http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology K562 K562
|
|
- Μέδουσα Αλεξίου
- 6 χρόνια πριν
- Προβολές:
Transcript
1 ISSN CN / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology ~ 367 OAZ1 K562 1 ** 2 ** 1 * 2 1 2* OAZ OAZ1 K562 OAZ1 plvx-neo- OAZ1-IRES-ZsGreen K562 Western FACS CD71 GPA hemin RT-PCR K562 GATA1 BCR / ABL TGFβ OAZ1 K562 OAZ1 CD71 + / GPA ± 2 09 % 4 07 ± 1 04 % 1 79 ± 2 36 % P < ± % P < 0 01 GATA1 BCR / ABL mrna OAZ1 TGFβ OAZ1 K562 TGFβ -1 OAZ1 R34 Effect of Ornithine Decarboxylase Antizyme 1 on the Erythroid Differentiation in Human Leukemia Cell Line K562 WU Bing-Ping 1 * * WANG Xing 2 * * MA Wen-Li 1 * ZHANG Si-Yi 2 ZHENG Wen-Ling 1 JIANG Li 2 * 1 Institute of Genetic Engineering Southern Medical University Guangzhou China 2 Guangdong General Hospital Guangdong Academy of Medical Sciences Guangzhou China Abstract Recently ornithine decarboxylase antizyme OAZ1 has been much concerned for its potentials in anti-tumor To investigate the role of OAZ1 in inducing the erythroid differentiation in human leukemia cell line K562 the lentivirus vector plvx-neo-oaz1-ires-zsgreen targeting gene OAZ1 modified at the frameshift site was constructed to transfect K562 cells OAZ1 overexpression efficiency was assessed by Western blotting The potential effect of OAZ1 in inducing erythroid differentiation were obtained by detecting two surface markers CD71 and GPA and the benzidine staining To explore the induction mechanism the relevant genes GATA1 BCR / ABL and TGFβ related with the differentiation and cancer formation of leukemia were detected by real-time RT-PCR adding the hemin-induced group The results showed that recombinant lentiviral vector and the overexpression cell line were successfully No No * Tel wenli@ fimmu com Tel jiangli27556@ vip 126 com * * Received December Accepted January Supported by National Natural Science Foundation of China No and Natural Science Foundation of Guangdong Province No and Leading Talent Project of Guangdong Province * Corresponding auther Tel wenli@ fimmu com Tel jiangli27556@ vip 126 com * * Co-first authors
2 constructed The positive rate of double labeling CD71 + / GPA + was ± 2 09 % in cells transfected with OAZ1 lentivirus which was significantly higher than that in the untreated cells 4 07 ± 1 04 % or in the treated cells with empty virus 1 79 ± 2 36 % P < 0 01 The positive rate of benzidine staining was ± % which was also significantly higher than that in other two groups P < 0 01 Quantitative results indicated that OAZ1 had more siginificant function on TGFβ than that in GATA1 or BCR / ABL In conclusion OAZ1 could effectively induce the erythroid differentiation in K562 cells and this induction is possiblely related to TGFβ signaling pathway Key words ornithine decarboxylase antizyme-1 OAZ-1 chronic myelogenous leukemia erythroid differentiation polyamine IgG-HRP OAZ1 Biomol CD71-PE CD235a -Percp IgG1-PE IgG1-1 Percp ebioscience G418 Merck ornithine decarboxylase antizyme OAZ PrimeScript RT SYBR Premix E Taq RNAiso ornithine Plus RNAfree ddh 2 O TaKaRa decarboxylase ODC 26S 1 2 ODC K562 10% RPMI μg / ml IU / ml 37 5% CO 2 OAZ1 2 ~ 3 d OAZ1 K K562 / OAZ Sigma EcoRI XbaI plvx-neo-ires-zsgreen OAZ1 OAZ1 JM109 plvx-neo-oaz1-ires-zsgreen 1 4 hemin 50 μmol / L DMSO K h OAZ1 2 ORF hemin ORF1 TCCTGATG 9 RD-PCR + 1 cdna OAZ1 K562 OAZ TCCTGATG TCCGATG OAZ1 TaKaRa 687 bp pmd19- OAZ1 T RPMI-1640 Gibco 4 plvx-neo-ires- Lentivirus ZsGreen VSVG prre REV 293T EcoRI XbaI T4 DNA Ligase 48 h NEB Qiagen OAZ1 GFP - 80 Western GAPDH K / ml 2 ml /
3 4 OAZ1 K IgG1-PE IgG1-Percp 12 h G μg / ml PBS / ml 20 μl 1 5 Western 3 K562 K562 / GFP K562 / OAZ1 PBS 2 RIPA PMSF 4 30 min 12% SDS-PAGE 1 7 RT-PCR OAZ1 GATA1 BCR / ABL PVDF 5% 2 h TGFβ HRP IgG ~ 2 Blast PAGE h ECL FluorChem 8900 K562 K562 / GFP K562 / OAZ1 hemin FACS CD71 GPA 10 6 / PBS 2 10 μl PCR 95 CD71 30 s 95 5 s s 40 PCR 55 A glycophorin GPA 4 30 min PBS 5 μl 0 2% 990 μl 10 μl 30% 5 min μmol / L hemin 96 h RNA RNAiso Plus PrimeScript RT cdna RT-PCR ~ / s nm FACS Table1 ACTB Table 1 Primer sequences of Real-time RT-PCR Primers Sequence 5'-3' Product length / bp OAZ1 NM_ F CTTCATTTGCTTCCACAAGAACC 82 R TCTCACAATCTCAAAGCCCAAA GATA1 NM_ F TTTCAGGTGTACCCATTGCTCA 198 R CCGCTCTGTCTTCAAAGTCTCC BCR / ABL AJ F TGGGTTTCTGAATGTCATCGTC 195 R GCCACAAAATCATACAGTGCAA TGFβ NM_ F CTGCCCCTACATTTGGAGCCTG 146 R GCTTGCGGCCCACGTAGTACAC ACTB NM_ F TGGCACCCAGCACAATGAA 186 R CTAAGTCATAGTCCGCCTAGAAGCA 1 8 x 珋 ± s Fig 1 SPSS plvx-neo-oaz1-ires- ZsGreen framshift 205 T plvx-neo-oaz1-ires-zsgreen 2 2 K T 48 h OAZ1 GFP 293T 48 h OAZ TU / ml GFP 10 8 TU / ml 687 bp pmd19-t K562 2 plvx-neo- K562 / GFP 48 h IRES-ZsGreen G418
4 OAZ1 Western K562 K562 / GFP K562 / OAZ1 OAZ1 Fig OAZ1 K CD71 GPA FACS Fig 4 K562 / OAZ1 CD71 + / GPA + K562 K562 / GFP P < 0 01 K562 K562 / GFP K562 / Fig 1 Validation of the recombinant lentivirus vector The recombinant lentivirus vector plvx-neo-oaz1-ires- ZsGreen was double digested by EcoRI and XbaI and then separated in 1% agarose gel electrophoresis M 2 kb DNA marker 1 ~ 3 plvx-neo-oaz1-ires-zsgreen the inserted target gene OAZ1 was 687 bp GFP CD71 + / GPA - P < 0 01 OAZ1 GPA CD71 K562 /GFP CD71 Table 2 95 % K562 / GFP Fig 5 K562 / OAZ1 G418 K562 K562 / GFP % ± % ± % K562 / GFP K562 / OAZ ± 90 % K562 / % K562 K562 / GFP P < OAZ1 OAZ OAZ1 K562 G % Fig 2 Table 2 Fig 3 Western blot analysis of OAZ1 expression levels in K562 K562 / GFP and K562 / OAZ1 Histogram in the right was the gray analysis of Western blotting in the left and normalization was done to GAPDH OAZ1 protein level in K562 / OAZ1 cells elevated approximately 1 5 times than that in other two groups K562 untreated control K562 / GFP negative control K562 / OAZ1 OAZ1 overexpression cell line The positive rate of cell differentiation markers Group Positive rate / % CD71 + / GPA - CD71 - / GPA + CD71 + / GPA + CD71 - / GPA - K ± ± ± ± 4 96 K562 / GFP ± 2 58 ** 0 00 ± ± ± 0 23 K562 / OAZ ± ± ± 2 09 ** 3 68 ± 2 47 Data were means ± S D from three independent experiments * * P < 0 01 vs K562 cells or K562 / GFP cells
5 4 OAZ1 K Fig 2 Green fluorescence detection by FACS left and fluorescence microscopic images right 200 The fluorescent rate and intensity of the K562 / OAZ1 cells were obviously less than the negative control coincidence with the micrograph A K562 / GFP the negative control group in which K562 cells were transfected with GFP virus B K562 / OAZ1 the overexpression group in which K562 cells were transfected with OAZ1-GFP virus Fig 4 Induction effect of OAZ1 on cells erythroid differentiation by detecting two surface markers CD71 and GPA The data represent one of three independent expriments Double staining positive rate CD71 + / GPA + in K562 / OAZ1 cells were significantly higher than that in other two groups A K562 untreated control B K562 / GFP negative control C K562 / OAZ1 OAZ1 overexpression cell line Fig 5 Benzidine staining analysis of the erythroid differentiation of cells 400 Cells expressing hemoglobin could oxidate benzidine staining forming the blue sediment in the active region Benzidine staining positive rate in K562 / OAZ1 cells were significantly higher than that in other two groups The date represent one of three independent expriments A K562 untreated control B K562 / GFP negative control C K562 / OAZ1 OAZ1 overexpression cell line
6 OAZ1 K562 GATA1 BCR / ABL TGFβ OAZ1 K562 hemin K562 RT-PCR GATA1 BCR / ABL TGFβ Fig 6 K562 / OAZ1 OAZ1 GATA1 BCR / ABL OAZ1 TGFβ Hemin OAZ1 K562 / GFP 9 GATA1 TGFβ OAZ1 OAZ1 Western OAZ1 TGFβ hemin 1 5 OAZ1 K562 K562 CD71 GPA Fig 6 Analysis of the relevant genes by real-time RT-PCR GATA1 BCR / ABL and TGFβ genes were analysed to explore the induction mechanism caused by OAZ1 K562 / GFP and K562 / OAZ1 cells were obtained K562 / Hemin cells were treated with 50 μmol / L hemin in 96 hours Normalization were completed to ACTB mrna * P < 0 05 * * P < 0 01 vs K562 cells or K562 / GFP cells P < 0 05 P < 0 01 vs K562 cells OAZ1 K562 K562 / GFP K562 / OAZ1 OAZ1 K562 OAZ1 GATA1 BCR / ABL TGFβ GATA1 A / T GATA A / G GATA 8 15 BCR / ABL P TGFβ K562 TGFβ / Smads TGFβ OAZ1 TGFβ mrna GATA1 BCR / ABL hemin OAZ1 9 hemin GATA1 TGFβ mrna 3 BCR / ABL OAZ1 hemin K562 P210 bcr / abl P210 bcr / abl PTK CyclinD1 Smad1 Aurora-A P210 bcr / abl OAZ1 TGFβ / Smads OAZ Hemin OAZ OAZ1 hemin OAZ1 OAZ1
7 4 OAZ1 K K562 Li Zheng Wen-Ling et al References 1 Agostinelli E Marques M P Calheiros R et al Polyamines fundamental characters in chemistry and biology J Amino Acids Schipper R G Cuijpers V M De Groot L H et al Intracellular localization of ornithine decarboxylase and its regulatory protein antizyme-1 J J Histochem Cytochem Kim J S Kim T L Cho E W et al Antizyme suppression leads to an increment of the cellular redox potential and an induction of HIF-1alpha its involvement in resistance to gamma-radiation J IUBMB Life Liu G Y Liao Y F Hsu P C et al Antizyme a natural ornithine decarboxylase inhibitor induces apoptosis of haematopoietic cells through mitochondrial membrane depolarization and caspases' cascade J Apoptosis Yamamoto D Shima K Matsuo K et al Ornithine decarboxylase antizyme induces hypomethylation of genome DNA and histone H3 lysine 9 dimethylation H3K9me2 in human oral cancer cell line J PLoS One e Tsuji T Katsurano M Ibaragi S et al Ornithine decarboxylase antizyme upregulates DNA-dependent protein kinase and enhances the nonhomologous end-joining repair of DNA doublestrand breaks in human oral cancer cells J Biochemistry Koeffler H P Golde D W Human myeloid leukemia cell lines a review J Blood K562 Smads signal transduction and leukemic cells J J Shanghai J Wang Wei-Jia Zhang Yan The research progress of erythroid differentiation in human leukemia cell line K562 J Int J Labor Med K562 J Jiang Li Ma Wen- Screening of the differentiationrelated genes from K562 cells induced by hemin J Acta Anat Sin Matsufuji S Matsufuji T Miyazaki Y et al Autoregulatory frameshifting in decoding mammalian ornithine decarboxylase antizyme J Cell Kurian L Palanimurugan R Godderz D et al Polyamine sensing by nascent ornithine decarboxylase antizyme stimulates decoding of its mrna J Nature Rato C Amirova S R Bates D G et al Translational recoding as a feedback controller systems approaches reveal polyaminespecific effects on the antizyme ribosomal frameshift J Nucleic Acids Res Lin Y Martin J Gruendler C et al A novel link between the proteasome pathway and the signal transduction pathway of the bone morphogenetic proteins BMPs J BMC Cell Biol J Jiang Li Ma Wen-Li Ornithine decarboxylase antizyme protein and inhibition of cell proliferation J J Med Mol Biol GATA-1 J Jin Cheng-Qiang Liu Fang The research progress of the transcription factor GATA-1 J Int J Immunol Melo J V The diversity of BCR-ABL fusion proteins and their relationship to leukemia phenotype J Blood TGF-β / Smads J Shen Jing-Jing Zhong Lu Chen Fang-Yuan Relationship between TGF-β / Jiaotong Univ Health Sci Meulmeester E Ten Dijke P The dynamic roles of TGF-beta in cancer J J Pathol
IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2
344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.
Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού
Σχολή Θετικών Επιστημών Τμήμα Βιολογίας Πρόγραμμα Μεταπτυχιακών Σπουδών Κατεύθυνση: Εφαρμοσμένη γενετική και βιοτεχνολογία ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology human telomerase reverse transcriptase htert
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2013 4 29 4 383 ~ 388 PCR htert mrna 1 2 2 3 1 1 2 2 1 1 530021 2 530021 3 * 3 530021 human
ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ
- - ό ό : Ω ί ό ί ώ.. ά ή ί ός ή ς ύ ί ί ή έ ώ ό. ή ς ά ς ής ό ός ά ς ή έ ός ή ς ί ής ί ς. ό έ ώ - ώ ή ής ή ς- ί ά ά ς ί ς. ά ί ί έ έ ά ύ ή, ό ί ά, ό ό ά έ ά ής ί ύ George Wald ή ί έ ς ί ύ ό ς ί ς ά έ
CPT. Tsuchiya. beta. quantitative RT PCR QIAGEN IGFBP. Fect Transfection Reagent sirna. RT PCR RNA Affymetrix GeneChip Expression Array
7 PTEN p Tsuchiya DNA Hepatocyte nuclear factor beta HNF beta HNFbeta IGFBP GLUT G Pase MODY maturity onset diabetes of the young Tsuchiya HNFbeta HNFbeta HNFbeta sirna CPT HNFbeta HNFbeta TOVG KOC ESMCAS
ER-Tree (Extended R*-Tree)
1-9825/22/13(4)768-6 22 Journal of Software Vol13, No4 1, 1, 2, 1 1, 1 (, 2327) 2 (, 3127) E-mail xhzhou@ustceducn,,,,,,, 1, TP311 A,,,, Elias s Rivest,Cleary Arya Mount [1] O(2 d ) Arya Mount [1] Friedman,Bentley
0. 35g kg ~ 2. 0cm 10min. Nar- 15μL 6mm
22 Journal of Ningxia Medical University 34 1 2012 1 1674-6309 2012 01-0022 - 03 1 2 1 3 1. 750004 2. 750004 3. 750004 60 SD 300 ± 20 g 5 S ICH M 2 M 4 M 8 12 Deinsberger S M 2 4 8 - ICH 10min 2 4 8 mg
Shiraia sp. Slf14 III
39 4 Vol 39 No 4 2015 7 Journal of Jiangxi Normal University Natural Science Jul 2015 1000-5862 2015 04-0430-05 Shiraia sp Slf14 III 1 1 2 1 1 1 2* 1 330022 2 330013 Polyketide synthase PKS Shiraia sp
30s 56 60s 72 60s dntp cm s s s 23
31 3 Vol 31 No 3 2012 8 JOURNAL OF OCEANOGRAPHY IN TAIWAN STRAIT Aug 2012 AFLP 1 1 2 1 1 361005 2 361005 dntp Taq Mg 2 + 300 ng DNA 5U PstI 5U MseI 4 h 16 10 50 AFLP AFLP 64 12 AFLP DOI 10 3969 /J ISSN
Antimicrobial Ability of Limonene, a Natural and Active Monoterpene
2010,32 (1) :24 28 http :/ / xuebao. jlau. edu. cn Journal of Jilin Agricultural University E2mail : jlndxb @vip. sina. com Ξ,,,, ΞΞ, 200062 : : 320 mg/ L,; ph 4 9, ; 80, 100,121 : : ; ; : TS20213 : A
Supporting Information
Supporting Information Mitochondria-Targeting Polydopamine Nanocomposites as Chemophotothermal Therapeutics for Cancer Zhuo Wang *,, Yuzhi Chen, Hui Zhang, Yawen Li, Yufan Ma, Jia Huang, Xiaolei Liu, Fang
ACTA CHINESE MEDICINE. diabetic nephropathies DN 24. urine protein quantitation in 24 hours 24hUTP serum creatinine Scr
* TGF-β1 215600 diabetic nephropathies DN 24 urine protein quantitation in 24 hours 24hUTP serum creatinine Scr -β1 transforming growth factor-β1 TGFβ1 STZ DN SD 10 10 10 8 24hUTP Scr HE ELISA TGF-β1 24hUTP
Differential Expression of DNMTs Between Gastric Tissues with and without H. Pylori Infection
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2011 11 27 11 1032 ~ 1038 DNMT 1 2 3 1 1 4 1 * 1 400016 2 400016 3 400016 4 400016 DNA DNA
TGFp FSH INH INH
(210095) E-mail ( genlinwang@hotmail.com) - -(Strept Avidin-Biotin-Peroxidase Complex SABC), 1 32,, 1 inhibin INH α 32 000 TGFp FSH FSH [1] INHα Sertoli Noguchi 1997 [2] Meunier et al.1988 [3] INH INH
Journal of Ningxia Medical University. Annexin P19 mrna P < AnnexinA2 P19 mrna. AnnexinA2 P19 mrna. PCR 1.
33 6 2011 6 Journal of Ningxia Medical University 511 1674-6309 2011 06-0511 - 04 AnnexinA2 P19 1 2 3 3 3 1. 415700 2. 750004 3. 750004 AnnexinA2 P19 62 IHC RT - PCR Western blot AnnexinA2P19 mrna AnnexinA2
JEV C RNA 11kb 3. Japanese encephalitis virus JEV JEV C 7. C E prm C 1 RNA. Gold pgbkt7 pgadt7- T pgbkt7-53 pgbkt7- JEV C PCR JEV C cdna
2012 12 4 CHINA TROPICAL MEDICINE Vol.12 No.4 April 2012 427 * JEV C PCR JEV C cdna pgbkt7 EcoRI/BamHI PEG/LiAc pgbkt7- JC pgbkt7 Gold Western- blotting BD- JC pgbkt7- JC Genebank JEV SA14-14- 2 JEV C
Η ΥΠΕΡΕΚΦΡΑΣΗ ΤΟΥ SMAD7 ΠΡΟΣΤΑΤΕΥΕΙ ΤΟ ΗΠΑΡ ΑΠΟ ΤΗΝ TGF-Β/SMAD ΜΕΣΟΛΑΒΟΥΜΕΝΗ ΙΝΟΓΕΝΕΣΗ
Η ΥΠΕΡΕΚΦΡΑΣΗ ΤΟΥ SMAD7 ΠΡΟΣΤΑΤΕΥΕΙ ΤΟ ΗΠΑΡ ΑΠΟ ΤΗΝ TGF-Β/SMAD ΜΕΣΟΛΑΒΟΥΜΕΝΗ ΙΝΟΓΕΝΕΣΗ OVEREXPRESSION OF SMAD7 PROTECTS LIVER FROM TGF-B/SMAD-MEDIATED FIBROGENESIS Γ. Γερμανίδης(1), Ν. Αργέντου(2), Ε.
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN
BIOTECHNOLOGY BULLETIN 2011 3 α 1 2-300457 PCR Helicobacter pylori HP DNA α 1 2- α 1 2-fucosyltransferase α 1 2-fuct 906 bp pet-22b + pet-fuct BL21 DE3 25 0. 1 mmol /L IPTG 4 h SDS-PAGE 33 kd α 1 2- BL21
Cellular Physiology and Biochemistry
Original Paper 2016 The Author(s). 2016 Published The Author(s) by S. Karger AG, Basel Published online: November 25, 2016 www.karger.com/cpb Published by S. Karger AG, Basel 486 www.karger.com/cpb Accepted:
Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis
HPLC * 271016 HPLC - DAD DiamonsilC 18 250 mm 4. 6 mm 5 μm - -1% 370 nm 1. 0 ml /min 40 R282. 7 A 1001-1528 2011 01-0001-05 Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus
Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...
III Contents I II III Abstract... I Zusammenfassung... II Contents... III 1 Aim of the work... 1 2 Introduction... 2 2.1 Short overview of Chinese hamster ovary cell lines... 2 2.2 Unspecific mutations:
Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin
2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity Jian-Long Li 1,a, Wei Zhao 1,a, Chen Zhou 1,a, Ya-Xuan
Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo
Bull. Earthq. Res. Inst. Univ. Tokyo Vol. 2.,**3 pp.,,3,.* * +, -. +, -. Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Kunihiko Shimazaki *, Tsuyoshi Haraguchi, Takeo Ishibe +, -.
Construction and Evaluation of Lentiviral Vector pita-hbp1
ISSN 1007-7626 CN 11-3870 / Q 2010 11 Chinese Journal of Biochemistry and Molecular Biology 26 11 1044 ~ 1049 pita-hbp1 1 2 3 4 4 * 1 100191 2 100086 3 050031 4 100191 1 HBP1 pita-hbp1 Western HBP1 Q78
The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea
2011 48 4 909 914 * 1 2** 2 2 2 2 2*** 1. 110161 2. 100081 026000 3 Calliptamus italicus L. 3 LC 50 LC 90 1. 34 14. 17 mg / L LC 50 LC 90 2. 09 45. 22 mg / L 50 mg / L 14 d 87% 100% 50 mg / L 50% The toxicity
( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;
28 1 2006 1 RESOURCES SCIENCE Vol. 28 No. 1 Jan. 2006 :1007-7588(2006) 01-0002 - 07 20 1 1 2 (11 100101 ; 21 101149) : 1978 1978 2001 ; 2010 ; ; ; : ; ; 24718kg 1) 1990 26211kg 260kg 1995 2001 238kg( 1)
Construction and Identification of Transforming Growth Factor-β1 shrna Expressing Vector
2010 30 5 975 -β1shrna 215123 TGF -β1 RNA shrna TGF-β1 mrna Ambion Target Finder TGF-β1shRNA BglⅡ HindⅢ psuper gfp-neo shrna psuper gfp-neo DH5a ELISA TGF-β1shRNA ELISA shrna-a shrna-b shrna-c TGF-β1 shrna-b
Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang
13 4 2015 7 Chinese Journal of Bioprocess Engineering Vol. 13 No. 4 Jul. 2015 doi 10. 3969 /j. issn. 1672-3678. 2015. 04. 012 1 2 2 2 2 1. 830054 2. 361005 L- 50% IC 50 0. 27 mg /ml K I - K IS 0. 218 0.
c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No
2008 245 2 1) 1) 2) 3) 4) 1) 1) 1) 1) 1), 2) 1) 2) 3) / 4) 20 3 24 20 8 18 2001 2 2 2004 2 59.0 2002 1 2004 12 3 2 22.1 1 14.0 (CNS), Bacillus c 2 p 0.01 2 1 31.3 41.9 21.4 1 2 80 CNS 2 1 74.3 2 Key words:
Τα ηπατικά επίπεδα του FOXP3 mrna στη χρόνια ηπατίτιδα Β εξαρτώνται από την έκφραση των οδών Fas/FasL και PD-1/PD-L1
Τα ηπατικά επίπεδα του FOXP3 mrna στη χρόνια ηπατίτιδα Β εξαρτώνται από την έκφραση των οδών Fas/FasL και PD-1/PD-L1 Γ. Γερμανίδης, Ν. Αργέντου, Θ. Βασιλειάδης, Κ. Πατσιαούρα, Κ. Μαντζούκης, A. Θεοχαρίδου,
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology H 2 O 2 AKT2 TUNEL DNA ladder AKT2 sirna PI3K / AKT
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2011 11 27 11 1044 ~ 1050 AKT2 * 350025 AKT2 H 2 RT-PCR AKT2 cdna pcdna3 1 / myc-his - A AKT2
Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology
2012 34 2 382-387 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com 212018 105 W 42 2 min 0. 631 TS202. 3 A 1000-2286 2012 02-0382 - 06 Optimizing
2 0 1 2 2 Journal of Shanghai Normal University Natural Sciences Feb. 2 0 1 2 SNAT2. HEK293T Western blot SNAT2 - HA Q 31 A 1000-5137 2012 01-0083-06
4 1 1 Vol 41 No 1 2 0 1 2 2 Journal of Shanghai Normal University Natural Sciences Feb 2 0 1 2 SNAT2 - HA * 200234 SNAT2 - SNAT2 PCR HA SNAT2 C pbk - CMVΔ 1098-1300 - SNAT2 - HA HEK293T Western blot SNAT2
Supporting Information
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Supporting Information Crotonols A and B, Two Rare Tigliane Diterpenoid
Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2015 Supporting information An unusual bifunctional Tb-MOF for highly sensing
Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application
31 5 2011 5 Acta Scientiae Circumstantiae Vol 31 No 5 May 2011 2011 - J 31 5 935-940 Huang Y M Yuan D X Peng Y Z et al 2011 Rapid determination of soluble reactive silicate in seawater by flow injection
A strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines
1 2 Supplementary information 3 4 A strategy for the identification of combinatorial bioactive compounds contributing to the holistic effect of herbal medicines 5 6 Fang Long 1, Hua Yang 1, Yanmin Xu,
,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78
ISSN 100727626 CN 1123870ΠQ 2002 4 Chinese Journal of Biochemistry and Molecular Biology 18 (2) :245 249 HLA2B2704 3 2) ( 2) 100044) HLA2B2704 286 HLA2B2704 DNA ( HLA2B2704 DNA) PCR F0 F1 RT2PCR HLA2B2704
,,, (, 100875) 1989 12 25 1990 2 23, - 2-4 ;,,, ; -
25 3 2003 5 RESOURCES SCIENCE Vol. 25 No. 3 May 2003 ( 100875) : 500L - 2-4 - 6-8 - 10 114h - 120h 6h 1989 12 25 1990 2 23-2 - 4 : ; ; - 4 1186cm d - 1 10cm 514d ; : 714 13 317 714 119 317 : ; ; ; :P731
Basic & Clinical Medicine PLGA MUC1 MUC1 IC 50 MUC1 +
2011 7 31 7 1001-6325 2011 07-0751 -05 July 2011 Vol. 31 No. 7 MUC1 1 1 1 2 1 1* 1. 100005 2. 100190 MUC1 PLGA MUC1 MUC1 MUC1 MCF-7 HepG2 MTS IC 50 MUC1 225. 3 ± 9. 2 nm 83. 6% ± 1. 7% MUC1 + MCF-7 P
Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
33 2 2011 4 Vol. 33 No. 2 Apr. 2011 1002-8412 2011 02-0096-08 1 1 1 2 3 1. 361005 3. 361004 361005 2. 30 TU746. 3 A Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells
2011 9 1 77 SLC26A4 HEK 293 1 2 1 1 1 1 (100853) 2 ( 050051) SLC26A4 (pegfp enhanced green fluorescent protein) SLC26A4 pegfp-slc26a4 HEK293 pegfp-slc26a4 HEK293 - (RT-PCR) SLC26A4 mrna Western Blot (
A Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn
56 [ ] 167-3619(009)03-056-05 Journal of Tropical Medicine Vol.9 No.3 Mar.009 * ( 510515) (PCT) CNKI VIP PCT QUADAS Metadisc1.4 DOR (SROC) SROC (AUC) Review Manager5 Meta 8 ; 7 8 (χ =3.8P=0.858I =0.0%)
High mobility group 1 HMG1
Vol. 29, pp.705 ~ 711, 2001 High mobility group 1 HMG1 13 12 20 anti-neutrophil cytoplasmic antibodies, ANCA ANCA 1982 Davies 1980 1 high mobility group HMG1 HMG2 30 kd high mobility group HMGHMG HMG1
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology HBx HBxΔ127
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2011 5 27 5 426 ~ 430 X HBxΔ127 ERK 1 * * 300071 hepatitis B virus HBV X HBx HBx HBxΔ127 1
Survivin sirna. Inhibitory effect of small interference RNA targeting survivin nanospheres on human pancreatic carcinoma BXPC-3 cell growth
Experimental Research Chin J Curr Adv Gen Surg Survivin sirna 253 1 2 1 3 1 1 1 1 266003 266003 : survivin sirna survivin sirna BXPC- 3 : BXPC- 3 BXPC- 3 4 survivin sirna survivin sirna RT- PCR survivin
HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332
,**1 The Japanese Society for AIDS Research The Journal of AIDS Research +,, +,, +,, + -. / 0 1 +, -. / 0 1 : :,**- +,**. 1..+ - : +** 22 HIV AIDS HIV HIV AIDS : HIV AIDS HIV :HIV AIDS 3 :.1 /-,**1 HIV
Science of Sericulture
Science of Sericulture 2012 38 1 0065-0069 ISSN 0257-4799 CN 32-1115 /S E-mail CYKE@ chinajournal. net. cn 215123 25 0 ~ 24 h GSH GSSG GSH + 2GSSG GSH /GSSG S- GST TPX 23% GR 57% GSH TPX GST GSSG 61% GSH
Chinese Journal of Biochemistry and Molecular Biology. p38mapk
ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2008 6 24 (6) :537 542 Grx1 HEK293T H 2 O 2 p38mapk 1), 2), 1), 1), 3), 1), 1) 3 ( 1), 150081 ; 2), 150081 ; 3), 161042)
KLT SMMC Anti - tumor effect in vitro of coix seed oil injection on the human liver cancer cell SMMC and the mechanism study
2012 4 20 4 MODERN ONCOLOGY Apr. 2012 VOI. 20 NO. 04 693 SMMC - 7721 珮 Anti - tumor effect in vitro of coix seed oil injection on the human liver cancer cell SMMC - 7721 and the mechanism study YIN Beipei
ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ
ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ Αρχή λειτουργίας Real-time PCR * Βασίζεται στην ανίχνευση και ποσοτικοποίηση του φθορισμού που εκπέμπεται από ειδικά φθοριοχρώματα * Η αρχική αύξηση
Mouse Gene 2.0 ST Array Shn3. Runx2 Shn3. Runx2 Shn3 Runx2. adult. (Schnurri, Shn)3/Hivep3. Runx2 Shn/Hivep. ST2 BMP-2 Shn3
adult (Schnurri, Shn)3/Hivep3 Runx2 Shn/Hivep Shn3 Shn3 Shn3 Shn3 Shn1 Shn2 Shn3 gain-of-function loss-of-function Shn3 in vivo mimic MC3T3-E1 ST-2 ATDC5 C3H10T1/2 ALP RT-PCR alcian blue RT-PCR Affymetrix
FENXI HUAXUE Chinese Journal of Analytical Chemistry. Savitzky-Golay. n = SG SG. Savitzky-Golay mmol /L 5700.
38 2010 3 FENXI HUAXUE Chinese Journal of Analytical Chemistry 3 342 ~ 346 DOI 10. 3724 /SP. J. 1096. 2010. 00342 Savitzky-Golay 1 * 1 2 1 3 1 1 510632 2 510632 3 200444 PLS Savitzky-Golay SG 10000 ~ 5300
HPV. Development and Optimization of Oligonucleotide Microarray for Detection and Sub-typing of Human Papillomavirus
3 3 Vol3 No3 2009 6 Life Science Research June2009 2009 HPV *,, 2,, 3, 5055 2 5000 3 50800 : HPV(Human papillomavirus) HPV (6 6 8 ), (Tm) ~60 mer,, HPV,, HPV,, : (HPV); ; ; :R372 :A :007-787(2009)03-020-06
*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G
J. Hot Spring Sci. /2 +.,.,**2 + + + +, - +3 ++ -*,* + -+ Evaluation of the E# ect of Hyperthermia on Bedrock Bath Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G + + + HNAMI KOUCHI
PACS: Pj, Gg
* 1)2) 2) 3) 2) 1) 1) (, 310023 ) 2) (, 315211 ) 3) (, 510006 ) ( 2011 6 16 ; 2011 10 31 ),..,,.,.,. :,,, PACS: 07.05.Pj, 05.45.Gg 1,.,, [1,2].,,, [3,4].,, [5,6].,. [7 9]., [10 17].,.,, [10]., [18 20],
MSM Men who have Sex with Men HIV -
,**, The Japanese Society for AIDS Research The Journal of AIDS Research HIV,0 + + + + +,,, +, : HIV : +322,*** HIV,0,, :., n,0,,. + 2 2, CD. +3-ml n,, AIDS 3 ARC 3 +* 1. A, MSM Men who have Sex with Men
Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic
Supporting Information Asymmetric Binary-acid Catalysis with Chiral Phosphoric Acid and MgF 2 : Catalytic Enantioselective Friedel-Crafts Reactions of β,γ- Unsaturated-α-Ketoesters Jian Lv, Xin Li, Long
Electrolyzed-Reduced Water as Artificial Hot Spring Water
/-,**- + +/ 0 +, - + + +, - + +. ++,3 +/. +. Electrolyzed-Reduced Water as Artificial Hot Spring Water Shoichi OKOUCHI +, Daisuke TAKEZAKI +, Hideyuki OHNAMI +, Yuhkoh AGISHI,, Yasuo KANROJI -, and Shigeo
HepG hotmail. com. HepG2 Bid Bcl-2. HepG2 G0 /G1 Bid Bcl-2. HepG2. HepG2
588 HepG2 2 2 53002 E-mail huan_chaos@ hotmail. com 2 3602 HepG2 MTT PI HepG2 Western Blot HepG2 Bid Bcl-2 HepG2 HepG2 G0 /G Bid Bcl-2 Bax Bid Bcl-2 Bax HepG2 HepG2 R 735. 7 A 0253-4304 204-588-05 DOI
Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk
32 3 2011 3 ENVIRONMENTAL SCIENCE Vol 32 No 3 Mar 2011 1 1 1 2 1 100101 2 663000 Panax notoginseng Burk F H Chen 6 9 ~ 242 0 mg kg - 1 48% 2 mg kg - 1 24% 81% 14% 57% 44% 100 mg kg - 1 ADI > > > > FAO
Μαρία Κατσιφοδήμου. Ο ρόλος της έκκρισης HLA-G από τα ανθρώπινα έμβρυα στην επιτυχία της εξωσωματικής γονιμοποίησης. Μεταπτυχιακή Διπλωματική Εργασία
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΚΑΤΕΥΘΥΝΣΗ: ΕΦΑΡΜΟΣΜΕΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΒΙΟΤΕΧΝΟΛΟΓΙΑ Ο ρόλος της έκκρισης HLA-G από τα ανθρώπινα
ΕΦΑΡΜΟΓΗ ΕΥΤΕΡΟΒΑΘΜΙΑ ΕΠΕΞΕΡΓΑΣΜΕΝΩΝ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΕ ΦΥΣΙΚΑ ΣΥΣΤΗΜΑΤΑ ΚΛΙΝΗΣ ΚΑΛΑΜΙΩΝ
ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙ ΕΥΤΙΚΟ Ι ΡΥΜΑ ΚΡΗΤΗΣ ΤΜΗΜΑ ΦΥΣΙΚΩΝ ΠΟΡΩΝ ΚΑΙ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΕΦΑΡΜΟΓΗ ΕΥΤΕΡΟΒΑΘΜΙΑ ΕΠΕΞΕΡΓΑΣΜΕΝΩΝ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΕ ΦΥΣΙΚΑ ΣΥΣΤΗΜΑΤΑ ΚΛΙΝΗΣ ΚΑΛΑΜΙΩΝ ΕΠΙΜΕΛΕΙΑ: ΑΡΜΕΝΑΚΑΣ ΜΑΡΙΝΟΣ ΧΑΝΙΑ
Mitomycin C application for the prevention of postoperative synechiae formation at the anterior commissure.
Otorhinolaryngologia - Head and Neck Surgery Issue 50, October - November - December 2012, pages 18-22 ORIGINAL REVIEW ARITCLE Mitomycin C application for the prevention of postoperative synechiae formation
[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,
in vitro αα In Vitro α-glucosidase and α-amylase Inhibitory Effects of Herbal Tea Leaves from Yacon (Smallanthus sonchifolius) 1, 1, 1, 2, 1, 2, 3, 1, 2, 1, 2, 1, 2, 1, 2 1, 2, *, 1 2, 3 Yuto Ueda 1, Shintaro
LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing
2003 61 3, 435 439 ACTA CHIMICA SINICA Vol 61, 2003 No 3, 435 439 2 ΞΞ ( 400715), 2, 2, 2, 3/ 2 2,, 2,, Ne w Methods for the Determination of the Inclusion Constant between Procaine Hydrochloride and 2Cyclodextrin
BGP TRACP-5b BGP TRACP-5b P 0.05
()2014 10 8 20 Chin J Clinicians(Electronic Edition),October 15,2014,Vol.8,No.20 3615 OP 2011 1 2013 6 120 OP 3 40 37 40 38 40 38 BMD BGP-5b TRACP-5b OP 1 4 L1 4NFTH BMD BGP TRACP-5b P 0.05 OP L1 4 NF
Identification of Fish Species using DNA Method
5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,
PE CVVH PE+HP HP+CVVH HP+CVVH+PE CVVH. ENLAV of HCO - 3 ENLAV-HCO ± μmol /L HP+PE HP+CVVH HP+CVVH+PE
2624 54 plasma exchange PE hemoperfusion HP continuous venovenous hemofiltration CVVH 54 PE CVVH PE+HP HP+CVVH HP+CVVH+PE 183 exceed normal limit absolute value ENLAV prothrombin time PT PE total bilirubin
ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΙΣ «ΚΛΙΝΙΚΕΣ ΚΑΙ ΚΛΙΝΙΚΟΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΤΡΙΚΕΣ ΕΙΔΙΚΟΤΗΤΕΣ»
ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΙΣ «ΚΛΙΝΙΚΕΣ ΚΑΙ ΚΛΙΝΙΚΟΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΤΡΙΚΕΣ ΕΙΔΙΚΟΤΗΤΕΣ» ΑΡΝΗΤΙΚΗ ΡΥΘΜΙΣΗ ΤΗΣ ΜΕΤΑΒΙΒΑΣΗΣ ΤΟΥ ΣΗΜΑΤΟΣ ΤΗΣ
þÿÿ ÁÌ» Â Ä Å ¹µÅ Å½Ä ÃÄ
Neapolis University HEPHAESTUS Repository School of Economic Sciences and Business http://hephaestus.nup.ac.cy Master Degree Thesis 2015 þÿÿ ÁÌ» Â Ä Å ¹µÅ Å½Ä ÃÄ þÿ ¹±Çµ Á¹Ã ºÁ õɽ ÃÄ ÃÇ» Tokatzoglou,
Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil
J. Jpn. Soc. Soil Phys. No. +*0, p.- +*,**1 Eh * ** Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil Daisuke MURAKAMI* and Tatsuaki KASUBUCHI** * The United Graduate
Electronic Supplementary Information DFT Characterization on the Mechanism of Water Splitting Catalyzed by Single-Ru-substituted Polyoxometalates
Electronic Supplementary Information DFT Characterization on the Mechanism of Water Splitting Catalyzed by Single-Ru-substituted Polyoxometalates Zhong-Ling Lang, Guo-Chun Yang, Na-Na Ma, Shi-Zheng Wen,
Effects of Chlorogenic Acid on the Activity of Cultured Osteoblasts in vitro
32 2 Vol 32 No 2 2013 6 Journal of South-Central University for NationalitiesNat Sci Edition Jun 2013 1 1 1 1 1 2* 1 4300742 430074 CGA MC3T3-E1 MTT 11 02 22 05 44 0988 19μmol /L CGA ALP PCR 11 02 ~ 88
Supporting Information. Multigenerational Disruption of Thyroid Endocrine System in Marine Medaka
Supporting Information Multigenerational Disruption of Thyroid Endocrine System in Marine Medaka after A Life-Cycle Exposure to Perfluorobutane Sulfonate (PFBS) Lianguo Chen,, Chenyan Hu #, Mirabelle M.
College of Life Science, Dalian Nationalities University, Dalian , PR China.
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2018 Postsynthetic modification
Study on Purification Technology and Antioxidant Activity of Total Flavonoid from Eriobotryae Folium
Interleukin-1beta causes pulmonary inflammation, emphysema, and airway remodeling in the adult murine lung [J]. Am J Respir Cell Mol Biol, 2005, 32(4): 311-318. [10] FAN C H, LI S Y, LI M, et al. The clinical
Journal of Ningxia Medical University BRCA2. M2610I 2405 delt stp ± t = P > %
33 6 2011 6 Journal of Ningxia Medical University 515 1674-6309 2011 06-0515 - 04 16 BRCA2 1 2 2 1 3 1. 750004 2. 750021 3. 750004 16-2 BRCA2 16 16 30 PCR BRCA2 16 3 18. 75% 2 M2610I 2405 delt stp729 1
Effects of soothing liver and invigorating spleen recipes of TCM on hepatic inflammatory cytokines of rats with nonalcoholic steatosishepatitis
33 2 Vol. 33 No. 2 2012 4 Journal of Jinan University Medicine Edition Apr. 2012 TNF-α IL-6 IL-1 1 2 1 3 2 2 2 1. 510630 2. 510632 3. 510630 NASH TNF-α 6 IL-6 1 IL-1 NASH NASH 16 HE O ELISA TNF-α IL-6
2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _
41 Vol.41, No. 01 RARE METAL MATERIALS AND ENGINEERING March 01 Pb O 4 PbO ( 710049) SnO -Sb Pb O 4 Pb O 4 100.5 h 970 h XRF XRD SEM Pb O 4 PbO PbO TG146.1 + A 100-185X(01)0-046-05 [1,] 1 PbO PbO Sn-Sb
Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water
31 1 2010 1 ENVIRONMENTAL SCIENCE Vol. 31,No. 1 Jan.,2010, 3, (,, 100084) :,.,, ( Microcystis aeruginosa),3 (A 2 O ) 10 6 ml - 1,> 0139 d - 1. A 2 O222,. TP ( K max ) ( R max ), Monod. :; ; ; ; :X173 :A
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΤΜΗΜΑ ΟΔΟΝΤΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΟΔΟΝΤΙΚΗΣ ΚΑΙ ΑΝΩΤΕΡΑΣ ΠΡΟΣΘΕΤΙΚΗΣ
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΤΜΗΜΑ ΟΔΟΝΤΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΟΔΟΝΤΙΚΗΣ ΚΑΙ ΑΝΩΤΕΡΑΣ ΠΡΟΣΘΕΤΙΚΗΣ ΣΥΓΚΡΙΤΙΚΗ ΜΕΛΕΤΗ ΤΗΣ ΣΥΓΚΡΑΤΗΤΙΚΗΣ ΙΚΑΝΟΤΗΤΑΣ ΟΡΙΣΜΕΝΩΝ ΠΡΟΚΑΤΑΣΚΕΥΑΣΜΕΝΩΝ ΣΥΝΔΕΣΜΩΝ ΑΚΡΙΒΕΙΑΣ
Approximation Expressions for the Temperature Integral
20 7Π8 2008 8 PROGRSS IN CHMISRY Vol. 20 No. 7Π8 Aug., 2008 3 3 3 3 3 ( 230026),,,, : O64311 ; O64213 : A : 10052281X(2008) 07Π821015206 Approimation pressions for the emperature Integral Chen Haiiang
PCR 2BS A X Comparison of Southern blotting and Real-time PCR in measuring telomere shortening
297 DNA PCR 100191 DNA PCR population doublings PDs 2BS DNA DNA PCR 1 μg DNA 4 ~ 5 μg DNA 150 bp PCR 300 ~ 400 bp 2 PDs 2BS 5 PDs PCR 10% DNA 2. 5% P < 0. 001 DNA PCR DNA R342. 3 doi 10. 3969 /j. issn.
Stress Relaxation Test and Constitutive Equation of Saturated Soft Soil
8 7 011 7 Journal of Highway and Transportation Research and Development Vol. 8 No. 7 Jul. 011 100-068 011 07-0014 - 05 1 1. 0009. 710064 k 0 Merchant 4 Merchant U416. 1 + 6 A Stress Relaxation Test and
Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone
ISSN 100727626 CN 1123870ΠQ 2002 12 Chinese Journal of Biochemistry and Molecular Biology 18 (6) :693 697 cdna, 3, (, 150030) RNA, cdna cdna PCR, 380 bp cdna pmd2182t2verctor 3,,, 96 %, 95 %,, 74 %, 95
Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica
35 1 2 0 1 7 1 DOI 10. 13193 /j. issn. 1673-7717. 2017. 01. 035 1 1 1 1 2 1. 150036 2. 150040 D101 DEAE Cellulose 52 Sephacryl S - 300 - - PJP - 1a PJP - 3a 1. 34 10 3 Da 1. 70 10 7 Da - PJP - 3a 4. 56
Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements
5 5 2012 10 Chinese Optics Vol. 5 No. 5 Oct. 2012 1674-2915 2012 05-0525-06 - * 100190-14 - - 14. 51 μm 81. 4 μm - 1. 64 μm / O436. 1 TH703 A doi 10. 3788 /CO. 20120505. 0525 Correction of chromatic aberration
* ** *** *** Jun S HIMADA*, Kyoko O HSUMI**, Kazuhiko O HBA*** and Atsushi M ARUYAMA***
J. Jpn. Soc. Soil Phys. No. +*2, p. +3,2,**2 * ** *** *** Influence Area of Stem Flow on a Soil of Deciduous Forest Floor by Electric Resistivity Survey and the Evaluation of Groundwater Recharge through
Quantum dot sensitized solar cells with efficiency over 12% based on tetraethyl orthosilicate additive in polysulfide electrolyte
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2017 Supplementary Information (SI) Quantum dot sensitized solar cells with
Technical Research Report, Earthquake Research Institute, the University of Tokyo, No. +-, pp. 0 +3,,**1. No ,**1
No. +- 0 +3,**1 Technical Research Report, Earthquake Research Institute, the University of Tokyo, No. +-, pp. 0 +3,,**1. * Construction of the General Observation System for Strong Motion in Earthquake
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to facilitate intracellular survival Hongwei Gu 1,2*, Chihao Zhao 1,2*, Tianfu Zhang 1,2*, Hongwei Liang 1,2, Xiao-Ming Wang 1,
Molecular evolutionary dynamics of respiratory syncytial virus group A in
Molecular evolutionary dynamics of respiratory syncytial virus group A in recurrent epidemics in coastal Kenya James R. Otieno 1#, Charles N. Agoti 1, 2, Caroline W. Gitahi 1, Ann Bett 1, Mwanajuma Ngama
Αλγοριθµική και νοηµατική µάθηση της χηµείας: η περίπτωση των πανελλαδικών εξετάσεων γενικής παιδείας 1999
Αλγοριθµική και νοηµατική µάθηση της χηµείας: η περίπτωση των πανελλαδικών εξετάσεων γενικής παιδείας 1999 Γεώργιος Τσαπαρλής, ηµήτριος Σταµοβλάσης, Χαράλαµπος Καµηλάτος, Εριφύλη Ζαρωτιάδου, ηµήτριος Παπαοικονόµου
Η ΑΥΛΗ ΤΟΥ ΣΧΟΛΕΙΟΥ ΠΑΙΧΝΙΔΙΑ ΣΤΗΝ ΑΥΛΗ ΤΟΥ ΣΧΟΛΕΙΟΥ
Η ΑΥΛΗ ΤΟΥ ΣΧΟΛΕΙΟΥ ΠΑΙΧΝΙΔΙΑ ΣΤΗΝ ΑΥΛΗ ΤΟΥ ΣΧΟΛΕΙΟΥ ΑΘΑΝΑΣΟΠΟΥΛΟΥ Κ. 6ο Δμοτικό Σχολείο Κηφησιας Πηνελόπη Δέλτα, Β Δ/νση Εκπ/σης Αθήνας ΠΕΡΙΛΗΨΗ Πρόθεσή μας είναι να παρουσιάσουμε ένα συνδυασμό των προγραμμάτων
encouraged to use the Version of Record that, when published, will replace this version. The most /BCJ BIOCHEMICAL JOURNAL
Biochemical Journal: this is an Accepted Manuscript, not the final Version of Record. You are encouraged to use the Version of Record that, when published, will replace this version. The most up-to-date
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΙΑΤΡΙΚΗ ΣΧΟΛΗ. ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥ ΩΝ «Ιατρική Ερευνητική Μεθοδολογία» ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΙΑΤΡΙΚΗ ΣΧΟΛΗ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥ ΩΝ «Ιατρική Ερευνητική Μεθοδολογία» ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Νόσος Pompe: Νεότερα κλινικά, γενετικά, διαγνωστικά και θεραπευτικά
ΚΥΠΡΙΑΚΗ ΕΤΑΙΡΕΙΑ ΠΛΗΡΟΦΟΡΙΚΗΣ CYPRUS COMPUTER SOCIETY ΠΑΓΚΥΠΡΙΟΣ ΜΑΘΗΤΙΚΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ 19/5/2007
Οδηγίες: Να απαντηθούν όλες οι ερωτήσεις. Αν κάπου κάνετε κάποιες υποθέσεις να αναφερθούν στη σχετική ερώτηση. Όλα τα αρχεία που αναφέρονται στα προβλήματα βρίσκονται στον ίδιο φάκελο με το εκτελέσιμο
Ελληνικό Περιοδικό Διοίκηση Αθλητισμού & Αναψυχής, 11 (2), 24 35, Δεκέμβριος, 2014. τόμος 11 (2), 24-35 Δημοσιεύτηκε: Δεκέμβριος 2014
Ελληνικό Περιοδικό Διοίκηση Αθλητισμού & Αναψυχής Hellenic Journal of Sport & Recreation Management 2014 Volume 11 (2), 24-35 Ελληνικό Περιοδικό Διοίκηση Αθλητισμού & Αναψυχής τόμος 11 (2), 24-35 Δημοσιεύτηκε: