ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Αλληλεπιδράσεις γονιδίων Ι ασκήσεις

Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Αλληλεπιδράσεις γονιδίων Ι ασκήσεις"


1 Αλληλεπιδράσεις γονιδίων Ι ασκήσεις 1. Στους σκύλους Labrador ένα θηλυκό άτομο με καστανό χρωματισμό διασταυρώθηκε με αρσενικό που είχε χρυσαφί χρωματισμό. Όλοι οι F1 απόγονοι είχαν μαύρο χρωματισμό. Η μεταξύ τους διασταύρωση έδωσε στην F2: 9[μαύρο] : 3[καστανό] : 4[χρυσαφί]. Να εξηγηθούν τα αποτελέσματα. 9 : 3 : 4 Υπολειπόμενη επίσταση 9 Α_Β_ Μαύρο 3 Α_ββ Καστανό 4 αα Χρυσαφί Για να προκύψουν αυτές οι αναλογίες, πρέπει να έχουν διασταυρωθεί διπλά ετερόζυγα άτομα (ΑαΒβ x ΑαΒβ) Άρα, η Ρ γενιά για να δώσει ΑαΒβ απογόνους πρέπει να είναι ΑΑββ x ααββ 2. Στο φυτό Curcupita pepo οι καθαρές σειρές Π, Κ, Λ για πράσινο, κίτρινο και λευκό χρώμα καρπού αντίστοιχα, διασταυρώθηκαν μεταξύ τους και έδωσαν τα παρακάτω αποτελέσματα : 1. Π Χ Κ F 1 : 100% [Κ] F 2 : 89 [Κ] : 29 [Π] 2. Λ Χ Κ F 1 : 100% [Λ] F 2 : 180 [λευκά] : 43 [κίτρ] : 14 [πρασ] Να βρεθούν οι γονότυποι των σειρών Π, Κ, Λ. Στην πρώτη διασταύρωση η F 2 αναλογία είναι 3 : 1 (P: ααββ x ααββ, F1: ααββ, F2: 3 αβ : 1 αβ) Στη δεύτερη διασταύρωση η F 2 αναλογία είναι 12 : 3 : 1 (Επικρατής επίσταση). 12 : 3 : 1 (Επικρατής επίσταση) 12 (Α _) Λευκό 3 (ααβ_) Κίτρινο 1 (ααββ) Πράσινο Άρα, στην πρώτη διασταύρωση οι γονότυποι είναι :

2 P : ααββ x ααββ F 1 : ααββ F 2 : 3 (αβ) : 1 (αβ) 3. Στους χοίρους Durok-Jersey το χρώμα του τριχώματος είναι κόκκινο. Δύο σειρές όμως οι D 1 και D 2 έχουν κίτρινο χρώμα. Να εξηγηθούν τα αποτελέσματα των διασταυρώσεων που ακολουθούν. Ρ : D 1 ή D 2 X [κοκ] F 1 : 100% [κοκ] F 2 : 41[κοκ] : 13[κιτρ] P : D 1 X D 2 F 1 : 100% [κοκ] F 2 : 92[κοκ] : 59[κιτρ] : 10[λευκό] Στην πρώτη διασταύρωση, η αναλογία F2 είναι 3:1 Στη δεύτερη διασταύρωση, η αναλογία F2 είναι 9 : 6 : 1 (διπλά υπολειπόμενα γονίδια) 9 : 6 : 1 (Διπλά υπολειπόμενα γονίδια) 9 (Α_Β_) Κόκκινο 6 (Α_ββ), (ααβ_) Κίτρινο 1 (ααββ) Λευκό Άρα, στην πρώτη διασταύρωση οι γονότυποι είναι : P : ΑΑββ x ΑΑΒΒ F 1 : ΑΑΒβ F 2 : 3 (ΑΒ) : 1 (Αβ) 4. Το χρώμα των λουλουδιών στο φυτό Callinsia parviflora είναι συνήθως μπλε. Όμως οι καθαρές σειρές P και W έχουν λουλούδια σε χρώμα ροζ και λευκό, αντίστοιχα. Οι σειρές αυτές διασταυρώθηκαν μεταξύ τους αλλά και με την καθαρή σειρά Β (μπλε χρώμα) και έδωσαν τα ακόλουθα αποτελέσματα : P 1. Β Χ W 2. B X P 3. P X W F 1

3 192 [B]: 63 [P] F [B]: 89 [P]: 121 [W] 101 [B]: 33 [W] Οι αναλογίες F2 των δύο πρώτων διασταυρώσεων είναι 3 : 1, το οποίο σημαίνει ότι υπάρχει μία ετεροζυγωτία στην F1 διασταύρωση. Η αναλογία F2 της τρίτης διασταύρωσης είναι 9 : 3 : 4 (υπολειπόμενη επίσταση) 9 : 3 : 4 Υπολειπόμενη επίσταση 9 (Α_Β_) Μπλε 3 (Α_ββ) Ροζ 4 (αα ) Λευκό Άρα, η διασταύρωση 1 είναι : Ρ : ΑΑΒΒ x ααββ F 1 : AαΒΒ F 2 3 (AB) : 1 (αβ) Και η διασταύρωση 2 είναι : Ρ : ΑΑΒΒ x ΑΑββ F 1 : AΑΒβ F 2 3 (AB) : 1 (Αβ) 5. Στο σιτάρι, τέσσερα φυτά Φ1, Φ2, Φ3 και Φ4 με κόκκινους σπόρους, αλλά με διαφορετικό γονότυπο αυτογονιμοποιήθηκαν και έδωσαν τα ακόλουθα αποτελέσματα: Διασταύρωση F1 1. Φ1 Χ Φ1 9 [κόκκινοι] : 6 [καστανοί] : 1 [λευκοί] 2. Φ2 Χ Φ2 100% [κοκ] 3. Φ3 Χ Φ3 3 [κοκ] : 1 [καστ] 4. Φ4 Χ Φ4 3 [κοκ] : 1 [καστ] Να βρεθούν οι γονότυποι των τεσσάρων φυτών.

4 Η αναλογία F1 της πρώτης διασταύρωσης είναι 9:6:1 και υποδηλώνει την ύπαρξη διπλά υπολειπόμενων γονιδίων. 9 Α_Β_ Κόκκινο 6 Α_ββ, ααβ_ Καστανό 1 ααββ Λευκό 6. Μεταξύ των καθαρών σειρών Π (φυτά με βυσσινί άνθη), Κ (φυτά με κόκκινα άνθη, Λ 1 και Λ 2 (φυτά με λευκά άνθη) έγιναν οι παρακάτω διασταυρώσεις. Να εξηγηθούν τα αποτελέσματα. 1. Π Χ Κ F 1 : 100% [βυσ] F 2 : 3 [βυσ]:1 [κοκ] 2. Π Χ Λ 1 F 1 : 100% [βυσ] F 2 : 9 [βυσ] : 3 [κοκ] : 4 [λευκά] 3. Π Χ Λ 2 F 1 : 100% [λευκά] F 2 : 12 [λευκά]: 3 [βυσ]: 1 [κοκ] Οι 2 και 3 διασταυρώσεις για να μπορούν να συμβούν, θα πρέπει στη μία το Λευκό χρώμα να είναι υποστατικό και στην άλλη επιστατικό. Αυτό όμως δε μπορεί να συμβεί όταν έχουμε μόνο δύο γονίδια, διότι το άτομο Π είναι το ίδιο και στις δύο περιπτώσεις. Συνεπώς υπάρχει ένα τρίτο γονίδιο (Γ,γ) το οποίο ευθύνεται για την εμφάνιση λευκού χρώματος όταν βρίσκεται σε επικρατή μορφή (ΓΓ). Τα γονίδια Α,α και Β,β έχουν μεταξύ τους σχέση υπολειπόμενης επίστασης, απουσία του Γ γονιδίου (δηλαδή όταν το Γ είναι στη μορφή γγ υπολειπόμενο). Το Α,α είναι υπεύθυνο για την εμφάνιση χρώματος, οπότε όταν απουσιάζει (αα μορφή) υπάρχει απουσία χρώματος, οπότε επίσης εμφάνιση λευκού χρώματος. Δηλαδή, αν αγνοηθεί το Γ,γ γονίδιο (αγνοείται μόνο όταν είναι στη μορφή γγ) τα α,α και β,β συμπεριφέρονται ως επιστατικό και υποστατικό αντίστοιχα. Όταν εμφανίζεται το επικρατές Γ στο γονότυπο, καλύπτει την έκφραση των υπολοίπων και δίνει πάντα λευκό χρώμα, ανεξάρτητα από την έκφραση των Α,α και Β,β. 9 Α_Β_ γγ Βυσσινί (Π) 3 Α_ββγγ Κόκκινο (Κ) 4 αα γγ Λευκό (Λ1) και ΓΓ Λευκό (Λ2) 1. P : ΑΑΒΒγγ x ΑΑββγγ F 1 : AABβγγ F 2 : 3(ABγ) : 1 (Αβγ) 2. Ρ : ΑΑΒΒγγ x ααββγγ F1 : ΑαΒβγγ F2 : 9 (Αβγ) : 3 (Αβγ) : 4 (αβγ, αβγ) 3. P : ΑΑΒΒγγ x ααββγγ F 1 : ΑαΒβΓΓ F 2 : 12 ( ΓΓ) : 3 (Αβγ) : 1 (αβγ)



ΓΕΝΕΤΙΚΗ AAT TCG CGA TTCC ΓΕΝΕΤΙΚΗ 1. Το πιο κάτω γενεαλογικό δέντρο δείχνει τον τρόπο κληρονόμησης μιας ασθένειας σε μια οικογένεια. Τα μαυρισμένα τετράγωνα συμβολίζουν αρσενικά άτομα με την πάθηση και οι μαυρισμένοι κύκλοι θηλυκά

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 8/09/06 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Γενετική του Φύλου Ι ασκήσεις

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Γενετική του Φύλου Ι ασκήσεις Γενετική του Φύλου Ι ασκήσεις 1. Δώστε το φύλο των πιο κάτω ατόμων στη Drosophila: α) ΑΑΧΧΧΧ, β) ΑΑΑΑΧΧΧ, γ) ΑΑΑΧ δ) ΑΑΑΑΧΧΧΧ, ε) ΑΑΧΧΥ. Υπολογίζουμε την αναλογία Χ/Α. Υπερράρεν (0,5) Άρρεν Μεσόφυλο (1)

Διαβάστε περισσότερα

Σε τι αναφέρεται η αναλογία 9:3:3:1 του διυβριδισμού και υπό ποιες προϋποθέσεις ισχύει;

Σε τι αναφέρεται η αναλογία 9:3:3:1 του διυβριδισμού και υπό ποιες προϋποθέσεις ισχύει; Σημειώστε τον αριθμό των χρωματίδων που υπάρχουν σε ένα κύτταρο του ανθρώπου 1)που μόλις έχει προκύψει από μίτωση 2)στη μετάφαση της μείωσης ΙΙ και 3)στην πρόφαση της μίτωσης. Σε τι αναφέρεται η αναλογία

Διαβάστε περισσότερα

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 1-2-2015 ΘΕΜΑ Α Α1. γ Α2. γ Α3. β Α4. γ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2. Τα άτομα μπορεί να χαρακτηρίζονται ως φορείς στην αυτοσωμική

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Αν διασταυρωθούν άτομα μοσχομπίζελου με κίτρινο χρώμα σπέρματος ποιες θα είναι οι φαινοτυπικές και γονοτυπικές αναλογίας της γενιάς; Κ=κίτρινο, κ=πράσινο,

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με κίτρινο χρώμα σπέρματος και ιώδες χρώμα άνθους. 109 άτομα με

Διαβάστε περισσότερα


ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΑΥΤΟΣΩΜΙΚΑ ΕΠΙΚΡΑΤΗ-ΥΠΟΛΕΙΠΟΜΕΝΑ 1. Διασταυρώνονται δυο μοσχομπίζελα, το ένα με κανονικό σχήμα καρπού και το άλλο με περιεσφιγμένο σχήμα. Να βρεθεί

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑ 1.1 Η γαλακτοζαιμία στον άνθρωπο είναι ασθένεια που οφείλεται σε υποτελές γονίδιο και κληρονομείται με απλό Μεντελικό τρόπο.

ΠΡΟΒΛΗΜΑ 1.1 Η γαλακτοζαιμία στον άνθρωπο είναι ασθένεια που οφείλεται σε υποτελές γονίδιο και κληρονομείται με απλό Μεντελικό τρόπο. ΠΡΟΒΛΗΜΑ 1.1 Η γαλακτοζαιμία στον άνθρωπο είναι ασθένεια που οφείλεται σε υποτελές γονίδιο και κληρονομείται με απλό Μεντελικό τρόπο. Μια γυναίκα της οποίας ο πατέρας έπασχε από γαλακτοζαιμία θέλει να

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑ 4.1 ΠΡΟΒΛΗΜΑ 4.2 ΠΡΟΒΛΗΜΑ 4.3 Ζευγάρια Παιδιά

ΠΡΟΒΛΗΜΑ 4.1 ΠΡΟΒΛΗΜΑ 4.2 ΠΡΟΒΛΗΜΑ 4.3 Ζευγάρια Παιδιά ΠΡΟΒΛΗΜΑ 4.1 Στο σιτάρι, φυτά με κόκκινους σπόρους διασταυρώθηκαν με φυτά που είχαν λευκούς. Όλοι οι απόγονοι είχαν κόκκινους σπόρους. Μετά από την αυτογονιμοποίηση των φυτών της F 1, πήραμε στην F 2 :

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 18/09/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Η Χαρά

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με χρώμα σπέρματος και ιώδες χρώμα άνθους. 109 άτομα με χρώμα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 22 Μαΐου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1. β Α.2. γ Α.3. α Α.4. δ Α.5. γ ΘΕΜΑ B B.1. 1. A 2. B 3. B 4. A 5. A 6. A 7. B 8.

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 5 ΚΕΦΑΛΑΙΟ 5 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

B5-Κεφάλαιο 5: Μεντελική κληρονομικότητα

B5-Κεφάλαιο 5: Μεντελική κληρονομικότητα A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την πρόταση, αν υπάρχει. 1. Από οποιοδήποτε φαινότυπο

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Ένας διπλοειδής οργανισμός με 4 ζεύγη ανεξάρτητων γονιδίων έχει γονότυπο ΑΑ ΒΒ Γγ Δδ. Ποια και πόσα είδη γαμετών είναι δυνατόν να δημιουργηθούν από

Διαβάστε περισσότερα



Διαβάστε περισσότερα


-ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΓΕΝΕΤΙΚΗΣ- Α. Εύρεση γαμετών -ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΓΕΝΕΤΙΚΗΣ- Α. Εύρεση γαμετών Για να βρίσκετε σωστά τους γαμέτες και να σχηματίζονται όλοι οι συνδυασμοί αλληλομόρφων σε αυτούς πρέπει να θυμάστε ότι κάθε γαμέτης περιέχει μόνο ένα

Διαβάστε περισσότερα

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων ΚεφόΑηιο 5 ΜενδεΠική κπηρονουικότηϊα 1. Συμπληρώστε με τις κατάλληλες λέξεις τα κενά στο κείμενο: Τα γονίδια που βρίσκονται στην ίδια γενετική θέση των ομόλογων χρωμοσωμάτων και ελέγχουν την ίδια ιδιότητα

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 5ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 5ο Μεθοδολογία Ασκσεων ΚΕΦ. 5ο Θα πρέπει να γνωρίζετε τα ακόλουθα: Γαμέτες. Κάθε γαμέτης περιέχει μόνο το ένα αλληλόμορφο από κάθε ζευγάρι γονιδίων. Όταν τα γονίδια βρίσκονται σε διαφορετικά ζεύγη ομόλογων

Διαβάστε περισσότερα

Μεντελική γενετική. Λείοι σπόροι του μοσχομπίζελου (Pisum sativum).

Μεντελική γενετική. Λείοι σπόροι του μοσχομπίζελου (Pisum sativum). Μεντελική γενετική Λείοι σπόροι του μοσχομπίζελου (Pisum sativum). Φαινότυπος και Γονότυπος Η φυσική εκδήλωση (φαινότυπος) της γενετικής σύστασης (γονότυπος) επηρεάζεται από τις αλληλεπιδράσεις με άλλα

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. 1. Στην πλειονότητά

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 12 Ιουνίου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. δ Α5. γ ΘΕΜΑ B B1. Σχολικό βιβλίο, κεφάλαιο 9

Διαβάστε περισσότερα


ΠΡΟΒΛΗΜΑ 5.1 ΠΡΟΒΛΗΜΑ 5.2 ΠΡΟΒΛΗΜΑ 5.3 ΠΡΟΒΛΗΜΑ 5.1 Στα ποντίκια το σκούρο μάτι απαιτεί την ταυτόχρονη παρουσία των υπερεχόντων αλληλομόρφων γονιδίων R και Q. Ζώα ομοζυγωτικά για ένα από τα δύο ή και τα δύο υποτελή αλληλόμορφα έχουν ανοιχτόχρωμα

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 2 ΕΠΙΚΡΑΤΗ 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με κίτρινο χρώμα σπέρματος και ιώδες χρώμα άνθους.

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ A Να γράψετε τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις A1 έως A5 και δίπλα το γράμμα που αντιστοιχεί στη φράση, η οποία

Διαβάστε περισσότερα


ΠΙΘΑΝΟΤΗΤΕΣ - ΑΣΚΗΣΕΙΣ ΠΙΘΑΝΟΤΗΤΕΣ - ΑΣΚΗΣΕΙΣ. Η πιθανότητα να είναι ένα νεογέννητο αγόρι είναι ½. Αν ένα αντρόγυνο κάνει δύο παιδιά, ποια η πιθανότητα να κάνει α πρώτα ένα αγόρι και μετά ένα κορίτσι, β ένα αγόρι και ένα κορίτσι

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελ. 120 «Τα κύτταρα των οργάνων να είναι επιτυχείς» Β2. Σελ. 136 «Το 1997 γέννησε την Dolly»

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β Β2. Σελίδα 40 σχολικού βιβλίου (έκδοση 2014-2015) Η παράγραφος «Έναρξη

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6 ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. Σε ένα είδος φυτών διακρίνονται δυο χρώματα άνθους, το κίτρινο και το λευκό. Για να διαπιστωθεί το είδος του γονιδίου που ελέγχει την ιδιότητα αυτή αλλά και ο τρόπος κληρονόμησής

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 ΘΕΜΑ Α Α1.β Α2.γ Α3.α Α4.δ Α5.γ ΘΕΜΑ Β Β1. 1A, 2B, 3B, 4A, 5A, 6A, 7B, 8B Β2. σελίδα 40 σχολικού

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης 22 Μαΐου 2015 Ενδεικτικές Απαντήσεις Θεμάτων

Βιολογία Θετικής Κατεύθυνσης 22 Μαΐου 2015 Ενδεικτικές Απαντήσεις Θεμάτων Βιολογία Θετικής Κατεύθυνσης 22 Μαΐου 2015 Ενδεικτικές Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. Α: 1, 4, 5, 6 Β: 2, 3, 7, 8 Β2. Βλέπε σχολικό εγχειρίδιο σελ. 41-42 «Κατά την έναρξη

Διαβάστε περισσότερα


ΚΕΦ.5 ΜΕΝΤΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΚΕΦ.5 ΜΕΝΤΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΕΡΩΤΗΣΕΙΣ ΑΝΑΠΤΥΞΗΣ ΚΑΙ ΕΜΒΑΘΥΝΣΗΣ ΘΕΩΡΙΑΣ 5.1. Σε ποια στοιχεία οφείλεται η επιτυχία των πειραμάτων του Mendel; 5.2. Τι είναι ο γονότυπος ; Πως μπορούμε να βρούμε το γονότυπο

Διαβάστε περισσότερα


ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 5 ΚΕΦΑΛΑΙΟ ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 5 ΚΕΦΑΛΑΙΟ 1 Στη δροσόφιλα το κόκκινο χρώμα των ματιών είναι επικρατές. Εάν οι απόγονοι σε δύο διαφορετικές διασταυρώσεις είναι οι ακόλουθοι: ιασταύρωση Α ιασταύρωση Β 24 αρσενικά

Διαβάστε περισσότερα


Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 Πανελλήνιες 2015 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 ΘΕΜΑ Α Α1- β Α2- γ Α3- α Α4- δ Α5- γ ΘΕΜΑ Β Β1. Α: σωματικά κύτταρα στην αρχή της μεσόφασης -> 1,4,5,6 Β: γαμέτης:

Διαβάστε περισσότερα

Β2. σελ σχ. βιβλίου: "Κατά το στάδιο της μετάφρασης...συνδέεται με τη μικρή".

Β2. σελ σχ. βιβλίου: Κατά το στάδιο της μετάφρασης...συνδέεται με τη μικρή. ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ ΘΕΜΑ Β Β1. 1-Α 2-Β 3-Β 4-Α 5-Α 6-Α 7-Β 8-Β Β2. σελ. 36-37 σχ. βιβλίου: "Κατά το στάδιο της μετάφρασης...συνδέεται με τη μικρή".

Διαβάστε περισσότερα

Δασική Γενετική Τα πειράματα του Mendel

Δασική Γενετική Τα πειράματα του Mendel Δασική Γενετική Τα πειράματα του Mendel Χειμερινό εξάμηνο 2014-2015 Παράδοξο... Οι απόγονοι μοιάζουν στους γονείς τους Δεν είναι όμως ακριβώς ίδιοι, ούτε με τους γονείς τους, ούτε μεταξύ τους Κληρονομικότητα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015

Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015 Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015 Θέμα Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ Θέμα Β Β1. 1. Α 2. Β 3. Β 4. Α 5. Α 6. Α 7. Β 8. Β Β2. Το σύμπλοκο που δημιουργείται μετά την πρόσδεση του

Διαβάστε περισσότερα

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.»

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.» 23 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1 γ Α.2 β Α.3 β Α.4 δ Α.5 α ΘΕΜΑ Β B.1 Σχολικό βιβλίο, σελίδα 34: «Η αλληλουχία

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 00 ΗΜΕΡΗΣΙΟ. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΡΟΒΛΗΜΑ 3.1 r/r III ΠΡΟΒΛΗΜΑ 3.2 ΠΡΟΒΛΗΜΑ 3.1 'Ένα υποτελές αλληλόμορφο r είναι υπεύθυνο για την εμφάνιση κόκκινου τριχώματος στις αγελάδες, ενώ το υπερέχων του αλληλόμορφο R προκαλεί σκούρο χρωματισμό. Στο παρακάτω γενεαλογικό δένδρο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό Θέμα 1 ο 1. α 2. γ 3. γ 4.β 5. δ Θέμα 2 ο Α. Οι νόμοι του Mendel δεν ισχύουν σε πολυγονιδιακούς χαρακτήρες και σε συνδεδεμένα γονίδια (μη ανεξάρτητα), ενώ οι αναλογίες δεν είναι οι αναμενόμενες σε φυλοσύνδετα

Διαβάστε περισσότερα

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική. β. Το πλασμίδιο που θα χρησιμοποιηθεί ως φορέας κλωνοποίησης.

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική. β. Το πλασμίδιο που θα χρησιμοποιηθεί ως φορέας κλωνοποίησης. β. Το πλασμίδιο που θα χρησιμοποιηθεί ως φορέας κλωνοποίησης. Ν Ε Β Η Γονίδιο ανθεκτικότητας στο αντιβιοτικό θέση έναρξης της αντιγραφής καθώς και τις θέσεις πάνω σε αυτό που αναγνωρίζουν και κόβουν οι

Διαβάστε περισσότερα



Διαβάστε περισσότερα


Μίτωση. ΓΕΝΕΤΙΚΗ Μίτωση http://vodpod.com/watch/631992-untitled http://www.youtube.com/watch?v=vln7k1-9qb0&feature=related Μείωση http://www.youtube.com/watch?v=qwmpd0ob3aq&feature=related Μεντελική Κληρονομικότητα

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 ΘΕΜΑ 1ο 1. δ, ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 2. β, 3. β, 4. γ, 5. δ. ΘΕΜΑ2ο 1. Σχολικό βιβλίο, σελίδα 31: «Υπάρχουν τέσσερα είδη μορίων RNA και το μεταφέρει στη θέση της πρωτεϊνοσύνθεσης».

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Γ Γ.1 Ο χαρακτήρας της ομάδας αίματος στον άνθρωπο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Παρασκευή, 21 Μαΐου 2010 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα


Κ Η Λ Ρ Η ΟΝ Ο Ο Ν Μ Ο ΙΚ Ι Ο Κ Τ Ο Η Τ Τ Η Α ΚΕΦΑΛΑΙΟ 5ο: Η πρώτη επιστηµονική µελέτη για την κληρονοµικότητα έγινε το 19ο αιώνα ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Από τον Αυστριακό µοναχός Gregor Mendel Θεωρείται ο πατέρας της Γενετικής 1 Ένα σηµαντικό στοιχείο

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα


ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΓΕΝΕΑΛΟΓΙΚΑ ΔΕΝΔΡΑ ΟΜΑΔΑ Α 1. Η Ιωάννα έχει βραχυδαχτυλία όπως επίσης και τα 2 μεγαλύτερα αδέλφια της που είναι ομοζυγωτικοί δίδυμοι. Οι άλλες δύο μικρότερες αδελφές της έχουν

Διαβάστε περισσότερα

Μέρος 4 ο. Μενδελική γενετική. Gregor Mendel 1866

Μέρος 4 ο. Μενδελική γενετική. Gregor Mendel 1866 Μέρος 4 ο Μενδελική γενετική Gregor Mendel 1866 Εισαγωγή στη δασική γενετική Εγγενής πολλαπλασιασµός Ο εγγενής πολλαπλασιασµός, περιλαµβάνει όλες τις περιπτώσεις που ένας νέος οργανισµός αρχίζει τη ζωή

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης

Βιολογία Θετικής Κατεύθυνσης ΘΕΜΑ Α Α1. β. Α2. γ. Α3. α. Α4. δ. Α5. γ. Θέμα Β Β1. 1. α 2. β 3. β 4. α 5. α 6. α 7. β 8. β Βιολογία Θετικής Κατεύθυνσης 22-5-2015 Β2. Σχολικό βιβλίο σελ:36-37 «κατά την έναρξη... σύμπλοκο έναρξης πρωτεϊνοσύνθεσης.»

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 24 Μαΐου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ B B1. Η διαδικασία που εφαρμόστηκε για πρώτη φορά

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ ΑΣΚΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ 1. Από τα παρακάτω σχήματα: - Το (i) παριστάνει τμήμα DNA προκαρυωτικού κυττάρου, στο οποίο περιέχεται ένα γονίδιο και ο υποκινητής του (Υ) - Το (ii) παριστάνει το

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013 ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά τροποποιούνται έξω

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ ΘΕΜΑ Β Β1. Η απάντηση περιλαμβάνεται στις σελ. 90 91 σχολικού βιβλίου από το παράδειγμα της δρεπανοκυτταρικής αναιμίας πολλές ομοιότητες με την αρχική.

Διαβάστε περισσότερα


ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ. 7η ΙΑΛΕΞΗ ΜΕΘΟ ΟΙ ΕΠΙΛΟΓΗΣ ΣΤΑΥΡΟΓΟΝΙΜΟΠΟΙΟΥΜΕΝΩΝ ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ 7η ΙΑΛΕΞΗ ΜΕΘΟ ΟΙ ΕΠΙΛΟΓΗΣ ΣΤΑΥΡΟΓΟΝΙΜΟΠΟΙΟΥΜΕΝΩΝ ΦΥΤΩΝ Μαζική Επιλογή Η παλαιότερη µέθοδος Γενετικής Βελτίωσης Κυρίως χρησιµοποιείται για την βελτίωση πληθυσµών σταυρογονιµοποιούµενων

Διαβάστε περισσότερα