυμένη με latex. - Ενισχυμένη με latex νεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ ΠΡΟΟΡΙΖΟΜΕΝΗ ΧΡΗΣΗ Διαγνωστική ανοσονεφελομετρική latex εξέταση για τον ποσοτικό προσδιορισμό της C Αντιδρώσας Πρωτεΐνης ( ΗS CRP ) σε ανθρώπινο

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Βιολογία Θετικής Κατεύθυνσης 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία ανασυνδυασμένου DNA Αναπτύχθηκε λόγω της ανακάλυψης: i. Περιοριστικών ενδονουκλεασών ii. Ειδικών φορέων DNA Έδωσε

Διαβάστε περισσότερα

artus EBV QS-RGQ Kit Χαρακτηριστικά απόδοσης Μάιος 2012 Sample & Assay Technologies Αναλυτική ευαισθησία πλάσμα

artus EBV QS-RGQ Kit Χαρακτηριστικά απόδοσης Μάιος 2012 Sample & Assay Technologies Αναλυτική ευαισθησία πλάσμα artus EBV QS-RGQ Kit Χαρακτηριστικά απόδοσης artus EBV QS-RGQ Kit, Έκδοση 1, 4501363 Ελέγξτε την διαθεσιμότητα νέων ηλεκτρονικών αναθεωρήσεων επισήμανσης στη διεύθυνση www.qiagen.com/products/artusebvpcrkit.aspx

Διαβάστε περισσότερα

Άσκηση Φαρμακευτικής Βιοτεχνολογίας

Άσκηση Φαρμακευτικής Βιοτεχνολογίας Άσκηση Φαρμακευτικής Βιοτεχνολογίας Χαρακτηρισμός Φαρμακογενετικών δεικτών με PCR-ARMS Θεωρητικό μέρος 1. Αλυσιδωτή αντίδραση Πολυμεράσης (PCR) Η αλυσιδωτή αντίδραση πολυμεράσης (polymerase chain reaction,

Διαβάστε περισσότερα

Απόστολος Πατσιάς Υπεύθυνος Χημικού-Μικροβιολογικού Εργαστηρίου «Η ΠΙΝΔΟΣ» Α.Π.Σ.Ι. ΕΛΙΝΥΑΕ-Πανεπιστήμιο Ιωαννίνων

Απόστολος Πατσιάς Υπεύθυνος Χημικού-Μικροβιολογικού Εργαστηρίου «Η ΠΙΝΔΟΣ» Α.Π.Σ.Ι. ΕΛΙΝΥΑΕ-Πανεπιστήμιο Ιωαννίνων Παράγοντες κινδύνου, μέτρα προστασίας εργαζομένων και εργαστήρια αυτοελέγχων & εφαρμοσμένης βιομηχανικής έρευνας Απόστολος Πατσιάς Υπεύθυνος Χημικού-Μικροβιολογικού Εργαστηρίου «Η ΠΙΝΔΟΣ» Α.Π.Σ.Ι. ΕΛΙΝΥΑΕ-Πανεπιστήμιο

Διαβάστε περισσότερα

artus CMV QS-RGQ Kit: Χαρακτηριστικά απόδοσης

artus CMV QS-RGQ Kit: Χαρακτηριστικά απόδοσης Σεπτέμβριος 2015 artus CMV QS-RGQ Kit: Χαρακτηριστικά απόδοσης artus CMV QS-RGQ Kit, Έκδοση 1 4503363 Ελέγξτε την διαθεσιμότητα νέων ηλεκτρονικών αναθεωρήσεων επισήμανσης στη διεύθυνση www.qiagen.com/products/artuscmvpcrkitce.aspx

Διαβάστε περισσότερα

To πρωτέωμα είναι η λειτουργική απεικόνιση του γονιδιώματος. Βιοχημεία Ι Γ-1

To πρωτέωμα είναι η λειτουργική απεικόνιση του γονιδιώματος. Βιοχημεία Ι Γ-1 To πρωτέωμα είναι η λειτουργική απεικόνιση του γονιδιώματος Βιοχημεία Ι Γ-1 καθαρισμός των πρωτεϊνών είναι το απαραίτητο πρώτο ήμα για να χαρακτηρίσουμε τη λειτουργικότητα μιας ρωτεΐνης σε φυσιολογικές

Διαβάστε περισσότερα

Μικροβιολογία Τροφίμων Ι Εργαστήριο

Μικροβιολογία Τροφίμων Ι Εργαστήριο Μικροβιολογία Τροφίμων Ι Εργαστήριο Ενότητα 10: Μοριακή Βιολογία και Μικροβιολογία Τροφίμων (1/2), 1ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Ευστάθιος Ζ. Πανάγου Πασχαλίτσα

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΓΕΝΙΚΗΣ ΧΗΜΕΙΑΣ (2 η Εργαστηριακή Ημέρα) ΘΕΜΑ : ΠΟΙΟΤΙΚΗ ΑΝΑΛΥΣΗ

ΑΣΚΗΣΕΙΣ ΓΕΝΙΚΗΣ ΧΗΜΕΙΑΣ (2 η Εργαστηριακή Ημέρα) ΘΕΜΑ : ΠΟΙΟΤΙΚΗ ΑΝΑΛΥΣΗ ΑΣΚΗΣΕΙΣ ΓΕΝΙΚΗΣ ΧΗΜΕΙΑΣ (2 η Εργαστηριακή Ημέρα) ΘΕΜΑ : ΠΟΙΟΤΙΚΗ ΑΝΑΛΥΣΗ ΑΣΚΗΣΗ 5η: Ανάλυση Α αναλυτικής ομάδας κατιόντων (Ag +, Hg 2, Pb ) ΣΚΟΠΟΣ: Μελέτη εργαστηριακών μεθόδων για την ταυτοποίηση (αναγνώριση)

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

Reagent Β: n º 1 φιαλίδιο x 5 ml.υγρό αντιδραστήριο, έτοιμο προς χρήση.

Reagent Β: n º 1 φιαλίδιο x 5 ml.υγρό αντιδραστήριο, έτοιμο προς χρήση. -Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ ΠΡΟΟΡΙΖΟΜΕΝΗ ΧΡΗΣΗ Διαγνωστική ανοσονεφελομετρική εξέταση για τον ποσοτικό προσδιορισμό της Ανοσοσφαιρίνης M (IGM) σε ανθρώπινο ορό ή πλάσμα με το σύστημα

Διαβάστε περισσότερα

ΙΣΤΟΡΙΚΑ ΠΕΙΡΑΜΑΤΑ ΣΤΗ ΒΙΟΛΟΓΙΑ. Τα πειράματα που οδήγησαν στο συμπέρασμα ότι το DNA είναι το γενετικό υλικό

ΙΣΤΟΡΙΚΑ ΠΕΙΡΑΜΑΤΑ ΣΤΗ ΒΙΟΛΟΓΙΑ. Τα πειράματα που οδήγησαν στο συμπέρασμα ότι το DNA είναι το γενετικό υλικό ΙΣΤΟΡΙΚΑ ΠΕΙΡΑΜΑΤΑ ΣΤΗ ΒΙΟΛΟΓΙΑ Τα πειράματα που οδήγησαν στο συμπέρασμα ότι το DNA είναι το γενετικό υλικό Πείραμα Griffith (1928) o O Griffith ήταν Βρετανός βακτηριολόγος του οποίου το ερευνητικό ενδιαφέρον

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

Σύγχρονη διαγνωστική προσέγγιση των ιώσεων

Σύγχρονη διαγνωστική προσέγγιση των ιώσεων Σύγχρονη διαγνωστική προσέγγιση των ιώσεων Μ. ΓΙΑΝΝΑΚΗ 10 η Ημερίδα Κλινικής Μικροβιολογίας 23/1/2010 Αξιολόγηση για την επιλογή της διαγνωστικής τεχνικής Ευαισθησία Ειδικότητα Θετική και Αρνητική Προγνωστική

Διαβάστε περισσότερα

Η ανίχνευση νεφρικών όγκων αυξάνει περίπου κατα 1% κατ' έτος. Η τυχαία ανεύρεση μικρών όγκων είναι σήμερα η πλειονότητα των νεφρικών όγκων.

Η ανίχνευση νεφρικών όγκων αυξάνει περίπου κατα 1% κατ' έτος. Η τυχαία ανεύρεση μικρών όγκων είναι σήμερα η πλειονότητα των νεφρικών όγκων. Ενδείξεις και περιορισμοί στη διαδερμική βιοψία των νεφρικών μαζών Αδαμόπουλος Βασίλειος Md.- FEBU Επιμ.Β' Γ.Ν.Καβάλας- Ουρολογική Κλινική Το Πρόβλημα... Η ανίχνευση νεφρικών όγκων αυξάνει περίπου κατα

Διαβάστε περισσότερα

Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών

Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών Αντιµεταλλαξιγόνο δράση ανίχνευση ουσιών που προστατεύουν το DNA από µεταλλαξιγόνα που προκαλούν µεταλλάξεις

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΓΝΩΣΕΙΣ ΚΑΙ ΕΞΕΤΑΣΕΙΣ

ΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΓΝΩΣΕΙΣ ΚΑΙ ΕΞΕΤΑΣΕΙΣ ΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΓΝΩΣΕΙΣ ΚΑΙ ΕΞΕΤΑΣΕΙΣ ΑΝΟΣΟΦΘΟΡΙΣΜΟΣ Εισαγωγή Ο ανοσοφθορισµός είναι η µέθοδος κατά την οποία χρησιµοποιούνται φθορίζοντα αντισώµατα για την ανίχνευση και εντόπιση αντιγόνου ή αντισώµατος

Διαβάστε περισσότερα

-Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ

-Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ -Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ ΠΡΟΟΡΙΖΟΜΕΝΗ ΧΡΗΣΗ Διαγνωστική ανοσονεφελομετρική εξέταση για τον ποσοτικό προσδιορισμό της Ανοσοσφαιρίνης A (IGA) σε ανθρώπινο ορό ή πλάσμα με το σύστημα

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ Θέμα Α ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ-ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ

Διαβάστε περισσότερα

Αποστείρωση και στειρότητα φαρμακευτικών προϊόντων

Αποστείρωση και στειρότητα φαρμακευτικών προϊόντων Αποστείρωση και στειρότητα φαρμακευτικών προϊόντων Ιωάννης Τσαγκατάκης, Ph.D. Η αποστείρωση είναι μια διαδικασία κατά την οποία επιτυγχάνεται ο θάνατος ολόκληρου του μικροβιακού φορτίου που πιθανόν να

Διαβάστε περισσότερα

Άσκηση 3η. Μέθοδοι Διαχωρισμού. Τμήμα ΔΕΑΠΤ - Εργαστήριο Γενικής Χημείας

Άσκηση 3η. Μέθοδοι Διαχωρισμού. Τμήμα ΔΕΑΠΤ - Εργαστήριο Γενικής Χημείας Άσκηση 3η Μέθοδοι Διαχωρισμού 1 2 Θεωρητικό μέρος Χρήση των μεταβολών των φάσεων στην ανάλυση Οι ουσίες λειώνουν και βράζουν σε ορισμένες θερμοκρασίες, αλλάζοντας έτσι μορφή από στερεή σε υγρή ή από υγρή

Διαβάστε περισσότερα

ΦΥΣΙΟΛΟΓΙΑ ΑΝΑΠΝΕΥΣΤΙΚΟΥ ΣΥΣΤΗΜΑΤΟΣ

ΦΥΣΙΟΛΟΓΙΑ ΑΝΑΠΝΕΥΣΤΙΚΟΥ ΣΥΣΤΗΜΑΤΟΣ ΦΥΣΙΟΛΟΓΙΑ ΑΝΑΠΝΕΥΣΤΙΚΟΥ ΣΥΣΤΗΜΑΤΟΣ ΙΩΑΝΝΑ ΔΗΜΟΠΟΥΛΟΥ ΚΑΘΗΓΗΤΡΙΑ ΕΡΓΑΣΤΗΡΙΟ ΠΕΙΡΑΜΑΤΙΚΗΣ ΦΥΣΙΟΛΟΓΙΑΣ ΙΑΤΡΙΚΗ ΣΧΟΛΗ ΕΚΠΑ ΟΞΕΟΒΑΣΙΚΗ ΙΣΟΡΡΟΠΙΑ ΣΗΜΑΣΙΑ ΟΞΕΟΒΑΣΙΚΗΣ Η ακριβής ρύθμιση των ιόντων υδρογόνου (Η

Διαβάστε περισσότερα

ΑΣΚΗΣΗ: ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ (POLYMERASE CHAIN REACTION, PCR)

ΑΣΚΗΣΗ: ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ (POLYMERASE CHAIN REACTION, PCR) ΑΣΚΗΣΗ: ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ (POLYMERASE CHAIN REACTION, PCR) ΑΣΚΗΣΗ: ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ (POLYMERASE CHAIN REACTION, PCR) Σκοπός της άσκησης Η εκμάθηση των βασικών σταδίων και συστατικών

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

ΑΛΕΞΑΝΔΡΕΙΟ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗΣ ΤΜΗΜΑ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ

ΑΛΕΞΑΝΔΡΕΙΟ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗΣ ΤΜΗΜΑ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΑΛΕΞΑΝΔΡΕΙΟ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗΣ ΤΜΗΜΑ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΚΑΤΕΥΘΥΝΣΗ: ΖΩΪΚΗΣ ΠΑΡΑΓΩΓΗΣ Η ΤΕΧΝΙΚΗ ΤΗΣ PCR ΣΤΗ

Διαβάστε περισσότερα

Εναλλακτικές Μέθοδοι

Εναλλακτικές Μέθοδοι Εναλλακτικές Μέθοδοι Δέσποινα Ν. Περρέα Αναπληρώτρια Καθηγήτρια Ιατρικής Σχολής Πανεπιστημίου Αθηνών Διευθύντρια Εργαστηρίου Πειραματικής Χειρουργικής και Χειρουργικής Ερεύνης «Ν.Σ. Χρηστέας» Ιστορικά

Διαβάστε περισσότερα

Εισαγωγή στη Real Time PCR. Καραπέτσας Θανάσης PhD, MSc

Εισαγωγή στη Real Time PCR. Καραπέτσας Θανάσης PhD, MSc Εισαγωγή στη Real Time PCR Καραπέτσας Θανάσης PhD, MSc Μειονεκτήματα της κλασικής PCR Ανάλυση ύστερα από ηλεκτροφόρηση(συνήθως αγαρόζης) Τεχνική τελικού σημείου(end-point detection), Σύγκριση της έντασης

Διαβάστε περισσότερα

ΑΝΤΙΜΙΚΡΟΒΙΑΚΗ ΘΕΡΑΠΕΙΑ ΣΤΙΣ ΛΟΙΜΩΞΕΙΣ ΤΗΣ ΟΡΘΟΠΑΙΔΙΚΗΣ

ΑΝΤΙΜΙΚΡΟΒΙΑΚΗ ΘΕΡΑΠΕΙΑ ΣΤΙΣ ΛΟΙΜΩΞΕΙΣ ΤΗΣ ΟΡΘΟΠΑΙΔΙΚΗΣ ΑΝΤΙΜΙΚΡΟΒΙΑΚΗ ΘΕΡΑΠΕΙΑ ΣΤΙΣ ΛΟΙΜΩΞΕΙΣ ΤΗΣ ΟΡΘΟΠΑΙΔΙΚΗΣ Ιωάννης Π.Κιουμής Αναπληρωτής Καθηγητής Α.Π.Θ. Για την καλύτερη κατανόηση της δέουσας αντιμικροβιακής θεραπείας στις λοιμώξεις της Ορθοπαιδικής ουσιαστική

Διαβάστε περισσότερα