Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:



1 ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Ένας διπλοειδής οργανισμός με 4 ζεύγη ανεξάρτητων γονιδίων έχει γονότυπο ΑΑ ΒΒ Γγ Δδ. Ποια και πόσα είδη γαμετών είναι δυνατόν να δημιουργηθούν από αυτόν τον οργανισμό; 4 γαμέτες ΑΒΓΔ, ΑΒΓδ, ΑΒγΔ, ΑΒγδ ΕΠΙΚΡΑΤΕΣ-ΥΠΟΛΕΙΠΟΜΕΝΟ 2. Αν διασταυρωθούν άτομα μοσχομπίζελου με κίτρινο χρώμα σπέρματος ποιες θα είναι οι φαινοτυπικές και γονοτυπικές αναλογίας της F 1 γενιάς; Κ=κίτρινο, κ=πράσινο, όπου Κ>κ 1 η περίπτωση: ΚΚ Χ ΚΚ Γ.Α: 100% ΚΚ Φ.Α: 100% κίτρινα 2 η περίπτωση: Κκ Χ ΚΚ Γ.Α: 1 ΚΚ : 1 Κκ Φ.Α: 100% κίτρινα 3 η περίπτωση: Κκ Χ Κκ Γ.Α: 1 ΚΚ : 2 Κκ : 1 κκ Φ.Α: 3 κίτρινα : 1 πράσινο 3. Η διασταύρωση σκύλων με απαλό τρίχωμα δίνει μόνο απογόνους με απαλό τρίχωμα. Αρσενικός σκύλος με σκληρό τρίχωμα διασταυρώνεται με θηλυκό σκύλο με απαλό τρίχωμα και γεννιούνται 8 κουτάβια από τα οποία τα 7 έχουν σκληρό τρίχωμα και το 1 έχει απαλό τρίχωμα. α. Ποιος ο γονότυπος των γονέων και των απογόνων; β. Ποια θα ήταν η αναμενόμενη φαινοτυπική αναλογία των απογόνων; γ. Ποιος θα ήταν ο αναμενόμενος αριθμός απογόνων με απαλό τρίχωμα; α. Σ=σκληρό, σ=απαλό, όπου Σ>σ Σσ, σσ (γονείς) Σσ, σσ (απόγονοι) β. 1 σκληρό : 1 απαλό γ Όταν διασταυρώνονται κόκκινες αλεπούδες γεννιούνται και απόγονοι με ασημίμαύρο χρώμα. Ποια η πιθανότητα από μια τέτοια διασταύρωση, οι 3 πρώτοι απόγονοι να έχουν οι δύο κόκκινο χρώμα και ο ένας ασημι-μαύρο με τυχαία σειρά; Κ=κόκκινο, κ=ασημί-μαύρο, όπου Κ>κ Κκ Χ Κκ 1 η περίπτωση: Κόκκινο Κόκκινο Ασημί μαύρο = 3/4 3/4 1/4 = 9/64 2 η περίπτωση: Κόκκινο Ασημί μαύρο Κόκκινο = 3/4 1/4 3/4 = 9/64 3 η περίπτωση: Ασημί μαύρο Κόκκινο Κόκκινο = 1/4 3/4 3/4 = 9/64 Άρα Pολ=P 1 + P 2 + P 3 = 9/64 + 9/64 + 9/64 = 27/64 5. Στον άνθρωπο τα σγουρά μαλλιά επικρατούν των ίσιων μαλλιών. Τέσσερα αδέλφια έχουν σγουρά μαλλιά. Τι τύπου μαλλιά έχουν οι γονείς τους; Σ=σγουρά μαλλιά, σ=ίσια μαλλιά, όπου Σ>σ ΣΣ Χ ΣΣ, ΣΣ Χ Σσ, Σσ Χ Σσ, Σσ Χ σσ, ΣΣ Χ σσ 6. Ένας άνδρας με μυϊκή δυστροφία (αυτοσωμικό επικρατές) παντρεύεται μια φυσιολογική γυναίκα. 1

2 α. Ποια η γονοτυπική και φαινοτυπική αναλογία των απογόνων; β. Ποια η πιθανότητα το 1 ο παιδί να έχει μϋική δυστροφία; α. Μ=επικρατές, μ=υπολειπόμενο, όπου Μ>μ 1 η περίπτωση: ΜΜ Χ μμ Γ.Α: 100% Μμ Φ.Α: 100% μυική δυστροφία 2 η περίπτωση: Μμ Χ μμ Γ.Α: 1 Μμ : 1 μμ Φ.Α: 1 μυική δυστροφία : 1 φυσιολογικό β. P 1= 1/2 1 = 1/2, P 2= 1/2 1/2 = 1/4 και Pολ= P 1 + P 2 = 1/2 + 1/4 =3/4 7. Γυναίκα με Rh - (ρέζους αρνητικό-παράγοντας αίματος) της οποίας και οι δύο γονείς έχουν Rh + ( ρέζους θετικό), έχει παντρευτεί με άνδρα Rh - του οποίου η μητέρα είναι Rh - και ο πατέρας Rh +. α. Να δείξετε τους γονότυπους όλων των ατόμων. β. Ο άνδρας κατηγορεί τη γυναίκα για μοιχεία. Το ζευγάρι έχει 3 παιδιά, τα 2 Rh - και το 1 Rh +. Έχει δίκιο; Επειδή από γονείς με Rh + προκύπτει γυναίκα με Rh -, αυτό σημαίνει ότι το Rh + είναι επικρατές και αυτοσωμικό. R= Rh +, r= Rh -, όπου R>r α. Γονείς γυναίκας: Rr και Rr Γυναίκα: rr Μητέρα άνδρα: rr Πατέρας άνδρα: Rr Άνδρας: rr β. Τα 2 παιδιά rr το άλλο Rr. Όμως από τη διασταύρωση rr Χ rr προκύπτουν μόνο άτομα με rr. Άρα έχει δίκιο. 8. Στα πρόβατα το στιλπνό τρίχωμα επικρατεί έναντι του κανονικού τριχώματος. Δύο ετερόζυγα άτομα διασταυρώνονται και γεννιέται αρνί με στιλπνό τρίχωμα. Αν τα αρνί διασταυρωθεί με τον πατέρα του ποια είναι η πιθανότητα να γεννηθεί απόγονος με κανονικό τρίχωμα; Σ=στιλπνό, σ=κανονικό, όπου Σ>σ Σσ Χ Σσ γαμέτες Σ, σ Σ, σ ΣΣ, Σσ, Σσ, σσ 1/3 2/3 1 η περίπτωση: ΣΣ Χ Σσ γαμέτες Σ Σ, σ P 1 = 0 2 η περίπτωση: Σσ Χ Σσ γαμέτες Σ, σ Σ, σ P 2 = 2/3 1/4 = 2/12 = 1/6 Άρα Pολ= P 1 + P 2 = 0 + 1/6 = 1/6 9. Η Δήμητρα έχει φυσιολογικό μεταβολισμό, αλλά ο αδελφός της έχει φαινυλκετονουρία ενώ ο πατέρας της έχει φαινυλκετονουρία και η μητέρα της έχει φυσιολογικό μεταβολισμό. α. Ποιοι είναι οι γονότυποι των ατόμων; β. Η Δήμητρα παντρεύεται άνδρα με φυσιολογικό μεταβολισμό. Ποια είναι η πιθανότητα να γεννήσει παιδί με φαινυλκετονουρία; γ. Ποια είναι η πιθανότητα να γεννήσει κορίτσι με φαινυλκετονουρία; Φ= φυσιολογικό, φ=φαινυλκετονουρία, όπου Φ>φ α. Δήμητρα Φφ Αδελφός φφ Πατέρας φφ Μητέρα Φφ β. Άνδρας= ΦΦ (1/2) ή Φφ (1/2) 2

3 1 η περίπτωση: ΦΦ Χ Φφ P 1 = 0 2 η περίπτωση: Φφ Χ Φφ P 2 = 1/2 1/4 = 1/8 Άρα Pολ= P 1 + P 2 = 0 + 1/8 = 1/8 γ. P= 1/8 1/2 = 1/ Στο ψάρι «sailfin mollies» αμιγή άτομα με χρυσαφί χρώμα διασταυρώθηκαν με αμιγή άτομα με κανονικό χρώμα. Στην F 2 γεννήθηκαν απόγονοι από τους οποίους οι είχαν χρυσαφί και οι υπόλοιποι κανονικό χρώμα. α. Να ερμηνεύσετε το αποτέλεσμα και να δείξετε τις διασταυρώσεις. β. Πως γίνεται στην F 3 γενιά να γεννιούνται μόνο άτομα με κανονικό χρώμα; α. F 2 = : χρυσαφί : 3 κανονικό Άρα Κ=κανονικό, κ=χρυσαφί, όπου Κ>κ ΚΚ Χ κκ γαμέτες Κ κ F 1 Κκ F 1 Χ F 1 : Κκ Χ Κκ γαμέτες Κ, κ Κ, κ F 2 ΚΚ, Κκ, Κκ, κκ 3 κανονικά 1 χρυσαφί β. Γίνεται διασταύρωση ελέγχου ώστε να απομακρυνθούν τα ετερόζυγα κανονικά άτομα. 1 η περίπτωση: ΚΚ Χ κκ γαμέτες Κ κ F 1 Κκ όλα κανονικά 2 η περίπτωση: Κκ Χ κκ γαμέτες Κ, κ κ F 1 Κκ, κκ κανονικά χρυσαφί 11. Στα ποντίκια άτομα με βερυκοκί χρώμα ματιών δίνουν πάντα βερυκοκί χρώμα, ενώ άτομα με καφέ μάτι δίνουν είτε καφέ και βερυκοκί είτε μόνο καφέ. α. Εάν ποντίκι με καφέ χρώμα διασταυρωθεί με θηλυκό ποντίκι με βερυκοκί χρώμα και γεννήσουν 4 απογόνους ποιος αναμένεται να είναι ο αριθμός των ατόμων με βερυκοκί μάτι; β. Από τους 4 απογόνους που γεννήθηκαν οι 2 είχαν καφέ και οι 2 βερυκοκί χρώμα. Πως το εξηγείτε; α. Κ=καφέ, κ=βερυκοκί, όπου Κ>κ Καφέ: ΚΚ (1/2) ή Κκ (1/2), βερυκοκί: κκ 1 η περίπτωση: ΚΚ Χ κκ P 1 (καφέ)= 1/2 1= 1/2 P 1 (βερυκοκί)= 0 2 η περίπτωση: Κκ Χ κκ P 1 (καφέ)= 1/2 1/2= 1/4 P 1 (βερυκοκί)= 1/2 1/2= 1/4 Άρα Pολ(καφέ)=P 1 + P 2 = 1/2+1/4=3/4 και Pολ(βερυκοκί)=P 1 + P 2 =0+1/4=1/4 (άτομο 1) β. Ο αριθμός των απογόνων είναι πολύ μικρός για να επιβεβαιωθούν τα στατιστικά αποτελέσματα. 12. Στη Drosophila melanogaster το κόκκινο χρώμα ματιών επικρατεί έναντι του ροζ. Η διασταύρωση ετερόζυγων ατόμων με κόκκινα μάτια έχει σαν αποτέλεσμα την γέννηση 60 απογόνων. α. Πόσοι από αυτούς θα έχουν κόκκινα μάτια και θα είναι ετερόζυγοι; β. Με ποιον τρόπο είναι δυνατό να απομακρυνθούν οι ετερόζυγοι γονότυποι; α. Κ=κόκκινο, κ=ροζ, όπου Κ>κ Άρα 2/4 60=30άτομα β. Διασταύρωση ελέγχου 3

4 1 η περίπτωση: ΚΚ Χ κκ γαμέτες Κ κ F 1 Κκ όλα κόκκινα 2 η περίπτωση: Κκ Χ κκ γαμέτες Κ, κ κ F 1 Κκ, κκ κόκκινα ροζ ΕΝΔΙΑΜΕΣΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 13. Διασταυρώνονται αμιγή άτομα, ως προς το κόκκινο και το λευκό χρώμα του άνθους, από το φυτό σκυλάκι. Ποιες οι αναμενόμενες φαινοτυπικές και γονοτυπικές αναλογίες στην F 1 και F 2 γενιά; Κ 1 =κόκκινο, Κ 2 =λευκό, όπου Κ 1 = Κ 2 F 1 Φ.Α: ροζ 100%, Γ.Α: Κ 1 Κ 2 F 2 Φ.Α: 1 κόκκινο : 2 ροζ : 1 λευκό, Γ.Α: 1 Κ 1 Κ 1 : 2 Κ 1 Κ 2 : 1 Κ 2 Κ Το σχήμα στα ραπάνια μπορεί να είναι επίμηκες, σφαιρικό και ωοειδές. Όταν διασταυρώνονται ωοειδή ραπανάκια εμφανίζονται και οι 3 φαινότυποι, με τα επιμήκη άτομα να είναι σε ίση αναλογία με τα σφαιρικά. Εάν από τη διασταύρωση ωοειδών ατόμων προέκυψαν 240 άτομα ποιος αριθμός ατόμων έχει επίμηκες, σφαιρικό και ωοειδές σχήμα; 120 άτομα ωοειδές, 60 άτομα σφαιρικό, 60 άτομα επίμηκες 15. Σε ένα μαιευτήριο 3 ζευγάρια ΑxB, ΑxO και ΟxB γέννησαν από 1 παιδί με ομάδα αίματος ΑΒ, Α και Ο. Σε ποιο ζευγάρι ανήκει το κάθε παιδί; Το ΑΒ ανήκει στο Α Χ Β το Α ανήκει στο Α Χ Ο το Ο ανήκει στο Ο Χ Β 16. Να δείξετε τις παρακάτω διασταυρώσεις: ΑxΟ, ΟxΟ, ΑΒxB Α Χ Ο 1 η περίπτωση: Ι Α Ι Α Χ ii γαμέτες Ι Α i F 1 Ι Α i ομάδα Α 2 η περίπτωση: Ι Α i Χ ii γαμέτες Ι Α, i i F 1 Ι Α i, ii ομάδα Α ομάδα Ο Ο Χ Ο ii Χ ii γαμέτες i i F 1 ii ομάδα Ο ΑΒ Χ Β 1 η περίπτωση: Ι Α Ι Β Χ Ι Β Ι Β γαμέτες Ι Α, Ι Β Ι Β F 1 Ι Α Ι Β, Ι Β Ι Β ομάδα ΑΒ ομάδα Β 2 η περίπτωση: Ι Α Ι Β Χ Ι Β i γαμέτες Ι Α, Ι Β Ι Β, i F 1 Ι Α Ι Β, ομάδα ΑΒ Ι Α i, ομάδα Α Ι Β Ι Β, ομάδα Β Ι Β i, ομάδα Β 17. Γυναίκα με ομάδα αίματος Β, της οποίας ο πατέρας είχε ομάδα αίματος Ο παντρεύεται άνδρα με ομάδα αίματος Α. α. Ποια η πιθανότητα από το ζευγάρι αυτό να γεννηθεί παιδί με ομάδα αίματος ΑΒ; β. Ποια η πιθανότητα από το ζευγάρι αυτό να γεννηθεί αγόρι με ομάδα αίματος Ο; 4

5 Γυναίκα Ι Β i, άνδρας Ι Α Ι Α (1/2) ή Ι Α i (1/2) 1 η περίπτωση: Ι Β i Χ Ι Α Ι Α P 1 (ΑΒ)= 1/2 1/2= 1/4 P 1 (Ο)= 1/2 0=0 2 η περίπτωση: Ι Β i Χ Ι Α i P 1 (ΑΒ)= 1/2 1/4= 1/8 P 1 (Ο)= 1/2 1/4= 1/8, άρα α. Pολ=P 1 (ΑΒ)+ P 2 (ΑΒ)= 1/4+1/8=2/8+1/8=3/8 β. Pολ=[P 1 (Ο)+ P2(Ο)] 1/2 (πιθανότητα να γεννηθεί αγόρι)= [0 +1/8] 1/2 =1/8 1/2=1/ Γυναίκα ομάδα αίματος Α ζητάει από άνδρα ομάδα αίματος Β, του οποίου οι γονείς είναι ΑΒ, διατροφή για το παιδί της που είναι ομάδα αίματος Ο. Μπορεί να στηρίξει την απαίτησή της; Όχι γιατί το παιδί είναι ii, ενώ ο άνδρας θα είναι υποχρεωτικά Ι Β Ι Β αφού οι γονείς του ήταν Ι Α Ι Β. Οπότε ο άνδρας μπορεί να δώσει στο παιδί μόνο το Ι Β γαμέτη και όχι το i. 19. Σε μια ποικιλία φυτού από τη διασταύρωση φυτών με κόκκινο χρώμα και φυτών με λευκό χρώμα άνθους προκύπτουν πάντα άτομα με ροζ χρώμα άνθους. Η διασταύρωση ατόμων με λευκό και ατόμων με κόκκινο χρώμα άνθους έχει σαν αποτέλεσμα στην F 2 να γεννιούνται 45 απόγονοι με κόκκινο χρώμα. Εμφανίζονται άλλοι φαινότυποι στην F 2 και αν ναι ποιος ο αριθμός των απογόνων που φέρουν τους συγκεκριμένους φαινότυπους; Κ 1 =κόκκινο, Κ 2 =λευκό, όπου Κ 1 = Κ 2 F 2 Κ 1 Κ 1 =κόκκινοι (45 απόγονοι) Κ 2 Κ 2 =λευκοί (45 απόγονοι) Κ 1 Κ 2 =ροζ (90 απόγονοι) 20. Οι φασιανοί μπορεί να έχουν χρώμα ανοιχτό, κίτρινο και δακτυλιωτό. Δίνονται οι παρακάτω διασταυρώσεις και τα αποτελέσματά τους. Αρσενικά x Θηλυκά Φαινότυποι απογόνων Ανοικτό Κίτρινο «Δακτυλιωτό» α. ανοικτά x ανοικτά 92 β. ανοικτά x κίτρινα γ. κίτρινα x ανοικτά δ. ανοικτά x «δακτυλιωτά» ε, κίτρινα x κίτρινα στ. κίτρινα x «δακτυλιωτά» ζ. «δακτυλιωτά» x κίτρινα η. «δακτυλιωτά» x δακτυλιωτά» Να βρείτε τους γονότυπους των γονέων. Οι διασταυρώσεις β, γ, στ και ζ δείχνουν ότι τα γονίδια δεν είναι φυλοσύνδετα. Αφού υπάρχουν 3 φαινότυποι τότε η εξήγηση δίνεται με βάση την ατελώς επικρατή ή τη συνεπικρατή κληρονόμηση, Η δ δείχνει ότι ετερόζυγο είναι το κίτρινο και η ε ότι το ανοιχτό και το δακτυλιωτό είναι ακραίοι φαινότυποι. Άρα αν Κ 1 =ανοιχτό, Κ 2 =δακτυλιωτό και Κ 1 = Κ 2, τότε Ανοιχτό: Κ 1 Κ 1 Δακτυλιωτό: Κ 2 Κ 2 Κίτρινο: Κ 1 Κ 2 ΦΥΛΟΣΥΝΔΕΤΑ 21. Άνδρας δαλτωνικός και γυναίκα φυσιολογική έχουν 5 κόρες δαλτωνικές και 1 γιο δαλτωνικό. Ο άνδρας έχει μάθει ότι ένα φυλοσύνδετο γνώρισμα δεν μεταφέρεται από τον πατέρα στον γιο γι αυτό και κατηγορεί την γυναίκα του για μοιχεία. Έχει δίκιο; 5

6 Όχι. Για να έχει 5 κόρες δαλτωνικές σημαίνει ότι η γυναίκα του είναι ετερόζυγη (φορέας) η οποία και μετέφερε το φυλοσύνδετο υπολειπόμενο γονίδιο στο γιο της και όχι αυτός. 22. Κουνέλια με λευκή ουρά διασταυρώνονται και γεννιούνται 25 θηλυκά με λευκή ουρά, 12 αρσενικά με κόκκινη και 14 αρσενικά με λευκή ουρά. Να δείξετε τη διασταύρωση. Χ Λ =λευκό, Χ λ =κόκκινο, όπου Χ Λ >Χ λ Χ Λ Υ Χ Χ Λ Χ λ γαμέτες Χ Λ, Υ Χ Λ, Χ λ Χ Λ Χ Λ, θηλυκό λευκό Χ Λ Χ λ, θηλυκό λευκό Χ Λ Υ, λευκό Χ λ Υ κόκκινο 23. Το Talmud, ιερό βιβλίο των Εβραίων, αναφέρει ότι αν μια γυναίκα γεννήσει 2 γιούς οι οποίοι πεθάνουν στην περιτομή (είναι η αφαίρεση δέρματος από την κεφαλή του γενετικού μορίου) από ακατάσχετη αιμορραγία τότε σε κάθε επόμενο γιο δεν θα πρέπει να γίνεται περιτομή. Εντούτοις στους γιους των αδελφών της μπορεί να γίνει η περιτομή χωρίς να υπάρχει για τα παιδιά αυτά κίνδυνος. Θα μπορούσε ένας τέτοιος θρησκευτικός νόμος να ερμηνευτεί με βάση τις αρχές τις γενετικής; Θα μπορούσε να ερμηνευτεί ως φυλοσύνδετο αφού περνάει από τη μητέρα στο γιο και όχι από τον πατέρα στο γιο. Επίσης το γνώρισμα θα πρέπει να είναι υπολειπόμενο, αφού διαφορετικά θα εμφανιζόταν σε μεγάλη συχνότητα και θα κινδύνευαν και οι γυναίκες από ακατάσχετη αιμορραγία σε περίπτωση πληγής. 24. Άνδρας κυαμικός (οφείλεται σε φυλοσύνδετο υπολειπόμενο) παντρεύεται γυναίκα φυσιολογική και αποκτούν κυαμικό παιδί. α. Ποια η πιθανότητα το επόμενο παιδί να είναι κυαμικό; β. Ποια η πιθανότητα το επόμενο παιδί να είναι αγόρι και κυαμικό; Χ Κ =φυσιολογικός, Χ κ =κυαμικός, όπου Χ Κ >Χ κ Η γυναίκα είναι ετερόζυγη Χ Κ Χ κ α. P 1 =1/2 β. P 2 =1/2 1/2=1/4 25. Από τη διασταύρωση γάτου με κοντή σαν ράβδο ουρά με θηλυκό άτομο με κανονική ουρά γεννιούνται 12 θηλυκά με κοντή σαν ράβδο ουρά και 11 αρσενικά με κανονική ουρά. Να γράψετε τους γονότυπους των ατόμων και να δείξετε τη διασταύρωση. Αφού όλα τα θηλυκά έχουν κοντή σαν ράβδο ουρά αυτό σημαίνει ότι το γονίδιο είναι επικρατές. Άρα Χ Ρ =κοντή σαν ράβδος ουρά, Χ ρ =κανονική ουρά, όπου Χ Ρ >Χ ρ Χ Ρ Υ Χ Χ ρ Χ ρ γαμέτες Χ Ρ, Υ Χ ρ Χ Ρ Χ ρ, Χ ρ Υ θηλυκό με ουρά ράβδο με κανονική ουρά 26. Σε μια οικογένεια υπάρχουν τρία παιδιά, ένα αγόρι κι δύο κορίτσια. Το ένα μόνο κορίτσι είναι αιμορροφιλικό. Γνωρίζοντας τα άλλα δύο παιδιά ότι η αιμορροφιλία είναι κληρονομική φοβούνται να παντρευτούν. Τι γενετική συμβουλή μπορείτε να τους δώσετε; Χ Α =κανονικό, Χ α = αιμορροφιλικό, όπου Χ Α >Χ α Οι γονότυποι των άλλων δύο παιδιών είναι Χ Α Χ α και Χ Α Υ α. Για το κορίτσι (Χ Α Χ α ) υπάρχουν δύο περιπτώσεις: 1 η περίπτωση: Ο άντρας της να είναι Χ Α Υ (1/2) Χ Α Χ α Χ Χ Α Υ P 1 =1/2 1/4=1/8 2 η περίπτωση: Ο άντρας της να είναι Χ α Υ (1/2) Χ Α Χ α Χ Χ α Υ 6

7 P 2 =1/2 1/2=1/4 Άρα η πιθανότητα να κάνει παιδί αιμορροφιλικό συνολικά είναι: Pολ=P 1 +P 2 =1/8+1/4=1/8+2/8=3/8 β. Για το αγόρι (Χ Α Υ) υπάρχουν τρεις περιπτώσεις: 1 η περίπτωση: Η γυναίκα του να είναι Χ Α Χ Α (1/3) Χ Α Υ Χ Χ Α Χ Α P 1 =0 2 η περίπτωση: Η γυναίκα του να είναι Χ Α Χ α (1/3) Χ Α Υ Χ Χ Α Χ α P 2 =1/3 1/4=1/12 Η γυναίκα του να είναι Χ α Χ α (1/3) Χ Α Υ Χ Χ α Χ α P 2 =1/2 1/3=1/6 Άρα η πιθανότητα να κάνει παιδί αιμορροφιλικό συνολικά είναι: Pολ=P 1 +P 2 +P 3 =0+1/12+1/6=1/12+2/12=3/12=1/ Στις κότες το γονίδιο που δίνει το στικτό φτέρωμα είναι φυλοσύνδετο και επικρατές έναντι του ομοιόχρωμου. Να βρεθούν οι απόγονοι που θα προκύψουν από τη διασταύρωση ομοιόχρωμων θηλυκών με στικτά αρσενικά και αντίστροφα. Δίνεται ότι το θηλυκό είναι ΧΥ. Χ Σ =στικτό φτέρωμα, Χ σ =ομοιόχρωμο φτέρωμα, όπου Χ Σ >Χ σ α. 1 η περίπτωση: Χ σ Υ Χ Χ Σ Χ Σ F 1 Χ Σ Χ σ, Χ Σ Υ στικτό φτέρωμα στικτό φτέρωμα 2 η περίπτωση: Χ σ Υ Χ Χ Σ Χ σ Χ Σ Χ σ, Χ σ Χ σ, Χ Σ Υ, Χ σ Υ στικτό ομοιόχρωμο στικτό ομοιόχρωμο φτέρωμα φτέρωμα φτέρωμα φτέρωμα ΘΝΗΣΙΓΟΝΑ β. Χ Σ Υ Χ Χ σ Χ σ F 1 Χ Σ Χ σ, Χ σ Υ στικτό φτέρωμα ομοιόχρωμο φτέρωμα 28. Κοτόπουλα με κοντά πόδια και φτερά ονομάζονται «creepers». Όταν διασταυρώνονται «creepers» με κανονικά κοτόπουλα τότε παράγονται creepers και κανονικά πτηνά σε αναλογία 1:1. Όταν creepers διασταυρώνονται μεταξύ τους γεννιούνται απόγονοι με αναλογία 2 creepers : 1 κανονικό. Διασταύρωση κανονικών ατόμων δίνει μόνο κανονικά άτομα. Πως μπορείτε να εξηγήσετε αυτά τα αποτελέσματα; Αυτοσωμικό θνησιγόνο γονίδιο. 29. Στα κουνέλια εμφανίζεται η ανωμαλία «Pelger» που προκαλεί την μη φυσιολογική λειτουργία των λευκοκυττάρων. Από την διασταύρωση ατόμων που φέρουν την ανωμαλία «Pelger» γεννιούνται 11 κανονικά και 23 άτομα με «Pelger». Να εξηγηθεί το αποτέλεσμα και να δείξετε την διασταύρωση. Κανονικά : Pelger 1 : 2, άρα θνησιγόνο αυτοσωμικό γονίδιο Έστω Α=φυσιολογικό και Α =θνησιγόνο ΑΑ Χ ΑΑ γαμέτες Α, Α Α, Α F 1 ΑΑ, ΑΑ, ΑΑ, Α Α φυσιολογικό Pelger πεθαίνει (1) (2) 30. Από την διασταύρωση ατόμων Drosophila γεννήθηκαν 200 θηλυκά και 90 αρσενικά. Να εξηγήσετε το αποτέλεσμα. 7

8 ΠΟΛΛΑΠΛΑ Φυλοσύνδετο θνησιγόνο γονίδιο. 31. Στα κουνέλια το χρώμα ελέγχεται από τα γονίδια C,C ch,c h,c ενώ τα άτομα μπορούν να εμφανίζουν το γκρι χρώμα, το χρώμα Chinchilla, το ανοιχτό γκρι, το χρώμα Himalayan και τον αλφικό χρωματισμό. Δίνονται οι παρακάτω διασταυρώσεις: Γονότυποι ατόμων Φαινότυποι απογόνων CC x CC ch Όλοι γκρι χρώμα C ch C ch x C ch C ch Όλοι Chinchilla C ch C ch x C ch C h Μισοί Chinchilla, μισοί ανοιχτό γκρι CC x CC h Όλοι γκρι χρώμα C ch C ch x C h C h Όλοι ανοιχτό γκρι cc x cc Όλοι αλφικοί C h C h x cc Όλοι Himalayan C ch C ch x cc Όλοι ανοιχτό γκρι CC x Cc Όλοι γκρι Τι συμπεραίνετε για την σχέση των γονιδίων; C>C ch >C h >c. To C ch δίνει δύο φαινότυπους: Ομόζυγο C ch C ch δίνει το χρώμα Chinchilla Ετερόζυγο C ch C h ή C ch c δίνει το ανοιχτό γκρι χρώμα 32. Το φτέρωμα στις κοινές πάπιες μπορεί να είναι ανοιχτό λαρδί, λαρδί και σκούρο λαρδί. Η διασταύρωση ατόμων με ανοιχτό λαρδί με άτομα με σκούρο λαρδί δίνει απογόνους με αναλογία 1 ανοιχτό λαρδί: 1 λαρδί. Σε άλλη περίπτωση διασταύρωση ατόμων με ανοιχτό λαρδί με άτομα με λαρδί δίνει απογόνους με αναλογία 2 ανοιχτό λαρδί: 1 λαρδί : 1 σκούρο λαρδί. Να εξηγήσετε τα αποτελέσματα και να δείξετε τις διασταυρώσεις. Πολλαπλά αλληλόμορφα γονίδια. Όχι ενδιάμεση κληρονομικότητα γιατί αν: α. Το ανοιχτό λαρδί και το σκούρο λαρδί είναι ομόζυγα τότε θα έπρεπε οι απόγονοι να είναι ενδιάμεσου τύπου β. Αν ο ένας γονιός είναι ομόζυγος και ο άλλος ετερόζυγος τότε η αναλογία στους απογόνους θα έπρεπε να είναι 1 ανοιχτό λαρδί : 1 σκούρο λαρδί (δηλαδή όπως οι γονείς) και όχι 1 ανοιχτό λαρδί : 1 λαρδί. Άρα τα γονίδια είναι πολλαπλά αλληλόμορφα και ισχύει Λ 1 >Λ 2 >Λ 3 όπου Λ 1 =ανοιχτό λαρδί, Λ 2 = λαρδί, Λ 3 =σκούρο λαρδί 1 η διασταύρωση: Λ 1 Λ 2 Χ Λ 3 Λ 3 γαμέτες Λ 1, Λ 2 Λ 3 F 1 Λ 1 Λ 3 Λ 2 Λ 3 ανοιχτό λαρδί λαρδί 2 η διασταύρωση: Λ 1 Λ 3 Χ Λ 2 Λ 3 γαμέτες Λ 1, Λ 3 Λ 2, Λ 3 F 1 Λ 1 Λ 2, Λ 1 Λ 3, Λ 2 Λ 3, Λ 3 Λ 3 ανοιχτό λαρδί λαρδί σκούρο λαρδί (2) (1) (1) 33. Το χρώμα του τριχώματος στα ποντίκια μπορεί να είναι κίτρινο, «Agouti» και μαύρο. Η διασταύρωση κίτρινων ποντικών έχει σαν συνέπεια των εμφάνιση απογόνων με φαινοτυπική αναλογία 2 κίτρινα : 1 Agouti, ενώ από τη διασταύρωση μεταξύ Agouti η φαινοτυπική αναλογία των απογόνων είναι 3 Agouti : 1 μαύρο. Τα μαύρα ποντίκια μεταξύ τους δίνουν μόνο μαύρους απογόνους. Τι μπορείτε να συμπεράνετε για τις σχέσεις των γονιδίων; Όχι ενδιάμεση κληρονομικότητα. Δε δικαιολογείται από τη δεύτερη διασταύρωση. Άρα πολλαπλά αλληλόμορφα γονίδια. Από τη δεύτερη διασταύρωση συμπεραίνεται ότι το χρώμα Agouti επικρατεί έναντι του μαύρου χρώματος. 8

9 ΟΜΑΔΑ Β ΕΠΙΚΡΑΤΗ Από την πρώτη διασταύρωση συμπεραίνεται ότι το γονίδιο για τα κίτρινο χρώμα σε ομόζυγη κατάσταση είναι θνησιγόνο και επικρατεί έναντι του χρώματος Agouti Από την τρίτη διασταύρωση συμπεραίνεται ότι το γονίδιο για το μαύρο χρώμα είναι υπολειπόμενο έναντι των άλλων. Άρα ισχύει Α 1 >Α>α όπου Α 1 = κίτρινο χρώμα, Α=χρώμα Agouti, α=μαύρο χρώμα 34. Μια γυναίκα φυσιολογική παντρεύεται άνδρα με οικογενή μεσογειακό πυρετό. Αν ο αδελφός της είναι φυσιολογικός και η μητέρα της έχει οικογενή μεσογειακό πυρετό και είναι ομόζυγη να βρεθεί: α. Ο γονότυπος του πατέρα της γυναίκας. β. Η φαινοτυπική αναλογία των απογόνων. γ. Ποια η πιθανότητα τα 2 πρώτα παιδιά να είναι αγόρια και να έχουν οικογενή μεσογειακό πυρετό; Από ομόζυγη ασθενής μητέρα προκύπτουν κόρη και γιος φυσιολογικοί. Άρα ο οικογενής μεσογειακός πυρετός οφείλεται σε υπολειπόμενο αυτοσωμικό γονίδιο. Έστω Α=φυσιολογικό, α= οικογενής μεσογειακός πυρετός όπου Α>α α. Γονότυπος πατέρα γυναίκας: ΑΑ ή Αα β. Φ.Α: 1 κανονικό : 1 με οικογενή μεσογειακό πυρετό γ. P= 1/2 1/2 1/2 1/2 = 1/ Στη Drosophila το αυτοσωμικό υπολειπόμενο γονίδιο tr μετατρέπει τα θηλυκά σε φαινοτυπικά αρσενικά τα οποία είναι στείρα. Το γονίδιο δεν έχει επίδραση στα αρσενικά. Από διασταύρωση ετερόζυγου θηλυκού με ομόζυγο ποιες θα είναι οι φαινοτυπικές αναλογίες στην F 2 γενιά; Tr=επικρατές, tr=υπολειπόμενο, όπου Tr> tr TrtrXX X trtrxy γαμέτες TrX, trx trx, try F 1 TrtrXX, θηλυκό φυσιολογικό TrtrXΥ, φυσιολογικό trtrxx, στείρο 2 περιπτώσεις: TrtrXΥ (1/2) ή trtrxy (1/2), TrtrXX 1 η περίπτωση: F 1 Χ F 1 TrtrXX X TrtrXΥ Άρα: P 1 = 1/2 3/8= 3/16 P 2 =1/2 5/8= 5/16 2 η περίπτωση: F 1 Χ F 1 TrtrXX X trtrxy Άρα: P 3 = 1/2 1/4= 1/8 P 4 =1/2 3/4= 3/8 Άρα Pολ = P 1 + P 3 =3/16+1/8=5/16, Pολ = P 2 + P 4 = 5/16+3/8=11/16 ΦΥΛΟΣΥΝΔΕΤΟ (ΑΝΤΙΘΕΤΟΣ ΦΥΛΟΚΑΘΟΡΙΣΜΟΣ) trtrxυ φυσιολογικό 36. Από τη διασταύρωση μεταξοσκωλήκων προκύπτουν στην F αρσενικά με κανονικό χρώμα φτερών, 150 θηλυκά με κανονικό χρώμα φτερών και 141 θηλυκά με άσπρισμα στα φτερά τους. Ποιοι είναι οι γονότυποι και φαινότυποι των ατόμων της P και F 1 γενιάς; Αντίθετος φυλοκαθορισμός από αυτόν του ανθρώπου. Χ Α =κανονικό χρώμα, Χ α =άσπρισμα φτερών, όπου Χ Α >Χ α Χ Α Χ α Χ Χ Α Υ 9

10 F 1 Χ Α Χ Α, κανονικό Χ Α Υ, θηλυκό κανονικό Χ Α Χ α, κανονικό Χ α Υ θηλυκό με άσπρισμα φτερών ΦΥΛΟΣΥΝΔΕΤΟ ΣΥΝΕΠΙΚΡΑΤΗ 37. Οι σπιτικές γάτες μπορεί να έχουν μαύρο χρώμα τριχώματος, καφέ χρώμα και μαύρο με καφέ κηλίδες. Όταν διασταυρώνονται μαύρα με μαύρα άτομα ή καφέ με καφέ άτομα γεννιούνται πάντα μαύρα ή καφέ άτομα αντίστοιχα. Όταν διασταυρώνονται θηλυκά μαύρα με αρσενικά καφέ τότε όλα τα θηλυκά που γεννιούνται θα έχουν μαύρο χρώμα με καφέ κηλίδες, ενώ όλα τα αρσενικά θα είναι μαύρα, ενώ όταν διασταυρώνονται θηλυκά καφέ με αρσενικά μαύρα τότε θα προκύπτουν μόνο θηλυκά μαύρα με καφέ κηλίδες και αρσενικά καφέ. Τι μπορείτε να συμπεράνετε για τον τρόπο κληρονόμησης του συγκεκριμένου χαρακτηριστικού; Φυλοσύνδετα συνεπικρατή γονίδια. 38. Η ασθένεια «nystagmus» στον άνθρωπο χαρακτηρίζεται από το ακούσιο κλείσιμο των ματιών. Το θηλυκό άτομο μπορεί να είναι φυσιολογικό, με ελαφριά νύστα ή με έντονη νύστα, ενώ δεν υπάρχει άτομο που να εμφανίζει ελαφριά νύστα. Αν διασταυρωθεί άτομο με ελαφριά νύστα με άτομο φυσιολογικό ποια θα είναι η γονοτυπική και φαινοτυπική αναλογία της F 1 γενιάς; Φυλοσύνδετα συνεπικρατή γονίδια. Χ Φ =φυσιολογικό, Χ Ν =νύστα, όπου Χ Φ =Χ Ν Χ Φ Χ Ν Χ Χ Φ Υ F 1 ΦΥΛΟΣΥΝΔΕΤΟ ΜΕ ΦΥΛΕΤΙΚΑ ΤΑ Ζ ΚΑΙ W 39. Στα κοτόπουλα το φύλο καθορίζεται από τα γονίδια Z και W (ZW θηλυκό, ZZ ). Σε μια ράτσα κοτόπουλων υπάρχει ένα επικρατές φυλοσύνδετο γονίδιο (βρίσκεται στο Z) που είναι υπεύθυνο για την εμφάνιση άσπρων γραμμών σε ενήλικα μαύρα κοτόπουλα. Διασταυρώνεται με το γνώρισμα με θηλυκό χωρίς το γνώρισμα. α. Ποια η πιθανότητα να γεννηθούν αρσενικά άτομα με άσπρες γραμμές; β. Ποια η πιθανότητα να γεννηθούν θηλυκά άτομα χωρίς άσπρες γραμμές; Ζ Α =άσπρες γραμμές, Ζ α =χωρίς άσπρες γραμμές, όπου Ζ Α > Ζ α Ζ Α Ζ Α (1/2) ή Ζ Α Ζ α (1/2) και Ζ α W 1 η περίπτωση: Ζ Α Ζ Α Χ Ζ α W F 1 Ζ Α Ζ α, Ζ A W άσπρες γραμμές άσπρες γραμμές 2 η περίπτωση: Ζ Α Ζ α Χ Ζ α W F 1 Χ Φ Χ Φ, φυσιολογικό Ζ Α Ζ α, άσπρες γραμμές Χ Φ Χ Ν ελαφριά νύστα Ζ α Ζ α, χωρίς άσπρες γραμμές Χ Φ Υ, φυσιολογικό Ζ A W, άσπρες γραμμές Χ Ν Υ έντονη νύστα Ζ α W χωρίς άσπρες γραμμές α. Η πιθανότητα να γεννηθούν αρσενικά με άσπρες γραμμές είναι: Από την 1 η περίπτωση P 1 =1/2 1/2=1/4 Από τη 2 η περίπτωση P 2 =1/2 1/4=1/8 Pολ=P 1 +P 2 =1/4+1/8=2/8+1/8=3/8 β. Η πιθανότητα να γεννηθούν θηλυκά χωρίς άσπρες γραμμές είναι: Από την 1 η περίπτωση P 1 =0 Από τη 2 η περίπτωση P 2 =1/2 1/4=1/8 Pολ=P 1 +P 2 =0+1/8=1/8 10

11 ΓΕΝΕΑΛΟΓΙΚΑ ΔΕΝΔΡΑ 40. Στα σκυλιά ένα γονίδιο είναι υπεύθυνο για την εμφάνιση σκούρου μαύρου χρώματος στο σώμα του ζώου. Το γονίδιο αυτό επικρατεί έναντι του αλληλομόρφου που είναι υπεύθυνο για τη μείωση της έντασης του χρώματος και την εμφάνιση πιο ξεθωριασμένου μαύρου χρώματος τρίχωμα. Αυτό με την σειρά του επικρατεί έναντι του αλληλομόρφου που σχηματίζει ένα πρότυπο με στίγματα. α. Να βρεθούν όλοι οι γονότυποι. β. Εάν το άτομο III2 διασταυρωθεί με το άτομο III1 ποια η πιθανότητα να γεννηθεί απόγονος με ξεθωριασμένο μαύρο χρώμα τριχώματος; Έστω Α 1 >Α 2 >Α 3, όπου Α 1 =σκούρο μαύρο χρώμα, Α 2 =ξεθωριασμένο μαύρο χρώμα, Α 3 =πρότυπο με στίγματα α. Ι 1 =Α 1 Α 2 Ι 2 =Α 3 Α 3 ΙΙ 1, ΙΙ 2, ΙΙ 4 =Α 2 Α 3 ΙΙ 3 =Α 1 Α 3 ΙΙΙ 1, ΙΙΙ 4 =Α 3 Α 3 ΙΙΙ 2 =Α 1 Α 2 ή Α 1 Α 3 ΙΙΙ 3 =Α 2 Α 3 β. Το άτομο III2 (Α 1 Α 2 ή Α 1 Α 3) προέρχεται από τη διασταύρωση των ΙΙ 3 και ΙΙ 4, δηλαδή: Α 1 Α 3 Χ Α 2 Α 3 F 1 Α 1 Α 2, Α 1 Α 3, Α 2 Α 3, Α 3 Α 3 (1/2) (1/2) σκούρο μαύρο χρώμα 1 η περίπτωση: Α 1 Α 2 Χ Α 3 Α 3 F 1 Α 1 Α 3 Α 2 Α 3 σκούρο μαύρο χρώμα ξεθωριασμένο μαύρο χρώμα (1/2) P 1 =1/2 1/2=1/4 2 η περίπτωση: Α 1 Α 3 Χ Α 3 Α 3 F 1 Α 1 Α 3 Α 3 Α 3 σκούρο μαύρο χρώμα πρότυπο με στίγματα P 2 =0 Άρα Pολ=P 1 +P 2 =1/4+0=1/4 11


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Αν διασταυρωθούν άτομα μοσχομπίζελου με κίτρινο χρώμα σπέρματος ποιες θα είναι οι φαινοτυπικές και γονοτυπικές αναλογίας της γενιάς; Κ=κίτρινο, κ=πράσινο,

Διαβάστε περισσότερα


ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΑΥΤΟΣΩΜΙΚΑ ΕΠΙΚΡΑΤΗ-ΥΠΟΛΕΙΠΟΜΕΝΑ 1. Διασταυρώνονται δυο μοσχομπίζελα, το ένα με κανονικό σχήμα καρπού και το άλλο με περιεσφιγμένο σχήμα. Να βρεθεί

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με κίτρινο χρώμα σπέρματος και ιώδες χρώμα άνθους. 109 άτομα με

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με χρώμα σπέρματος και ιώδες χρώμα άνθους. 109 άτομα με χρώμα

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 2 ΕΠΙΚΡΑΤΗ 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με κίτρινο χρώμα σπέρματος και ιώδες χρώμα άνθους.

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 5 ΚΕΦΑΛΑΙΟ 5 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 5 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 18/09/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Η Χαρά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 5ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 5ο Μεθοδολογία Ασκσεων ΚΕΦ. 5ο Θα πρέπει να γνωρίζετε τα ακόλουθα: Γαμέτες. Κάθε γαμέτης περιέχει μόνο το ένα αλληλόμορφο από κάθε ζευγάρι γονιδίων. Όταν τα γονίδια βρίσκονται σε διαφορετικά ζεύγη ομόλογων

Διαβάστε περισσότερα

B5-Κεφάλαιο 5: Μεντελική κληρονομικότητα

B5-Κεφάλαιο 5: Μεντελική κληρονομικότητα A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την πρόταση, αν υπάρχει. 1. Από οποιοδήποτε φαινότυπο

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων ΚεφόΑηιο 5 ΜενδεΠική κπηρονουικότηϊα 1. Συμπληρώστε με τις κατάλληλες λέξεις τα κενά στο κείμενο: Τα γονίδια που βρίσκονται στην ίδια γενετική θέση των ομόλογων χρωμοσωμάτων και ελέγχουν την ίδια ιδιότητα

Διαβάστε περισσότερα

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 1-2-2015 ΘΕΜΑ Α Α1. γ Α2. γ Α3. β Α4. γ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2. Τα άτομα μπορεί να χαρακτηρίζονται ως φορείς στην αυτοσωμική

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 8/09/06 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα


ΓΕΝΕΤΙΚΗ AAT TCG CGA TTCC ΓΕΝΕΤΙΚΗ 1. Το πιο κάτω γενεαλογικό δέντρο δείχνει τον τρόπο κληρονόμησης μιας ασθένειας σε μια οικογένεια. Τα μαυρισμένα τετράγωνα συμβολίζουν αρσενικά άτομα με την πάθηση και οι μαυρισμένοι κύκλοι θηλυκά

Διαβάστε περισσότερα


ΚΕΦ.5 ΜΕΝΤΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΚΕΦ.5 ΜΕΝΤΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΕΡΩΤΗΣΕΙΣ ΑΝΑΠΤΥΞΗΣ ΚΑΙ ΕΜΒΑΘΥΝΣΗΣ ΘΕΩΡΙΑΣ 5.1. Σε ποια στοιχεία οφείλεται η επιτυχία των πειραμάτων του Mendel; 5.2. Τι είναι ο γονότυπος ; Πως μπορούμε να βρούμε το γονότυπο

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6 ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. Σε ένα είδος φυτών διακρίνονται δυο χρώματα άνθους, το κίτρινο και το λευκό. Για να διαπιστωθεί το είδος του γονιδίου που ελέγχει την ιδιότητα αυτή αλλά και ο τρόπος κληρονόμησής

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 00 ΗΜΕΡΗΣΙΟ. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα

Διαβάστε περισσότερα

Σε τι αναφέρεται η αναλογία 9:3:3:1 του διυβριδισμού και υπό ποιες προϋποθέσεις ισχύει;

Σε τι αναφέρεται η αναλογία 9:3:3:1 του διυβριδισμού και υπό ποιες προϋποθέσεις ισχύει; Σημειώστε τον αριθμό των χρωματίδων που υπάρχουν σε ένα κύτταρο του ανθρώπου 1)που μόλις έχει προκύψει από μίτωση 2)στη μετάφαση της μείωσης ΙΙ και 3)στην πρόφαση της μίτωσης. Σε τι αναφέρεται η αναλογία

Διαβάστε περισσότερα

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Γενετική του Φύλου Ι ασκήσεις

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Γενετική του Φύλου Ι ασκήσεις Γενετική του Φύλου Ι ασκήσεις 1. Δώστε το φύλο των πιο κάτω ατόμων στη Drosophila: α) ΑΑΧΧΧΧ, β) ΑΑΑΑΧΧΧ, γ) ΑΑΑΧ δ) ΑΑΑΑΧΧΧΧ, ε) ΑΑΧΧΥ. Υπολογίζουμε την αναλογία Χ/Α. Υπερράρεν (0,5) Άρρεν Μεσόφυλο (1)

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ A Να γράψετε τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις A1 έως A5 και δίπλα το γράμμα που αντιστοιχεί στη φράση, η οποία

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΓΕΝΕΑΛΟΓΙΚΑ ΔΕΝΔΡΑ ΟΜΑΔΑ Α 1. Η Ιωάννα έχει βραχυδαχτυλία όπως επίσης και τα 2 μεγαλύτερα αδέλφια της που είναι ομοζυγωτικοί δίδυμοι. Οι άλλες δύο μικρότερες αδελφές της έχουν

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑ 1.1 Η γαλακτοζαιμία στον άνθρωπο είναι ασθένεια που οφείλεται σε υποτελές γονίδιο και κληρονομείται με απλό Μεντελικό τρόπο.

ΠΡΟΒΛΗΜΑ 1.1 Η γαλακτοζαιμία στον άνθρωπο είναι ασθένεια που οφείλεται σε υποτελές γονίδιο και κληρονομείται με απλό Μεντελικό τρόπο. ΠΡΟΒΛΗΜΑ 1.1 Η γαλακτοζαιμία στον άνθρωπο είναι ασθένεια που οφείλεται σε υποτελές γονίδιο και κληρονομείται με απλό Μεντελικό τρόπο. Μια γυναίκα της οποίας ο πατέρας έπασχε από γαλακτοζαιμία θέλει να

Διαβάστε περισσότερα


ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 5 ΚΕΦΑΛΑΙΟ ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 5 ΚΕΦΑΛΑΙΟ 1 Στη δροσόφιλα το κόκκινο χρώμα των ματιών είναι επικρατές. Εάν οι απόγονοι σε δύο διαφορετικές διασταυρώσεις είναι οι ακόλουθοι: ιασταύρωση Α ιασταύρωση Β 24 αρσενικά

Διαβάστε περισσότερα


-ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΓΕΝΕΤΙΚΗΣ- Α. Εύρεση γαμετών -ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΓΕΝΕΤΙΚΗΣ- Α. Εύρεση γαμετών Για να βρίσκετε σωστά τους γαμέτες και να σχηματίζονται όλοι οι συνδυασμοί αλληλομόρφων σε αυτούς πρέπει να θυμάστε ότι κάθε γαμέτης περιέχει μόνο ένα

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα

Κεφάλαιο 5: Μενδελική Κληρονομικότητα

Κεφάλαιο 5: Μενδελική Κληρονομικότητα Κεφάλαιο 5: Μενδελική Κληρονομικότητα ΕΛΕΓΧΟΣ ΓΝΩΣΕΩΝ 1. Ο Mendel. α. εξέταζε σε κάθε πείραμά του το σύνολο των ιδιοτήτων του μοσχομπίζελου β. χρησιμοποιούσε αμιγή στελέχη στις ιδιότητες που μελετούσε

Διαβάστε περισσότερα

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό Θέμα 1 ο 1. α 2. γ 3. γ 4.β 5. δ Θέμα 2 ο Α. Οι νόμοι του Mendel δεν ισχύουν σε πολυγονιδιακούς χαρακτήρες και σε συνδεδεμένα γονίδια (μη ανεξάρτητα), ενώ οι αναλογίες δεν είναι οι αναμενόμενες σε φυλοσύνδετα

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ. Μονάδες 2 Να αιτιολογήσετε την επιλογή σας. Μονάδες 3. β. το αλληλόµορφο γονίδιο που προκαλεί την

ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ. Μονάδες 2 Να αιτιολογήσετε την επιλογή σας. Μονάδες 3. β. το αλληλόµορφο γονίδιο που προκαλεί την 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 2001 ΗΜΕΡΗΣΙΟ 1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 Ονοματεπώνυμο εξεταζόμενου:. ΘΕΜΑ 1 Ο Να απαντήσετε στις ερωτήσεις πολλαπλής επιλογής: 1. Η ανευπλοειδία είναι είδος μετάλλαξης που οφείλεται:

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 22 Μαΐου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1. β Α.2. γ Α.3. α Α.4. δ Α.5. γ ΘΕΜΑ B B.1. 1. A 2. B 3. B 4. A 5. A 6. A 7. B 8.

Διαβάστε περισσότερα


ΠΡΟΒΛΗΜΑ 5.1 ΠΡΟΒΛΗΜΑ 5.2 ΠΡΟΒΛΗΜΑ 5.3 ΠΡΟΒΛΗΜΑ 5.1 Στα ποντίκια το σκούρο μάτι απαιτεί την ταυτόχρονη παρουσία των υπερεχόντων αλληλομόρφων γονιδίων R και Q. Ζώα ομοζυγωτικά για ένα από τα δύο ή και τα δύο υποτελή αλληλόμορφα έχουν ανοιχτόχρωμα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελ. 120 «Τα κύτταρα των οργάνων να είναι επιτυχείς» Β2. Σελ. 136 «Το 1997 γέννησε την Dolly»

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΡΟΒΛΗΜΑ 3.1 r/r III ΠΡΟΒΛΗΜΑ 3.2 ΠΡΟΒΛΗΜΑ 3.1 'Ένα υποτελές αλληλόμορφο r είναι υπεύθυνο για την εμφάνιση κόκκινου τριχώματος στις αγελάδες, ενώ το υπερέχων του αλληλόμορφο R προκαλεί σκούρο χρωματισμό. Στο παρακάτω γενεαλογικό δένδρο

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Αλληλεπιδράσεις γονιδίων Ι ασκήσεις

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Αλληλεπιδράσεις γονιδίων Ι ασκήσεις Αλληλεπιδράσεις γονιδίων Ι ασκήσεις 1. Στους σκύλους Labrador ένα θηλυκό άτομο με καστανό χρωματισμό διασταυρώθηκε με αρσενικό που είχε χρυσαφί χρωματισμό. Όλοι οι F1 απόγονοι είχαν μαύρο χρωματισμό. Η

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑ 4.1 ΠΡΟΒΛΗΜΑ 4.2 ΠΡΟΒΛΗΜΑ 4.3 Ζευγάρια Παιδιά

ΠΡΟΒΛΗΜΑ 4.1 ΠΡΟΒΛΗΜΑ 4.2 ΠΡΟΒΛΗΜΑ 4.3 Ζευγάρια Παιδιά ΠΡΟΒΛΗΜΑ 4.1 Στο σιτάρι, φυτά με κόκκινους σπόρους διασταυρώθηκαν με φυτά που είχαν λευκούς. Όλοι οι απόγονοι είχαν κόκκινους σπόρους. Μετά από την αυτογονιμοποίηση των φυτών της F 1, πήραμε στην F 2 :

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 24 Μαΐου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ B B1. Η διαδικασία που εφαρμόστηκε για πρώτη φορά

Διαβάστε περισσότερα

5. Η μεταγραφή σ ένα ευκαρυωτικό κύτταρο γίνεται α. στα ριβοσώματα. β. στο κυτταρόπλασμα. γ. στον πυρήνα. δ. στο κεντρομερίδιο.


Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


Γ ΛΥΚΕΙΟΥ κεφ. 5. ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Μάθημα 1,2 Γ ΛΥΚΕΙΟΥ κεφ. 5 ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Μάθημα 1,2 O Mendel στο Brno (Τσεχία) Τον αναγνωρίζετε; Το μοναστήρι σήμερα Οι κήποι σήμερα Το μοσχομπίζελο Η επιτυχία των πειραμάτων του Μέντελ 1. χωριστά η

Διαβάστε περισσότερα



Διαβάστε περισσότερα


Κ Η Λ Ρ Η ΟΝ Ο Ο Ν Μ Ο ΙΚ Ι Ο Κ Τ Ο Η Τ Τ Η Α ΚΕΦΑΛΑΙΟ 5ο: Η πρώτη επιστηµονική µελέτη για την κληρονοµικότητα έγινε το 19ο αιώνα ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Από τον Αυστριακό µοναχός Gregor Mendel Θεωρείται ο πατέρας της Γενετικής 1 Ένα σηµαντικό στοιχείο

Διαβάστε περισσότερα


3 ΩΡΕΣ. Σελίδα 1 από 3 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ ΙΑΡΚΕΙΑ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΡΚΕΙΑ 3 ΩΡΕΣ ΘΕΜΑ 1 Ο Στις ερωτήσεις 1-5, να γράψετε τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Από τη διασταύρωση

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 12 Ιουνίου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. δ Α5. γ ΘΕΜΑ B B1. Σχολικό βιβλίο, κεφάλαιο 9

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 ΘΕΜΑ 1ο 1. δ, ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 2. β, 3. β, 4. γ, 5. δ. ΘΕΜΑ2ο 1. Σχολικό βιβλίο, σελίδα 31: «Υπάρχουν τέσσερα είδη μορίων RNA και το μεταφέρει στη θέση της πρωτεϊνοσύνθεσης».

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΘΕΜΑ 1ο 1. Στην αυτοσωμική επικρατή κληρονομικότητα α. κάθε ασθενής γονέας γεννά έναν τουλάχιστον ασθενή απόγονο

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

κεφάλαιο Τοιχογραφία με χαρακτηριστικά αλόγων (4.000 π.χ.)

κεφάλαιο Τοιχογραφία με χαρακτηριστικά αλόγων (4.000 π.χ.) Μενδελική κληρονομικότητα κεφάλαιο 5 Τοιχογραφία με χαρακτηριστικά αλόγων (4.000 π.χ.) 5. Μενδελική κληρονομικότητα Το ενδιαφέρον για την κληρονομικότητα είναι πολύ παλιό, σχεδόν όσο και η ύπαρξη του ανθρώπινου

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 ΘΕΜΑ Α Α1.β Α2.γ Α3.α Α4.δ Α5.γ ΘΕΜΑ Β Β1. 1A, 2B, 3B, 4A, 5A, 6A, 7B, 8B Β2. σελίδα 40 σχολικού

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ/Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 05/01/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική 5.5.24.Δίνεται το γενεαλογικό δένδρο μίας οικογένειας στην οποία εμφανίζεται η ασθένεια της αιμορροφιλίας Α. Τα άτομα 3, 6 και 7 πάσχουν από αιμορροφιλία. α. Να βρεθούν οι πιθανοί γονότυποι όλων των μελών

Διαβάστε περισσότερα


ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα


ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα γονίδια Ι Α και i που καθορίζουν τις ομάδες αίματος:

Διαβάστε περισσότερα

Μεντελική γενετική. Λείοι σπόροι του μοσχομπίζελου (Pisum sativum).

Μεντελική γενετική. Λείοι σπόροι του μοσχομπίζελου (Pisum sativum). Μεντελική γενετική Λείοι σπόροι του μοσχομπίζελου (Pisum sativum). Φαινότυπος και Γονότυπος Η φυσική εκδήλωση (φαινότυπος) της γενετικής σύστασης (γονότυπος) επηρεάζεται από τις αλληλεπιδράσεις με άλλα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά»

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2ο 1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» 2. σελ. 119-120: «Θεραπευτικά. Τα αντισώματα μπορούν να

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. 1. Στην πλειονότητά

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα


Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 Πανελλήνιες 2015 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 ΘΕΜΑ Α Α1- β Α2- γ Α3- α Α4- δ Α5- γ ΘΕΜΑ Β Β1. Α: σωματικά κύτταρα στην αρχή της μεσόφασης -> 1,4,5,6 Β: γαμέτης:

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. α, Α2. γ, Α3. δ, Α4. β, Α5. γ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (30-05-2012) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σελ.120 Τα µονοκλωνικά αντισώµατα χρησιµοποιούνται για την επιλογή οργάνων συµβατών για µεταµόσχευση.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα γονίδια Ι Α και i που καθορίζουν τις ομάδες αίματος: Α. είναι ατελώς επικρατή Β. είναι συνεπικρατή

Διαβάστε περισσότερα

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA.

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελ. 120 την κουκίδα «Για την επιλογή οργάνων συμβατών για μεταμόσχευση.» Β2. Σελ. 136 «Το πρόβατο Dolly» έως «γέννησε τη Dolly.»

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης 22 Μαΐου 2015 Ενδεικτικές Απαντήσεις Θεμάτων

Βιολογία Θετικής Κατεύθυνσης 22 Μαΐου 2015 Ενδεικτικές Απαντήσεις Θεμάτων Βιολογία Θετικής Κατεύθυνσης 22 Μαΐου 2015 Ενδεικτικές Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. Α: 1, 4, 5, 6 Β: 2, 3, 7, 8 Β2. Βλέπε σχολικό εγχειρίδιο σελ. 41-42 «Κατά την έναρξη

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ/Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 05/01/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2012 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή φράση, η οποία συµπληρώνει σωστά

Διαβάστε περισσότερα

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.»

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.» 23 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1 γ Α.2 β Α.3 β Α.4 δ Α.5 α ΘΕΜΑ Β B.1 Σχολικό βιβλίο, σελίδα 34: «Η αλληλουχία

Διαβάστε περισσότερα

Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015

Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015 Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015 Θέμα Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ Θέμα Β Β1. 1. Α 2. Β 3. Β 4. Α 5. Α 6. Α 7. Β 8. Β Β2. Το σύμπλοκο που δημιουργείται μετά την πρόσδεση του

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ ΘΕΜΑ Β Β1. Η απάντηση περιλαμβάνεται στις σελ. 90 91 σχολικού βιβλίου από το παράδειγμα της δρεπανοκυτταρικής αναιμίας πολλές ομοιότητες με την αρχική.

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β Β2. Σελίδα 40 σχολικού βιβλίου (έκδοση 2014-2015) Η παράγραφος «Έναρξη

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Γ Γ.1 Ο χαρακτήρας της ομάδας αίματος στον άνθρωπο

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα